Non-enzymatic synthesis of nucleic acids via wet-dry cycles
The wet-dry cycle method effectively synthesizes nucleic acids up to thousands of nucleotides in length, addressing the limitations of existing non-enzymatic synthesis methods and offering cost-effective and flexible siRNA production.
Patent Information
- Application Number
- PCT/US2025/056648
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-06-16
- Filing Date
- 2025-11-21
- Publication Date
- 2026-05-28
AI Technical Summary
Existing methods for non-enzymatic synthesis of nucleic acids have limited success in producing long chains, and there is a need for new approaches that can efficiently synthesize nucleic acids without enzymatic activation.
A method involving wet-dry cycles is used to synthesize nucleic acids by drying and resolubilizing a mixture of mononucleotides and monovalent salts, optionally with a template, to form nucleic acids through ester bonds, with conditions optimized by pH, temperature, and the presence of organizing lipids.
This method can produce nucleic acids ranging from tens to thousands of nucleotides in length, confirmed by mass spectrometry and nanopore sequencing, and reduces the cost and increases flexibility in synthesizing siRNA for therapeutic applications.
Smart Images

Figure US2025056648_28052026_PF_FP_ABST
Abstract
Description
Attorney Docket No.: UPR-1002PCTNON-ENZYMATIC SYNTHESIS OF NUCLEIC ACIDS VIA WET-DRY CYCLES CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 724,244 filed November 22, 2024. titled NON-ENZYMATIC SYNTHESIS OF NUCLEIC ACIDS VIA WETDRY CYCLES, and designated by attorney docket number UPR-1002PROV, and also claims priority to U.S. Provisional Patent Application No. 63 / 824,668, filed June 16, 2025, titled NON- ENZYMATIC SYNTHESIS OF NUCLEIC ACIDS VIA WET-DRY CYCLES, and designated by attorney docket number UPR-1002PROV2, the contents of which applications are incorporated herein by reference in their entirety.BACKGROUND
[0002] Nucleic acids find use in a variety of different applications including, but not limited to, research reagents, diagnostic agents and therapeutic agents. A variety of different protocols have been developed to synthesize nucleic acids. However, there is continued interest in the identification of new ways to synthesize nucleic acid.
[0003] Non-enzymatic nucleic acid synthesis approaches have been developed, including anhydrous heating of nucleotides (Verlander et al., J. Mol. Evol. (1973) 2:303), cycles of heating and drying (Usher, D. A. Science (1977) 196:31 1), as well as studying the impact of amphiphilic structures (Walde, P. Orig Life Evol Biosph. Apr. 27 (2006); Deamer, D. W. and G. L. Barchfeld. (1982) J. Mol. Evol.18:203; and Szostak J. W., Bartel, D. P. and Luisi, P. L. Nature (2001) 409:387).
[0004] Condensation of activated mononucleotides also has been employed for non- enzymatic synthesis. Imidazole esters of mononucleotides assemble on RNA templates to produce complementary RNA strands up to 40-50 nucleotides in length (Inoue T, and Orgel, L. E. Science (1983) 219:859; and Orgel, L. Orig. Life Evol. Biosphere (1997) 28:227). Mineral surfaces of montmorillonite clay organize imidazole-activated mononucleotides and synthesize RNA strands up to 50-mers in the absence of templates (Huang, W. and Ferris J. P. Chem. Commun. (2003) 21:1458: and Ferris, J. Orig. Life Evol. Biosphere (2002) 32:31 1). RNA oligomers of up to 14 nucleotides in length spontaneously assemble in the absence of templates or organizing surfaces when activated mononucleotides are concentrated in the eutectic phase of frozen reaction mixtures (Kanavarioti et al., Astrobiology (2002) 1 :271).Attorney Docket No.: UPR-1002PCT
[0005] Unfortunately, synthesis of nucleic acids as reported above has met with limited success, and new approaches for non-enzymatically synthesizing nucleic acids are needed. The present disclosure addresses this and other needs.SUMMARY
[0006] Provided herein is a method for synthesizing nucleic acids, comprising the steps of (a) providing a solution substantially free of nucleic acid polymerase and lipids, but containing mononucleotides and at least one monovalent salt; (b) drying and resolubilizing the mixture of step (a) a plurality of times; (c) recovering nucleic acids from a resolubilized mixture of step (b); and (d) separating desired nucleic acids from the recovered nucleic acids of step (c). In certain aspects, step (a) further comprises inclusion of a template or other component to direct evolution of the resulting nucleic acids to be recovered in step (c). In certain aspects, the method further uses techniques described in US Patent 10,717,759, the disclosure of which is incorporated by reference in its entirety.
[0007] The present invention relates to the field of chemical (abiotic) synthesis of nucleic acids, particularly single stranded and double stranded nucleic acids, such as double stranded RNA. The present invention further relates to methods of directed evolution of nucleic acids using repeated cycles of wet-dry conditions in a non-enzymatic environment. In various embodiments, the nucleic acids are long chains. In various embodiments, the nucleic acids have a chain length of greater than 10 nucleotides. In various embodiments, the nucleic acids have a chain length of longer than 100 nucleotides and less than 500 nucleotides.
[0008] In an aspect, provided herein are methods of preparing RNA oligomers, comprising: providing a DNA template; contacting the DNA template with a solution comprising solvent, adenosine monophosphate (AMP), uridine monophosphate (UMP), guanosine monophosphate (GMP) and cytidine monophosphate (CMP); and drying the solution. In some cases, the method further comprises, after the drying, contacting the DNA template with additional solvent, thereby re-wetting the DNA template; and drying the additional solvent, thereby re-drying the DNA template. In some cases, the method further comprises, after the re-drying, repeating steps d and e to achieve a total of three wet-dry cycles. In some cases, the method further comprises, after the re-drying, repeating steps d and e to achieve a total of four wet-dry cycles. In some cases, the method further comprises, after the re-drying, repeating steps d and e to achieve a total of five wet-dry cycles. In some cases, the method further comprises, after the re-drying, repeating steps d and e to achieve a total of ten wet-dryAttorney Docket No.: UPR-1002PCT cycles. In some cases, the AMP, the UMP, the GMP, and the CMP are present in the solution at a concentration of about 2.5 mM each. In some cases, the pH of the solution is about 2.0. In some cases, the DNA template is an siRNA sense strand template. In some cases, the DNA template is an siRNA antisense strand template. In some cases, the method further comprises (i) performing steps a-c wherein the DNA template is an siRNA sense strand template, thereby producing siRNA sense strand oligomers, (ii) performing steps a-c wherein the DNA template is an siRNA antisense strand template, thereby producing siRNA antisense strand oligomers, (iii) capturing the siRNA sense strand oligomers and the siRNA antisense strand oligomers, (iv) mixing the siRNA sense strand oligomers and the siRNA antisense strand oligomers, thereby producing siRNA oligomers, (v) heating the siRNA oligomers, (vi) cooling the siRNA oligomers, thereby producing siRNA duplexes. In some cases, the method further comprises (vii) contacting the siRNA duplexes with DNase, and (viii) concentrating the siRNA duplexes.INCORPORATION BY REFERENCE
[0009] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference in its entirety as well as any references cited therein.BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1 depicts the general structure of siRNA, where two RNA strands form a duplex with 3’ dinucleotide overhangs on each strand, with the antisense strand being a perfect reverse complement of the intended target mRNA.
[0011] FIG. 2 depicts HPLC analysis results of the product of Example 1.
[0012] FIG. 3 depicts an exemplary ionic current blockade associated with the sequencing of a strand of RNA synthesized from a template, with ionic current components: (i) strand capture; (ii) ONT adapter translocation; (iii) poly(A) RNA tail translocation; (iv) putatively synthesized RNA translocation; and (v) exit of the strand from the nanopore.Attorney Docket No.: UPR-1002PCT
[0013] FIG. 4 depicts results of two cycles of wetting and drying with uridine monophosphate (UMP - U), adenosine monophosphate (AMP - A), thymidine monophosphate (TMP - dT) and deoxy adenosine monophosphate (dAMP - dA).
[0014] FIG. 5 depicts results of mixing polycytidylic acid with guanosine monophosphate and exposing the mixture to two 30 minutes cycles of dehydration and rehydration at 80° C. Oligomers with lengths of 16 and 23 nucleotides were major products.
[0015] FIG. 6 depicts a test chamber for cycling samples.
[0016] FIG. 7 depicts results of drying a dilute solution of the four mononucleotides with and without the presence of a DNA template.
[0017] FIG. 8 depicts synthesis of siRNA by wet-dry cycling.DETAILED DESCRIPTIONNon-enzymatic polymerization of mononucleotides
[0018] It has been reported that RNA-like molecules are synthesized from ordinary mononucleotides if the monomers are organized within a liquid crystalline matrix (Rajamani S, Vlassov A, Benner S, Coombs A, Olasagasti F, Deamer D., "Lipid-assisted synthesis of RNA-like polymers from mononucleotides," Orig Life Evol Biosph. 38:57-74 (2008)). This method is based on providing an aqueous suspension of phospholipid vesicles and monomers, and subjecting the mixture to alternating cycles of hydration and dehydration, hereafter referred to as HD cycles.
[0019] It has also been demonstrated that under the same conditions sequence information could be transferred non-enzymatically from a template strand of DNA to product strands (Olasagasti F, Kim H J, Pourmand N, Deamer D W., 2011, "Non-enzymatic transfer of sequence information under plausible prebiotic conditions," Biochimie. 93:556-61). In this report, an environment was created where dry and wet periods were cycled. Under anhydrous conditions, lipid molecules present in the medium could form fluid lamellar matrices and work as organizing agents for the condensation of nucleic acid monomers into polymers on a DNA template strand.
[0020] Without wishing to be bound by theory, for life to begin on the prebiotic Earth, there must have been a non-enzymatic process capable of driving condensation reactions required for synthesis of polymers resembling nucleic acids. Earlier studies using chemically activated mononucleotides have demonstrated that oligomers can spontaneously assemble from nucleotides. For instance, Inoue and Orgel (Inoue T., Orgel L.E., A nonenzymatic RNA polymerase model. Science, 219, 859-862Attorney Docket No.: UPR-1002PCT(1983)) reported that the imidazole ester of guanosine monophosphate assembles on a polycytidylic acid template and polymerizes into short oligomers of RNA. Ferris (Ferris J.P., Mineral catalysis and prebiotic synthesis: Montmorillonite-catalyzed formation of RNA. Elements. 1, 145-149. (2005)) discovered that the imidazole ester of AMP in the presence of montmorillonite clay formed oligomers of polyadenylic acid. More recently, 2'-3' cyclic guanosine monophosphate has been shown to spontaneously polymerize (Morasch M„ Mast C.B., Langer J.K., Schilcher P., Brau D., Dry polymerization of 3',5'-cyclic GMP to long strands of RNA. ChemBiochem 15, 879-883 (2014)). Others such as Obianyor et al. (Obianyor C., Newnam G., Clifton B., Grover M., Hud N.V., “Impact of substrate-template stability, temperature, phosphate location, and nick-site base pairs on non- enzymatic DNA ligation: Defining parameters for optimization of ligation rates and yields with carbodiimide activation.” bioRxiv doi.org / 10.1101 / 821017 (2019)) investigated non-enzymatic DNA ligation in which carbodiimide was used as a phosphate activating agent. See also Krishnamurthy and Hud (Krishnamurthy R„ Hud N.V., Introduction: Chemical evolution and the origins of life. Chem. Rev. 2020, 120, 11, 4613-4615 (2020)) for a review. These results depend on the assumption that monomers must be chemically activated to cause polymerization. However, there has been no consensus on a plausible prebiotic activation process. Therefore, there is a need for evidence that wetdry cycles could have provided the needed activation for the formation of nucleic acid polymers.
[0021] Wet-dry cycles are ubiquitous in freshwater hot springs associated with subaerial volcanic landmasses. In previous studies, Ross and Deamer (Ross D.S.. Deamer D.W., Dry / wet cycling and the thermodynamics and kinetics of prebiotic polymer synthesis. Life, 6, 28, (2016); Ross D.S., Deamer D.W., Prebiotic oligomer assembly: What was the energy source? Astrobiology, 19, 517-521, (2019)) explored the thermodynamic and kinetic properties of such cycles and concluded that evaporation provides an increasingly significant air / water interface that emerges as a foundational factor in oligomer growth.
[0022] FIG. 4 shows mass spectrometry results confirming synthesis of nucleic acids by wet-dry cycles. Uridine monophosphate (UMP - U), adenosine monophosphate (AMP - A), thymidine monophosphate (TMP - dT) and deoxyadenosine monophosphate (dAMP - dA) were exposed to two cycles of wetting and drying. Mass spectrometry confirmed that oligomers of RNA and DNA as long as 50-mers are synthesized by this process.Attorney Docket No.: UPR-1002PCTNon-Enzymatic Polymerization of Ribonucleotides on a DNA template
[0023] The present disclosure describes how wet-dry cycles can drive non-enzymatic nucleic acid synthesis without chemical activation. A single or just a few cycles of wetting and drying link mononucleotides by ester bonds can form polymers ranging from tens to hundreds of nucleotides in length. By increasing the number of cycles, polymers greater than 1000 nucleotides in length can be obtained. The resulting products can be analyzed by nanoelectrospray ionization mass spectrometry (nESI-MS), field asymmetry ion mobility mass spectrometry (FAIMS), and nanopore sequencing. Mass spectrometry can identify multiple species of oligomers in the mixture of products. For instance, nESI-MS can identify uridine monophosphate oligomers ranging from 30-50 nucleotides in length. Oligomeric products can also be observed when thymidine monophosphate, adenosine monophosphate and deoxy adenosine monophosphate were exposed to wet-dry cycles. Nanopore sequencing can confirm that the polymers are linear polyanion chains linked by phosphodiester linkages.
[0024] By simulating wet-dry cycles that may have existed in a pre-biotic world, the present disclosure investigates polymerization reactions in which the monomers are mononucleotides. In contrast to earlier studies that used imidazole esters of mononucleotides as activated reactants, it is found that the concentrating effect of evaporation at an elevated temperature of 85oC combined with acid catalysis at the water-solid interface provides sufficient activation energy to support the synthesis of ester linkages. This temperature was chosen to reflect that typical of hot springs associated with volcanic activity today, as well as global temperature estimates for early Earth. Studies employing mass spectrometric analysis and nanopore sequencing may confirm that wet-dry cycling of ordinary mononucleotides can synthesize oligonucleotides. The presence of phosphodiester bonds can also be confirmed by 3 IP nuclear magnetic resonance (31P-NMR) and Fourier transform infrared spectroscopy (FTIR). A weak peak with -1.15 (for PolyA) and -0.87 (for PolyU) may indicate successful detection in the 31P-NMR spectra, matching the chemical shift of phosphorus in phosphodiester bonds. Additionally, the increased absorption of symmetric and asymmetric PO2 stretching vibration at 1065 ±10 cm-1, and 1225 ±10 cm-1 may be observed in the FTIR spectrum.
[0025] FIG. 5 shows results from mixing polycytidylic acid template with guanosine monophosphate, followed by exposure to two 30-minute cycles of dehydration and rehydration at 80° C. Oligomers with lengths of 16 and 23 nucleotides were major products. The results confirmed that wet-dry cycles could drive polymerization of an ordinary mononucleotide in the presence of a template. ThisAttorney Docket No.: UPR-1002PCT demonstrates that a template can promote non-enzymatic polymerization of ordinary mononucleotides without being activated.
[0026] FIG. 6 shows an exemplary test chamber for cycling samples. The chamber permits small volumes of nucleotides and templates to be subjected to wet-dry cycles at a controlled temperature of 80° C. The three large white tubes deliver a gentle flow of CO2 (250 mL / min) to the vials being cycled. This helps to evaporate the water during drying and also protects reagents against possible oxidation damage. The syringes and thinner tubing on the right deliver 0.1 mL of water to the vials every 30 minutes which allows reactants in the dry film to redissolve and be exposed to the template.
[0027] FIG. 7 shows a representation of how wet-dry cycles can drive non-enzymatic RNA synthesis guided by a DNA template. If a nucleotide solution is dried in the absence of a template, the nucleotides form a glassy film in which polymerization will produce random sequence products.However, if a DNA template and membrane-forming lipid are present, as the nucleotides become increasingly concentrated within a multilamellar matrix of lipid, they will tend to find favorable Watson-Crick base pairing partners in the template strand. This allows the nucleotides to line up on the template and ultimately undergo condensation reactions with water molecules serving as leaving groups.
[0028] FIG. 8 illustrates an exemplary workflow for using a wet-dry cycle process to synthesize the sense and antisense RNA strands composing siRNA. A DNA template encoding the sense and antisense sequence of siRNA 23mers is added to a solution of all four ribomononucleotides: AMP. UMP, GMP and CMP. A dispersion of an organizing lipid such as lysophosphatidylcholine or phosphatidic acid may also be present. In the first step of synthesis, the mixture is heated (e.g., to 80° C), which melts the template into single strands. During evaporation, the concentrated mononucleotides line up on the template strands by Watson-Crick base pairing, followed by condensation reactions that form linking ester bonds. Water is then added and heated to melt the double-stranded transcripts. When cooled, the transcripts anneal into the desired siRNA duplex.
[0029] In various embodiments, thousands of sequences may be detected from cycled mixtures via nanopore analysis. This may confirm the mass spectrometry conclusion that oligomers are synthesized. Furthermore, nanopore analysis may confirm that the oligomers are recognized by a ligase enzyme that attaches an adapter sequence for nanopore sequencing, and also such sequences are recognized by the helicase that controls the rate at which the oligomer is translocated through the pore. The attachment of the adapter allows one to search through the sequences, looking for theAttorney Docket No.: UPR-1002PCT adapter sequence as a marker for a successful read. Those reads generally match expectations from the composition of the mononucleotides. Surprisingly, nanopore sequencing was developed to read double stranded biological DNA, but many oligoT sequences synthesized from TMP alone may be observed even though they would be single stranded. In such a case, they are ligated to the adapter sequence, then they found the nanopore for the helicase to advance the strand through the pore. The base calling algorithm developed for double stranded biological DNA may recognize oligomers of TMP and dAMP if they are attached to the adapter sequence, but the algorithm also produces sequences without the adapter that would not make sense. Because non-enzymatic polymerization produces complex mixtures of multiple products varying in length, mass spectrometry can only identify shorter oligomers composed of single nucleotides such as those described here. In contrast, nanopore sequencing resolves individual molecules which allows longer polymers to be characterized in terms of length, base composition and sequence.Parameters
[0030] There are numerous variables in the wet-dry process that can be adjusted: pH of the nucleotide solution, ratios of mononucleotides to templates, temperature of the dry film in which polymerization occurs, number of cycles, duration of the wet phase, duration of the dry phase, presence of Mg++ in the solution, presence of a multilamellar lipid matrix, and others.
[0031] In various embodiments, the pH of the wet-dry cycling environment is controlled. In some cases, the pH is about 1.0, about 1.5, about 2.0, about 2.5, about 3.0, about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 6.0, about 6.5, or about 7.0. In some cases, the pH is from about 2.0 to about 3.0. In some cases, the pH is about 2.5.
[0032] In various embodiments, the ratio of monomers to template is controlled. In some cases, the ratio is about 1:3, 1:2, 1:1, 2:1, or 3:1 monomer to template by weight.
[0033] In various embodiments, the temperature of the wet-dry cycling environment is controlled. In some cases, the temperature is between about 70 °C and about 90 °C. In some cases, the temperature is about 85 °C.
[0034] In various embodiments, the wet-dry cycling to produce oligomers is repeated to produce oligomers of greater than 1000 nucleotides, optionally greater than 1000 nucleotides and less than 5000 nucleotides. In some cases, the wet-dry cycling is repeated 2, 3, 4, 5, 6, 7, 8, 9. 10. 15, 20. 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more times. In some cases, the wet-dry cycling is repeated between 2 and 10 times.Attorney Docket No.: UPR-1002PCT
[0035] In various embodiments, the duration of the wet phase is controlled. In some cases, the wet phase lasts 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 minutes.
[0036] In various embodiments, the duration of the dry phase is controlled. In some cases, the dry phase lasts 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 minutes.
[0037] In various embodiments, divalent cations, including but not limited to Mg2+, are present in the wet-dry cycling environment.
[0038] In various embodiments, the wet-dry cycling is conducted in the presence of an organizing lipid. In some cases, the organizing lipid is lysophosphatidylcholine, phosphatidic acid, or another suitable multilamellar lipid matrix. In some cases, the organizing lipid is present at an equivalent weight to the monomers.
[0039] In various embodiments, wet-dry cycling to produce oligomers is performed in the substantial absence of enzymes. In various embodiments, wet-dry cycling to produce oligomers is performed in the substantial absence of polymerase enzymes. In various embodiments, wet-dry cycling to produce oligomers is performed with components that are incompatible with enzymatic amplification of nucleotides. In various embodiments, wet-dry cycling to produce oligomers is performed with an agent that directs functionality or sequence specificity, such that functionality or sequence specificity increases over time correlated with the number of cycles. In various embodiments, wet-dry cycling to produce oligomers occurs at a faster rate than acid-catalyzed hydrolysis of the ester bonds, resulting in accumulation of oligomers during wet-dry cycling.Base Sequence Transcription Accuracy of RNA Oligomers from DNA Templates
[0040] The accuracy of the base sequence transcribed in the RNA oligomer products from the DNA template sequence can be related to the length of oligomers.
[0041] Sequencing, such as nanopore sequencing, can be used to establish the base sequences of RNA oligomers produced by the methods of the present disclosure.Applications
[0042] Certain diseases are caused by accumulation of toxic proteins in cells. These are referred to as proteinopathies, and common examples include Alzheimer’s, Parkinson’s and Huntington’s disease. Small interfering RNAs (siRNA) interfere with the synthesis of targeted proteins and six have now been approved for use in treating relatively rare proteinopathies. The latest example is nedosiran which was approved in 2024 to treat primary hyperoxaluria type 1. Despite their promise, research onAttorney Docket No.: UPR-1002PCT siRNA faces several challenges. They are expensive, and ordering siRNA designed by the investigator lacks flexibility when various designs must be screened for efficacy.
[0043] The methods of the present disclosure can reduce cost and increase flexibility by allowing inexpensive siRNA to be easily synthesized. An example of the potential cost reduction is to compare the cost of synthetic DNA ($0.15 per base pair) to the cost of siRNA ($2.11 per base pair). The reduced cost and increased flexibility can allow significantly more research to be undertaken. It may also aid the transition from the laboratory to clinical trials. A human patient can require multiple doses of siRNA in milligram quantities to be effective. Annual per patient costs of six approved siRNA drugs range from $263,000 to $1.6 million.EXAMPLESExample 1
[0044] A DNA template the size of a typical siRNA sense or antisense strand (22mer) was prepared. The base sequence was designed to target for silencing the green fluorescent protein in HeLa cell cultures. The template was mixed in a 1:2 ratio with all four ribomononucleotides (AMP, UMP, GMP, CMP, 10 mM total concentration, pH 2.5), then exposed to three 30-minute wet-dry cycles at 80° C, purified by ethanol precipitation, and analyzed on HPLC (Fig. 2). The large peak at 22 minutes is the template, and the smaller peaks to the left are presumably RNA polymers synthesized by the cycling process. They are absent in a control in which the mixture of mononucleotides is absent, so they are not hydrolysis products of the template.Example 2: Transcribing sequences from a DNA template to a DNA product
[0045] The synthesis procedure of Example 1 was conducted, except that deoxyribonucleotides were used as substrates, thereby producing DNA products, in order to prove out the sequencing-based analysis workflow with the more commonly sequenced DNA before moving on to RNA, and to see if base sequences in DNA templates could be transcribed to DNA products and confirmed by sequencing as proof of principle.
[0046] Several enzymatic steps are involved in preparing short DNA samples for sequencing. These include an adapter sequence that is ligated to each product strand to prepare it for nanopore sequencing. A second sequence present is the bar code used to identify samples that are being sequenced. Finally, there is a template DNA sequence that is added as a target. If sequences areAttorney Docket No.: UPR-1002PCT transferred from a DNA template to a DNA product, the expectation was that both the template and complementary sequences would be present in the mixture after wet-dry cycling.
[0047] The complementary sequence is limited by the length of the template, but shorter complementary sequences are likely to be present because of errors in guiding the Watson-Crick base pairing during synthesis of the product sequences.
[0048] The sequencing adapter and barcodes are purchased from Oxford Nanopore Technologies.This is the order of sequences present in a typical read:
[0049] < ADAPTERx BAR CODEx TEMPLATE or PRODUCT STRANDxBARCODExAD APTER.
[0050] The adapter sequence is 5'-TTTTTTTTCCTGTACTTCGTTCAGTTACGTATTGCT-3'. An example of what a read would look like is shown below after the adapter, barcode and template strands have been added:
[0051] <TTTTTTTTCCTGTACTTCGTTCAGTTACGTATTGCT><AAGGTTAACACAAAGACACCGACAACTTTCTTCAGCACCT> <TEMPLATE or PRODUCTSTRAND > <GGTGCTGAAGAAAGTTGTCGGTGTCTTTGTG> <TTAACCTTAGCAATACGTAACTGAACGAAGTACAGG>.
[0052] A typical output of a PromethlON ran is tens of thousands of base sequences of individual molecules, each confirmed as accurate because they contain the exact base sequences of adapter, bar codes and template.
[0053] Five series of four samples each were sequenced on a PromethlON device manufactured by Oxford Nanopore Technologies. Here are the results from an experiment that used a 54mer DNA template with four deoxymononucleotides as substrates:
[0054] Template sequence:
[0055] 5’-TTGATTGAACCCTTGATTGAACCCTTGATTGAACCCTTGATTGAACCCAAAAAA-3’
[0056] Complementary sequence:
[0057] 3’-AACTAACTTGGGAACTAACTTGGGAACTAACTTGGGAACTAACTTGGGTTTTTT-5’
[0058] The complementary strand is not read directly in the 3 ’-5’ direction, but in the 5 ’-3’ direction, so if complementary sequences are present, they will appear in the reverse direction in the reads:
[0059] Reverse complementary sequence:Attorney Docket No.: UPR-1002PCT
[0060] 5’-TTTTTTGGGTTCAATCAAGGGTTCAATCAAGGGTTCAATCAAGGGTTCAATCAA 3,
[0061] If there is no effect of the template on polymerization, all of the base sequences other than the template, adapter and barcodes will be random. But if the template does guide the sequence of bases in the product strand, we will find sequences that are complementary to the template. We began by looking for complementary lOmers, then t imers. 12mers and so on. The odds of finding a single lOmer in large numbers of random sequences is 1 in 1,048,576 (i.e., 410) so if we see more than one lOmer it will be consistent with non-random copying from the template. In fact, there were 35,907 copies. We then looked for longer complementary sequences such as GGGTTCAATCAAGGGTTCAATCAAGGGTTCAATCAA and found 3,503 copies. Given these results, we are confident that a template sequence can be copied to complementary DNA product strands. The next question is whether a similar process can generate RNA product strands from a DNA template.Example 3: Transcribing sequences from a DNA template to an RNA product
[0062] Samples were prepared in which a DNA template was cycled with four ribomononucleotides, AMP, UMP, GMP and CMP, as described in Example 1.
[0063] Nanopore sequencing of possible RNA products was performed. Briefly, we first poly(A) tailed the prepared products from the reaction using E. coli poly(A) polymerase followed by a bead cleanup. We then used standard direct RNA sequencing kit but skipped the reverse transcription step during the adaptation of poly(A) tailed products from the previous step. Each sample was then run using a PromethlON RNA flow cell.
[0064] We observed that RNA strands were synthesized and acquired between 4 - 5.4 million molecular captures per experiment. The median read lengths ranged between 56 to 59 nt. By observation of individual ionic current events, we determined that over 98% of the strands appeared to have undergone a normal translocation from open channel to a strand capture, followed by strand translocation, and a normal exit back to open channel.
[0065] FIG. 3 shows one example of an ionic current blockade associated with the sequencing of a strand of RNA synthesized from a template, with ionic current components: (i) strand capture; (ii) ONT adapter translocation; (iii) poly(A) RNA tail translocation; (iv) putatively synthesized RNA translocation; and (v) exit of the strand. We observed a 31-merAttorney Docket No.: UPR-1002PCT(UGUCGUGAGAUGUUGGGUUAAGUCCCGCAAC) in this 744 nt long strand. The same 31 -mer was also observed in several thousand other strands across all three cycles.
[0066] Also shown below are three examples of RNA sequences picked at random from thousands of reads:
[0067] CAGCCCCUCC CAUACCAUCU GUAUCAUCUA UAUAUAUCAU CCAUCAUGCU CCUACUUUUC
[0068] CCCAUACAUU UAUGCCCCUC AUAUCAUAUU CUAUCCCACA UUCAUGUCCC CACAUAAUC
[0069] UUACCCUCCC AUCUAUCCCC UCAUAUUUUA ACCAUCCCCA UUUAUUCCUA CUCC
[0070] This demonstrated that (1) RNA strands are synthesized from mononucleotides by wet-dry cycling, (2) nanopore sequencing can establish the base sequences of the synthetic RNA, and (3) the method can synthesize strands of RNA long enough to serve as sense and antisense strands of siRNA.Example 4: Synthesis of siRNA
[0071] A DNA template was purchased from IDT. The template was a 60-mer that contains siRNA sequences targeted for the mRNA guiding synthesis of green fluorescent protein. Accordingly, synthesized RNA should inhibit the synthesis of GFP in HeLa cell tissue cultures.
[0072] Template: 5’-TTTTATAACTCCAGTAGCCTATTTAATAAGAAAATAGCCCCTATTAATAACATCAACCCC AUCAA-3’
[0073] Complementary sequence: 3’- AAAAUAUGUGAGGUCAUCGGAUAAAUUAUUCUUUUAUCGGGGAUAAUUAUUGGGGUA GUU-5’
[0074] For an initial experiment, rather than attempt to synthesize a 60-mer complementary to the template, the 60-mer was divided into six 10-mer sequences within the molecule. The products can then be searched for evidence that one or more of the 10-mer sequences were complementary to the template.
[0075] Nanopore sequencing reads a strand from the 5’ to the 3’ end of the molecule, so we needed to reverse the complementary sequence to accommodate the read direction. The reversed complementary sequence divided into six 10-mers is: 5’-UUGAUGGGGU UAUUAAUAGG GGCUAUUUUC UUAUUAAAUA GGCUACUGGA GUGUAUAAAA-3’Attorney Docket No.: UPR-1002PCT
[0076] Wet-dry cycling template-directed synthesis of RNA products was conducted. A mixture of the four monomers (AUGC) was mixed with the template in a 2:1 ratio by weight.Lysophosphatidylcholine (LPC) improves yields, so an equivalent weight of this lipid was also present.
[0077] Products were sequenced via Oxford Nanopore. Sequencing results were informatically searched for the 10-mers. The chances of a given 10-mer sequence appearing by random chance in a large set of random sequences is one in 410, or one in 1,048,576. If we observe significantly more than one such sequence, it will support the conclusion that it was copied from the template. Most of the 10- mers were represented by just a few copies or even none, but there were 55 copies of UUAUUAAAUA, far beyond the number expected by chance.
[0078] UUGAUGGGGU 5 copies
[0079] UAUUAAUAGG 0 copies
[0080] GGCUAUUUUC 5 copies
[0081] UUAUUAAAUA 55 copies
[0082] GGCUACUGGA 0 copies
[0083] GUGUAUAAAA 0 copies
Claims
Attorney Docket No.: UPR-1002PCTCLAIMSWhat is claimed is:
1. A method of preparing RNA oligomers, comprising: a. providing a DNA template; b. contacting the DNA template with a solution comprising solvent, adenosine monophosphate (AMP), uridine monophosphate (UMP), guanosine monophosphate (GMP) and cytidine monophosphate (CMP); and c. drying the solution.
2. The method of claim 1, further comprising, after the drying, d. contacting the DNA template with additional solvent, thereby re- wetting the DNA template; and e. drying the additional solvent, thereby re-drying the DNA template.
3. The method of claim 2, further comprising, after the re-drying, repeating steps d and e to achieve a total of three wet-dry cycles.
4. The method of claim 2, further comprising, after the re-drying, repeating steps d and e to achieve a total of four wet-dry cycles.
5. The method of claim 2, further comprising, after the re-drying, repeating steps d and e to achieve a total of five wet-dry cycles.
6. The method of claim 2, further comprising, after the re-drying, repeating steps d and e to achieve a total of ten wet-dry cycles.
7. The method of any one of claims 1-6, wherein the AMP, the UMP, the GMP, and the CMP are present in the solution at a concentration of about 2.5 mM each.
8. The method of any one of claims 1-7, wherein the pH of the solution is about 2.0.
9. The method of any one of claims 1-8, wherein the DNA template is an siRNA sense strand template.
10. The method of any one of claims 1-8, wherein the DNA template is an siRNA antisense strand template.
11. The method of claim 1, further comprising (i) performing steps a-c wherein the DNA template is an siRNA sense strand template, thereby producing siRNA sense strand oligomers, (ii) performing steps a-c wherein the DNA template is an siRNA antisense strand template, thereby producing siRNA antisense strand oligomers, (iii) capturing theAttorney Docket No.: UPR-1002PCT siRNA sense strand oligomers and the siRNA antisense strand oligomers, (iv) mixing the siRNA sense strand oligomers and the siRNA antisense strand oligomers, thereby producing siRNA oligomers, (v) heating the siRNA oligomers, (vi) cooling the siRNA oligomers, thereby producing siRNA duplexes.
12. The method of claim 11, further comprising (vii) contacting the siRNA duplexes with DNase, and (viii) concentrating the siRNA duplexes.