Lipid nanoparticle compositions and uses thereof

Lipid nanoparticle compositions with ionizable cationic lipids enhance lung delivery of polynucleotides, overcoming immune recognition and achieving targeted protein expression and gene editing with minimal cytotoxicity.

WO2026117699A1PCT designated stage Publication Date: 2026-06-04RECODE THERAPEUTICS INC

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
RECODE THERAPEUTICS INC
Filing Date
2025-11-26
Publication Date
2026-06-04

AI Technical Summary

Technical Problem

There is an unmet need for lipid nanoparticle compositions that can efficiently deliver polynucleotides, such as mRNA, to the lung while avoiding immune system recognition and inactivation.

Method used

Development of lipid nanoparticles (LNPs) comprising specific combinations of ionizable cationic lipids, including DEA-16-DAP, PN-16-DAP, and DODAP, along with other lipids like 14:0 TAP and 16:0 EPC, to enhance delivery efficiency and minimize immune response.

Benefits of technology

The LNPs effectively deliver polynucleotides to lung tissues with reduced immune activation, enabling targeted protein expression and gene editing, while maintaining low cytotoxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025057302_04062026_PF_FP_ABST
    Figure US2025057302_04062026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are lipid nanoparticle (LNP) compositions for use in delivering a payload to a lung cell of a subject. Also provided are a method for treating and / or preventing a lung disease, kits, pharmaceutical compositions, and other compositions and methods.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No. 061529-516001WOLIPID NANOPARTICLE COMPOSITIONS AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U. S. Provisional Patent Application No. 63 / 725,936 filed November 27, 2024 of which is incorporated by reference herein in its entirety.SEQUENCE LISTING

[0002] This application contains a Sequence Listing which has been submitted in. XML format and is hereby incorporated by reference in its entirety. The XML file, created on November 25, 2025, is named 061529-516001WO.xml and is 53.419 bytes in size.BACKGROUND

[0003] Nucleic acids, such as messenger ribonucleic acid(s) (mRNA(s)) may be used by cells to express proteins and polypeptides. Some cells may be deficient in a certain protein or nucleic acid and result in disease states. A cell can also take up and translate exogenous ribonucleic acid(s) (RNA(s)), but many factors influence efficient uptake and translation. For instance, the immune system recognizes many exogenous RNAs as foreign and triggers a response that is aimed at inactivating the RNAs. There is an unmet need for lipid nanoparticle compositions for specific delivery of polynucleotides to lung. The present disclosure provides lipid nanoparticle compositions, as well as pharmaceutical compositions, and methods of delivering them to lung.SUMMARY

[0004] In some aspects, disclosed herein is a compound selected from:0x V z. W Z. "“vX.z Z-,,. Z 1 ••V„Z~S.6(DEA-16-DAP), (DEA- 16:1 -DAP).o 0.--X / . - If ■a a(PN-16-DAP), (P-16 DAP),Attorney Docket No. 061529-516001WO o XXZ... X-- X' -....,, z 4 < J ^XX. X.._X ^XXX Xz¥ / X.. X. „.. N -. Z-'0(PN-16: 1 DAP), (P-16: l DAP),0..0(14-AllylPC),(MO- 16: 1 -DAP),i "+kiMeo IIo> 1 ^o'b ° v^rlj crMeT T 7 < (Me-16-EPC),(Pr-16-EPC),. AM» X - ^ U 1 (16-AllylPC),(16-PrgPC),0 Met.P °y". ii<° '„ry(16-PrAPC),(16: l-PrPC).\X'x^ / NX\x^zxyO X ^ X X vl cr r(MO-14:0-TAP), (MO-16:0-TAP), andBr~z^X / \Xxz / XAvAxx-0A(TDMO).

[0005] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising:(i) a first lipid wherein the first lipid is an ionizable cationic lipid.Attorney Docket No. 061529-516001WO(ii) a second lipid wherein the second lipid is separate from the first lipid, and wherein the second lipid is a permanently cationic or ionizable cationic lipid, and(iii) a third lipid wherein the third lipid is separate from the first and second lipid, and wherein the third lipid is a permanently cationic or ionizable cationic lipid.

[0006] In some embodiments, the second lipid is an ionizable cationic lipid. In some embodiments, the second lipid is a permanently cationic lipid. In some embodiments, the second lipid is a trimethyl ammoniumpropane, a dimethylammoniumpropane or an ethylphosphocholine, or a modified version, derivative or variant thereof. In some embodiments, the second lipid is selected from: DEA-16-DAP, PN-16-DAP, P-16 DAP, DEA-16: 1-DAP, PN-16:1 DAP, P-16: 1 DAP, MO-16: 1-DAP, 4-(2.3-bis(palmitoyloxy)propyl)-4-methylmorpholin-4-ium chloride (MO-16:0-TAP), 4-(2,3-bis(tetradecanoyloxy)propyl)-4-methylmorpholin-4-ium chloride (MO-14:0-TAP), l,2-dimyristoyl-3-dimethylammonium-propane (14:0 DAP), l,2-dipalmitoyl-3-dimethylammonium-propane (16:0 DAP), 1,2-distearoyl-3-dimethylammonium-propane (18:0 DAP). 16:1 DAP, l,2-dioleoyl-3-dimethylammonium-propane (18:1 DAP, DODAP), and 4-methyl-4-(2-(tetradecyloxy)-3-(tridecyloxy)propyl)morpholin-4-ium bromide (TDMO). In some embodiments, the second lipid is selected from 4-(2,3-bis(palmitoyloxy)propyl)-4-methylmorpholin-4-ium chloride (MO-16:0-TAP), 4-(2,3-bis(tetradecanoyloxy)propyl)-4-methylmorpholin-4-ium chloride (MO-14:0-TAP). and TDMO. In some embodiments, the third lipid is a permanently cationic lipid. In some embodiments, the third lipid is an ionizable cationic lipid. In some embodiments, the third lipid is a trimethylammoniumpropane, a dimethylammoniumpropane or an ethylphosphocholine, or a modified version, derivative, or variant thereof. In some embodiments, the third lipid is l,2-dioleoyl-3-trimethylammonium-propane (14:0 TAP). 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:0 EPC) l,2-dipalmitoyl-sn-glycero-3-ethylphosphocholine (16:0 EPC), 16:1 EPC, l,2-distearoyl-sn-glycero-3-ethylphosphocholine (18:0 EPC), l,2-dioleoyl-sn-glycero-3-ethylphosphocholine (18:1 EPC), 14-AllylPC, Me-16-EPC, Pr-16-EPC, 16-AllylPC. 16-PrgPC, 16-PrAPC. 16:l-PrPC. In some embodiments, the third lipid is selected from 4-(2,3-bis(palmitoyloxy)propyl)-4-methylmorpholin-4-ium chloride (MO-16:0-TAP), 4-(2,3-bis(tetradecanoyloxy)propyl)-4-methylmorpholin-4-ium chloride (MO-14:0-TAP), and 4-methyl-4-(2-(tetradecyloxy)-3- (tridecyloxy)propyl)morpholin-4-ium bromide (TDMO). In some embodiments, the third lipid is selected from a lipid in Table 6A or Table 6B. In some embodiments, the lipid component comprises the second lipid in an amount of from about 5 mol% to about 30 mol% of the totalAttorney Docket No. 061529-516001WOlipids in the lipid component (e.g., in an amount of from about 10 mol% to about 30 mol% or in an amount of from about 10 mol% to about 20 mol% of the total lipids in the lipid component). In some embodiments, the lipid component comprises the second lipid in an amount of about 15 mol% of the total lipids in the lipid component. In some embodiments, the lipid component comprises the third lipid in an amount of from about 5 mol% to about 30 mol% of the total lipids in the lipid component (e.g., in an amount of from about 10 mol% to about 30 mol% or in an amount of from about 10 mol% to about 20 mol% of the total lipids in the lipid component). In some embodiments, the lipid component comprises the third lipid in an amount of about 13 mol% of the total lipids in the lipid component. In some embodiments, the lipid component comprises the third lipid in an amount of about 12.5 mol% of the total lipids in the lipid component. In some embodiments, the lipid component comprises the third lipid in an amount of about 17.5% of the total lipids in the lipid component. In some embodiments, the lipid component comprises the third lipid in an amount of about 20% of the total lipids in the lipid component. In some embodiments, the lipid component comprises the third lipid in an amount of about 25% of the total lipids in the lipid component.

[0007] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising:i. an ionizable cationic lipid, 14:0 DAP and 14:0 TAP,ii. an ionizable cationic lipid, 16:0 DAP and 14:0 TAP,iii. an ionizable cationic lipid, 18:0 DAP and 14:0 TAP.iv. an ionizable cationic lipid, DEA-16-DAP and 14:0 TAP,v. an ionizable cationic lipid, PN-16-DAP and 14:0 TAP,vi. an ionizable cationic lipid, P-16 DAP and 14:0 TAP,vii. an ionizable cationic lipid, 16:1 DAP and 14:0 TAP.viii. an ionizable cationic lipid, DEA-16: 1-DAP and 14:0 TAP,ix. an ionizable cationic lipid, PN-16:1 DAP and 14:0 TAP,x. an ionizable cationic lipid, P-16:l DAP and 14:0 TAP,xi. an ionizable cationic lipid, MO-16T-DAP and 14:0 TAP,xii. an ionizable cationic lipid, DODAP and 14-AllylPC,xiii. an ionizable cationic lipid, DODAP and Me-16-EPC,xiv. an ionizable cationic lipid, DODAP and Pr-16-EPC,xv. an ionizable cationic lipid, DODAP and 16-AllylPC,xvi. an ionizable cationic lipid, DODAP and 16-PrgPC,xvii. an ionizable cationic lipid, DODAP and 16-PrAPC,Attorney Docket No. 061529-516001WOxviii. an ionizable cationic lipid, DODAP and 16:1 EPC,xix. an ionizable cationic lipid, DODAP and 16: 1-PrPC,xx. an ionizable cationic lipid, DODAP and 18:0 EPC,xxi. an ionizable cationic lipid, DODAP and 18:1 EPC,xxii. an ionizable cationic lipid, 14:0 DAP and 14:0 TAP,xxiii. an ionizable cationic lipid, DODAP and MO-14:0 TAP,xxiv. an ionizable cationic lipid, DODAP and MO-16:0 TAP, orxxv. an ionizable cationic lipid, DODAP and TDMO.

[0008] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 14:0 DAP in an amount of from about 10 mol% to about 30 mol%. optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0009] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 16:0 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0010] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 18:0 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0011] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DEA-16-DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0012] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, PN-16-DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.Attorney Docket No. 061529-516001WO

[0013] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, P-16 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0014] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 16:1 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0015] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DEA-16: l-DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0016] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, PN-16: 1 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0017] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, P-16:l DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0018] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, MO-16: l-DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

[0019] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14-AllylPC in an amount of fromAttorney Docket No. 061529-516001WOabout 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0020] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and Me-16-EPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0021] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and Pr-16-EPC in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

[0022] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 16-AllylPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0023] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%. optionally about 15 mol % and 16-PrgPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0024] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid. DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 16-PrAPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0025] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid. DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 16: 1 EPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0026] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10Attorney Docket No. 061529-516001WOmol% to about 30 mol%, optionally about 15 mol % and 16: 1-PrPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0027] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%. optionally about 15 mol % and 18:0 EPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0028] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%. optionally about 15 mol% and 18:1 EPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

[0029] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%. optionally about 15 mol% and 14:0 TAP in an amount of from about 15 mol% to about 30 mol%, optionally about 20 mol% or about 27.5 mol % of the total lipids in the lipid component.

[0030] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid. DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and 14:0 EPC in an amount of from about 15 mol% to about 30 mol%, optionally about 20 mol %, about 25 mol%, or about 27.5 mol % of the total lipids in the lipid component.

[0031] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and MO-16:0-TAP in an amount of from about 15 mol% to about 30 mol%, optionally about 20 mol %, about 25 mol%, or about 27.5 mol % of the total lipids in the lipid component.

[0032] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and MO-14:0-TAP in an amount of from about 15 mol% to about 30 mol%, optionally about 20 mol %, about 25 mol%, or about 27.5 mol % of the total lipids in the lipid component.Attorney Docket No. 061529-516001WO

[0033] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid. DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and MO-14:0-TAP in an amount of from about 15 mol% to about 30 mol%, optionally about 20 mol %, about 25 mol%, or about 27.5 mol % of the total lipids in the lipid component.

[0034] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising: a first lipid, wherein the first lipid is a permanently cationic or ionizable cationic lipid, and wherein the lipid component comprises the lipid in an amount of from about 10 mol% to about 20 mol % of the total lipids in the lipid component. In some embodiments, the first lipid is a permanently cationic lipid. In some embodiments, first lipid is an ionizable cationic lipid. In some embodiments, the first lipid is a trimethyl ammoniumpropane, a dimethylammoniumpropane or an ethylphosphocholine, or a modified version, derivative, or variant thereof. In some embodiments, the first lipid is selected from: DEA-16-DAP, PN-16-DAP, P-16 DAP, DEA-16: 1-DAP, PN-16:1 DAP, P-16: 1 DAP, MO-16:1-DAP, 14:0 DAP, 16:0 DAP, 18:0 DAP, 16:1 DAP, 18:1 DAP. DODAP. 14:0 TAP, 14:0 EPC, 16:0 EPC, 16:1 EPC, 18:0 EPC. 18:1 EPC. 14-AllylPC, Me-16-EPC, Pr-16-EPC.16-AllylPC, 16-PrgPC, 16-PrAPC, and 16:l-PrPC. In some embodiments, the lipid component comprises the first lipid in an amount of from about 10 mol% to about 15 mol % of the total lipids in the lipid component. In some embodiments, the lipid component comprises the first lipid in an amount of about 13 mol% of the total lipids in the lipid component. In some embodiments, the lipid component comprises the first lipid in an amount of about 12.5 mol% of the total lipids in the lipid component. In some embodiments, the lipid component further comprises an ionizable cationic lipid separate from the first lipid.

[0035] In some embodiments, the ionizable cationic lipid is a compound of Formula D-A:pD1a RD2aOKO RD2aCH3(CH2)Z3aSH^°^OA°o':i(CH?)73aCH3O O O;iO ^D2a^ RD2aCH3(CH2)Z^;A<O°YXH®a(CH2)23aCH3o 024a(D-A), or a pharmaceutically acceptable salt thereof,wherein:RD,ais a Ci-C4alkyl;RD2ais a C1-C4 alkyl;zla and z2a are each independently 1, 2, or 3;Attorney Docket No. 061529-516001WOz3a is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14; and z4a is 0 or 1.

[0036] In some embodiments, the ionizable cationic lipid is a compound selected from Table 3 or Table 4. For example, in some embodiments, the ionizable cationic lipid is 4A3-SC7.

[0037] In some embodiments, the lipid component comprises the ionizable cationic lipid in an amount of from about 5 mol% to about 30 mol% of the total lipids in the lipid component (e.g.. in an amount of from about 20 mol% to about 40 mol% or in an amount of from about 10 mol% to about 30 mol% or in an amount of from about 10 mol% to about 20 mol% of the total lipids in the lipid component). In some embodiments, the lipid component comprises the ionizable cationic lipid in an amount of about 15 mol% (e.g., about 14.8 mol%) of the total lipids in the lipid component.

[0038] In some embodiments, the lipid component further comprises a phospholipid (e.g., DOPE or DSPC). In some embodiments, the lipid component comprises the phospholipid in an amount of from about 5 mol% to about 35 mol% of the total lipids in the lipid component (e.g., from about 10 mol% to about 30 mol% of the total lipids in the lipid component). In some embodiments, the lipid component comprises the phospholipid in an amount of about 22 mol% (e.g., about 22.2 mol%) of the total lipids in the lipid component.

[0039] In some embodiments, the lipid component further comprises a PEG lipid (e.g., 1,2-dimyristoyl-sn-glycero-3-methoxypolyethylene glycol-2000 (PEG2000-DMG)). In some embodiments, the lipid component comprises the PEG lipid in an amount of from about 0.5 mol% to about 5 mol% of the total lipids in the lipid component (e.g., from about 2 mol% to about 4 mol% of the total lipids in the lipid component). In some embodiments, the lipid component comprises the PEG lipid in an amount of about 3 mol% of the total lipids in the lipid component.

[0040] In some embodiments, the lipid component further comprises a sterol (e.g., cholesterol). In some embodiments, the lipid component comprises the sterol in an amount of from about 25 mol% to about 45 mol% of the total lipids in the lipid component (e.g., in an amount of from about 25 mol% to about 40 mol% or in an amount of from about 30 mol% to about 35 mol% of the total lipids in the lipid component). In some embodiments, the lipid component comprises the sterol in an amount of about 33 mol% (e.g., 32.5 mol%) of the total lipids in the lipid component. In some embodiments, the lipid component comprises the sterol in an amount of from about 15 mol% to about 30 mol% of the total lipids in the lipid component. In some embodiments, the lipid component comprises the sterol in an amount of about 20 mol% of the total lipids in the lipid component. In some embodiments, the lipidAttorney Docket No. 061529-516001WOcomponent comprises the sterol in an amount of about 25 mol% of the total lipids in the lipid component. In some embodiments, the sterol in an amount of about 27.5 mol% of the total lipids in the lipid component.

[0041] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising:i. an ionizable cationic lipid in an amount of about 16 mol% of the total lipids of the lipid component; a phospholipid in an amount of about 21 mol% of the total lipids of the lipid component; a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component; a sterol in an amount of about 44 mol% of the total lipids of the lipid component; and 14:0 TAP in an amount of about 12.5 mol% of the total lipids of the lipid component; or ii. an ionizable cationic lipid in an amount of about 30 mol% of the total lipids of the lipid component; a phospholipid in an amount of about 22 mol% of the total lipids of the lipid component; a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component: a sterol in an amount of about 32.5 mol% of the total lipids of the lipid component; and 14:0 TAP in an amount of about 12.5 mol% of the total lipids of the lipid component: or iii. An ionizable cationic lipid in an amount of about 19 mol% of the total lipids of the lipid component; a phospholipid in an amount of about 21 mol% of the total lipids of the lipid component; a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component; a sterol in an amount of about 44 mol% of the total lipids of the lipid component; and 14:0 EPC in an amount of about 12.5 mol% of the total lipids of the lipid component; or iv. An ionizable cationic lipid in an amount of about 30 mol% of the total lipids of the lipid component; a phospholipid in an amount of about 22 mol% of the total lipids of the lipid component; a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component; a sterol in an amount of about 32.5 mol% of the total lipids of the lipid component; and 14:0 EPC in an amount of about 12.5 mol% of the total lipids of the lipid component.

[0042] In some aspects, disclosed herein is a lipid nanoparticle (LNP) comprising a lipid component comprising:v. an ionizable cationic lipid in an amount of about 15 mol% of the total lipids of the lipid component; a phospholipid in an amount of about 17 mol% of the total lipids of the lipid component; a PEG lipid in an amount of about 3 mol%Attorney Docket No. 061529-516001WOof the total lipids of the lipid component: a sterol in an amount of about 25 mol% of the total lipids of the lipid component; and MO- 14:0 TAP in an amount of about 25% mol% of the total lipids of the lipid component; or vi. an ionizable cationic lipid in an amount of about 15 mol% of the total lipids of the lipid component; a phospholipid in an amount of about 17 mol% of the total lipids of the lipid component; a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component: a sterol in an amount of about 25 mol% of the total lipids of the lipid component; and MO-16:0 TAP in an amount of about 25% mol% of the total lipids of the lipid component; or vii. An ionizable cationic lipid in an amount of about 15 mol% of the total lipids of the lipid component: a phospholipid in an amount of about 17 mol% of the total lipids of the lipid component; a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component; a sterol in an amount of about 25 mol% of the total lipids of the lipid component; and TDMO in an amount of about 25% mol% of the total lipids of the lipid component.

[0043] In some embodiments, the LNP does not induce significant cytotoxicity in a tissue or cell of the subject. For example, in some embodiments, the LNP does not induce significant cytotoxiciW in a lung tissue or lung cell of the subject.

[0044] In some embodiments, an LNP disclosed herein further comprises a payload.

[0045] In some embodiments, the payload comprises a polypeptide or a protein. In some embodiments, the polypeptide or protein is selected from: a cystic fibrosis transmembrane conductance regulator (CFTR) protein, Dynein axonemal heavy chain 5, Dynein axonemal heavy chain 11, Bone morphogenetic protein receptor ty pe 2, Fumarylacetoacetate hydrolase, Phenylalanine hydroxylase, Alpha-L-iduronidase, Collagen type IV alpha 3 chain, Collagen type IV alpha 4 chain, Collagen type IV alpha 5 chain, Poly cystin 1, Poly cystin 2, Fibrocystin (or polyductin), Solute carrier family 3 member 1, Solute carrier family 7 member 9, Paired box gene 9, Myosin VII A, Cadherin related 23, Usherin, Clarin 1, Gap junction beta-2 protein, Gap junction beta-6 protein, Rhodopsin, dystrophia myotonica protein kinase. Dystrophin, Sodium voltage-gated channel alpha subunit 1, Sodium voltage-gated channel beta subunit 1, Coagulation factor VIII, Coagulation factor IX, N-glycanase 1, Palmitoyl-protein thioesterase 1, Tripeptidyl peptidase l, Kvl 1.1 (alpha subunit of potassium ion channel), Palmitoyl-protein thioesterase 1, ATM serine / threonine kinase, Fibrillin 1, MUC5A, MUC5B, matrix metalloproteinase- 1 (MMP1), a disintegrin and metalloproteinase 10 (ADAM 10). CXCL8 (interleukin-8; IL-8), telomerase reverse transcriptase (TERT), Interleukin 1 receptorAttorney Docket No. 061529-516001WOantagonist (IL1RN), alpha-1 antitrypsin (AAT), FK506-binding protein 51 (FKBP5), miR-145-5p, and autophagy protein 5 (ATG5). In some embodiments, the polypeptide or protein is a protein expressed by SERPINA1.

[0046] In some embodiments, the payload comprises a nucleic acid. In some embodiments, the nucleic acid is selected from an siRNA, a miRNA, a pri-miRNA, a messenger RNA (mRNA), a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA). a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), a plasmid DNA (pDNA), a transfer RNA (tRNA), an antisense oligonucleotide (ASO), a guide RNA, a double stranded DNA (dsDNA), a single stranded DNA (ssDNA), a single stranded RNA (ssRNA), and a double stranded RNA (dsRNA). In some embodiments, the payload comprises a small interfering RNA (siRNA). In some embodiments, the payload comprises a micro RNA (miRNA). In some embodiments, the miRNA is miR-145-5p. In some embodiments, the payload comprises an mRNA. In some embodiments, the mRNA encodes a gene-editing system or component thereof.

[0047] In some embodiments, the gene-editing system or component thereof comprises a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), and a guide RNA.

[0048] In some embodiments, the payload comprises an mRNA. In some embodiments, the mRNA encodes a protein selected from: a cystic fibrosis transmembrane conductance regulator (CFTR) protein, Dynein axonemal heavy chain 5, Dynein axonemal heavy chain 11, Bone morphogenetic protein receptor type 2, Fumarylacetoacetate hydrolase, Phenylalanine hydroxylase, Alpha-L-iduronidase, Collagen type IV alpha 3 chain, Collagen type IV alpha 4 chain, Collagen type IV alpha 5 chain. Poly cystin 1. Poly cystin 2, Fibrocystin (or poly ductin), Solute carrier family 3 member 1, Solute earner family 7 member 9, Paired box gene 9, Myosin VII A, Cadherin related 23, Usherin, Clarin 1, Gap junction beta-2 protein, Gap junction beta-6 protein, Rhodopsin, dystrophia my otonica protein kinase, Dystrophin, Sodium voltage-gated channel alpha subunit 1, Sodium voltage-gated channel beta subunit 1. Coagulation factor VIII, Coagulation factor IX. N-glycanase 1. Palmitoyl-protein thioesterase 1, Tripeptidyl peptidase 1, Kvl 1.1 (alpha subunit of potassium ion channel), Palmitoyl-protein thioesterase 1, ATM serine / threonine kinase, Fibrillin 1, MUC A, MUC5B, matrix metalloproteinase- 1 (MMP1), a disintegrin and metalloproteinase 10 (ADAM10), CXCL8 (interleukin-8; IL-8), telomerase reverse transcriptase (TERT), Interleukin 1 receptor antagonist (IL1RN). FK506-binding protein 51 (FKBP5), and autophagy protein 5 (ATG5).Attorney Docket No. 061529-516001WO

[0049] In some embodiments, the mRNA encodes a gene-editing system or component thereof. In some embodiments, the gene-editing system or component thereof comprises a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), and a guide RNA.

[0050] In some embodiments, the payload comprises a guide RNA.

[0051] In another aspect, the disclosure provides a method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering an effective amount of the lipid nanoparticle composition described herein.

[0052] In some embodiments, the method comprises selectively delivering the payload to a target organ. In some embodiments, the method comprises selectively delivering the payload to a target cell.

[0053] In another aspect, the disclosure provides a method of selectively delivering a payload to a target organ of a subject in need thereof, the method comprising administering to the subject an effective amount of the lipid nanoparticle composition described herein. In some embodiments, the target organ is the lung.

[0054] In some embodiments, the payload is an mRNA and wherein the selectively delivering results in expression of a protein encoded by the mRNA in a cell of the target organ. In some embodiments, the payload is a polynucleotide encoding a gene product and wherein the selectively delivering results in expression of the gene product in a cell of the target organ and optionally wherein the gene product is functional in the cell. In some embodiments, the payload comprises an mRNA encoding a gene-editing system or component thereof and wherein the selectively delivering results in altered expression of a protein targeted by the geneediting system in a cell of the target organ.

[0055] In some embodiments, the concentration of the payload in the LNP is from about 0.5 mg / mL to about 4 mg / mL (e.g., from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL). In some embodiments, the concentration of the payload in the LNP is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL. about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL. In some embodiments, the concentration of the mRNA in the LNP is from about 0.5 mg / mL to about 4 mg / mL (e g., from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL). In some embodiments, the concentration of the mRNA in the LNP is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7Attorney Docket No. 061529-516001WOmg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL.

[0056] In some embodiments, the LNP has a diameter of from about 65 nm to about 100 nm, e.g. from about 70 nm to about 90 nm.

[0057] In some embodiments, a plurality of the LNPs has a poly dispersity index (PDI) of from about 0.05 to about 0.3. In some embodiments, a plurality of the LNPs has a poly dispersity index (PDI) of from about 0.7 to about 0.3. In some embodiments, a plurality of the LNPs has a poly dispersity index (PDI) of from about 0.03 to about 0.2. In some embodiments, a plurality of the LNPs has a poly dispersity index (PDI) of from about 0.04 to about 0.1.

[0058] In some embodiments, the LNP has an encapsulation efficiency (%EE) of from about 90% to about 100%, e.g., from about 95% to about 99%.

[0059] In some aspects, disclosed herein is a pharmaceutical composition comprising the LNP of the disclosure and a pharmaceutically acceptable excipient.

[0060] In some aspects, disclosed herein is an aerosolized pharmaceutical composition comprising an LNP the disclosure and a pharmaceutically acceptable excipient. In some embodiments, the aerosolized pharmaceutical composition is a nebulized pharmaceutical composition. In some embodiments, the concentration of the payload in the aerosolized pharmaceutical composition is from about 0.5 mg / mL to about 4 mg / mL. In some embodiments, the concentration of the payload in the aerosolized pharmaceutical composition is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL. In some embodiments, the concentration of the payload in the aerosolized pharmaceutical composition is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL. In some embodiments, the concentration of the rnRNA in the aerosolized pharmaceutical composition is from about 0.5 mg / mL to about 4 mg / mL. In some embodiments, the concentration of the mRNA in the aerosolized pharmaceutical composition is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL. In some embodiments, the concentration of the mRNA in the aerosolized pharmaceutical composition is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL.Attorney Docket No. 061529-516001WO

[0061] In some embodiments, the aerosolized composition comprises aerosol particles. In some embodiments, the aerosol particles have a Mass Median Aerodynamic Diameter (MMAD) from about 1 pm to about 9 pm, or from about 1 pm to about 8 pm, or from about 1 pm to about 7 pm, or from about 1 pm to about 6 pm, or from about 1 pm to about 5 pm, or from about 1 pm to about 4 pm, or from about 1 pm to about 3 pm, or from about 1 pm to about 2 pm, or from about 2 pm to about 5 pm, or from about 3 pm to about 5 pm, or from about 2 pm to about 6 pm, or from about 3 pm to about 6 pm. In some embodiments, the aerosol particles have an MMAD of about 1 pm, about 2 pm, about 3 pm, about 4 pm, about 5 pm, or about 6 pm. In some embodiments, the aerosol particles have an MMAD of from about 3 pm to about 5 pm. In some embodiments, the aerosol particles have an MMAD of about 3.0 pm, about 3.1 pm. about 3.2 pm, about 3.3 pm, about 3.4 pm. about 3.5 pm, about 3.6 pm, about 3.7 pm. about 3.8 pm, about 3.9 pm, 4.0 pm, about 4.1 pm. about 4.2 pm, about 4.3 pm, about 4.4 pm. about 4.5 pm, about 4.6 pm, about 4.7 pm. about 4.8 pm, about 4.9 pm, about 5.0 pm, about 5.1 pm. about 5.2 pm, about 5.3 pm, about 5.4 pm. about 5.5 pm, about 5.6 pm, about 5.7 pm. about 5.8 pm, about 5.9 pm, or about 6 pm. In some embodiments, the aerosol particles have a GSD from about 1 to about 4. In some embodiments, the aerosol particles have a GSD from about 1 to about 3. In some embodiments, the aerosol particles have a GSD from about 1 to about 2. In some embodiments, the aerosol particles have a GSD of about 1, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9. or about 2. In some embodiments, the aerosol particles have a fine particle fraction of from about 50% to about 80%. In some embodiments, the aerosol particles have a fine particle fraction of from about 60% to about 70%. In some embodiments, the aerosol particles have a fine particle fraction of about 55%, of about 60%, of about 70%, of about 75%, of about 80%, of about 85%. or of about 90%. In some embodiments, the aerosolized composition further comprises a buffer.

[0062] Also disclosed herein are liquid pharmaceutical compositions for use in making the aerosolized pharmaceutical composition of the disclosure. In some embodiments, the concentration of the payload in the liquid pharmaceutical composition is from about 0.5 mg / mL to about 4.0 mg / mL. In some embodiments, the concentration of the payload in the liquid pharmaceutical composition is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL. In some embodiments, the concentration of the pay load in the liquid pharmaceutical composition is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL. about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL,Attorney Docket No. 061529-516001WOabout 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL. In some embodiments, the concentration of the mRNA in the liquid pharmaceutical composition is from about 0.5 mg / mL to about 4 mg / mL. In some embodiments, the concentration of the mRNA in the liquid pharmaceutical composition is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL. In some embodiments, the concentration of the mRNA in the liquid pharmaceutical composition is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL. about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL. In some embodiments, the liquid pharmaceutical composition further comprises a buffer. In some embodiments, the buffer is a citrate buffer, an acetate buffer, or a tris(hydroxymethyl)aminomethane (Tris) buffer. In some embodiments, the buffer is a Tris buffer. In some embodiments, the buffer comprises Tris and phosphate buffered saline (PBS). In some embodiments, the buffer comprises 1 x PBS, 15 mM Tris buffer. In some embodiments, the buffer is a citrate buffer. In some embodiments, the buffer comprises citrate at a concentration of from about 5 mM to about 20 mM. In some embodiments, the buffer comprises citrate at a concentration of about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, or about 20 mM. In some embodiments, the buffer comprises tris at a concentration of from about 5 mM to about 20 mM. In some embodiments, the buffer comprises tris at a concentration of about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, or about 20 mM. In some embodiments, the buffer further comprises sucrose. In some embodiments, the buffer comprises the sucrose in an amount of from about 5% to about 15%. In some embodiments, the buffer comprises the sucrose in an amount of about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, or about 15%. In some embodiments, the buffer has a pH of about 7.5. In some embodiments, the buffer has a pH of about 6. In some embodiments, the buffer has a pH of about 4.

[0063] Also disclosed herein are methods of delivering a payload to a cell, comprising contacting the cell with an LNP of the disclosure, a pharmaceutical composition of the disclosure, or an aerosolized pharmaceutical composition of the disclosure.

[0064] Also disclosed herein are methods of expressing a protein or an RNA in a cell, comprising contacting the cell with an LNP of the disclosure, a pharmaceutical composition ofAttorney Docket No. 061529-516001WOthe disclosure, or an aerosolized pharmaceutical composition of the disclosure. In some embodiments, the cell is a lung cell. In some embodiments, the lung cell is a secretory cell. In some embodiments, the lung cell is an ionocyte. In some embodiments, the lung cell is an basal cell. In some embodiments, the lung cell is a ciliated cell. In some embodiments, the lung cell is a human bronchial epithelial cell. In some embodiments, the method specifically transduces the secretory cells compared to other lung cells. In some embodiments, the method specifically transduces the ionocyte compared to other lung cells. In some embodiments, the method specifically transduces the ciliated cell compared to other lung cells. In some embodiments, the method specifically transduces the human bronchial epithelial cell compared to other lung cells. In some embodiments, the lung cell is a basal cell. In some embodiments, the method specifically transduces the basal cells compared to other lung cells. In some embodiments, the method comprises nebulizing the LNP to generate an aerosolized composition, then contacting the aerosolized composition with the cell. In some embodiments, the LNP is an aerosolized composition, and the method comprises contacting the aerosolized composition with the cell.

[0065] Also disclosed herein are methods of delivering a payload to lungs of a subject, comprising administering to the subject an LNP of the disclosure, a pharmaceutical composition of the disclosure, or an aerosolized pharmaceutical composition of the disclosure.

[0066] Also disclosed herein are methods of treating or preventing lung disease in a subject, comprising administering to the subject an LNP of the disclosure, a pharmaceutical composition of the disclosure, or an aerosolized pharmaceutical composition of the disclosure. In some embodiments, the disease or disorder is Acute Interstitial Pneumonia (A1P), alpha- 1 antitrypsin deficiency (AATD), asthma, bronchiectasis, Bronchiolitis obliterans with Organizing Pneumonia (BOOP), bronchitis, Chronic Obstructive Pulmonary Disease (COPD), coronavirus, cystic fibrosis, Desquamative Interstitial Pneumonia (DIP), emphysema, Idiopathic Interstitial Pneumonia (IIP), influenza. Interstitial Lung Disease (ILD), Interstitial Pulmonary Fibrosis (IPF), Legionnaire’s disease, lung cancer, Non-Specific Interstitial Pneumonia (NSIP), pleurisy, pneumonia, Primary Ciliary Dyskinesia (PCD), pulmonary7arterial hypertension, pulmonary edema, pulmonary7fibrosis, pulmonary hypertension, Respiratory Bronchiolitis-associated Interstitial Lung Disease (RBILD), restrictive lung disease, sarcoidosis, Severe Acute Respirator}7Syndrome, or tuberculosis. In some embodiments, the method comprises nebulizing the LNP prior to the administering step. In some embodiments, the LNP is administered as an aerosolized composition, by inhalation. In some embodiments, the method delivers an effective amount of the LNP to the lungs. In some embodiments, the method delivers an effective amount of the LNP to the lungs to treat the lungAttorney Docket No. 061529-516001WOdisease. In some embodiments, the method comprises nebulizing a liquid pharmaceutical composition of the disclosure to generate an aerosolized LNP.

[0067] Also disclosed herein are uses of an LNP of the disclosure, a pharmaceutical composition of the disclosure, or an aerosolized pharmaceutical composition of the disclosure in the manufacture of a medicament for treating a lung disease. In some embodiments, an LNP of the disclosure, a pharmaceutical composition of the disclosure, or an aerosolized pharmaceutical composition of the disclosure is for treatment of a lung disease.

[0068] Also disclosed herein are methods for expressing a protein in the lung of a subject, the method comprising administering of an LNP of the disclosure, a pharmaceutical composition of the disclosure, or an aerosolized pharmaceutical composition of the disclosure for treatment of a lung disease.

[0069] In some embodiments of the methods disclosed herein, the LNP does not induce significant cytotoxicity in a tissue or cell of the subject, optionally a lung tissue or cell. For example, in some embodiments of the methods disclosed herein, the LNP does not induce significant cytotoxicity in a lung tissue or lung cell of the subject.

[0070] In some embodiments of the methods disclosed herein, the subject is a primate. In some embodiments, the subject is a human.

[0071] Also disclosed herein are kits comprising an LNP of the disclosure, a pharmaceutical composition of the disclosure, or an aerosolized pharmaceutical composition of the disclosure, and a nebulizer mask and / or a mesh suitable for use in a nebulizer.BRIEF DESCRIPTION OF THE DRAWINGS

[0072] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0073] The novel features of the disclosure are set forth wi th particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (also '‘figure” and “FIG.” herein), of which:

[0074] FIG. 1 shows LDH assay data in graphical form measuring cytotoxicity by lactate dehydrogenase (LDH) occurrence for each in vitro human bronchial epithelial (HBE) cellular sample dosed with an LNP described herein. In the figure, the numbers 1-37 refer to the administered compositions as follows: 1: untreated cells, 2: A; 3: 3D7; 4: 2J10; 5: 7B11;Attorney Docket No. 061529-516001WO6:7B12; 7:7B13; 8: 7B14; 9: 7B15; 1O:7A1; 11: 7A2; 12: 7A3; 13: 7A4; 14: 7A5; 15: 7A6; 16: 7A7; 17: 7A8; 18: 7A9; 19: 7A10; 20: 7A11: 21: 7C1: 22: 7C2; 23: 7B1; 24: 7B2; 25: 7B3; 26: 7B4; 27: 7B5; 28: 7B6; 29: 7B7; 30: 7B8; 31: 7B9; 32: 7B10; 33: 7C3; 34: 7C4; 35: 3D7 (tested at pH=6); 36: 2B; and 37: 3B3.

[0075] FIG. 2 shows percent adenine base editing of HBE cellular samples dosed with LNP compositions described herein. In the figure, the numbers 1-37 refer to the administered compositions as follows: 1: untreated cells, 2: A; 3: 3D7; 4: 2J10; 5: 7B11; 6:7B12; 7:7B13; 8: 7B14; 9: 7B15; 1O:7A1; 11: 7A2; 12: 7A3; 13: 7A4; 14: 7A5; 15: 7A6; 16: 7A7; 17: 7A8; 18: 7A9; 19: 7A10; 20: 7A11; 21: 7C1; 22: 7C2; 23: 7B1; 24: 7B2; 25: 7B3; 26: 7B4; 27: 7B5; 28: 7B6; 29: 7B7; 30: 7B8; 31: 7B9; 32: 7B10; 33: 7C3; 34: 7C4; 35: 3D7 (tested at pH=6); 36: 2B; and 37: 3B3.

[0076] FIG. 3 shows TEER assay data in graphical form measuring cellular integrity and permeability of HBE cellular samples pre-dosing with an LNP compositions described herein, and post-dosing at 5 hour and 72 hour time points. In the figure, the numbers 1-37 refer to the administered compositions as follows: 1: untreated cells, 2: A; 3: 3D7; 4: 2J10; 5: 7B11; 6:7B12; 7:7B13; 8: 7B14; 9: 7B15; 10:7Al; 11: 7A2; 12: 7 A3; 13: 7A4; 14: 7A5; 15: 7A6; 16: 7A7; 17: 7A8; 18: 7A9; 19: 7A10; 20: 7A11; 21: 7C1; 22: 7C2; 23: 7B1; 24: 7B2; 25: 7B3; 26: 7B4; 27: 7B5; 28: 7B6; 29: 7B7; 30: 7B8; 31: 7B9; 32: 7B10; 33: 7C3; 34: 7C4; 35: 3D7 (tested at pH=6); 36: 2B; and 37: 3B3.

[0077] FIG. 4 shows percent adenine base editing of HBE cellular samples from two wild type donors (donor DD068Q at left series; donor DD015S at right series) dosed with LNP compositions of Table 8 including 3: 3D7, 38: 7B16, 39: 7B17, AND 40: 7B18.

[0078] FIG. 5 shows percent adenine base editing of HBE cellular samples from wild type donor DD068Q dosed with LNP compositions of Table 8 including 3: 3D7, 38: 7B16, 39: 7B17, and 40: 7B18.DETAILED DESCRIPTION

[0079] While various embodiments of the invention have been show n and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous vanations, changes, and substitutions may occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed.Attorney Docket No. 061529-516001WODefinitions

[0080] Before the embodiments of the disclosure are described, it is to be understood that such embodiments are provided by way of example only, and that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the invention. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention.

[0081] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Various scientific dictionaries that include the terms included herein are well known and available to those in the art. Although any methods and materials similar or equivalent to those described herein find use in the practice or testing of the disclosure, some preferred methods and materials are described. Accordingly, the terms defined immediately below are more fully described by reference to the specification as a whole.

[0082] Unless otherwise indicated, all numbers expressing quantities, ranges, conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.'’ Accordingly, unless indicated to the contrary, the numerical parameters set forth in the present specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the present application. Generally the term “about”, as used herein when referring to a measurable value such as an amount of weight, time, dose, etc. is meant to encompass in one example variations of ±20% or ±10%, in another example ±5%, in another example ±1%, and in yet another example ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.

[0083] The singular forms “a,” “an,” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0084] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1% of a given value. In some cases, the term “about” refers to ±10% of a stated number or value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably w ithin 5-fold, and more preferably withinAttorney Docket No. 061529-516001WO2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0085] The term “at least” followed by a number is used herein to denote the start of a range beginning with that number (which may be a range having an upper limit or no upper limit, depending on the variable being defined). For example, “at least 1” means 1 or more than 1.

[0086] The term “at most” followed by a number is used herein to denote the end of a range ending with that number (which may be a range having 1 or 0 as its lower limit, or a range having no lower limit, depending upon the variable being defined). For example, “at most 4” means 4 or less than 4, and “at most 40%” means 40% or less than 40%. When, in this specification, a range is given as “(a first number) to (a second number)” or “(a first number)-(a second number)” this means a range whose low er limit is the first number and whose upper limit is the second number. For example, 25 to 100 mm means a range whose lower limit is 25 mm, and whose upper limit is 100 mm.

[0087] As used herein, the phrases “at least one”, “one or more”, and “and / or” are open-ended expressions that are both conjunctive and disjunctive in operation. For example, each of the expressions “at least one of A, B and C”, “at least one of A, B, or C”, “one or more of A, B, and C”, “one or more of A, B, or C” and “A, B, and / or C” means A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B and C together.

[0088] As used herein, “or” may refer to “and”, “or,” or “and / or” and may be used both exclusively and inclusively. For example, the term “A or B” may refer to “A or B”, “A but not B”, “B but not A”, and “A and B”. In some cases, context may dictate a particular meaning.

[0089] As used herein, the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “include” and “includes”) or “containing” (and any form of containing, such as “contain” and “contains”), are inclusive or open-ended and do not exclude additional, unrecited elements or process steps. As also used herein, in any instance or embodiment described herein, “comprising” may be replaced with “consisting essentially of’ and / or “consisting of’ used herein, in any instance or embodiment described.

[0090] The terms “increased”, “increasing”, “increase”, “improved”, “improvement”, “improving” and the like, are used herein to generally means an increase by a statically significant amount. In some aspects, the terms “increased” or “improved” means an increase or improvement of at least 10% as compared to a reference level, for example an increase or improvement of at least about 10%, at least about 20%, or at least about 30%, or at least aboutAttorney Docket No. 061529-516001WO40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any improvement between 10-100% as compared to a reference level, standard, or control. Other examples of “increase” or “improvement” includes an increase of at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 1000-fold or more as compared to a reference level.

[0091] The terms “decreased”, “decreasing”, “decrease”, “reduced”, “reducing”, “reduce” and the like, are used herein generally to mean a decrease or reduction by a statistically significant amount. In some aspects, “decreased” or “reduced” means a reduction by at least 10% as compared to a reference level, for example a decrease or reduction by at least about 20%. or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease or reduction (e.g., absent level or non-detectable level as compared to a reference level), or any decrease or reduction between 10-100% as compared to a reference level.

[0092] Throughout this application, various embodiments may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0093] As used herein, the term “lipid nanoparticle”, “LNP,” “lipid nanoparticle composition,” or “LNP composition” refers to a carrier or vehicle, formed by one or more lipid components, for payload (e.g., nucleic acid, protein, peptide, polypeptide, polynucleotide, or oligonucleotide) delivery in the context of pharmaceuticals. Further, as used herein the term “formulation” refers to a specific lipid nanoparticle composition of the disclosure. In other words the terms “formulation,” lipid nanoparticle”, “LNP,” “lipid nanoparticle composition,” or “LNP composition” are used herein interchangeably. Lipid nanoparticles can have one or more lipids with at least one dimension on the order of nanometers (e.g., 1-1000 nm). Generally, lipid nanoparticle compositions for delivery are composed of one or more lipids, such as, but not limited to, a synthetic ionizable or cationic lipid, a phospholipid, a structuralAttorney Docket No. 061529-516001WOlipid (e.g., a sterol), and a polyethylene glycol (PEG) lipid. These compositions may also include other lipids. In various embodiments, the lipid nanoparticle composition comprises five components: (i) an ionizable cationic lipid; (ii) a phospholipid; (iii) a steroid or steroid derivative; and (iv) a polymer-conjugated lipid; and (v) an additional cationic ionizable cationic lipid, a permanently cationic lipid or an anionic lipid (“SORT lipid”) separate from said ionizable cationic lipid. In some embodiments, at least one therapeutic agent (e.g., mRNA) can be encapsulated in the lipid portion of the lipid nanoparticle or in an aqueous space enveloped by some or all of the lipid portion of the lipid nanoparticle, thereby protecting it from enzymatic degradation of other undesirable effects induced by the biological mechanism of a target subject, tissue, and / or cell, e.g., an adverse immune response. In some embodiments, lipid nanoparticles comprise at least one therapeutic agent (e.g., mRNA) that is either organized within inverse lipid micelles and encased within a lipid monolayer envelop or intercalated between adjacent lipid bilayers. In some embodiments, the morphology of lipid nanoparticles is not like a traditional liposome, which are characterized by a lipid bilayer surrounding an aqueous core. In some embodiments, lipid nanoparticles are substantially non-toxic. In some embodiments, the therapeutic agent (e.g., mRNA) is resistant in aqueous solution to degradation by intracellular or intercellular enzymes by virtue of the lipid nanoparticle.

[0094] The term Selective Organ Targeting (SORT) lipid, as used herein, refers to a component of a lipid nanoparticle (LNP) composition that provides predictable cell-, tissue-, and / or organ-specific targeting of the LNP (for example as described in Cheng et al. Nat. Nanotechnol. 15:313-320 (2020); Wang et al. Nat. Protoc. 18(I):265-29I; and US 11,766,408 and US 11,229,609, the entire contents of each of which is incorporated herein by reference). A selected SORT lipid provides accurate and specific delivery7of the cargo from a rationally-designed LNP based, in part, on the biophysical properties of the selected SORT lipid and its prevalence in the LNP. In some cases, specificity is modulated by a LNP’s surface's acid dissociation constant (pKa), which may be affected by the proportion of charged and uncharged ionizable cationic lipids at the LNP surface and may depend on the ty pe of SORT used in the LNP formulation. Without wishing to be bound by theory, the SORT lipid directs tissue specificity of a rationally-design LNP by adjusting surface properties and / or physicochemical characteristics of the LNP. Illustrative SORT lipids include, but are not limited to, permanently cationic lipids, anionic lipids, zwitterionic lipids, and ionizable cationic lipids. See, e.g., Table 5, Table 6A, and Table 6B. In some embodiments, anionic SORT lipids generally favor delivery to the spleen, at least when administered intravenously; ionizable cationic SORT lipids or ionizable amino SORT lipids generally favor delivery to the liver; permanently cationicAttorney Docket No. 061529-516001WOSORT lipids generally favor delivery' to the lungs; and zwitterionic SORT lipids favor delivery to the spleen. In some embodiments of the LNPs of the disclosure, the second and / or the third lipids are SORT lipids. In some embodiments, the first lipid is a SORT lipid.

[0095] As used herein, the term “ionizable cationic lipid” refers to lipid and lipid-like molecules having at least one pKa in the range of about 4.5-8, such that, without being bound by theory, they may facilitate release of LNP payloads upon uptake into the endosomal compartment of a cell. The ionizable cationic lipid may maintain a neutral charge in pH above the pKa of the lipid; it becomes positively charged in a pH lower than its pKa which facilitates membrane fusion and subsequent cytosolic release of an LNP. Illustrative ionizable cationic lipids have one or more nitrogen atoms having pKa’s in the range of about 4.5-8, such are tertiary amine groups.

[0096] As used herein, the term “permanently cationic lipid” refers to lipid or lipid-like molecules that are positively charged in physiologically relevant solutions, regardless of a pH (positively charged without pKa or with a pKa greater than 8). Illustrative permanently cationic lipids may include a quaternary ammonium group, and lack a negatively charged phosphate group. Without being bound by theory, a permanently cationic lipid may act as a SORT lipid by raising the apparent pKa of an LNP, as described, e.g., in Dilliard et al. PNAS USA.118(52):e2109256118 (2021).

[0097] As used herein, the term “phospholipid” refers to lipids that comprise a phosphate group. The lipid component of a lipid nanoparticle composition may’ include one or more phospholipids, such as one or more (poly)unsaturated lipids. Phospholipids may assemble into one or more lipid bilayers. In general, phospholipids may include a phospholipid moiety and one or more fatty acid moieties.

[0098] As used herein, the term “sterol” refers to a subgroup of steroids with a hydroxyl group at the 3-position of the A-ring of a gonane ringsystem. “Cholesterol” is an illustrative sterol that has a structure of four fused hydrocarbon rings (gonane ringsystem) with a polar hydroxyl group at one end and an eight-carbon branched aliphatic tail at the other end. The sterol component of an LNP, e g., cholesterol influences the fluidity, thickness, compressibility, water penetration and intrinsic curvature of lipid bilayers, for example in LNPs. For example, “sterol” can be cholesterol or sitosterol.

[0099] As used herein, the term “PEG-lipid” refers to a lipid modified with a polyethylene glycol (PEG) unit. In some embodiments, the PEG-lipid comprises dimyristoyl glycerol (DMG), and is referred to as PEG-DMG. In some embodiments, the PEG-lipid comprises 1,2-distearoyl-sn-glycero-3-phosphorylethanolamine (DSPE).Attorney Docket No. 061529-516001WO

[0100] As used herein, the phrase “N / P ratio’' refers to a molar ratio of nitrogen in the lipid composition to phosphate in the payload, e.g., a polynucleotide payload.

[0101] As used herein, the term "apparent pKa” refers to the overall dissociation constant of all titratable groups in the lipid nanoparticles of an LNP. Apparent pKa is an experimentally determined value of molecules or nanoparticles. Apparent pKa can be expressed as the pH at which the number of ionized (protonated) and deionized groups are equal in a system. The surface charge and ionic interaction of assembled nanomaterials in nanoparticles can be estimated according to apparent pKa. The apparent pKa of a nanoparticle can be the result of the average ratio of all the ionized to deionized groups in the nanoparticle. Thus, apparent pKa is not the intrinsic pKa value for any individual molecule. The apparent pKa of nanoparticles can be measured by various techniques. For example, acid-base titration of 2-(p-toluidino)-6-naphthalene sulfonic acid (TNS) fluorescent methods are widely used in determination of apparent pKa of blank nanoparticles.

[0102] As used herein, the phrase “lipid: RNA ratio” refers to milligram of lipid for each milligram of RNA payload. This ratio influences the encapsulation efficiency of RNA-containing lipid nanoparticles.

[0103] The term ’‘encapsulation,” as used herein refers to the process of confining a payload within an LNP. For example, "encapsulation” refers to confining an mRNA molecule within an LNP. The term “encapsulation efficiency” refers to the fraction of a payload that is encapsulated within or otherwise coupled with a lipid nanoparticle composition when LNPs are formed. Encapsulation efficiency may be determined by comparing the amount of input payload to the amount of pay load in a sample of LNPs, or by comparing the amount of payload in the LNPs to the free excess pay load in the sample. For example, a fluorescence detection assay (e.g., RiboGreen™) is used to determine encapsulation efficiency by measuring the free RNA in a sample with intact LNPs compared with the total RNA in a sample treated to disrupt the LNPs.

[0104] The term “payload” refers to a bioactive molecule or molecules, such as a small molecule, biomolecule, nucleic acid (e.g., DNA, RNA, siRNA, shRNA), protein, polypeptide, or peptide, which is associated with an LNP composition. For example, the payload can be bound covalently or non-covalently to the LNP, encapsulated in the LNP, coupled to the LNP, or complexed with the LNP within the LNP composition.

[0105] As may be used herein, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid oligomer.” “oligonucleotide.” “nucleic acid sequence.” “nucleic acid fragment” and “polynucleotide” are used interchangeably and are intended to include, but are not limited to.Attorney Docket No. 061529-516001WOa polymeric form of nucleotides covalently linked together that may have various lengths, either deoxyribonucleotides or ribonucleotides, or analogs, derivatives or modifications thereof. Different polynucleotides may have different three-dimensional structures, and may perform various functions, known or unknown. Non-limiting examples of polynucleotides include a gene, a gene fragment, an exon, an intron, intergenic DNA (including, without limitation, heterochromatic DNA), messenger RNA (mRNA). small interfering ribonucleic acid (siRNA), a short hairpin RNA (shRNA), a micro RNA (miRNA). transfer RNA, ribosomal RNA, a ribozyme, an antisense RNA, a guide RNA (gRNA), cDNA, a recombinant polynucleotide, a branched polynucleotide, a plasmid, a vector, isolated DNA, isolated RNA, a nucleic acid probe, and a primer. Polynucleotides useful in the methods of the disclosure may comprise natural nucleic acid sequences and variants thereof, artificial nucleic acid sequences, or a combination of such sequences. When the polynucleotides are chemically and / or structurally modified the polynucleotides may be referred to as “modified polynucleotides.'’

[0106] As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one polypeptide. mRNA as used herein encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression, or chemically synthesized. Where appropriate, mRNA can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, or backbone modifications. An mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated.

[0107] As used herein, the term “shRNA” or “short hairpin RNA” refers to a short sequence of RNA, which can make a tight hairpin turn and can be used to silence gene expression.

[0108] As used herein, the term “microRNA” refers to noncoding RNA consisting of about 22 ribonucleotides which regulates gene expression in the post transcriptional stage by silencing messenger RNA by base-pairing with a complementary sequence in its targeted mRNA.

[0109] The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues and optionally one or more post-translational modifications (e.g., glycosylation) and / or other modifications known in the art. A polypeptide can be a chain of at least three amino acids, a protein, a recombinant protein, an antigen, an epitope, an enzy me, a receptor, or a structure analogue or combinations thereof. As used herein, the abbreviations for the L-enantiomeric amino acids that form a polypeptide are as follows: alanine (A, Ala); arginine (R, Arg); asparagine (N, Asn); aspartic acid (D, Asp); cysteine (C,Attorney Docket No. 061529-516001WOCys); glutamic acid (E, Glu); glutamine (Q, Gin); glycine (G, Gly); histidine (H, His); isoleucine (I. He); leucine (L, Leu); lysine (K, Lys); methionine (M. Met); phenylalanine (F, Phe); proline (P, Pro); serine (S, Ser); threonine (T, Thr); tryptophan (W, Trp); tyrosine (Y, Tyr); valine (V, Vai). X or Xaa can indicate any amino acid.

[0110] As used herein, the term “detectable” refers to an occurrence of, or a change in, a signal that is directly or indirectly detectable either by observation or by instrumentation. Typically, a detectable response is an occurrence of a signal wherein the fluorophore is inherently fluorescent and does not produce a change in signal upon binding to a metal ion or biological compound. Alternatively, the detectable response is an optical response resulting in a change in the wavelength distribution patterns or intensity' of absorbance or fluorescence or a change in light scatter, fluorescence lifetime, fluorescence polarization, or a combination of the above parameters. Other detectable responses include, for example, chemiluminescence, phosphorescence, radiation from radioisotopes, magnetic attraction, and electron density.[OHl] The term “engineered,” as used herein, generally refers to polynucleotides, vectors, and nucleic acid constructs that have been genetically designed and manipulated to provide a polynucleotide intracellularly. An engineered polynucleotide can be partially or fully synthesized in vitro. An engineered polynucleotide can also be cloned. An engineered polyribonucleotide can contain one or more base or sugar analogues, such as ribonucleotides not naturally-found in messenger RNAs. An engineered polyribonucleotide can contain nucleotide analogues that exist in transfer RNAs (tRNAs). ribosomal RNAs (rRNAs), guide RNAs (gRNAs), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), SmY RNA, spliced leader RNA (SL RNA), CRISPR RNA, long untranslated RNA (IncRNA), microRNA (miRNA), or another suitable RNA.

[0112] As used herein, the term “gene-editing system” refers to a DNA or RNA editing system that comprises one or more guide RNA elements and one or more RNA-guided endonuclease elements. The guide RNA element comprises a target RNA comprising a nucleotide sequence substantially complementary to a nucleotide sequence at the one or more target genomic regions or a nucleic acid comprising a nucleotide sequence(s) encoding the target RNA. The RNA-guided endonuclease element comprises an endonuclease that is guided or brought to a target genomic region(s) by a guide RNA element or a nucleic acid comprising a nucleotide sequence(s) encoding such endonuclease.

[0113] The terms “identity,” “identical,” and “sequence identity” refer to the extent to which two optimally aligned polynucleotides or polypeptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. “Identity” can readilyAttorney Docket No. 061529-516001WObe calculated by known methods, including, but not limited to, those described in Needleman and Wunsch. J. Mol. Biol. 48:443 (1970), as such one polynucleotide or polypeptide sequence has a certain percentage of sequence identity compared to another polynucleotide or polypeptide sequence. The term “percent sequence identity7”, “percent identity”, or “identical to” refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (“query”) polynucleotide molecule (or its complementary strand) as compared to a test (“subject”) polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, “percent identity” can refer to the percentage of identical amino acids in an amino acid sequence. For sequence comparison, one sequence acts as a reference sequence, to which test sequences are compared. The term “reference sequence” refers to a molecule to which a test sequence is compared. Methods of sequence alignment for comparison and determination of percent sequence identity are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443.

[0114] The term “isolated” when applied to a polynucleotide or polypeptide, denotes that the polynucleotide or polypeptide is essentially free of other cellular components with which it is associated in the natural state or components present during chemical synthesis. It can be, for example, in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high-performance liquid chromatography. A polynucleotide or polypeptide that is the predominant species present in a preparation is substantially purified.

[0115] As used herein, the term “lipid composition” generally refers to a composition comprising lipid compound(s), including but not limited to, a lipoplex, a liposome, a lipid particle. Example of lipid compositions include suspensions, emulsions, and vesicular compositions.

[0116] The term “administering” refers to providing a composition to a subject in a manner that permits the composition to have its intended effect. Administration may be performed by intramuscular injection, intravenous injection, intraperitoneal injection, inhalation, or any other suitable route.

[0117] The term “assemble” or “assembled,” as used herein, in context of delivery’ of a payload to target cell(s) generally refers to covalent or non-covalent interaction(s) or association(s), for example, such that a therapeutic or prophylactic agent be complexed with or encapsulated in a lipid composition.Attorney Docket No. 061529-516001WO

[0118] “Co-administer” means that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies. The compositions provided herein can be administered alone or can be co-administered to the subject. Co-administration is meant to include simultaneous or sequential administration of the compounds individually or in combination. Thus, the preparations can also be combined, when desired, with other active substances (e.g., to reduce degradation of an LNP or the pay load of the LNP).

[0119] As used herein, the term "delivering" means causing, through chemical or biophysical properties of a composition (e.g., an LNP composition) and / or the payload (e.g.. a polynucleotide) of an LNP to pass from a site of administration to a subject to a target organ (e.g., the lung, liver, heart, or spleen), target tissue, or target cell. In some cases, “delivering'’ is equivalent to “administering”, e.g., to a subject in need thereof. As used herein, the term “selectively delivering” refers to the delivery to a target organ, tissue, or cell at a greater rate or in a greater amount than delivered to a reference, non-target organ, tissue, or cell, or that a greater fraction of total the amount of LNP or pay load administered to a subject is delivered to a target organ, tissue, or cell by the composition than delivered by a reference composition. For example, selective delivery may mean that at least 25% (e.g.. at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%) of the total amount administered is delivered to the target organ, tissue, or cell. “Selective delivery” is determined by comparing the fraction of an LNP composition or payload that is delivered to a target organ (e.g, the lung, liver, heart, or spleen) by an LNP composition comprises a selected lipid (e.g., SORT lipid) compared to a reference LNP composition in which the selected lipid is replaced by a control lipid.

[0120] The term “expression” includes any step involved in the production of the polypeptide including, but not limited to. transcription, post-transcriptional modification, translation, post-translational modification, and secretion. Expression can be detected using conventional techniques for detecting protein (e.g., ELISA, Western blotting, flow cytometry, immunofluorescence, PCR, and immunohistochemistry).

[0121] As used herein, the term “patient” or “subject” refers to a living mammalian organism, such as a human, monkey, cow. sheep, goat, dog, cat, mouse, rat. guinea pig, or transgenic species thereof. In certain embodiments, the patient or subject is a primate (e.g., non-human primate). In certain embodiments, the patient or subject is a human. Non-limiting examples of human subjects are adults, juveniles, infants and fetuses.

[0122] The term “pharmaceutically acceptable excipients” and “pharmaceutically acceptable carrier” refer to a substance that aids the administration of a herein-disclosed composition andAttorney Docket No. 061529-516001WOabsorption by a subject of the same. Pharmaceutically acceptable excipients do not cause a significant adverse toxicological effect on the subject. These excipients are usually approved by a regulatory agency of the Federal or a state government or listed in the U. S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. Non-limiting examples of pharmaceutically acceptable excipients include water, a sodium chloride (NaCl) solution, normal saline solutions, lactated Ringer’s, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethy cellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and / or aromatic substances and the like that do not deleteriously react with the compounds of the disclosure. One of skill in the art will recognize that other pharmaceutically acceptable excipients are useful in the present disclosure.

[0123] “Prevention” or “preventing” refers to inhibiting the onset of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, and / or delaying the onset of the pathology or symptomatology' of a disease in a subject or patient which may be at risk and / or predisposed to the disease but has not yet experienced or displayed any of the pathology or symptomatology of the disease. Prevention may be complete (no detectable symptoms) or partial, such that fewer symptoms are observed than would likely occur absent treatment.

[0124] As used herein, the term “ratio” generally refers to the relative amount of one or more molecules to another molecule(s). Non-limiting examples of the ratio(s) include molar ratio(s), weight ratio(s). or mass ratio(s).

[0125] The terms “subject” refers to a living organism to which any of the compositions as described herein may be administered. The subject may be suffering from or be at risk for a disease or condition that can be treated by administration of pharmaceutical composition as provided herein or by a therapeutic method disclosed herein. Non-limiting examples of subjects include humans, other mammals, bovines. rats, mice, dogs, monkey’s, goat, sheep, cows, deer, and other non-mammalian animals. In some embodiments, the subject is a primate, e.g., a human.

[0126] The term “therapeutically effective amount,” as used herein, refers to an amount of an LNP and / or an LNP comprising a therapeutic agent sufficient to treat a disease, a disorder, or a condition. For example, with regard to the use of LNPs with mRNA payload to treat e.g..Attorney Docket No. 061529-516001WOcystic fibrosis (CF) or primary ciliary dyskinesia (PCD), a therapeutically effective amount is the dosage or concentration of the LNP and / or the LNP comprising the mRNA (e.g, CFTR or PCD mRNA) capable of eradicating, inhibiting, preventing, slowing down the progression of all or part of e.g., CF or PCD respiratory symptoms or some combination thereof. For the given parameter, a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%. 25%. 40%. 50%, 60%, 75%, 80%, 90%, or at least 100% of symptoms in a subject in need. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control. The “therapeutically effective amount” can vary depending, for example, but not limited to, on the compound, the disease, or the condition and / or symptoms thereof, severity of the disease or the condition and / or symptoms thereof, the age, weight, and / or health of the subject to be treated, and the judgment of the prescribing physician. An appropriate amount in any given instance can be ascertained by those skilled in the art or capable of determination by routine experimentation.

[0127] “Treating” or “treatment” as used herein (and as well-understood in the art) also broadly includes any approach for obtaining beneficial or desired results in a subject’s condition, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of the extent of a disease, stabilizing (i.e., not worsening) the state of disease, prevention of a disease’s transmission or spread, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission, whether partial or total and whether detectable or undetectable. In other words, "treatment" as used herein includes any cure, amelioration, or prevention of a disease. Treatment may prevent the disease from occurring; inhibit the disease's spread; relieve the disease’s symptoms, fully or partially remove the disease’s underlying cause, shorten a disease’s duration, or do a combination of these things.

[0128] The term “variant” refers to a polypeptide or polynucleotide having one or more insertions, deletions, or amino acid substitutions relative to a reference polypeptide or polynucleotide.

[0129] Chemical moieties referred to as univalent chemical moieties (e g., alkyl, aryl, etc.) also encompass structurally permissible multivalent moieties, as understood by those skilled in the art. For example, while an “alkyl” moiety generally refers to a monovalent radical (e.g., CH3CH2-), in appropriate circumstances an “alkyl” moiety can also refer to a divalent radical (e.g., -CH2CH2-, which is equivalent to an “alkylene” group). Similarly, under circumstancesAttorney Docket No. 061529-516001WOwhere a divalent moiety is required, those skilled in the art will understand that the term “aryl” refers to the corresponding divalent arylene group.

[0130] As used herein, “Alkyl” refers to optionally substituted, straight and branched chain aliphatic groups having from 1 to 30 carbon atoms. For example, “Ci, C2, C3, C4, C5 or Ce alkyd”, “Ci-C6alkyl”, “alkyl(C<6)”, or “alkyl(Cl-C6)”, is intended to include Ci, C2, C3, C4, C5 or Ce straight chain (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5 or Ce branched saturated aliphatic hydrocarbon groups. Examples of alkyd include, moieties having from one to six carbon atoms, such as, but not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n-hexyl. In some embodiments, a straight chain or branched alkyl has six or fewer carbon atoms (e.g., C i-Ce for straight chain, C3-Ce for branched chain), and in another embodiment, a straight chain or branched alkyl has four or fewer carbon atoms. Analogously, for example “Cis, C19, C20, C21, C22, C23or C24alkyl”, “C18-C24 alkyl”, “alkyl(C<24)”, or “alkyl(C8-C24)” is intended to include Cis, C19, C2o, C21, C22, C23or C24straight chain (linear) saturated aliphatic hydrocarbon groups and Cis, C19, C2o, C21, C22, C23or C24 branched saturated aliphatic hydrocarbon groups. Examples of “Ci8-C24 alkyl” include octadecyl, nonadecyl, didecyl, henicosyl, docosyl, tricosyl, tetracosyl, 5-butylpentadecanyl, 4-methyl-5-(pentan-2-yl)hexadecanyl, 7-methylhenicosanyl, 2,15,15-trimethylhenicosanyl, 8,9-dimethyldocosanyl, 6-ethyl-8-methylnonadecanyl, and 6,7-dimethyl-8-propyltridecanyl.

[0131] “Alkenyl” includes unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double bond. For example, the term “alkenyl” includes straight chain alkenyl groups e.g., ethenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl), and branched alkenyl groups. The term “C2, C3, C4, C5or C6alkenyl,” “C2-C6alkenyl,” “alkenyl(C<6)”, or “alkenyl(C2-C6)” includes alkenyl groups containing two to six carbon atoms. The term “Cs, C9, C10, Cn, C12, C13, Ci4, C15, Ci6, Cn, Cis, Ci9, C20, C21, C22, C23or C24 alkenyl,” “C8-C24 alkenyl,” or “alkenyl(C8-C24)” includes alkenyl groups containing eight to twenty-four carbon atoms. Examples of “C8-C24 alkenyl” include 2,6-dimethylhept-2-enyl, 2,6-dimethylhept-2-enyl, 2,8-dimethylnon-2-enyl, 2,7-dimethyldec-2-ene, 3-ethyl-8-methylundec-3-ene, and 2,9,9-trimethyltridec-2-ene.

[0132] The term “optionally substituted alkyl” or “optionally substituted alkenyl” refers to an alkyl or alkenyl having designated substituents replacing one or more hydrogen atoms on one or more hydrocarbon backbone carbon atoms. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl.Attorney Docket No. 061529-516001WOalkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0133] The term “alkynyl” when used without the '“substituted” modifier refers to a monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, at least one carbon-carbon triple bond, and no atoms other than carbon and hydrogen. As used herein, the term alkynyl does not preclude the presence of one or more non-aromatic carbon-carbon double bonds. The groups -C=CH, -C=CCHs, and - CH2C=CCH3 are non-limiting examples of alkynyl groups. An “alkyne” refers to the class of compounds having the formula H-R, wherein R is alkynyl. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2. -CO2H, -CO2CH3, -CN, -SH, -OCH3. -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2. -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH. or -S(O)2NH2.

[0134] The term “aryl” when used without the “substituted” modifier refers to a monovalent unsaturated aromatic group with an aromatic carbon atom as the point of attachment, said carbon atom forming part of a one or more six-membered aromatic ring structure, wherein the ring atoms are all carbon, and wherein the group consists of no atoms other than carbon and hydrogen. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. Non-limiting examples of aryl groups include phenyl (Ph), methylphenyl, (dimethyl)phenyl, -C6H4CH2CH3 (ethylphenyl), naphthyl, and a monovalent group derived from biphenyl. The term “arenediyl” when used without the “substituted” modifier refers to a divalent aromatic group with two aromatic carbon atoms as points of attachment, said carbon atoms forming part of one or more six-membered aromatic ring structure(s) wherein the ring atoms are all carbon, and wherein the monovalent group consists of no atoms other than carbon and hydrogen. As used herein, the term does not preclude the presence of one or more alkyl, aryl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl.Attorney Docket No. 061529-516001WOor alkenediyl groups (carbon number limitation permitting). Non-limiting examples of arenediyl groups include:An “arene’' refers to the class of compounds having the formula H-R, wherein R is aryl as that term is defined above. Benzene and toluene are non-limiting examples of arenes. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, C(O)NHCH3, C(O)N(CH3)2, OC(O)CH3, NHC(O)CH3, S(O)2OH or S(O)2NH2.

[0135] The term “aralkyl” when used without the “substituted” modifier refers to the monovalent group -alkanediyl-aryL in which the terms alkanediyl and aryl are each used in a manner consistent with the definitions provided above. Non-limiting examples are: phenylmethyl (benzyl, Bn) and 2-phenyl-ethyl. When the term aralkyl is used with the “substituted” modifier one or more hydrogen atom from the alkanediyl and / or the aryl group has been independently replaced by -OH. -F. -Cl, -Br, -I. -NH2, -NO2, -CO2H. -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or-S(O)2NH2. Nonlimiting examples of substituted aralkyls are: (3-chlorophenyl)-methyl, and 2-chloro-2-phenyl-eth-l-yl.

[0136] The term “heteroaryl” when used without the “substituted” modifier refers to a monovalent aromatic group with an aromatic carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heteroaryl group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. Heteroaryl rings may contain 1, 2, 3, or 4 ring atoms selected from are nitrogen, oxygen, and sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Non-limiting examples of heteroaryl groups include furanyl, imidazolyl,Attorney Docket No. 061529-516001WOindolyl, indazolyl (Im), isoxazolyl, methylpyridinyl, oxazolyl, phenylpyridinyl, pyridinyl (pyridyl), pyrrolyl, pyrimidinyl, pyrazinyl, quinolyl, quinazolyl, quinoxalinyl, triazinyl, tetrazolyl, thiazolyl, thienyl, and triazolyl. The term “A-heteroaryl” refers to a heteroaryl group with a nitrogen atom as the point of attachment. The term ‘'heteroarenediyl” when used without the “substituted’' modifier refers to an divalent aromatic group, with two aromatic carbon atoms, two aromatic nitrogen atoms, or one aromatic carbon atom and one aromatic nitrogen atom as the two points of attachment, said atoms forming part of one or more aromatic ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Nonlimiting examples of heteroarenediyl groups include:

[0137] A “heteroarene” refers to the class of compounds having the formula H-R, wherein R is heteroaryl. Pyridine and quinoline are non-limiting examples of heteroarenes. When these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2.

[0138] The term “heterocycloalkyl” when used without the “substituted” modifier refers to a monovalent non-aromatic group with a carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more non-aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heterocycloalkyl group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. Heterocycloalkyl rings may contain 1, 2, 3, or 4 ring atoms selected from nitrogen, oxygen, or sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resultingAttorney Docket No. 061529-516001WOgroup remains non-aromatic. Non-limiting examples of heterocycloalkyl groups include aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl. morpholinyl, thiomorpholinyl, tetrahydrofuranyl, tetrahydrothiofuranyl, tetrahydropyranyl, pyranyl, oxiranyl, and oxetanyl. The term “7V-heterocycloalkyl” refers to a heterocycloalkyl group with a nitrogen atom as the point of attachment. N-pyrrolidinyl is an example of such a group. The term “heterocycloalkanediyl” when used without the ‘‘substituted” modifier refers to an divalent cyclic group, with two carbon atoms, two nitrogen atoms, or one carbon atom and one nitrogen atom as the two points of attachment, said atoms forming part of one or more ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non-limiting examples of heterocycloalkanediyl groups include:

[0139] When these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN. -SH. -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3. -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2.

[0140] The term “acyl” when used without the “substituted” modifier refers to the group -C(O)R, in which R is a hydrogen, alkyl, cycloalkyl, alkenyl, aryl, aralkyl or heteroaryl, as those terms are defined above. The groups, -CHO, -C(O)CH3 (acetyl, Ac), -C(O)CH2CH3, -C(O)CH2CH2CH3, -C(O)CH(CH3)2, -C(O)CH(CH2)2, -C(O)C6H5, -C(O)C6H4CH, -C(O)CH2CeH5, -C(O)(imidazolyl) are non-limiting examples of acyl groups. A “thioacyl” is defined in an analogous manner, except that the oxygen atom of the group -C(O)R has been replaced with a sulfur atom, -C(S)R. The term “aldehyde” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a -CHO group. When any of these terms are used with the “substituted” modifier one or more hydrogen atomAttorney Docket No. 061529-516001WO(including a hydrogen atom directly attached to the carbon atom of the carbonyl or thiocarbonyl group, if any) has been independently replaced by -OH. -F, -Cl. -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(0)CH3, — S(O)2OH or — S(O)2NH2. The groups, -C(O)CH2CF3, -CO2H (carboxyl), -CO2CH3 (methylcarboxyl), -CO2CH2CH3, -C(0)NH2 (carbamoyl), and -CON(CH3)2. are non-limiting examples of substituted acyl groups.

[0141] The term “alkoxy” when used without the “substituted” modifier refers to the group -OR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: OCH3 (methoxy), OCH2CH3 (ethoxy), OCH2CH2CH3, OCH(CH3)2 (isopropoxy), - OC(CH3)3(7m-butoxy). -OCH(CH2)2, -Q-cyclopentyl. and -O-cyclohexyl. The terms “cycloalkoxy”, “alkenyloxy”, “alkynyloxy”, “aryloxy”, “aralkoxy”, “heteroaryl oxy”, “heterocycloalkoxy”, and “acyloxy”, when used without the “substituted” modifier, refers to groups, defined as -OR, in which R is cycloalkyl, alkenyl, alkynyl, ary l, aralkyl, heteroaryl, heterocycloalkyl, and acyl, respectively. The term “alkoxydiyl” refers to the divalent group -O-alkanediyl-, -O-alkanediyl-O-, or -alkanediyl-O-alkanediyl- The term “alkylthio” and “acylthio” when used without the “substituted” modifier refers to the group -SR, in which R is an alkyd and acyl, respectively. The term “alcohol” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a hydroxy group. The term “ether” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with an alkoxy group. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by OH, F, Cl, Br, I, NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3. -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3. -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH. or -S(O)2NH2.

[0142] The term “alkylamino” when used without the “substituted” modifier refers to the group -NHR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: -NHCH3 and -NHCH2CH3. The term “dialkylamino” when used without the “substituted” modifier refers to the group -NRR'. in which R and R' can be the same or different alkyl groups, or R and R' can be taken together to represent an alkanediyl. Nonlimiting examples of dialkylamino groups include: -N(CHs)2 and -N(CHs)(CH2CH3). The terms “cycloalkylamino”, “alkenylamino”, “alkynylamino”, “arylamino”, “aralkyl amino”, “heteroarylamino”, “heterocycloalkylamino”, “alkoxyamino”, and “alkylsulfonylamino” when used without the “substituted” modifier, refers to groups, defined as -NHR, in which R isAttorney Docket No. 061529-516001WOcycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, alkoxy, and alkylsulfonyl, respectively. A non-limiting example of an arylamino group is -NHCeHs. The term "alkylaminodiyl” refers to the divalent group -NH-alkanediyl-, -NH-alkanediyl-NH-, or -alkanediyl-NH-alkanediyl- The term '‘amido” (acylamino), when used without the “substituted” modifier, refers to the group -NHR, in which R is acyl, as that term is defined above. A non-limiting example of an amido group is -NHC(O)CH3. The term “alkylimino” when used without the “substituted” modifier refers to the divalent group =NR, in which R is an alkyl, as that term is defined above. When any of these terms is used with the '‘substituted” modifier one or more hydrogen atom attached to a carbon atom has been independently replaced by OH, F, Cl, Br, I, NH2, NO2, CO2H, CO2CH3, CN, SH, OCH3, -OCH2CH3, -C(O)CH3, -NHCH3. -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2. The groups -NHC(O)OCH3and -NHC(O)NHCH3are non-limiting examples of substituted amido groups.Cystic fibrosis transmembrane conductance regulator (CFTR)

[0143] Cystic fibrosis transmembrane conductance regulator (CFTR) is a membrane protein and chloride channel in vertebrates encoded by the CFTR gene. CFTR gene is on the long arm of chromosome 7, at position q31.2. Mutations of the CFTR gene affecting chloride ion channel function led to dysregulation of epithelial fluid transport in the lung, pancreas and other organs, resulting in cystic fibrosis (CF).

[0144] Cystic fibrosis (CF) affects approximately one in every 2,500 infants in the United States. Within the general United States population, up to 10 million people carry a single copy of the defective gene without apparent ill effects. In contrast, individuals with two copies of the CF associated gene suffer from the debilitating and fatal effects of CF, including chronic lung disease. Complications of cystic fibrosis include thickened mucus in the lungs with frequent respiratory infections, and pancreatic insufficiency giving rise to malnutrition and diabetes. These conditions lead to chronic disability’ and reduced life expectancy. In male patients, the progressive obstruction and destruction of the developing vas deferens (spermatic cord) and epididymis appear to result from abnormal intraluminal secretions, causing congenital absence of the vas deferens and male infertility’.

[0145] So far, nearly 1000 cystic fibrosis-causing mutations have been described. Many mutations are infrequent. The distribution and frequency of mutations varies among different populations. Mutations consist of replacements, duplications, deletions, or shortenings in the CFTR gene. This may result in dysfunctional proteins which have less activity, are more quickly degraded or present in inadequate numbers. The most common mutation, DeltaF508Attorney Docket No. 061529-516001WO(AF508) results from a deletion (A) of three nucleotides which results in a loss of the amino acid phenylalanine (F) at the 5O8th position on the protein. As a result, the protein does not fold normally and is more quickly degraded.Payloads

[0146] The present disclosure contemplates delivery of various payloads useful in the treatment of a lung disease. Payloads comprise therapeutic polypeptides or polynucleotides encoding polypeptides. For example, the payload may be a polynucleotide encoding a gene related to lung disease, or a polynucleotide encoding a gene editor for editing a gene related to lung disease.

[0147] In some embodiments, lipid nanoparticle compositions described herein further comprise a payload. In some embodiments, the payload comprises a polypeptide or a protein. In some embodiments, the payload comprises a small interfering RNA (siRNA). In some embodiments, the payload comprises an mRNA. In some embodiments, the mRNA encodes a gene editing system of component thereof. In some embodiments the gene editing system of component thereof comprises a cluster regularly interspaced short palindromic repeats (CR1SPR) related nucleic acid, a single guide RNA (sgRNA), a CR1SPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), and a guide RNA.Polypeptides

[0148] In some embodiments, the disclosure provides polypeptides comprising one or more therapeutic proteins. Therapeutic proteins comprise, but are not limited to cytokines, chemokines, interleukins, interferons, growth factors, coagulation factors, anti-coagulants, blood factors, bone morphogenic proteins, immunoglobulins, or enzy mes. Some non-limiting examples of particular therapeutic proteins include Erythropoietin (EPO), Granulocyte colonystimulating factor (G-CSF), Alpha-galactosidase A, Alpha-L-iduronidase, Thyrotropin a, N-acetylgalactosamine-4-sulfatase (rhASB), Domase alfa, Tissue plasminogen activator (TP A) Activase, Glucocerebrosidase, Interferon (IF) b-la, Interferon b-lb, Interferon gamma, Interferon alpha, TNF-alpha, IL-1 through IL-36, Human growth hormone (rHGH), Human insulin (BHI), Human chorionic gonadotropin a, Darbepoetin a, Follicle-stimulating hormone (FSH), and Factor VIII.

[0149] In some embodiments, the polypeptide comprises a peptide or protein that restores the function of a defective protein in a subject. For example, the polynucleotide encodes a cystic fibrosis transmembrane conductance regulator (CFTR) protein, Dynein axonemal heavy chain 5, Dynein axonemal heavy chain 11, Bone morphogenetic protein receptor type 2, Fumarylacetoacetate hydrolase. Phenylalanine hydroxylase, Alpha-L-iduronidase, CollagenAttorney Docket No. 061529-516001WOtype IV alpha 3 chain, Collagen type IV alpha 4 chain, Collagen type IV alpha 5 chain, Poly cystin 1, Polycystin 2, Fibrocystin (or poly ductin), Solute earner family 3 member 1, Solute carrier family 7 member 9, Paired box gene 9, Myosin VIIA, Cadherin related 23, Usherin, Clarin 1, Gap junction beta-2 protein, Gap junction beta-6 protein, Rhodopsin, dystrophia myotonica protein kinase, Dy strophin, Sodium voltage-gated channel alpha subunit 1, Sodium voltage-gated channel beta subunit 1, Coagulation factor VIII, Coagulation factor IX, N-glycanase 1, Palmitoyl-protein thioesterase 1. Tripeptidyl peptidase l. Kvl 1.1 (alpha subunit of potassium ion channel), Palmitoyl-protein thioesterase 1, ATM serine / threonine kinase, or Fibrillin 1.Polynucleotides

[0150] In some embodiments, the lipid composition described herein comprises one or more polynucleotides. In some embodiments, the polynucleotides encode for one or more polypeptides described herein.

[0151] Exemplary nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (ENAs, including ENA having a P-D-ribo configuration, a-ENA having an a-E-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino-a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof.

[0152] In addition, it should be clear that the present disclosure is not limited to the specific polynucleotides disclosed herein. The present disclosure is not limited in scope to any particular source, sequence, or type of polynucleotides, however, as one of ordinary skill in the art could readily identify related homologs in various other sources of the polynucleotides including polynucleotides from non-human species (e.g, mouse, rat, rabbit, dog, monkey, gibbon, chimp, ape, baboon, cow, pig, horse, sheep, cat and other species). It is contemplated that the polynucleotides used in the present disclosure can comprise a sequence based upon a naturally -occurring sequence. Allowing for the degeneracy of the genetic code, sequences that have at least about 50%, usually at least about 60%. more usually about 70%, most usually about 80%, preferably at least about 90% and most preferably about 95% of nucleotides that are identical to the nucleotide sequence of the naturally-occurring sequence. In some embodiments, the polynucleotide is a complementary' sequence to a naturally occurring sequence, or complementary to at least 75%, at least 80%, at least 85%, at least 90%, at leastAttorney Docket No. 061529-516001WO95% and 100%. Longer polynucleotides encoding 250, 500, 1000, 1212, 1500, 2000, 2500, 3000 or longer are contemplated herein.

[0153] In some embodiments, the polynucleotide used herein may be derived from genomic DNA, i.e., cloned directly from the genome of a particular organism. In some embodiments, the polynucleotide comprises complementary' DNA (cDNA). Also contemplated is a cDNA plus a natural intron or an intron derived from another gene; such engineered molecules are sometime referred to as "‘mini -genes”. The term "“cDNA” is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy.

[0154] In some embodiments, the polynucleotide comprises one or more segments comprising a small interfering ribonucleic acid (siRNA), a short hairpin RNA (shRNA), a micro-ribonucleic acid (miRNA), a primary micro-ribonucleic acid (pri-miRNA), a long noncoding RNA (IncRNA), a messenger ribonucleic acid (mRNA), a plasmid deoxyribonucleic acid (pDNA), a transfer ribonucleic acid (tRNA), an antisense oligonucleotide (ASO), an antisense ribonucleic acid (RNA), a guide ribonucleic acid, deoxyribonucleic acid (DNA), a double stranded deoxyribonucleic acid (dsDNA), a single stranded deoxyribonucleic acid (ssDNA), a single stranded ribonucleic acid (ssRNA), a or double stranded ribonucleic acid (dsRNA). In some embodiments, the polynucleotide encodes at least one of the therapeutic agent (or prophylactic agent) described herein.

[0155] In some embodiments, the polynucleotide is greater than 30 nucleotides, greater than 50 nucleotides, greater than 100 nucleotides, greater than 200 nucleotides, greater than 300 nucleotides, greater than 400 nucleotides, greater than 500 nucleotides, greater than 600 nucleotides, greater than 700 nucleotides, greater than 800 nucleotides, greater than 900 nucleotides, greater than 1000 nucleotides, greater than 1500 nucleotides, greater than 2000 nucleotides, greater than 2500 nucleotides, greater than 3000 nucleotides, greater than 3500 nucleotides, greater than 4000 nucleotides, greater than 4500 nucleotides, or greater than 5000 nucleotides in length.

[0156] In some embodiments, the mRNA is about 50 nucleotides in length. In some embodiments, the mRNA molecule is about 100 nucleotides in length. In some embodiments, the mRNA molecule is about 200 nucleotides in length. In some embodiments, the mRNAAttorney Docket No. 061529-516001WOmolecule is about 300 nucleotides in length. In some embodiments, the mRNA molecule is about 400 nucleotides in length. In some embodiments, the mRNA molecule is about 500 nucleotides in length. In some embodiments, the mRNA molecule is about 600 nucleotides in length. In some embodiments, the mRNA molecule is about 700 nucleotides in length. In some embodiments, the mRNA molecule is about 800 nucleotides in length. In some embodiments, the mRNA molecule is about 900 nucleotides in length. In some embodiments, the mRNA molecule is about 1000 nucleotides in length. In some embodiments, the mRNA molecule is about 2000 nucleotides in length. In some embodiments, the mRNA molecule is about 3000 nucleotides in length. In some embodiments, the mRNA molecule is about 4000 nucleotides in length. In some embodiments, the mRNA molecule is about 5000 nucleotides in length.

[0157] In some embodiments, the polynucleotide comprises about 50 to about 100000 nucleotides. In some embodiments, the polynucleotide comprises about 50 to about 5000 nucleotides. In some embodiments, the polynucleotide comprises about 50 to about 2500 nucleotides. In some embodiments, the polynucleotide comprises about 50 to about 1000 nucleotides. In some embodiments, the polynucleotide comprises about 50 to about 500 nucleotides. In some embodiments, the polynucleotide comprises about 50 to about 300 nucleotides. In some embodiments, the polynucleotide comprises about 50 to about 200 nucleotides. In some embodiments, the polynucleotide comprises about 50 to about 100 nucleotides. In some embodiments, the polynucleotide comprises about 100 to about 100000 nucleotides. In some embodiments, the polynucleotide comprises about 100 to about 5000 nucleotides. In some embodiments, the polynucleotide comprises about 100 to about 2500 nucleotides. In some embodiments, the polynucleotide comprises about 100 to about 1000 nucleotides. In some embodiments, the polynucleotide comprises about 100 to about 500 nucleotides. In some embodiments, the polynucleotide comprises about 100 to about 300 nucleotides. In some embodiments, the polynucleotide compnses about 100 to about 200 nucleotides. In some embodiments, the polynucleotide comprises about 500 to about 100000 nucleotides. In some embodiments, the polynucleotide comprises about 500 to about 5000 nucleotides. In some embodiments, the polynucleotide comprises about 500 to about 2500 nucleotides. In some embodiments, the polynucleotide comprises about 500 to about 1000 nucleotides. In some embodiments, the polynucleotide comprises about 1000 to about 100000 nucleotides. In some embodiments, the polynucleotide comprises about 1000 to about 5000 nucleotides. In some embodiments, the polynucleotide comprises about 1000 to about 2500 nucleotides. In some embodiments, the polynucleotide comprises about 1000 to about 2000 nucleotides.Attorney Docket No. 061529-516001WO

[0158] In some embodiments, the LNP composition comprises mRNA at a lipid:mRNA (weight / weight) ratio is between 5:1 and 40:1. In some embodiments, the LNP comprises mRNA at a lipid:mRNA ratio between 10:1 and 40:1, between 15:1 and 40:1, between 20:1 and 40:1, between 25:1 and 40:1, between 30:1 and 40:1, between 35:1 and 40:1, between 20:1 and 35:1, between 25:1 and 35:1, between 30:1 and 35:1, between 20:1 and 30:1, between 25:1 and 30:1, between 20:1 and 25:1, between 25:1 and 30:1, between 25:1 and 35:1, between 20:1 and 36: 1. between 25: 1 and 36: 1, betw een 5: 1 and 45: 1. between 20: 1 and 40: 1, between 25: 1 and 40:1, between 35:1 and 40:1, or between 30: 1 and 40:1. In some embodiments, the LNP comprises mRNA at a lipid:mRNA ratio of 30:1. In some embodiments, the LNP comprises mRNA at a lipid:mRNA ratio of 40: 1.

[0159] In some embodiments, the mRNA encodes a gene or a portion of a gene related to lung disease shown in Table SI or Table S2.

[0160] It is understood that T is T in DNA and T is U in RNA polynucleotide sequences.Table SI. Examples of genes related to lung diseasesLung disease Related GenesCystic fibrosis CFTRPrimary Ciliary Dyskinesia ARMC4, CCDC114, CCDC39, CCDC40, DNAAF1, DNAAF2, DNAAF3, DNAAF4. DNAH11, DNAH5, (PCD)DNAI1, DNAI2, LRRC6, LRRC50, RSPH1, RSPH4A, SPAG1, ZMYND10alpha- 1 antitrypsin deficiency AATpulmonary' arterial hypertension BMPR2 (Bone morphogenetic protein receptor type 2) Lung disease disorders MUC5bChronic Obstructive Pulmonary- Upregulated genes strongly associated wdth COPD: Disease (COPD)ADAMTS4 (aggrecanase-1), ANDPT2, BMPR1 B, BTG2, CEBPA, DKK3, Fas, FGFR2, FZD6, GLI1, HK2, HMGA1, HMGA2, IGF1R, IGF2, IL6-R, MMP2, MMP13. MMP26, MUC1, SFRP5, SGPL1,SMAD4, STAT3, TACSTD2, TNF, TNFAIP33 Table S2. Example sequences of genes related to lung diseasesSEQGene SequenceID NO CFTR GGGAGACCCAAGCTGGCTAGCGTTTAAACTTCAGCTTGGC 1 AATCCGGTACTGTTGGTAAAGCCACCATGCAGAGAAGCCC CCTGGAAAAGGCCAGCGTGGTGAGCAAGCTGTTCTTCAGC TGGACCCGGCCCATCCTGCGGAAGGGCTACAGACAGAGACTGGAACTGAGCGACATCTACCAGATCCCCAGCGTGGACAAttorney Docket No. 061529-516001WOSEQGene SequenceID NO GCGCCGACAACCTGAGCGAGAAGCTGGAAAGAGAGTGGG ACAGAGAGCTGGCCAGCAAGAAGAACCCCAAGCTGATCA ACGCCCTGCGGCGGTGCTTCTTCTGGCGGTTCATGTTCTAC GGCATCTTCCTGTACCTGGGCGAAGTGACCAAAGCCGTGC AGCCCCTGCTGCTGGGCAGAATCATCGCCAGCTACGACCC CGACAACAAAGAGGAACGGAGCATCGCCATCTACCTCGG CATCGGCCTGTGCCTGCTGTTCATCGTCAGAACCCTGCTG CTGCACCCCGCCATCTTCGGACTGCACCACATCGGCATGC AGATGCGGATCGCCATGTTCAGCCTGATCTACAAGAAAAC CCTGAAGCTGAGCAGCAGAGTGCTGGACAAGATCAGCAT CGGACAGCTGGTGAGCCTGCTGAGCAACAACCTGAACAA GTTCGACGAAGGCCTGGCCCTGGCCCACTTCGTGTGGATC GCCCCCCTGCAAGTGGCCCTGCTGATGGGCCTGATCTGGG AACTGCTGCAGGCCAGCGCCTTCTGCGGACTGGGATTCCT GATCGTGCTGGCCCTGTTCCAGGCCGGACTGGGGAGAATG ATGATGAAGTACCGGGACCAGAGAGCCGGCAAGATCAGC GAGAGACTGGTCATCACCAGCGAGATGATCGAGAACATC CAGAGCGTGAAGGCCTACTGCTGGGAAGAGGCCATGGAA AAGATGATCGAGAACCTGCGGCAGACCGAGCTGAAGCTG ACAAGAAAGGCCGCCTACGTGCGCTACTTCAACAGCAGC GCCTTCTTCTTCAGCGGCTTCTTCGTGGTGTTCCTGAGCGT GCTGCCCTACGCCCTGATCAAGGGCATCATCCTGAGAAAG ATCTTCACCACCATCAGCTTCTGCATCGTGCTGCGGATGG CCGTGACCAGACAGTTCCCCTGGGCCGTGCAGACCTGGTA CGACAGCCTGGGCGCCATCAACAAGATCCAGGACTTCCTG CAGAAGCAAGAGTACAAGACCCTCGAGTACAACCTGACC ACCACCGAGGTGGTCATGGAAAACGTGACCGCCTTCTGGG AGGAAGGCTTCGGCGAGCTGTTCGAGAAGGCCAAGCAGA ACAACAACAACCGCAAGACCAGCAACGGCGACGACAGCC TGTTCTTCAGCAACTTCAGCCTGCTGGGGACCCCCGTGCT GAAGGACATCAACTTCAAGATCGAGCGGGGACAGCTGCT GGCCGTGGCCGGAAGCACAGGCGCCGGAAAAACCAGCCT GCTCATGGTCATCATGGGCGAGCTGGAACCCAGCGAGGG CAAGATCAAGCACAGCGGCAGGATCAGCTTCTGCAGCCA GTTCAGCTGGATCATGCCCGGCACCATCAAAGAGAACATC ATCTTCGGCGTGAGCTACGACGAGTACAGATACCGCAGCG TGATCAAGGCCTGCCAGCTGGAAGAGGACATCAGCAAGT TCGCCGAGAAGGACAACATCGTGCTCGGCGAAGGCGGCA TCACACTGAGCGGCGGACAGAGGGCCAGAATCAGCCTGG CCAGAGCCGTGTACAAGGACGCCGACCTGTACCTGCTGGA CAGCCCCTTCGGCTACCTGGACGTGCTGACCGAGAAAGAG ATCTTCGAGAGCTGCGTGTGCAAGCTGATGGCCAACAAGA CCCGGATCCTGGTCACCAGCAAGATGGAACACCTGAAGA AGGCCGACAAGATCCTGATCCTGCACGAGGGCAGCAGCT ACTTCTACGGCACCTTCAGCGAGCTGCAGAACCTGCAGCC CGACTTCAGCAGCAAACTGATGGGCTGCGACAGCTTCGACCAGTTCAGCGCCGAGCGGAGAAACAGCATCCTGACAGAGAttorney Docket No. 061529-516001WOSEQGene SequenceID NO ACACTGCACCGGTTCAGCCTGGAAGGCGACGCCCCCGTGA GCTGGACCGAGACAAAGAAGCAGAGCTTCAAGCAGACCG GC GAGTTC GGCGAGAAGCGGAAGAAC AGC ATCCTGAACC CCATCAACAGCATCCGGAAGTTCAGCATCGTCCAGAAAAC CCCCCTGCAGATGAACGGCATCGAAGAGGACAGCGACGA GCCCCTGGAAAGACGGCTGAGCCTGGTGCCCGACAGCGA ACAGGGCGAAGCCATCCTGCCCCGGATCAGCGTGATCAG CACAGGCCCCACACTGCAGGCCCGGAGAAGGCAGAGCGT GCTGAACCTGATGACCCACAGCGTGAACCAGGGACAGAA CATCCACAGAAAGACCACCGCCAGCACACGGAAAGTGAG CCTGGCCCCCCAGGCCAACCTGACTGAGCTGGACATCTAC AGCAGACGGCTGAGCCAAGAGACAGGCCTGGAAATCAGC GAGGAAATCAACGAAGAGGACCTGAAAGAGTGCTTCTTC GACGACATGGAAAGCATCCCCGCCGTGACAACCTGGAAC ACCTACCTGCGGTACATCACCGTGCACAAGAGCCTGATCT TCGTGCTGATCTGGTGCCTCGTGATCTTCCTGGCCGAAGT GGCCGCCAGCCTGGTGGTGCTGTGGCTGCTCGGAAACACC CCACTGCAGGACAAGGGCAACAGCACCCACAGCCGGAAC AACAGCTACGCCGTGATCATCACCAGCACCAGCAGCTACT ACGTGTTCTACATCTACGTGGGCGTCGCCGACACTCTGCT CGCCATGGGCTTCTTCAGAGGACTGCCCCTGGTGCACACC CTGATCACCGTGAGCAAGATCCTGCACCACAAGATGCTGC ACAGCGTCCTGCAGGCCCCCATGAGCACACTGAACACCCT GAAAGCCGGCGGAATCCTGAACAGATTCAGCAAGGACAT CGCCATCCTGGACGACCTGCTGCCCCTGACCATCTTCGAC TTCATCCAGCTGCTGCTGATCGTGATCGGCGCCATCGCCG TGGTGGCCGTGCTGCAGCCCTACATCTTCGTGGCCACCGT GCCCGTGATCGTGGCCTTCATCATGCTGCGGGCCTACTTC CTGCAGACCAGCCAGCAGCTGAAGCAGCTCGAGAGCGAG GGCAGAAGCCCCATCTTCACCCACCTCGTGACCAGCCTGA AAGGCCTGTGGACCCTGAGAGCCTTCGGCAGACAGCCCTA CTTCGAGACACTGTTCCACAAGGCCCTGAACCTGCACACC GCCAACTGGTTCCTGTACCTGAGCACCCTGCGGTGGTTCC AGATGAGGATCGAGATGATCTTCGTCATCTTCTTCATCGC CGTGACCTTCATCAGCATCCTCACCACTGGCGAAGGCGAG GGCAGAGTGGGAATCATCCTGACCCTGGCCATGAACATCA TGAGCACACTCCAGTGGGCCGTGAACAGCAGCATCGACG TGGACAGCCTGATGCGGAGCGTGAGCCGGGTGTTCAAGTT CATCGACATGCCCACAGAGGGCAAGCCCACCAAGAGCAC CAAGCCCTACAAGAACGGCCAGCTGAGCAAAGTCATGAT CATCGAGAACAGCCACGTCAAGAAGGACGACATCTGGCC CAGCGGAGGCCAGATGACCGTGAAGGACCTGACCGCCAA GTACACCGAAGGCGGAAACGCCATCCTGGAAAACATCAG CTTCAGCATCAGCCCCGGCCAGCGCGTGGGACTCCTGGGA AGAACCGGAAGCGGCAAGAGCACTCTGCTGAGCGCCTTC CTGAGACTGCTGAACACCGAGGGCGAGATCCAGATCGACGGGGTGAGCTGGGACAGCATCACCCTGCAACAATGGCGGAttorney Docket No. 061529-516001WOSEQGene SequenceID NO AAGGCCTTCGGCGTGATCCCCCAGAAGGTGTTCATCTTCA GCGGCACGTTCCGGAAGAACCTGGACCCCTACGAGCAGT GGAGCGACCAAGAGATCTGGAAGGTGGCCGACGAAGTGG GACTGAGAAGCGTGATCGAGCAGTTCCCCGGCAAGCTGG ACTTCGTGCTGGTGGACGGCGGCTGCGTGCTGAGCCACGG ACACAAGCAGCTGATGTGCCTGGCCAGAAGCGTGCTGAG CAAGGCCAAGATCCTGCTGCTCGACGAGCCCAGCGCCCAC CTGGACCCCGTGACCTACCAGATCATCCGGCGGACACTGA AGCAGGCCTTCGCCGACTGCACCGTGATCCTGTGCGAGCA CAGAATCGAGGCCATGCTGGAATGCCAGCAGTTCCTGGTG ATCGAAGAGAACAAAGTGCGGCAGTACGACAGCATCCAG AAGCTGCTGAACGAGCGGAGCCTGTTCAGACAGGCCATC AGCCCCAGCGACAGAGTGAAGCTGTTCCCCCACCGGAAC AGCAGCAAGTGCAAGAGCAAGCCCCAGATCGCCGCCCTG AAAGAAGAAACCGAGGAAGAGGTGCAGGACACACGGCT GTGAGAATTCtgcagDNAI1 GGGAGACCCAAGCTGGCTAGCGTTTAAACTTCAGCTTGGC 2 AATCCGGTACTGTTGGTAAAGCCACCATGATCCCAGCAAG CGCCAAGGCACCACACAAGCAGCCCCACAAGCAGAGCAT CAGCATCGGCAGGGGCACAAGGAAGAGGGACGAGGACA GCGGAACCGAAGTGGGAGAGGGAACAGACGAGTGGGCA CAGAGCAAGGCAACCGTGCGCCCACCCGACCAGCTGGAG CTGACAGACGCCGAGCTGAAGGAGGAGTTCACCAGGATC CTGACAGCCAACAACCCACACGCCCCCCAGAACATCGTGC GCTACAGCTTCAAGGAGGGCACATACAAGCCAATCGGCTT CGTGAACCAGCTGGCCGTGCACTACACCCAAGTGGGCAA CCTGATCCCCAAGGACAGCGACGAGGGCCGGAGACAGCA CTACAGGGACGAGCTGGTGGCAGGAAGCCAGGAGAGCGT GAAAGTGATCAGCGAGACCGGCAACCTGGAGGAGGACGA GGAGCCAAAGGAGCTGGAGACCGAGCCAGGAAGCCAGAC AGACGTGCCCGCAGCAGGAGCAGCAGAGAAGGTGACCGA GGAGGAGCTGATGACACCCAAGCAGCCAAAGGAGCGGAA GCTGACCAACCAGTTCAACTTCAGCGAGAGAGCCAGCCA GACATACAACAACCCAGTGCGGGACAGAGAGTGCCAGAC CGAGCCACCCCCCAGAACCAACTTCAGCGCCACAGCCAA CCAGTGGGAGATCTACGACGCCTACGTGGAGGAGCTGGA GAAGCAGGAGAAGACCAAGGAGAAGGAGAAGGCCAAGA CACCCGTGGCCAAGAAGAGCGGCAAGATGGCCATGCGGA AGCTGACCAGCATGGAGAGCCAGACAGACGACCTGATCA AGCTGAGCCAGGCCGCCAAGATCATGGAGAGAATGGTGA ACCAGAACACCTACGACGACATCGCCCAGGACTTCAAGT ACTACGACGACGCAGCAGACGAGTACAGGGACCAAGTGG GCACACTGCTGCCCCTGTGGAAGTTCCAGAACGACAAGGC CAAGAGGCTGAGCGTGACCGCCCTGTGCTGGAACCCAAA GTACAGGGACCTGTTCGCAGTGGGATACGGAAGCTACGA CTTCATGAAGCAGAGCAGAGGCATGCTGCTGCTGTACAGCCTGAAGAACCCCAGCTTCCCCGAGTACATGTTCAGCAGCAAttorney Docket No. 061529-516001WOSEQGene SequenceID NO ACAGCGGCGTGATGTGCCTGGACATCCACGTGGACCACCC CTACCTGGTGGCCGTGGGCCACTACGACGGCAACGTGGCC ATCTACAACCTGAAGAAGCCCCACAGCCAGCCCAGCTTCT GCAGCAGCGCCAAGAGCGGCAAGCACAGCGACCCCGTGT GGCAGGTGAAGTGGCAGAAGGACGACATGGACCAGAACC TGAACTTCTTCAGCGTGAGCAGCGACGGCAGGATCGTGAG CTGGACCCTGGTGAAGCGCAAGCTGGTGCACATCGACGTG ATCAAGCTGAAGGTGGAGGGCAGCACCACAGAGGTGCCA GAGGGACTGCAGCTGCACCCAGTGGGATGCGGCACAGCC TTCGACTTCCACAAGGAGATCGACTACATGTTCCTGGTGG GCACCGAGGAGGGCAAGATCTACAAGTGCAGCAAGAGCT ACAGCAGCCAGTTCCTGGACACATACGACGCCCACAACAT GAGCGTGGACACCGTGAGCTGGAACCCCTACCACACAAA GGTGTTCATGAGCTGCAGCAGCGACTGGACCGTGAAGATC TGGGACCACACCATCAAGACACCCATGTTCATCTACGACC TGAACAGCGCCGTGGGCGACGTGGCATGGGCACCATACA GCAGCACAGTGTTCGCAGCAGTGACCACAGACGGCAAGG CACACATCTTCGACCTGGCCATCAACAAGTACGAGGCCAT CTGCAACCAGCCCGTGGCCGCCAAGAAGAACAGGCTGAC CCACGTGCAGTTCAACCTGATCCACCCCATCATCATCGTG GGCGACGACCGGGGCCACATCATCAGCCTGAAGCTGAGC CCCAACCTGAGAAAGATGCCCAAGGAGAAGAAGGGACAG GAGGTGCAGAAGGGACCAGCAGTGGAGATCGCAAAGCTG GACAAGCTGCTGAACCTGGTGCGCGAGGTGAAGATCAAG ACCTGAGAATTCtgcagDNAH5 ATGTTTAGGATTGGGAGGAGACAGCTCTGGAAGCATAGC 3 GTCACTCGAGTTTTAACGCAAAGACTGAAGGGAGAGAAG GAAGCCAAGCGGGCTCTTTTGGATGCGAGGCATAACTACT TATTTGCAATTGTGGCTTCCTGTTTGGACCTGAACAAAAC CGAAGTGGAGGATGCCATTCTTGAAGGGAATCAGATTGA AAGAATTGATCAACTTTTTGCTGTTGGAGGTCTCCGACAC CTCATGTTTTACTATCAAGATGTGGAGGAAGCAGAAACAG GACAACTTGGCTCTCTAGGAGGGGTAAATCTTGTTTCTGG AAAGATTAAAAAACCTAAGGTGTTCGTGACCGAGGGAAA CGATGTGGCTCTTACTGGGGTATGTGTGTTCTTCATCAGG ACTGACCCTTCCAAAGCCATCACCCCTGACAACATCCACC AGGAGGTGAGTTTTAACATGTTAGATGCGGCAGATGGAG GCCTGCTCAACAGTGTGAGACGTTTGCTGTCGGACATCTT CATTCCTGCTCTCAGAGCCACGAGCCATGGCTGGGGCGAG CTCGAGGGCCTTCAGGACGCAGCTAACATTCGCCAGGAGT TCTTGAGCTCCCTGGAAGGCTTTGTGAACGTCCTGTCGGG TGCACAGGAGAGTCTGAAGGAGAAGGTGAACCTTCGAAA GTGTGACATACTTGAACTGAAAACCCTAAAGGAACCTACG GACTACTTGACTCTAGCAAATAACCCTGAGACTTTGGGAA AAATAGAGGATTGCATGAAAGTATGGATCAAACAGACAG AACAGGTTCTTGCTGAAAACAATCAGCTGCTGAAGGAAGCGGATGACGTTGGGCCACGAGCGGAGCTGGAGCACTGGAAttorney Docket No. 061529-516001WOSEQGene SequenceID NO AAAAAAGACTCTCCAAGTTTAACTACCTTTTGGAACAATT GAAAAGCCCGGATGTGAAGGCTGTGCTGGCAGTGCTTGC GGCGGCCAAGTCGAAACTGCTGAAGACTTGGCGGGAGAT GGATATTCGAATCACTGATGCAACTAATGAAGCAAAGGA CAATGTGAAATACTTGTATACACTTGAAAAATGTTGTGAC CCTTTGTACAGCAGTGATCCCCTATCCATGATGGATGCTA TTCCTACACTTATAAATGCAATTAAAATGATCTATAGTAT CTCTCATTACTATAATACCTCTGAGAAGATCACATCTCTGT TTGTAAAGGTGACAAATCAGATTATATCTGCATGTAAAGC CTATATTACCAATAATGGAACCGCTTCCATCTGGAACCAG CCACAGGATGTTGTTGAAGAAAAAATACTATCTGCGATTA AACTGAAACAGGAATACCAGCTCTGCTTTCACAAGACAA AACAAAAGCTTAAACAAAATCCAAATGCAAAACAATTTG ATTTTAGCGAGATGTATATTTTTGGAAAATTCGAAACTTTT CACCGACGCCTTGCCAAGATAATAGACATCTTTACAACCC TCAAGACGTATTCAGTCCTGCAAGATTCCACAATTGAAGG GCTGGAAGACATGGCCACTAAATACCAGGGCATTGTGGC AACCATAAAGAAAAAGGAATACAATTTCCTAGACCAGCG GAAAATGGATTTTGACCAAGATTACGAAGAGTTTTGCAAG CAGACTAATGACCTTCATAACGAGTTGCGGAAGTTCATGG ATGTTACATTTGCAAAGATTCAAAACACAAATCAAGCTCT AAGAATGTTGAAGAAATTTGAAAGATTGAATATACCTAAT CTTGGTATTGATGACAAATATCAACTTATCCTTGAGAACT ATGGGGCTGACATTGATATGATTTCAAAGCTGTATACAAA GCAGAAATACGATCCTCCTCTGGCTCGAAACCAGCCTCCC ATCGCTGGAAAGATTTTGTGGGCCCGCCAGCTCTTCCATA GGATTCAGCAGCCCATGCAGCTTTTCCAGCAGCACCCAGC TGTGCTAAGCACGGCAGAAGCCAAACCTATAATTCGCAGT TACAACAGGATGGCCAAGGTCCTCCTGGAGTTTGAGGTCC TCTTCCACAGGGCGTGGCTTCGGCAAATTGAAGAAATTCA TGTAGGTCTTGAGGCTTCATTATTGGTGAAGGCTCCAGGC ACAGGGGAATTGTTTGTAAACTTTGACCCTCAGATATTAA TCTTATTTAGAGAAACAGAGTGCATGGCCCAGATGGGTCT GGAAGTCTCTCCACTGGCAACTTCCCTCTTCCAGAAACGA GATAGATACAAAAGGAACTTCAGTAACATGAAGATGATG CTAGCTGAATATCAGAGAGTGAAGTCAAAAATACCTGCTG CCATTGAGCAATTGATTGTCCCTCACTTGGCCAAAGTGGA TGAAGCTCTCCAACCTGGCTTGGCTGCACTGACCTGGACA TCACTGAATATTGAGGCTTATTTAGAAAACACTTTTGCAA AGATCAAGGACCTGGAGTTGCTGCTTGACAGGGTCAATGA TTTGATTGAGTTCCGCATTGATGCCATTCTAGAAGAAATG AGCAGCACGCCTCTTTGTCAGCTTCCCCAGGAGGAGCCAC TAACCTGTGAAGAGTTTCTCCAAATGACAAAGGATCTTTG TGTAAATGGTGCACAAATACTACATTTTAAAAGCTCATTA GTGGAGGAGGCAGTCAATGAGCTTGTAAATATGTTGCTGG ATGTGGAAGTTTTATCTGAAGAAGAAAGTGAAAAAATATCCAATGAGAATAGTGTTAATTACAAAAATGAAAGTTCAGCAttorney Docket No. 061529-516001WOSEQGene SequenceID NO AAAAAGAGAAGAAGGAAATTTTGACACCTTGACATCATC TATTAATGCCAGGGCCAATGCCCTGCTTTTGACGACAGTC ACGAGGAAAAAGAAAGAAACTGAGATGTTAGGGGAAGA AGCCCGCGAGTTACTCTCTCATTTCAACCATCAGAACATG GATGCTCTTCTGAAAGTTACAAGGAATACACTAGAGGCCA TTCGCAAACGTATTCATTCCTCTCACACAATTAACTTCCGG GACAGTAACAGTGCCTCTAACATGAAGCAGAACAGTTTGC CCATTTTCCGGGCAAGCGTCACTCTGGCCATTCCCAACAT CGTCATGGCCCCTGCCCTGGAAGATGTACAGCAGACCCTG AACAAAGCCGTGGAGTGCATCATCAGTGTCCCTAAGGGG GTCAGACAGTGGAGCAGTGAACTGTTGTCCAAGAAAAAG ATACAAGAAAGAAAAATGGCTGCTTTGCAGAGTAATGAA GACAGTGATTCTGATGTTGAAATGGGAGAAAATGAACTTC AAGATACCTTGGAGATAGCATCTGTAAATTTACCCATTCC CGTGCAAACCAAGAACTATTATAAGAATGTTTCTGAAAAC AAAGAGATTGTAAAATTAGTTTCTGTGCTTAGCACAATTA TCAACTCCACCAAAAAGGAAGTTATTACATCCATGGATTG CTTCAAACGCTACAATCACATTTGGCAAAAGGGAAAAGA AGAAGCCATTAAGACATTTATTACACAGAGCCCCTTGCTT TCTGAATTTGAGTCCCAGATTCTCTATTTCCAAAACCTAGA GCAGGAAATTAATGCTGAGCCTGAATATGTCTGTGTGGGT TCCATTGCTCTGTACACAGCTGACTTGAAGTTCGCCCTGA CTGCTGAGACAAAGGCCTGGATGGTTGTCATTGGACGCCA CTGTAACAAAAAATACCGGAGTGAGATGGAAAACATTTTT ATGCTTATTGAAGAATTCAATAAGAAACTAAATCGTCCAA TTAAGGACCTAGATGATATTCGGATTGCAATGGCAGCGCT GAAAGAAATAAGGGAGGAGCAAATCTCCATTGACTTTCA AGTAGGACCTATTGAGGAATCTTATGCCCTGCTTAACAGA TATGGACTTCTGATAGCAAGGGAAGAGATAGACAAAGTT GATACACTGCACTATGCTTGGGAGAAGCTGCTGGCACGTG CTGGCGAAGTCCAGAATAAATTAGTCTCACTGCAGCCCAG TTTCAAGAAAGAGCTTATTAGTGCTGTGGAGGTATTCCTC CAAGATTGTCACCAGTTTTATCTGGACTATGATTTGAATG GTCCAATGGCTAGCGGCTTGAAGCCCCAGGAAGCCAGTG ACAGGCTTATCATGTTTCAGAATCAATTTGATAATATCTAT CGGAAATACATCACATATACTGGAGGAGAGGAGCTTTTTG GCCTGCCAGCTACACAGTATCCTCAGCTTCTTGAAATAAA GAAGCAACTAAATCTTCTACAGAAAATATATACTCTGTAC AACAGTGTCATAGAAACTGTAAATAGCTATTATGATATTC TTTGGTCAGAGGTGAATATTGAAAAAATTAACAATGAACT CTTAGAATTCCAGAACAGATGTCGAAAGCTTCCCCGGGCC TTGAAGGACTGGCAGGCTTTTTTGGACCTGAAGAAGATCA TTGATGATTTCAGCGAGTGTTGCCCGCTGCTGGAATACAT GGCCAGTAAAGCCATGATGGAGCGGCACTGGGAAAGGAT AACCACCCTCACCGGGCACAGTCTGGATGTGGGGAATGA AAGCTTTAAGTTAAGAAATATCATGGAGGCACCTCTTCTGAAATATAAAGAGGAAATAGAGGACATCTGTATCAGTGCGAttorney Docket No. 061529-516001WOSEQGene SequenceID NO GTGA A AGAGAGAGAC ATTGAGC A A A AGCTGA AGC A AGTG ATTAATGAATGGGACAATAAAACATTCACCTTCGGCAGCT TTAAAACC CGTGGAGAGCTCCTCTTGAGAGGAGAC AGTAC CTCGGAAATCATCGCCAACATGGAGGACAGCTTGATGTTG CTGGGATCCCTACTGAGCAACAGGTACAATATGCCATTCA AAGCCCAGATTCAAAAATGGGTGCAGTACCTTTCCAACTC AACAGACATCATCGAGAGCTGGATGACGGTGCAAAACCT GTGGATTTATTTAGAAGCTGTCTTTGTGGGAGGAGACATT GCCAAGCAGCTGCCCAAGGAAGCCAAGCGGTTTTCTAAC ATAGATAAATCTTGGGTGAAGATCATGACTCGGGCACATG AAGTGCCCAGTGTAGTCCAGTGCTGTGTTGGAGATGAGAC CCTGGGGCAGCTGTTACCACACTTGCTGGACCAGTTGGAA ATATGCCAGAAATCCCTTACTGGGTACTTGGAGAAAAAAC GACTGTGCTTTCCTCGGTTTTTCTTCGTCTCAGATCCTGCC CTTCTAGAGATTCTGGGGCAGGCGTCGGACTCCCACACTA TACAGGCCCATTTGCTGAATGTGTTTGACAACATTAAATC TGTCAAGTTCCACGAAAAGATCTATGATCGAATTCTGTCA ATTTCCTCTCAAGAGGGTGAGACGATTGAATTGGATAAAC CTGTCATGGCAGAGGGCAATGTGGAAGTTTGGCTTAATTC TCTTTTGGAAGAATCTCAGTCCTCATTGCATCTTGTGATTC GCCAGGCAGCCGCAAATATTCAAGAAACAGGTTTCCAACT AACTGAATTTCTTTCATCCTTCCCTGCTCAGGTTGGATTAT TAGGAATTCAGATGATATGGACACGGGATTCAGAAGAAG CCCTTAGAAATGCCAAGTTTGATAAAAAAATCATGCAGAA AACTAATCAGGCTTTCCTGGAGCTACTCAATACATTGATA GACGTCACCACGAGGGATCTGAGTTCCACGGAACGAGTG AAATACGAGACTCTGATTACTATTCATGTGCACCAAAGGG ATATCTTTGATGACCTGTGTCATATGCATATCAAGAGTCC CATGGACTTTGAGTGGCTGAAACAGTGCAGATTTTACTTT AACGAAGATTCTGACAAGATGATGATTCACATCACAGATG TGGCGTTCATATACCAGAATGAATTTTTAGGCTGCACTGA CAGGCTTGTAATAACTCCACTTACAGACAGATGTTACATC ACGCTGGCTCAAGCTCTGGGAATGAGCATGGGGGGAGCC CCTGCTGGACCTGCAGGCACAGGCAAAACAGAAACCACT AAAGACATGGGACGATGCCTCGGGAAATACGTCGTGGTTT TCAATTGTTCAGACCAGATGGATTTCCGAGGACTTGGACG GATTTTTAAGGGACTGGCACAGTCTGGATCCTGGGGTTGT TTTGATGAATTTAACCGTATTGATCTACCAGTTCTCTCGGT TGCAGCCCAGCAAATTTCCATTATTCTGACATGTAAAAAG GAGCACAAAAAGTCTTTTATCTTTACTGATGGAGATAATG TGACTATGAACCCTGAATTTGGGCTTTTCTTAACCATGAAT CCTGGCTATGCCGGACGGCAGGAACTCCCTGAAAACTTGA AGATTAATTTCCGCTCAGTGGCCATGATGGTGCCTGACCG TCAGATTATCATAAGGGTGAAGTTGGCTAGTTGTGGCTTC ATTGACAACGTTGTTTTGGCCAGGAAGTTTTTCACGCTCTA CAAACTGTGTGAGGAGCAGCTTTCTAAGCAGGTTCATTATGACTTTGGCCTGCGTAACATTCTGTCAGTTCTTCGGACCTTAttorney Docket No. 061529-516001WOSEQGene SequenceID NO GGGAGCAGCAAAAAGAGCCAATCCAATGGATACGGAGTC CACGATTGTCATGCGTGTACTACGGGACATGAATCTTTCT AAACTGATTGATGAGGATGAACCCTTGTTTTTGAGTTTGA TTGAAGATCTCTTTCCAAATATTCTTCTGGACAAGGCAGG TTACCCTGAACTGGAAGCAGCAATTAGTAGACAGGTTGAA GAAGCTGGTTTAATCAACCATCCTCCTTGGAAACTGAAGG TCATCCAGCTATTCGAAACGCAGAGAGTGCGACATGGGAT GATGACTCTGGGGCCCAGTGGGGCTGGGAAGACCACCTG CATCCACACCTTGATGAGAGCCATGACAGATTGTGGAAAA CCACATCGGGAAATGAGGATGAATCCCAAAGCGATTACT GCCCCACAGATGTTTGGTCGGCTGGACGTTGCCACAAATG ACTGGACTGATGGGATATTTTCTACGCTTTGGAGGAAAAC ATTAAGAGCAAAGAAAGGGGAACATATCTGGATAATTCT TGATGGTCCAGTAGATGCCATCTGGATTGAAAATCTGAAT TCTGTTTTGGATGATAACAAAACTCTAACCCTTGCCAATG GTGATCGGATTCCCATGGCTCCAAACTGCAAGATCATTTT CGAGCCTCATAACATTGACAATGCTTCTCCTGCCACCGTC TCAAGAAATGGAATGGTTTTCATGAGCTCTTCTATCCTTG ATTGGAGTCCTATTCTTGAGGGTTTTCTTAAGAAACGCTC ACCTCAAGAAGCAGAAATTCTTCGTCAGCTGTACACCGAG TCTTTCCCAGACTTGTATCGCTTCTGTATCCAGAACTTAGA ATACAAGATGGAGGTGCTGGAGGCCTTTGTCATCACACAG AGCATTAACATGCTTCAAGGCCTGATTCCTCTGAAGGAGC AAGGCGGGGAGGTGAGCCAGGCTCACCTGGGGCGGCTGT TCGTGTTCGCGCTGCTGTGGAGCGCGGGGGCGGCGCTGGA GCTGGACGGACGGCGCCGCCTGGAGCTCTGGCTGCGCTCT CGGCCCACAGGGACGCTGGAGCTGCCGCCGCCAGCGGGG CCCGGGGACACCGCCTTCGACTACTATGTGGCGCCCGATG GTACATGGACGCACTGGAACACGCGTACCCAGGAATACC TGTATCCGTCTGATACCACCCCAGAGTATGGTTCTATTCTG GTGCCAAATGTTGACAATGTGAGGACTGACTTTCTAATTC AAACCATTGCTAAACAGGGCAAGGCTGTGCTATTAATTGG TGAACAAGGAACAGCCAAAACAGTAATAATTAAAGGATT TATGTCAAAATATGATCCTGAATGTCACATGATCAAGAGT CTGAATTTTTCTTCTGCAACCACCCCACTGATGTTCCAGAG GACGATAGAGAGCTATGTGGATAAACGAATGGGTACAAC ATATGGCCCTCCTGCGGGAAAGAAGATGACTGTTTTTATT GATGATGTGAATATGCCAATAATCAATGAGTGGGGAGAT CAGGTTACGAATGAGATAGTGCGACAGCTGATGGAACAA AATGGATTCTATAATCTAGAGAAGCCTGGGGAGTTCACCA GCATCGTGGACATCCAGTTTTTGGCAGCCATGATCCATCC TGGTGGTGGACGCAATGACATACCCCAAAGACTCAAGAG GCAGTTCTCTATATTTAATTGCACGTTGCCCTCTGAAGCTT CTGTGGACAAGATCTTTGGTGTGATTGGGGTAGGCCACTA CTGTACTCAGAGGGGTTTCTCAGAAGAAGTGAGAGATTCT GTGACAAAATTGGTGCCTCTGACACGCCGACTATGGCAGATGACCAAGATTAAAATGCTTCCTACCCCTGCAAAATTCCAAttorney Docket No. 061529-516001WOSEQGene SequenceID NO TTATGTGTTTAACCTACGAGATCTTTCTCGGGTCTGGCAGG GAATGCTGAACACTACTTCAGAGGTCATCAAGGAACCAA ATGATCTGTTAAAGCTGTGGAAGCATGAGTGTAAACGTGT TATAGCTGACCGTTTCACAGTGTCCAGTGATGTGACCTGG TTTGATAAGGCTTTAGTAAGTTTGGTAGAGGAGGAGTTTG GTGAAGAGAAAAAACTCTTGGTGGATTGTGGAATTGACA CATATTTTGTGGATTTCTTGAGAGATGCACCTGAAGCTGC AGGTGAAACATCTGAAGAGGCTGATGCTGAAACACCTAA AATTTATGAGCCAATTGAATCTTTTAGTCACCTAAAAGAG CGTCTGAATATGTTCCTGCAGCTCTATAATGAGAGCATCC GTGGCGCCGGCATGGACATGGTGTTCTTTGCAGATGCCAT GGTTCACTTAGTCAAGATCTCTCGTGTCATTCGTACTCCTC AGGGAAATGCCCTCCTGGTCGGGGTGGGCGGATCAGGAA AGCAGAGCCTGACGAGGTTGGCTTCATTCATTGCTGGCTA CGTTTCCTTCCAGATCACTCTGACGAGATCCTACAACACA TCAAATCTGATGGAAGATCTGAAGGTTTTGTATCGAACAG CTGGTCAGCAAGGCAAAGGAATCACTTTTATTTTCACAGA CAATGAGATTAAAGATGAGTCATTTTTGGAATATATGAAC AATGTTTTATCATCAGGTGAGGTCTCTAACCTATTTGCTCG AGATGAAATTGATGAAATTAATAGCGACCTGGCATCAGTC ATGAAAAAAGAATTCCCCAGGTGCCTTCCTACCAATGAGA ACCTGCACGACTACTTCATGAGTCGGGTCCGACAGAACCT TCATATTGTGCTCTGCTTCTCGCCAGTGGGGGAGAAATTT CGAAACAGAGCTTTGAAGTTCCCTGCCCTAATTTCAGGAT GCACAATTGACTGGTTCAGCCGATGGCCCAAAGATGCTTT AGTTGCTGTGTCTGAACACTTCCTCACTTCCTATGATATTG ACTGCAGTTTGGAAATCAAGAAGGAGGTGGTCCAATGCA TGGGCTCCTTCCAGGATGGGGTGGCTGAGAAGTGTGTTGA TTATTTTCAGAGATTCCGACGTTCTACCCACGTGACGCCC AAATCATACCTCTCCTTTATTCAGGGCTATAAGTTCATATA TGGAGAAAAGCATGTGGAGGTGCGGACCCTGGCCAACAG AATGAATACTGGATTGGAAAAGCTCAAAGAAGCTTCAGA GTCTGTTGCAGCCTTGAGTAAAGAACTGGAAGCGAAAGA AAAGGAGCTACAAGTGGCCAACGATAAAGCCGACATGGT CTTAAAAGAAGTGACAATGAAAGCACAGGCTGCTGAAAA GGTCAAGGCTGAGGTACAGAAGGTGAAGGACAGGGCCCA GGCCATTGTGGACAGCATCTCTAAAGACAAAGCCATTGCT GAAGAAAAACTGGAAGCAGCAAAACCAGCTTTAGAAGAG GCAGAAGCTGCATTGCAGACCATCAGGCCTTCGGACATCG CCACTGTTCGCACGTTGGGCCGCCCCCCTCACCTCATCAT GCGGATCATGGATTGCGTACTGCTGCTGTTTCAAAGGAAA GTCAGTGCTGTGAAAATTGACCTGGAAAAAAGCTGTACCA TGCCCTCCTGGCAGGAATCCTTAAAATTGATGACTGCAGG GAACTTTTTACAGAACTTACAGCAATTCCCAAAAGACACA ATCAATGAAGAGGTGATAGAATTTTTGAGTCCTTACTTTG AAATGCCTGACTATAACATCGAAACTGCTAAACGCGTATGTGGAAATGTAGCTGGTCTTTGTTCCTGGACGAAAGCTATGAttorney Docket No. 061529-516001WOSEQGene SequenceID NO GCTTCCTTCTTTTCTATAAACAAAGAAGTACTGCCTCTGAA GGCCAACTTGGTGGTGCAAGAGAATCGCCATCTCCTGGCC ATGCAGGATCTGCAGAAAGCCCAGGCCGAGTTGGATGAC AAGCAGGCGGAACTTGACGTGGTGCAGGCTGAGTATGAA CAGGCCATGACTGAAAAGCAGACCTTGCTTGAAGATGCA GAGCGATGCAGACACAAGATGCAGACAGCTTCCACGCTC ATCAGTGGCTTGGCAGGTGAAAAAGAAAGATGGACAGAG CAAAGCCAAGAGTTTGCTGCACAAACTAAAAGACTTGTA GGGGATGTACTGTTGGCTACAGCTTTTCTATCTTATTCTGG TCCATTTAACCAAGAGTTTCGTGATCTTCTGTTAAATGACT GGCGGAAGGAAATGAAAGCCCGGAAAATTCCATTTGGAA AGAACCTAAATCTCAGTGAGATGTTGATTGATGCTCCTAC TATTAGTGAATGGAACCTCCAAGGTCTGCCAAATGATGAC TTGTCCATTCAAAATGGAATTATTGTCACGAAGGCATCTC GTTACCCTTTGTTAATTGATCCACAGACTCAAGGCAAGAT CTGGATTAAAAATAAAGAAAGCCGAAATGAACTCCAGAT CACGTCTTTAAATCACAAGTACTTCAGAAACCACCTGGAA GACAGCCTTTCTCTTGGAAGGCCTTTGCTTATTGAAGATGT TGGAGAGGAACTAGATCCAGCACTAGATAATGTTTTGGAA AGAAACTTCATTAAAACTGGGTCTACCTTTAAGGTGAAAG TTGGTGACAAGGAAGTAGATGTGTTGGATGGCTTTAGACT CTACATTACCACCAAATTGCCTAACCCAGCCTACACCCCT GAGATAAGTGCCCGTACCTCCATCATTGACTTCACTGTCA CCATGAAAGGTCTAGAAGATCAGTTACTGGGGAGGGTCA TTCTCACAGAGAAGCAGGAATTGGAGAAAGAAAGAACTC ATCTGATGGAAGATGTAACTGCAAACAAAAGAAGGATGA AGGAACTAGAAGATAACTTGCTTTACCGCCTGACAAGTAC CCAGGGGTCCCTGGTAGAAGATGAAAGTCTCATTGTCGTG CTGAGTAACACAAAAAGGACAGCCGAGGAGGTGACACAG AAGCTAGAAATTTCTGCTGAGACAGAAGTTCAAATTAACT CAGCCCGGGAGGAATACAGACCTGTGGCTACGCGGGGCA GCATCCTCTACTTCCTCATTACTGAGATGCGCTTGGTTAAT GAGATGTATCAGACTTCGCTTCGCCAGTTTCTGGGCTTATT TGACCTTTCCTTAGCCAGGTCTGTCAAGAGCCCGATTACA AGCAAGAGGATTGCTAATATCATCGAGCACATGACCTACG AGGTTTATAAGTATGCTGCCCGAGGGCTGTACGAGGAGCA CAAATTCCTGTTCACCTTGTTGCTTACCCTAAAGATTGACA TCCAGAGGAACCGAGTCAAGCATGAAGAGTTTCTCACTCT TATTAAAGGAGGTGCCTCATTAGACCTTAAAGCTTGTCCT CCAAAACCATCAAAATGGATCCTGGACATAACATGGCTG AATTTGGTGGAACTTAGCAAACTCAGACAGTTTTCAGATG TCCTTGACCAGATATCGAGAAATGAGAAAATGTGGAAAA TTTGGTTTGATAAGGAAAACCCGGAGGAGGAACCTCTTCC AAATGCCTATGATAAATCTCTTGACTGCTTCAGACGTCTTC TCCTTATTAGATCCTGGTGTCCTGACAGAACCATCGCCCA GGCCCGCAAGTACATCGTGGACTCCATGGGAGAAAAATATGCCGAAGGTGTTATTTTAGACTTGGAGAAGACGTGGGAGAttorney Docket No. 061529-516001WOSEQGene SequenceID NO GAATCTGATCCACGGACGCCACTCATCTGTCTCCTGTCTAT GGGCTCAGACCCCACAGATTCCATCATTGCCTTGGGGAAG AGATTAAAAATAGAAACCCGTTATGTGTCCATGGGCCAGG GCCAGGAAGTCCATGCTCGGAAGCTCTTGCAGCAGACCAT GGCGAACGGAGGATGGGCACTTCTGCAGAACTGCCATCT GGGACTTGATTTCATGGATGAGCTGATGGACATAATCATA GAAACTGAGCTTGTACATGATGCGTTCCGCCTCTGGATGA CCACCGAGGCTCATAAGCAGTTTCCCATTACACTCCTTCA GATGTCCATTAAATTTGCCAACGATCCTCCACAAGGACTC CGGGCAGGACTGAAAAGAACATATAGTGGTGTCAGCCAA GACCTGCTGGACGTGAGCTCTGGGTCCCAGTGGAAGCCCA TGCTGTACGCAGTGGCTTTCCTGCACTCCACTGTCCAGGA GAGGCGCAAGTTCGGTGCCCTGGGGTGGAATATCCCCTAC GAATTTAACCAAGCGGACTTTAATGCCACTGTGCAGTTCA TCCAAAACCACTTGGATGACATGGATGTCAAAAAGGGTGT CTCCTGGACCACCATCCGCTACATGATAGGAGAGATTCAA TATGGAGGCAGAGTCACTGACGACTATGATAAGAGATTGT TGAACACATTTGCTAAGGTTTGGTTCAGTGAAAATATGTT TGGACCAGATTTCAGTTTTTACCAAGGATACAATATTCCA AAATGCAGCACAGTGGATAACTATCTTCAGTATATCCAGA GTTTGCCTGCCTATGACAGCCCTGAGGTGTTTGGGCTGCA CCCCAATGCTGACATCACCTACCAGAGCAAGCTGGCCAAG GACGTGCTGGACACCATCCTAGGCATCCAACCCAAGGAC ACCTCTGGTGGAGGGGATGAGACCCGGGAGGCGGTGGTG GCCCGGCTGGCTGATGATATGCTGGAGAAGCTGCCCCCAG ACTATGTCCCCTTTGAAGTAAAAGAGAGGCTGCAGAAGAT GGGGCCATTCCAGCCTATGAACATTTTCCTCAGGCAGGAA ATAGACAGAATGCAAAGGGTACTCAGCCTTGTCCGCAGC ACCCTCACTGAGCTGAAACTTGCTATTGATGGCACCATCA TC ATGAGC GA A A ATCTGCGAGATGC ATTGGATTGC ATGTT TGATGCTAGAATCCCTGCTTGGTGGAAAAAAGCTTCTTGG ATTTCTAGTACACTGGGTTTCTGGTTTACTGAACTTATAGA AAGAAACAGCCAGTTTACCTCGTGGGTTTTCAATGGCCGA CCTCACTGCTTTTGGATGACGGGTTTTTTTAACCCCCAGGG ATTTTTAACTGCAATGCGACAGGAAATAACTCGGGCCAAC AAAGGCTGGGCTCTGGACAATATGGTGCTTTGCAATGAAG TCACCAAATGGATGAAGGACGACATTTCTGCCCCTCCCAC AGAGGGTGTCTATGTCTATGGCTTATATCTTGAAGGTGCT GGCTGGGACAAGAGGAACATGAAACTCATTGAATCAAAG CCAAAAGTGCTCTTTGAGTTGATGCCTGTCATAAGGATTT ATGCAGAAAACAATACTTTACGAGATCCTCGGTTTTACTC CTGTCCCATCTATAAGAAGCCAGTTCGAACGGACTTGAAC TACATTGCCGCTGTGGATCTCAGGACAGCCCAGACCCCTG AACACTGGGTGCTCCGTGGGGTTGCCCTTCTGTGTGATGT CAAGTAA AAT ATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAG 4GCCTGTGCTGCCTGGTCCCTGTCTCCCTGGCTGAGGATCCCAttorney Docket No. 061529-516001WOSEQGene SequenceID NO CAGGGAGATGCTGCCCAGAAGACAGATACATCCCACCAT GATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACC TGGCTGAGTTCGCCTTCAGCCTATACCGCCAGCTGGCACA CCAGTCCAACAGCACCAATATCTTCTTCTCCCCAGTGAGC ATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCAAGG CTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAA CCTCACGGAGATTCCGGAGGCTCAGATCCATGAAGGCTTC CAGGAACTCCTCCGTACCCTCAACCAGCCAGACAGCCAGC TCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGG CCTGAAGCTAGTGGATAAGTTTTTGGAGGATGTTAAAAAG TTGTACCACTCAGAAGCCTTCACTGTCAACTTCGGGGACA CCGAAGAGGCCAAGAAACAGATCAACGATTACGTGGAGA AGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGC TTGACAGAGACACAGTTTTTGCTCTGGTGAATTACATCTTC TTTAAAGGCAAATGGGAGAGACCCTTTGAAGTCAAGGAC ACCGAGGAAGAGGACTTCCACGTGGACCAGGTGACCACC GTGAAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACA TCCAGCACTGTAAGAAGCTGTCCAGCTGGGTGCTGCTGAT GAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCT GATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACC CACGATATCATCACCAAGTTCCTGGAAAATGAAGACAGA AGGTCTGCCAGCTTACATTTACCCAAACTGTCCATTACTG GAACCTATGATCTGAAGAGCGTCCTGGGTCAACTGGGCAT CACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTC ACAGAGGAGGCACCCCTGAAGCTCTCCAAGGCCGTGCAT AAGGCTGTGCTGACCATCGACGAGAAAGGGACTGAAGCT GCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATCC CCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAAT GATTGAACAAAATACCAAGTCTCCCCTCTTCATGGGAAAA GTGGTGAATCCCACCCAAAAATAA ARMC4 ATGGGTGTGGCTCTGAGGAAATTGACGCAGTGGACTGCTG 5 CCGGACATGGAACTGGAATCCTCGAAATCACCCCTCTAAA TGAAGCGATATTGAAAGAAATTATTGTGTTTGTGGAGAGT TTTATCTATAAACATCCTCAAGAGGCAAAATTTGTTTTTGT GGAACCACTTGAATGGAACACAAGTTTGGCGCCCTCAGCA TTTGAATCAGGTTATGTTGTCAGTGAAACAACAGTCAAAT CAGAAGAAGTTGATAAAAATGGACAGCCTTTGCTATTTCT CTCTGTACCACAAATTAAAATTAGGAGCTTTGGGCAGCTG TCACGCTTGTTACTTATTGCCAAAACTGGGAAGTTGAAGG AAGCCCAAGCATGTGTTGAAGCTAACAGAGACCCCATAG TAAAAATCCTGGGCTCTGATTATAATACAATGAAAGAAAA CTCAATTGCATTAAATATTCTTGGCAAAATTACCAGAGAT GATGATCCTGAAAGTGAAATTAAGATGAAGATTGCTATGC TGCTTAAGCAATTGGATCTGCACCTCCTCAATCATTCTCTA AAACATATTTCATTAGAAATAAGTTTAAGTCCCATGACGG TGAAGAAGGATATAGAACTGCTCAAACGTTTCTCAGGAAAAGGAAACCAAACAGTCTTGGAATCTATTGAATATACCTCAttorney Docket No. 061529-516001WOSEQGene SequenceID NO AGATTATGAATTTTCAAATGGATGTCGAGCCCCACCGTGG AGACAAATTCGTGGGGAAATTTGTTATGTGCTGGTGAAAC CTCACGATGGTGAGACTCTGTGCATTACTTGCAGTGCAGG AGGAGTATTTTTAAATGGTGGCAAAACAGATGATGAAGG GGACGTTAATTATGAGAGAAAAGGTTCAATTTATAAAAAC CTTGTCACATTTTTAAGAGAAAAATCACCAAAATTTTCAG AAAATATGTCTAAATTGGGAATTAGCTTCAGTGAAGACCA GCAAAAGGAAAAGGATCAGCTTGGCAAAGCCCCCAAGAA GGAAGAAGCAGCTGCCCTCCGCAAAGACATTTCTGGTTCA GACAAAAGGTCACTGGAGAAGAACCAAATTAATTTTTGG AGGAATCAAATGACCAAGAGATGGGAACCAAGCTTAAAC TGGAAGACCACTGTTAATTACAAAGGCAAAGGCTCAGCA AAAGAAATCCAAGAGGACAAACACACAGGAAAACTTGAA AAACCAAGACCATCTGTTTCACACGGAAGAGCACAATTAC TTCGGAAGAGTGCTGAAAAGATTGAGGAAACTGTTAGCG ATAGCTCCTCAGAAAGTGAGGAAGATGAAGAACCACCTG ACCATCGTCAGGAAGCAAGTGCAGATTTGCCATCAGAATA TTGGCAAATTCAGAAGCTGGTGAAATATTTAAAGGGAGG AAATCAAACAGCTACAGTGATTGCGTTGTGTTCAATGAGG GATTTCAGCTTAGCTCAAGAAACCTGCCAGTTGGCCATCA GAGATGTTGGAGGCCTGGAAGTGCTGATAAATTTGCTTGA AACCGATGAAGTCAAATGTAAGATTGGTTCATTAAAAATA CTGAAGGAAATCAGTCATAATCCTCAAATCAGACAGAAT ATTGTTGACCTTGGGGGCTTACCAATTATGGTGAATATAC TTGATTCTCCACACAAGAGTCTAAAATGTTTGGCAGCCGA GACTATCGCGAATGTTGCCAAGTTTAAAAGAGCACGGCG GGTGGTGAGGCAGCACGGGGGTATCACCAAACTGGTTGC TCTACTAGACTGTGCACATGATTCCACAAAACCTGCCCAA TCGAGTCTGTATGAGGCCAGAGACGTGGAAGTGGCTCGCT GTGGGGCACTGGCCCTGTGGAGCTGCAGTAAGAGTCATAC GAATAAAGAAGCCATCCGCAAAGCTGGGGGCATTCCTCT GTTGGCTCGGCTGCTGAAGACTTCTCATGAAAACATGCTA ATTCCAGTGGTGGGGACATTGCAAGAGTGTGCATCAGAG GAAAACTACCGGGCTGCAATCAAAGCAGAAAGGATCATT GAAAACCTTGTCAAGAACCTAAATAGTGAGAATGAGCAG CTGCAGGAGCACTGCGCCATGGCCATTTACCAGTGTGCTG AAGATAAGGAAACCCGGGACCTCGTTAGGCTGCACGGAG GACTTAAGCCCTTGGCCAGTCTACTCAATAACACTGACAA TAAAGAGCGGTTAGCTGCTGTCACAGGGGCTATATGGAA ATGTTCCATCAGCAAAGAGAATGTTACCAAGTTTCGGGAA TACAAAGCCATTGAAACCTTGGTGGGACTTCTAACAGATC AGCCTGAAGAAGTACTTGTGAATGTGGTTGGGGCCTTGGG AGAATGCTGCCAAGAACGTGAAAACCGAGTCATTGTCCG GAAATGTGGTGGCATTCAACCACTTGTGAACCTCCTTGTT GGAATAAACCAAGCTCTTCTTGTGAATGTTACAAAAGCAG TTGGTGCTTGTGCAGTAGAACCTGAAAGTATGATGATAATTGATCGCTTAGATGGAGTTCGTTTGTTGTGGTCCCTGCTGAAttorney Docket No. 061529-516001WOSEQGene SequenceID NO AAAATCCTCACCCAGACGTGAAGGCCAGCGCAGCATGGG CACTCTGTCCATGCATCAAAAATGCAAAGGATGCTGGGGA AATGGTTCGTTCCTTTGTTGGTGGTTTGGAACTTATTGTCA ATTTACTGAAATCAGATAACAAAGAAGTTCTGGCAAGTGT ATGTGCTGCCATTACCAACATAGCAAAAGATCAAGAAAA TTTAGCTGTTATCACAGATCATGGAGTTGTTCCTTTATTGT CCAAACTGGCAAATACAAATAACAATAAATTGAGACATC ATCTAGCAGAAGCTATTTCACGTTGCTGTATGTGGGGCAG GAATAGAGTGGCCTTCGGTGAGCACAAAGCAGTGGCTCC ACTAGTGCGTTATCTGAAATCAAATGACACCAACGTGCAT CGGGCGACAGCTCAGGCCTTGTACCAACTCTCAGAAGACG CCGATAACTGCATCACCATGCATGAGAATGGTGCAGTAAA GCTTCTACTGGATATGGTTGGGTCCCCTGACCAGGATCTC CAGGAAGCTGCAGCTGGTTGTATATCCAATATCCGCAGGC TGGCTCTTGCTACAGAGAAGGCAAGATACACTTGA DNAAF ATGCACCCTGAGCCCTCGGAGCCTGCGACAGGTGGTGCAG 6 CAGAGCTGGATTGCGCGCAGGAGCCCGGCGTGGAGGAGT1CTGCGGGTGACCACGGGAGCGCAGGCCGAGGGGGCTGCA AGGAAGAAATTAATGATCCTAAGGAAATATGTGTGGGTTC TTCTGACACATCCTACCACAGCCAGCAGAAACAGAGTGGT GATAATGGGTCAGGTGGTCACTTCGCACACCCAAGAGAA GACAGGGAAGATCGGGGCCCCAGAATGACTAAAAGTTCC CTGCAAAAACTCTGCAAGCAGCACAAGCTTTATATTACCC CAGCATTGAATGATACGCTGTATTTACACTTTAAAGGTTTT GATCGCATTGAGAACCTGGAAGAGTACACAGGGCTGCGC TGTCTCTGGCTGCAGAGCAATGGAATACAGAAAATCGAA AACCTGGAGGCCCAAACTGAGTTGCGTTGCCTCTTCTTGC AAATGAACTTGCTCCGTAAAATTGAGAACCTGGAACCTCT GCAGAAACTGGATGCTCTTAACCTCAGCAACAATTACATC AAGACCATTGAAAACCTCTCCTGCCTCCCAGTCCTGAACA CATTGCAGATGGCCCACAATCACCTGGAGACCGTGGAGG ACATTCAGCATCTACAAGAGTGTTTGAGGCTTTGTGTCCTT GACCTTTCGCACAACAAGCTGAGTGACCCGGAGATCCTGA GCATTCTGGAAAGCATGCCCGATTTGCGTGTACTGAATTT GATGGGAAACCCGGTTATCAGACAGATTCCTAATTACAGA AGGACAGTCACTGTACGACTAAAGCACTTAACATACCTGG ATGATAGACCAGTGTTTCCAAAGGACAGAGCTTGTGCGGA GGCCTGGGCTAGGGGAGGGTACGCAGCTGAAAAGGAGGA GAGACAGCAGTGGGAGAGCAGGGAGCGGAAGAAGATCA CAGACAGCATTGAAGCCTTGGCCATGATCAAGCAGCGGG CAGAGGAGAGGAAAAGACAGAGAGAGAGTCAAGAGAGA GGGGAGATGACATCTTCAGATGATGGTGAGAATGTGCCC GCCAGTGCGGAAGGCAAGGAGGAGCCTCCCGGGGACAGA GAAACAAGGCAGAAGATGGAGCTATTTGTTAAGGAAAGC TTTGAGGCCAAGGACGAGCTCTGCCCGGAAAAGCCAAGT GGAGAGGAGCCGCCTGTGGAGGCTAAAAGAGAGGATGGAGGTCCAGAGCCAGAGGGGACCCTCCCAGCTGAGACCCTGAttorney Docket No. 061529-516001WOSEQGene SequenceID NO CTACTGTCGTCACCTGTGGAGGTTAAAGGAGAGGACGGA GATGGAGAGCCAGAGGGGACCCTCCCAGCTGAGGCCCCA CCACCCCCGCCACCTGTGGAGGTTAAAGGAGAGGATGGA GATCAAGAGCCAGAGGGGACCCTCCCAGCTGAGACCCTG CTACTGTCACCGCCTGTGAAGGTTAAAGGAGAGGATGGA GATCGAGAGCCAGAGGGGACCCTCCCAGCTGAGGCCCCA CCACCACCGCCCCTGGGAGCTGCCAGGGAAGAACCGACT CCCCAGGCTGTGGCCACTGAGGGTGTATTCGTTACAGAAC TTGATGGAACGAGAACGGAAGATTTAGAAACCATTAGAC TGGAGACAAAGGAGACATTCTGCATTGATGACCTACCTGA CTTGGAAGATGATGATGAAACAGGCAAATCTCTGGAAGA CCAGAATATGTGCTTTCCGAAGATTGAGGTCATCTCGAGC TTGAGTGATGACAGTGACCCTGAACTGGACTACACGTCAC TCCCTGTGCTGGAAAACCTCCCCACAGACACTCTGTCAAA TATATTTGCAGTCTCTAAAGACACCTCAAAGGCGGCTCGG GTGCCCTTCACAGACATCTTTAAAAAAGAAGCTAAGAGG GACTTGGAAATCCGAAAACAAGACACCAAGTCCCCAAGA CCCCTGATCCAGGAGCTCAGCGACGAGGACCCCTCTGGCC AGCTACTGATGCCCCCCACCTGCCAAAGAGATGCTGCACC ACTCACTTCCAGTGGAGACAGGGACAGCGACTTCCTTGCA GCCTCTTCTCCGGTGCCGACTGAGAGCGCCGCCACACCCC CAGAGACGTGTGTCGGAGTTGCCCAGCCCAGCCAAGCTCT GCCCACGTGGGACCTCACTGCATTCCCAGCACCGAAAGCA TCATAG DNAAF ATGGCCAAAGCGGCGGCCTCCTCGTCGCTGGAGGACTTGG 7 ACCTGAGCGGAGAGGAGGTCCAGCGGCTCACCTCCGCCTT2CCAGGACCCGGAGTTCCGGCGAATGTTCTCCCAGTACGCC GAGGAGCTCACCGACCCGGAGAACCGGCGGCGCTACGAG GCGGAGATCACCGCGCTAGAGCGTGAGCGCGGGGTGGAA GTGCGGTTCGTGCACCCGGAGCCCGGCCATGTGCTGCGCA CCAGCCTGGACGGGGCGCGGCGCTGCTTTGTGAATGTCTG CAGCAACGCGTTGGTGGGCGCGCCCAGCAGCCGGCCCGG CTCCGGTGGCGACCGGGGCGCAGCTCCTGGCAGCCACTGG TCCCTGCCCTACAGCCTGGCGCCCGGCCGCGAGTACGCGG GGCGCAGCAGCAGCCGCTACATGGTCTACGACGTGGTCTT CCATCCAGACGCGCTTGCGCTGGCCCGGCGGCACGAGGG CTTCCGCCAGATGCTGGACGCCACGGCCCTGGAGGCCGTC GAGAAGCAGTTCGGCGTGAAGCTGGACCGCAGGAATGCC AAGACCCTGAAGGCCAAGTATAAGGGGACCCCAGAGGCT GCGGTGCTGCGCACGCCCCTGCCCGGGGTCATCCCCGCAA GGCCTGACGGGGAGCCGAAGGGTCCTCTCCCGGACTTCCC CTACCCTTACCAGTACCCGGCAGCCCCCGGGCCCCGGGCG CCCTCCCCTCCGGAAGCGGCCTTGCAGCCCGCCCCCACCG AGCCTCGCTACAGCGTGGTGCAGCGCCACCACGTGGACCT CCAGGATTACCGCTGCTCCAGGGACTCAGCCCCGAGCCCC GTGCCCCATGAGCTGGTGATCACCATCGAACTGCCGCTGTTGCGCTCGGCCGAGCAGGCGGCGCTGGAGGTAACGAGAAAttorney Docket No. 061529-516001WOSEQGene SequenceID NO AGCTGCTGTGCCTCGACTCGAGGAAACCTGACTACCGGCT GCGGCTCTCGCTCCCGTACCCAGTGGACGATGGCCGCGGC AAGGCACAATTCAACAAGGCCCGGCGGCAGCTGGTGGTT ACGCTGCCAGTGGTGCTGCCGGCCGCGCGCCGGGAGCCC GCTGTCGCCGTCGCCGCCGCCGCGCCGGAAGAGTCCGCGG ACCGGTCCGGAACTGACGGCCAGGCCTGCGCTTCCGCTCG CGAGGGGGAGGCGGGACCCGCGAGGAGTCGCGCGGAGG ACGGAGGCCACGATACCTGCGTGGCTGGGGCTGCGGGCT CCGGGGTCACCACCCTGGGCGACCCGGAGGTGGCGCCTCC GC CGGCCGC AGCTGGAGAGGAGCGTGTC CC C AAGCC GGG GGAGCAGGACTTGAGCAGGCACGCGGGGTCACCGCCGGG CAGCGTGGAGGAGCCATCTCCTGGAGGAGAAAACTCACC TGGTGGCGGAGGCTCCCCTTGTTTGTCCTCCCGGAGCCTG GC GTGGGGTTCTTCTGC GGGAAGAGAGAGTGCGCGC GGA GATAGCAGTGTGGAAACACGCGAGGAGTCGGAGGGCACG GGCGGCCAGCGCTCAGCCTGCGCCATGGGTGGTCCCGGG ACCAAGAGCGGGGAGCCTTTGTGTCCTCCGTTACTGTGTA ATCAGGACAAAGAAACCTTGACTCTGCTCATTCAGGTGCC TCGGATCCAGCCGCAAAGTCTTCAAGGAGATTTGAATCCC CTCTGGTACAAATTACGCTTCTCCGCACAAGACTTAGTTT ATTCCTTCTTTTTGCAATTTGCTCCAGAGAATAAATTGAGT ACCACAGAACCTGTGATTAGCATTTCTTCAAACAATGCAG TGATAGAACTGGCAAAATCTCCAGAGAGCCATGGACATT GGAGAGAGTGGTATTATGGTGTAAACAACGATTCTTTGGA GGAAAGGTTATTTGTCAATGAAGAAAATGTTAATGAGTTT CTTGAAGAGGTCCTGAGCTCTCCATTCAAACAGTCTATGT CCTTGACCCCACCATTAATTGAAGTTCTTCAAGTTACTGAT AATAAGATTCAAATTAATGCAAAGTTGCAAGAATGTAGTA ACTCTGATCAGCTACAAGGAAAGGAGGAAAGAGTAAATG AAGAAAGTCATCTAACTGAAAAGGAATATATAGAACATT GTAACACCCCTACAACTGATTCTGATTCATCTATAGCAGT TAAAGCACTACAAATAGATAGCTTTGGTTTAGTTACATGC TTTCAACAAGAGTCTCTTGATGTTTCTCAAATGATACTTGG AAAATCTCAGCAACCTGAGTCAAAAATGCAATCTGAATTT ATAAAAGAAAAAAGTGCTACTTGTTCAAATGAGGAAAAA GATAACTTAAACGAGTCAGTAATAACTGAAGAGAAAGAA ACAGATGGAGATCACCTATCTTCATTACTGAACAAAACTA CGGTTCACAATATACCTGGATTCGACAGCATAAAAGAAAC CAATATGCAGGATGGTAGTGTGCAGGTCATTAAAGATCAT GTGACCAATTGTGCATTCAGTTTTCAGAATTCTTTGCTATA TGATTTGGATTAA DNAAF ATGCCTCTTCAGGTTAGCGATTACAGCTGGCAGCAGACGA 8 AGACTGCGGTCTTTCTGTCTCTGCCCCTCAAAGGCGTGTG4CGTCAGAGACACGGACGTGTTCTGCACGGAAAACTATCTG AAGGTCAACTTTCCTCCATTTTTATTTGAGGCATTTCTTTA TGCTCCCATAGACGATGAGAGCAGCAAAGCAAAGATTGGGAATGACACCATTGTCTTCACCTTGTATAAAAAAGAAGCGAttorney Docket No. 061529-516001WOSEQGene SequenceID NO GCCATGTGGGAGACCCTTTCTGTGACGGGTGTTGACAAAG AGATGATGCAAAGAATTAGAGAAAAATCTATTTTACAAG CACAAGAGAGAGCAAAAGAAGCTACAGAAGCAAAAGCT GCAGCAAAGCGGGAAGATCAAAAATACGCACTAAGTGTC ATGATGAAGATTGAAGAAGAAGAGAGGAAAAAAATAGA AGATATGAAAGAAAATGAACGGATAAAAGCCACTAAAGC ATTGGAAGCCTGGAAAGAATATCAAAGAAAAGCTGAGGA GCAAAAAAAAATTCAGAGAGAAGAGAAATTATGTCAAAA AGAAAAGCAAATTAAAGAAGAAAGAAAAAAAATAAAAT ATAAGAGTCTTACTAGAAATTTGGCATCTAGAAATCTTGC TCCAAAAGGGAGAAATTCAGAAAATATATTTACTGAGAA GTTAAAGGAAGACAGTATTCCTGCTCCTCGCTCTGTTGGC AGTATTAAAATCAACTTTACCCCTCGAGTATTCCCAACAG CTCTTCGTGAATCACAAGTAGCAGAAGAGGAGGAGTGGC TACACAAACAAGCTGAGGCACGAAGAGCAATGAATACTG ACATAGCTGAACTTTGCGATTTAAAAGAAGAAGAAAAGA ACCCAGAATGGTTGAAGGATAAAGGAAACAAATTGTTTG CAACGGAAAACTATTTGGCAGCTATCAATGCATATAATTT AGCCATAAGACTAAATAATAAGATGCCACTATTGTATTTG AACCGGGCTGCTTGCCACCTAAAACTAAAAAACTTACACA AGGCTATTGAAGATTCTTCTAAGGCACTGGAATTATTGAT GCCACCTGTTACAGACAATGCTAATGCAAGAATGAAGGC ACATGTACGACGTGGAACAGCATTCTGTCAACTAGAATTG TATGTAGAAGGCCTACAGGATTATGAAGCGGCACTTAAG ATTGATCCATCCAACAAAATTGTACAAATTGATGCTGAGA AGATTCGGAATGTAATTCAAGGAACAGAACTAAAATCTTA A ZMYND ATGGGAGACCTGGAACTGCTGCTGCCCGGGGAAGCTGAA 9 GTGCTGGTGCGGGGTCTGCGCAGCTTCCCGCTACGCGAGA10TGGGCTCCGAAGGGTGGAACCAGCAGCATGAGAACCTGG AGAAGCTGAACATGCAAGCCATCCTCGATGCCACAGTCA GCCAGGGCGAGCCCATTCAGGAGCTGCTGGTCACCCATGG GAAGGTCCCAACACTGGTGGAGGAGCTGATCGCAGTGGA GATGTGGAAGCAGAAGGTGTTCCCTGTGTTCTGCAGGGTG GAGGACTTCAAGCCCCAGAACACCTTCCCCATCTACATGG TGGTGCACCACGAGGCCTCCATCATCAACCTCTTGGAGAC AGTGTTCTTCCACAAGGAGGTGTGTGAGTCAGCAGAAGAC ACTGTCTTGGACTTGGTAGACTATTGCCACCGCAAACTGA CCCTGCTGGTGGCCCAGAGTGGCTGTGGTGGCCCCCCTGA GGGGGAGGGATCCCAGGACAGCAACCCCATGCAGGAGCT GCAGAAGCAGGCAGAGCTGATGGAATTTGAGATTGCACT GAAGGCCCTCTCAGTACTACGCTACATCACAGACTGTGTG GACAGCCTCTCTCTCAGCACCTTGAGCCGTATGCTTAGCA CACACAACCTGCCCTGCCTCCTGGTGGAACTGCTGGAGCA TAGTCCCTGGAGCCGGCGGGAAGGAGGCAAGCTGCAGCA GTTCGAGGGCAGCCGTTGGCATACTGTGGCCCCCTCAGAGCAGCAAAAGCTGAGCAAGTTGGACGGGCAAGTGTGGATCAttorney Docket No. 061529-516001WOSEQGene SequenceID NO GCCCTGTACAACCTGCTGCTAAGCCCTGAGGCTCAGGCGC GCTACTGCCTCACAAGTTTTGCCAAGGGACGGCTACTCAA GCTTCGGGCCTTCCTCACAGACACACTGCTGGACCAGCTG CCCAACCTGGCCCACTTGCAGAGTTTCCTGGCCCATCTGA CCCTAACTGAAACCCAGCCTCCTAAGAAGGACCTGGTGTT GGAACAGATCCCAGAAATCTGGGAGCGGCTGGAGCGAGA AAACAGAGGCAAGTGGCAGGCAATTGCCAAGCACCAGCT CCAGCATGTGTTCAGCCCCTCAGAGCAGGACCTGCGGCTG CAGGCGCGAAGGTGGGCTGAGACCTACAGGCTGGATGTG CTAGAGGCAGTGGCTCCAGAGCGGCCCCGCTGTGCTTACT GCAGTGCAGAGGCTTCTAAGCGCTGCTCACGATGCCAGAA TGAGTGGTATTGCTGCAGGGAGTGCCAAGTCAAGCACTGG GAAAAGCATGGAAAGACTTGTGTCCTGGCAGCCCAGGGT GACAGAGCCAAATGA CCDC39 ATGAGTAGCGAATTCCTGGCTGAGCTGCACTGGGAGGATG 10 GGTTCGCCATCCCGGTGGCGAACGAGGAGAACAAGCTAC TGGAAGATCAGTTGTCAAAGCTGAAGGATGAAAGAGCAA GCTTGCAAGATGAGTTACGTGAGTATGAAGAGCGAATTA ATTCTATGACTTCTCACTTCAAAAATGTTAAGCAAGAGCT CTCAATTACACAGTCTCTTTGCAAAGCAAGGGAGCGTGAG ACTGAAAGTGAAGAACATTTTAAGGCCATTGCTCAAAGA GAATTGGGACGAGTGAAAGATGAAATTCAACGGCTGGAA AATGAGATGGCTTCAATACTGGAAAAGAAAAGTGATAAA GAAAATGGCATATTTAAAGCCACTCAAAAATTGGATGGTT TGAAATGTCAAATGAACTGGGACCAGCAAGCATTGGAGG CCTGGTTAGAAGAATCAGCTCATAAAGATAGTGATGCTCT CACTCTCCAGAAGTATGCACAACAAGATGATAATAAAATC AGGGCACTGACTCTGCAATTAGAAAGACTAACTTTGGAAT GTAATCAGAAAAGAAAGATACTTGACAACGAACTTACAG AGACTATAAGCGCACAGTTAGAATTGGATAAAGCAGCAC AAGATTTTCGTAAGATTCATAATGAAAGACAAGAACTCAT TAAACAATGGGAGAACACAATAGAACAGATGCAGAAGAG GGATGGAGACATAGATAACTGTGCTTTGGAATTAGCAAG GATAAAGCAGGAAACGAGAGAAAAAGAAAATTTGGTTAA AGAAAAGATCAAGTTTTTGGAAAGTGAGATTGGGAATAA CACAGAGTTTGAGAAAAGAATTTCTGTGGCTGATCGTAAA CTTTTAAAATGTAGAACGGCATATCAGGACCATGAAACTA GTAGAATTCAGCTGAAGGGTGAGCTGGATTCTTTAAAAGC CACTGTGAATAGAACTTCCAGTGATTTAGAAGCTCTGAGG AAAAATATTTCCAAGATAAAGAAGGACATTCATGAAGAA ACAGCAAGGTTACAAAAAACTAAAAATCATAATGAGATA ATACAAACAAAATTAAAGGAGATAACTGAGAAAACCATG TCTGTAGAAGAGAAAGCTACTAATTTGGAAGATATGCTAA AGGAGGAGGAAAAAGATGTGAAGGAAGTAGATGTTCAAC TGAACCTCATAAAAGGTGTGCTGTTTAAGAAAGCTCAGGA GTTACAGACTGAGACAATGAAAGAAAAAGCTGTTTTATCAGAAATTGAAGGAACTCGTTCCTCTCTGAAACATCTCAACCAttorney Docket No. 061529-516001WOSEQGene SequenceID NO ATCAGTTACAAAAACTGGATTTTGAAACCTTGAAGCAGCA AGAAATTATGTACAGCCAGGATTTTCACATTCAACAAGTG GAACGGAGAATGTCACGGTTAAAGGGAGAAATTAATTCA GAAGAAAAACAAGCGCTTGAAGCAAAAATTGTTGAACTT AGGAAGTCTTTGGAAGAGAAAAAATCTACATGTGGCCTTT TGGAAACACAGATCAAGAAGCTTCATAATGATCTTTATTT TATCAAGAAGGCACATAGTAAAAACAGTGATGAAAAACA GTCCCTTATGACCAAAATAAATGAACTAAACCTTTTCATC GACAGATCAGAGAAAGAACTTGATAAAGCCAAAGGTTTT AAGCAGGATTTGATGATAGAGGACAATCTTTTAAAACTTG AAGTTAAGCGTACTCGAGAAATGCTTCACAGTAAGGCAG AAGAAGTTCTTTCCCTAGAAAAAAGAAAACAGCAATTAT ACACAGCAATGGAAGAGCGAACTGAAGAAATCAAGGTTC ATAAAACAATGCTTGCGTCACAAATAAGATATGTTGATCA AGAACGGGAAAACATAAGCACTGAGTTTCGCGAGCGGCT AAGTAAAATTGAGAAGCTGAAGAATAGATATGAAATTCT GACTGTTGTTATGCTGCCTCCTGAAGGAGAAGAGGAGAA AACACAGGCCTATTATGTAATAAAGGCTGCTCAAGAAAA AGAAGAACTTCAAAGGGAAGGTGACTGTTTGGATGCCAA GATCAACAAAGCTGAAAAAGAAATCTACGCTCTAGAAAA TACCCTTCAAGTGCTGAACAGCTGTAACAACAATTATAAG CAATCTTTTAAAAAAGTGACTCCATCTAGTGATGAGTATG AGCTAAAAATTCAACTAGAAGAACAAAAAAGAGCTGTTG ATGAAAAATACAGATACAAACAAAGACAAATCAGAGAAC TTCAAGAAGACATCCAGAGCATGGAAAATACATTAGATG TTATAGAACATTTGGCAAATAATGTTAAAGAAAAGTTATC AGAGAAGCAGGCTTATTCATTTCAACTAAGTAAAGAAAC GGAGGAGCAGAAGCCAAAATTAGAAAGAGTGACCAAACA GTGTGCAAAACTCACAAAGGAAATCCGTCTTTTGAAAGAC ACAAAAGATGAAACAATGGAAGAACAAGACATCAAACTT CGTGAAATGAAACAGTTTCACAAAGTTATTGATGAAATGT TAGTTGATATCATAGAAGAAAATACTGAGATCCGTATTAT CCTTCAAACATACTTTCAACAGAGTGGGTTAGAACTACCT ACAGCTAGCACAAAAGGCAGTCGTCAGAGCTCTAGATCTC CTTCACATACTTCACTATCAGCAAGGTCATCTAGGAGTAC AAGTACATCTACTTCTCAGTCTTCAATTAAAGTACTGGAG CTTAAATTCCCGGCCTCCTCTTCACTAGTAGGCAGCCCTTC TAGGCCATCTAGTGCTAGTAGTAGCTCTAGTAATGTTAAG AGCAAAAAGAGCAGCAAATAA CCDC40 ATGGCGGAACCGGGCGGCGCGGCGGGCCGGTCCCATCCG 11 GAAGATGGATCGGCTTCTGAGGGAGAGAAGGAAGGGAAT AATGAAAGCCACATGGTGTCACCACCAGAGAAGGATGAT GCCAGAAAGGTGAAGAAGCTGTCGGTAGCACAGAGCATC CTGAGGAAGTCACAACCCAAGCGGAAGCTGCAATTGAAG AGGGGGAGGTGGAGACAGAAGGGGAAGCAGCAGTGGAA GGGGAAGAGGAGGCTGTGTCCTATGGAGATGCTGAAAGCGAAGAGGAATATTACTATACAGAAACTTCATCCCCGGAAAttorney Docket No. 061529-516001WOSEQGene SequenceID NO GGGCAAATCAGTGCTGCAGATACGACTTACCCGTATTTCA GTCCTCCTCAGGAACTGCCTGGAGAGGAGGCATACGATA GTGTTAGCGGGGAGGCTGGTCTCCAAGGCTTCCAGCAAGA GGCCACCGGTCCACCAGAATCCAGAGAAAGGAGGGTCAC CTCCCCAGAGCCATCCCACGGAGTCTTAGGCCCGTCGGAG C AAATGGGC C AGGTC AC CTCTGGGC C AGC AGTGGGC AGA TTGACAGGATCCACAGAGGAGCCCCAGGGGCAGGTGCTC CCAATGGGCGTCCAGCACCGCTTCCGGCTGAGCCACGGGA GCGACATCGAGTCCTCAGACCTGGAGGAGTTCGTCTCGCA GGAGCCAGTGATCCCCCCAGGGGTGCCCGATGCCCACCCC AGGGAAGGAGACCTGCCAGTGTTCCAGGACCAGATCCAG CAGCCCAGCACCGAGGAGGGGGCCATGGCAGAGAGAGTG GAGTCCGAGGGGAGTGACGAGGAAGCAGAAGACGAAGG GTCCCAGCTGGTGGTTTTGGACCCAGACCACCCCCTGATG GTAAGATTCCAGGCTGCCCTGAAGAACTACCTGAACCGAC AGATCGAAAAGTTGAAGCTGGACCTCCAAGAGCTGGTTGT GGCTACCAAGCAGAGCCGAGCCCAGCGGCAGGAGCTGGG GGTGAATCTCTATGAGGTGCAGCAGCACCTGGTACACCTG CAGAAGCTGCTGGAGAAGAGTCACGACCGCCACGCAATG GCCTCGAGCGAGCGCAGGCAGAAGGAGGAGGAGCTGCAG GCCGCCCGCGCTCTCTACACCAAGACCTGCGCAGCCGCCA ACGAGGAGCGCAAAAAGTTGGCGGCTCTGCAGACTGAGA TGGAGAACTTGGCCCTGCATCTCTTCTACATGCAGAACAT CGACCAGGACATGCGTGACGACATCCGCGTGATGACACA AGTGGTAAAGAAGGCCGAGACGGAGAGGATCCGGGCAGA AATCGAGAAGAAAAAGCAGGACCTGTATGTGGACCAGCT CACCACTCGAGCCCAGCAACTGGAAGAAGACATTGCCCT GTTTGAGGCTCAGTACTTGGCCCAAGCTGAGGACACCCGG ATTTTAAGGAAAGCAGTGAGTGAGGCCTGCACCGAGATC GACGCCATCAGCGTGGAGAAGAGGCGCATCATGCAGCAA TGGGCCAGCAGCCTGGTGGGCATGAAGCACCGCGACGAG GCGCACAGGGCGGTGCTGGAGGCGCTCAGAGGATGCCAG CATCAAGCCAAATCCACCGACGGCGAGATTGAGGCCTAT AAGAAATCCATCATGAAGGAGGAAGAAAAGAACGAGAA GCTGGCGAGCATCCTGAACCGGACAGAGACGGAAGCCAC ACTGCTGCAGAAGCTCACCACCCAGTGCCTGACCAAGCAG GTGGCCCTGCAGAGCCAGTTCAATACCTACAGGCTCACCC TGCAGGACACAGAGGATGCCCTCAGCCAGGACCAGCTGG AACAAATGATACTCACGGAGGAGTTGCAGGCCATCCGCC AAGCCATCCAGGGCGAGCTGGAGCTCAGGAGGAAGACGG ATGCTGCCATCCGGGAGAAGCTGCAGGAGCACATGACCT CCAACAAGACCACCAAATACTTCAACCAGCTCATCCTGAG GCTGCAGAAGGAGAAGACCAACATGATGACACATCTTTC CAAAATCAACGGTGACATTGCCCAGACCACCCTGGACATC ACACACACCAGCAGCAGGCTGGACGCACACCAGAAGACC CTGGTGGAGCTGGACCAGGACGTGAAGAAAGTCAACGAGCTCATCACCAACAGCCAGAGCGAGATCTCCCGGCGCACGAttorney Docket No. 061529-516001WOSEQGene SequenceID NO ATCCTGATCGAGAGGAAGCAAGGGCTCATCAACTTCCTCA ACAAGCAGCTGGAGCGGATGGTCTCCGAGCTGGGGGGGG AAGAAGTGGGGCCCCTGGAGCTTGAAATCAAAAGGCTGA GCAAGCTGATCGACGAGCACGATGGCAAGGCGGTCCAGG CCCAGGTGACCTGGCTGCGCCTGCAGCAGGAGATGGTCA AGGTGACACAGGAGCAGGAGGAGCAGCTGGCCTCCCTGG ACGCATCCAAGAAGGAGCTCCACATCATGGAGCAGAAGA AACTACGAGTAGAAAGCAAGATTGAGCAGGAGAAGAAGG AGCAGAAGGAGATCGAGCACCACATGAAGGACCTGGACA ACGACCTGAAGAAGCTCAACATGTTGATGAATAAAAACC GGTGCAGCTCGGAGGAGCTGGAGCAGAACAACCGGGTGA CAGAGAATGAGTTCGTGCGCTCGCTGAAGGCCTCTGAGAG GGAGACCATCAAGATGCAGGACAAGCTGAACCAGCTCAG CGAGGAGAAGGCGACCCTCCTGAATCAACTGGTGGAAGC AGAACACCAGATTATGCTTTGGGAGAAAAAAATCCAACT GGC AAAAGAGATGC GTTC CTC AGTGGATTC C GAGATC GGC CAGACGGAGATCCGGGCCATGAAGGGCGAGATCCACAGG ATGAAGGTCAGGCTCGGGCAGCTGCTGAAGCAGCAGGAG AAGATGATCCGTGCCATGGAGTTGGCGGTTGCCCGCAGAG AGACCGTCACCACCCAGGCCGAGGGGCAGCGCAAGATGG ACAGGAAGGCGCTCACCCGCACCGACTTCCACCACAAGC AGCTTGAGCTGCGCCGGAAAATCAGGGACGTTCGCAAGG CCACCGATGAGTGCACCAAAACCGTCCTGGAACTGGAAG AAACACAAAGAAATGTGAGCAGCTCCCTCCTAGAGAAGC AGGAAAAGCTGTCGGTGATTCAGGCAGACTTCGACACACT CGAGGCCGACCTCACCCGGCTTGGGGCCCTCAAACGACA GAACCTTTCAGAGATCGTGGCCCTGCAGACACGCCTTAAG CACCTGCAGGCTGTGAAGGAGGGGCGCTACGTGTTCCTGT TCCGCTCCAAGCAGTCCCTAGTGCTGGAGCGCCAGCGCCT GGACAAGCGACTGGCTCTCATCGCCACCATCCTGGACCGC GTGCGGGACGAGTACCCCCAGTTCCAGGAGGCCCTGCAC AAGGTCAGCCAGATGATCGCCAACAAGCTCGAGTCACCAGGGCCCTCCTAG

[0161] In some embodiments, the mRNA encoding CFTR comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 1. In some embodiments, the mRNA encoding DNAI1 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 2. In some embodiments, the mRNA encoding DNAH5 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 3. In some embodiments, the mRNA encoding AAT comprises a polynucleotide sequence at least 85% identical, at least 90%Attorney Docket No. 061529-516001WOidentical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 4. In some embodiments, the mRNA encoding ARMC4 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 5. In some embodiments, the mRNA encoding DNAAF1 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 6. In some embodiments, the mRNA encoding DNAAF2 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 7. In some embodiments, the mRNA encoding DNAAF4 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 8. In some embodiments, the mRNA encoding ZMYND10 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 9. In some embodiments, the mRNA encoding CCDC39 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10. In some embodiments, the mRNA encoding CCDC40 comprises a polynucleotide sequence at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 11.

[0162] Polynucleotide sequences can be optimized for expression in various cells and tissues by adjusting codon usage. Codon usage optimization is known in the art, for example at world wide web owpgenomes.urv.es / OPTIMIZER / . In some embodiments, the codon usage of the polynucleotide is optimized for expression in a cell, for example a human cell.

[0163] In some embodiments, the polynucleotide has a concentration of 0.5-3.0 mg / rnL, 1.0-3.0 mg / mL, or 2.0-3.0 mg / mL of 1.0 mg / mL. In some embodiments, the polynucleotide has a concentration of 0.5 mg / mL, 0.6 mg / rnL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, 1.0 mg / mL, 1.1 mg / mL, 1.2 mg / mL, 1.3 mg / mL, 1.4 mg / mL, or 1.5 mg / mL. In some embodiments, the polynucleotide has a concentration of 1.0 mg / mL.

[0164] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000Attorney Docket No. 061529-516001WOnucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL.

[0165] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL.

[0166] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL.

[0167] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL.

[0168] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL.Attorney Docket No. 061529-516001WOModified polynucleotidesNucleotide analogues

[0169] In some embodiments of the synthetic polynucleotide, the polynucleotide may comprise one or more nucleotide analogues. In some embodiments, the nucleotide analogues replace uridines in a sequence. For example, a sequence using standard nucleotides (A, C, U, T, G) may comprises a uridine at a particular position in a sequence. A sequence may instead have a nucleotide analogue in place of the uridine. The nucleotide analogue may have structure that may still be recognized by the cellular translation machinery such that the polynucleotide comprising a nucleotide analogue may still be translated. The nucleotide analogue may be recognized as synonymous with a standard nucleotide. For example, the nucleotide analogue may be recognized as synonymous with uridine and the resulting translation product is generated as if the nucleotide analogue is a uridine. In some embodiments, at least about 70%, 75%. 80%. 81%. 82%. 83%. 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of nucleotides replacing uridine within said polynucleotide are nucleotide analogues. In some embodiments, fewer than about 15% of nucleotides within said polynucleotide are nucleotide analogues. In some embodiments, fewer than about 30% of the nucleotides are nucleotide analogues. In other cases, fewer than about 27.5%, fewer than about 25%, fewer than about 22.5%, fewer than about 20%, fewer than about 17.5%, fewer than about 15%, fewer than about 12.5%, fewer than about 10%, fewer than about 7.5%, fewer than about 5%, or fewer than about 2.5% of the nucleotides are nucleotide analogues.

[0170] A polyribonucleotide can have the same or a mixture of different nucleotide analogues or modified nucleotides. The nucleotide analogues or modified nucleotides can have structural changes that are naturally or not naturally occurring in messenger RNA. A mixture of various analogues or modified nucleotides can be used. For example, one or more analogues within a polynucleotide can have natural modifications, while another part has modifications that are not naturally found in mRNA. Additionally, some analogues or modified ribonucleotides can have a base modification, while other modified ribonucleotides have a sugar modification. In the same way, it is possible that all modifications are base modifications, or all modifications are sugar modifications or any suitable mixture thereof.

[0171] In some embodiments of the synthetic polynucleotide, the nucleotide analogue is a purine or pyrimidine analogue. In some cases, a polyribonucleotide of the disclosure comprises a modified pyrimidine, such as a modified uridine. A nucleotide analogue may be a pseudouridine (Y). A nucleotide analogue may be a methylpseudouridine. A nucleotideAttorney Docket No. 061529-516001WOanalogue may be a 1 -methylpseudouridine (m1'P). In some embodiments, the polynucleotide comprises a 1 -methylpseudouridine. In some cases a uridine analogue is selected from pseudouridine 1 -methylpseudouridine, 2-thiouridine (s2U), 5 -methyluridine (m5U), 5-methoxyuridine (mo5U), 4-thiouridine (s4U), 5-bromouridine (Br5U), 2'0-methyluridine (U2'm), 2 -amino-2' -deoxy uridine (U2'NH2), 2 '-azi do-2' -deoxy uridine (U2'Ns), and 2'-fluoro-2' -deoxy uridine (U2'F).

[0172] In some embodiments, the synthetic polynucleotide comprises (e.g., one or more) 1-methylpseudouridine. In some embodiments, at least about 80% of nucleotides replacing uridine within said polynucleotide are 1 -methylpseudouridine. In some embodiments, at least (about) 5%, 10%, 15%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%. 82%. 83%. 84%. 85%. 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of nucleotides replacing uridine within said polynucleotide are 1-methylpseudouridine. In some embodiments, 100% of nucleotides replacing uridine within said polynucleotide are 1 -methylpseudouridine.Nucleic Acid Constructs, Vectors, and Engineered Polyribonucleotides

[0173] In some embodiments, the present disclosure provides nucleic acid molecules, such as polynucleotides, which encode one or more polypeptides of interest. The term nucleic acid includes any compound and / or substance that comprises a polymer of nucleotides. Nucleotide polymers that contain greater than 50% of ribose bases or ribonucleotide analogues are referred to as polyribonucleotides. Nucleotide polymers may use altered nucleotide usage that encode a protein or functional fragment thereof, such as CFTR. The sequence of the engineered polynucleotides can be derived from, for example, DNA, RNA, mRNA transcripts, genomic DNA, mitochondrial DNA, mitochondrial RNA, or another suitable nucleic acid that comprises the genetic information of a gene of interest. The nucleic acid constructs, vectors, engineered polyribonucleotides, or compositions can be derived from nucleic acids carrying mutated genes and polymorphisms.

[0174] In addition to the four canonical ribonucleotides, namely, adenosine, guanosine, cytidine and uridine, several cellular RNAs also contain a number of structurally diverse ribonucleotides. About a hundred structurally different nucleotides or nucleotide analogues have been identified in transfer RNAs (tRNAs), ribosomal RNAs (rRNAs), messenger RNAs (mRNAs) and small nuclear RNAs (snRNAs). In tRNAs, some nucleotides can be important determinants of the specificity and efficiency of aminoacylation and codon recognition. Such structurally diverse ribonucleotides can be a modified ribonucleotide or a nucleotide analogue.Attorney Docket No. 061529-516001WOIn some cases, a polynucleotide of the disclosure is engineered to comprise a ribonucleotide analogue.

[0175] In some cases, a nucleic acid construct, a vector, or a polynucleotide is engineered to contain the four classical ribonucleotides and can be modified post-transcriptionally, after being administered to a subject. For instance, in some cases the disclosure provides a composition, vector, or a nucleic acid construct comprising a nucleic acid construct encoding CFTR, wherein fewer than 30% of the nucleic acids encoding CFTR are nucleotide analogues. In other cases, fewer than 27.5%, fewer than 25%, fewer than 22.5%, fewer than 20%, fewer than 17.5%, fewer than 15%, fewer than 12.5%, fewer than 10%, fewer than 7.5%, fewer than 5%, or fewer than 2.5% of the nucleotides encoding CFTR are nucleotide analogues.

[0176] Example nucleic acids that can form a polynucleotide of the disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), or hybrids thereof. Example modified nucleotides that can form at least a fraction of a polynucleotide of the disclosure include, but are not limited to, pseudouridine (T) and 1 -methylpseudouridine (ml ).

[0177] A chemical modification can be located on one or more nucleoside(s) or the backbone of the nucleic acid molecule. They can be located on both a nucleoside and a backbone linkage. A modification can be engineered into a polynucleotide in vitro. Modified ribonucleotides and nucleic acid analogues can also be introduced post-transcriptionally by covalent modification of the classical ribonucleotides.

[0178] A nucleic acid construct, a vector, or an engineered polyribonucleotide of the disclosure can comprise purine and pyrimidine analogues. In some cases, a polyribonucleotide of the disclosure comprises a modified pyrimidine, such as a modified uridine. In some cases, a uridine analogue is selected from pseudouridine ( ), 1 -methylpseudouridine (ml ). 2-thiouridine (s2U), 5 -methyluridine (m5U), 5-methoxyuridine (mo5U), 4-thiouridine (s4U), 5-bromouridine (Br5U), 2'O-methyluridine (U2'm), 2'-amino-2'-deoxyuridine (U2'NH2), 2'-azido-2'-deoxyuridine (U2'N3), and 2'-fluoro-2'-deoxyuridine (U2F).

[0179] In some instances, the nucleic acid construct(s), vector(s), engineered polyribonucleotide(s), or composition(s) encodes CFTR or a variant thereof at a level that is increased by a factor of at least about 1.5 as compared to levels within cells exposed to a composition comprising a nucleic acid construct that does not include the codons encoding CFTR or a variant thereof. In some cases, the factor is at least about 1.1, at least about 1.2, at least about 1.3, at least about 1.4, at least about 1.5, at least about 2. at least about 3, at least about 4, at least about 5, at least about 10, at least about 20, at least about 30, at least about 40,Attomey Docket No. 061529-516001WOat least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100.

[0180] A polyribonucleotide can have the same or a mixture of different nucleotide analogues or modified nucleotides. The nucleotide analogues or modified nucleotides can have structural changes that are naturally or not naturally occurring in messenger RNA. A mixture of various analogues or modified nucleotides can be used. For example, one or more analogues within a polynucleotide can have natural modifications, while another part has modifications that are not naturally found in mRNA. Additionally, some analogues or modified ribonucleotides can have a base modification, while other modified ribonucleotides have a sugar modification. In the same way, it is possible that all modifications are base modifications or all modifications are sugar modifications or any suitable mixture thereof.

[0181] In some embodiments, the polynucleotide comprises one or more modifications selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, I-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-l-methyl-pseudouridine, 2- thio- 1-methyl-pseudouri dine, 1-methyl-l-deaza-pseudouridine, 2 -thio- 1 -methyl- 1 -deaza-pseudo uridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcylidine. 5-formylcytidine, N4-methylcytidine, 5 -hydroxy methylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio- 1-methyl-pseudoisocytidine, 4-thio-l-methyl-l-deaza-pseudoisocytidine, 1 -methyl- 1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy -cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l -methyl-pseudoisocytidine. 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl adenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine. N6-threonylcarbamoyl adenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6, N6-Attorney Docket No. 061529-516001WOdimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2 -methoxy -adenine, inosine, 1 -methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy -guanosine, 1 -methylguanosine, N2-methylguanosine, N2, N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2, N2-dimethyl-6-thio-guanosine, and combinations thereof.

[0182] In some embodiments, a polynucleotide of the disclosure comprises a modified pyrimidine, such as a modified uridine. In some cases a uridine analogue is selected from pseudouridine (’P), 1 -methylpseudouridine (m'P), 2-thiouridine (s2U), 5-methyluridine (m5U), 5-methoxyuridine (mo5U), 4-thiouridine (s4U), 5-bromouridine (Br5U), 2' O-methyl uridine (U2’m), 2'-amino-2'-deoxyuridine (U2'NH2), 2'-azido-2'-deoxyuridine (U2'Ns), and 2'-fluoro-2'-deoxyuridine (U2'F).Modification in untranslated regions

[0183] In some embodiments, a polynucleotide such as a nucleic acid construct, a vector, or a polyribonucleotide of the disclosure can comprise one or more untranslated regions. An untranslated region can comprise any number of modified or unmodified nucleotides. Untranslated regions (UTRs) of a gene are transcribed but not translated into a polypeptide. In some cases, an untranslated sequence can increase the stability of the polynucleotide and the efficiency of translation. The regulatory features of a UTR can be incorporated into the modified mRNA molecules of the present disclosure, for instance, to increase the stability of the molecule. The specific features can also be incorporated to ensure controlled downregulation of the transcript in case they are misdirected to undesired organ sites. Some 5' UTRs play roles in translation initiation. A 5' UTR can comprise a Kozak sequence which is involved in the process by which the ribosome initiates translation of many genes. Kozak sequences can have the consensus GCC(R)CCAUGG (SEQ ID NO: 12), where R is a purine (adenine or guanine) that is located three bases upstream of the start codon (AUG). 5 ' UTRs may form secondary structures which are involved in binding of translation elongation factor. In some cases, one can increase the stability and protein production of the polynucleotide molecule of the disclosure, by engineering the features ty pically found in abundantly expressed genes of specific target organs. For example, introduction of 5 UTR of liver-expressed mRNA, such as albumin, serum amyloid A. Apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can be used to increase expression of a polynucleotide in a liver.Attorney Docket No. 061529-516001WOLikewise, use of 5' UTR from muscle proteins (MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (Tie-1, CD36), for myeloid cells (C / EBP, AML1, G-CSF, GM-CSF, CD1 lb, MSR, Fr-L i-NOS), for leukocytes (CD45, CD 18), for adipose tissue (CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (SP-A / B / C / D) can be used to increase expression of a polynucleotide in a desired cell or tissue.

[0184] Other non-UTR sequences can be incorporated into the 5' (or 3' UTR) UTRs of the polynucleotides of the present disclosure. The 5' and / or 3' UTRs can provide stability and / or translation efficiency of polynucleotides. For example, introns or portions of intron sequences can be incorporated into the flanking regions of a polynucleotide. Incorporation of intronic sequences can also increase the rate of translation of the polynucleotide.

[0185] In some embodiments, 3' UTRs may have stretches of Adenosines and Uridines embedded therein. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into classes: Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of AREs include GM-CSF and T F-a. Class III ARES are less well defined. These U rich regions do not contain an AUUUA motif c-Jun and Myogenin are two well-studied examples of this class. Proteins binding to the AREs may destabilize the messenger RNA (mRNA), whereas members of the ELAV family, such as HuR, may increase the stability' of mRNA. HuR may bind to AREs of all the three classes. Engineering the HuR specific binding sites into the 3 ' UTR of polynucleotide molecules can lead to HuR binding and thus, stabilization of the message in vivo. Engineering of 3' UTR AU rich elements (AREs) can be used to modulate the stability of a polynucleotide. One or more copies of an ARE can be engineered into a polynucleotide to modulate the stability of a polynucleotide. AREs can be identified, removed or mutated to increase the intracellular stability' and thus increase translation and production of the resultant protein. Transfection experiments can be conducted in relevant cell lines, using polynucleotides and protein production can be assayed at various time points post-transfection. For example, cells can be transfected with different ARE-engineering molecules and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hours, 12 hours, 24 hours, 48 hours, and 7 days post-transfection.

[0186] In some embodiments, a polynucleotide such as a nucleic acid construct, a vector, a polyribonucleotide, or compositions of the disclosure can comprise an engineered 5' cap structure, or a 5 '-cap can be added to a polynucleotide intracellularly. The 5 'cap structure ofAttorney Docket No. 061529-516001WOan mRNA can be involved in binding to the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature pseudo-circular mRNA species. The 5 'cap structure can also be involved in nuclear export, increases in mRNA stability, and in assisting the removal of 5' proximal introns during mRNA splicing.

[0187] In some embodiments, a polynucleotide such as a nucleic acid construct, a vector, or a polynucleotide can be 5 '-end capped generating a 5 '-GpppN-3 ' -triphosphate linkage between a terminal guanosine cap residue and the 5 '-terminal transcribed sense nucleotide of the mRNA molecule. The cap-structure can comprise a modified or unmodified 7-methylguanosine linked to the first nucleotide via a 5 '-51triphosphate bridge. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue (Cap-0 structure). The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5'end of the mRNA may optionally also be 2'-O-methylated (Cap-1 structure). 5'-decapping through hydrolysis and cleavage of the guanylate cap structure may target a polynucleotide molecule, such as an mRNA molecule, for degradation. In some cases, a cap can comprise further modifications, including the methylation of the 2' hydroxy -groups of the first 2 ribose sugars of the 5' end of the mRNA. For instance, an eukaryotic cap-1 has a methylated 2'-hydroxy group on the first ribose sugar, while a cap-2 has methylated 2 '-hydroxy groups on the first two ribose sugars. The 5' cap can be chemically similar to the 3 ' end of an RNA molecule (the 5 ' carbon of the cap ribose is bonded, and the free 3'-hydroxyls on both 5'- and 3 '- ends of the capped transcripts. Such double modification can provide significant resistance to 5' exonucleases. Non-limiting examples of 5 ' cap structures that can be used with a polynucleotide include, but are not limited to, m7G(5')ppp(5')N (Cap-0), m7G(5')ppp(5')NlmpNp (Cap-1), and m7G(5')-ppp(5 ')NlmpN2mp (Cap-2).

[0188] Modifications to the modified mRNA of the present disclosure may generate a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life while facilitating efficient translation. Because cap structure hydrolysis requires cleavage of 5'-ppp-5' triphosphate linkages, modified nucleotides may be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) may be used with guanosine a-thiophosphate nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap. Additional modified guanosine nucleotides may be used such as a-methyl-phosphonate and seleno-phosphate nucleotides. Additional modifications include, but are not limited to, 2'-O-methylation of the ribose sugars of 5'-terminal and / or 5'-anteterminal nucleotides of the mRNA on the 2'-hydroxyl group of theAttorney Docket No. 061529-516001WOsugar ring. Multiple distinct 5'-cap structures can be used to generate the 5'-cap of a polynucleotide.

[0189] The modified mRNA may be capped post-transcriptionally. According to the present disclosure, 5' terminal caps may include endogenous caps or cap analogues. According to the present disclosure, a 5' terminal cap may comprise a guanine analogue. Useful guanine analogues include, but are not limited to, inosine, Nl-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8 -oxo-guanosine. 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0190] In some embodiments, an untranslated region can comprise any number of nucleotides. An untranslated region can comprise a length of about 1 to about 10 bases or base pairs, about 10 to about 20 bases or base pairs, about 20 to about 50 bases or base pairs, about 50 to about 100 bases or base pairs, about 100 to about 500 bases or base pairs, about 500 to about 1000 bases or base pairs, about 1000 to about 2000 bases or base pairs, about 2000 to about 3000 bases or base pairs, about 3000 to about 4000 bases or base pairs, about 4000 to about 5000 bases or base pairs, about 5000 to about 6000 bases or base pairs, about 6000 to about 7000 bases or base pairs, about 7000 to about 8000 bases or base pairs, about 8000 to about 9000 bases or base pairs, or about 9000 to about 10000 bases or base pairs in length. An untranslated region can comprise a length of for example, at least 1 base or base pair, 2 bases or base pairs, 3 bases or base pairs, 4 bases or base pairs, 5 bases or base pairs, 6 bases or base pairs. 7 bases or base pairs, 8 bases or base pairs, 9 bases or base pairs, 10 bases or base pairs, 20 bases or base pairs, 30 bases or base pairs, 40 bases or base pairs, 50 bases or base pairs, 60 bases or base pairs, 70 bases or base pairs, 80 bases or base pairs, 90 bases or base pairs, 100 bases or base pairs, 200 bases or base pairs, 300 bases or base pairs, 400 bases or base pairs, 500 bases or base pairs, 600 bases or base pairs, 700 bases or base pairs, 800 bases or base pairs, 900 bases or base pairs, 1000 bases or base pairs, 2000 bases or base pairs, 3000 bases or base pairs, 4000 bases or base pairs, 5000 bases or base pairs, 6000 bases or base pairs, 7000 bases or base pairs, 8000 bases or base pairs, 9000 bases or base pairs, or 10000 bases or base pairs in length.

[0191] In some embodiments, a polynucleotide of the disclosure can comprise a polyA sequence. A polyA sequence (e.g. polyA tail) can comprise any number of nucleotides. A polyA sequence can comprise a length of about 1 to about 10 bases or base pairs, about 10 to about 20 bases or base pairs, about 20 to about 50 bases or base pairs, about 50 to about 100 bases or base pairs, about 100 to about 500 bases or base pairs, about 500 to about 1000 bases or base pairs, about 1000 to about 2000 bases or base pairs, about 2000 to about 3000 bases orAttorney Docket No. 061529-516001WObase pairs, about 3000 to about 4000 bases or base pairs, about 4000 to about 5000 bases or base pairs, about 5000 to about 6000 bases or base pairs, about 6000 to about 7000 bases or base pairs, about 7000 to about 8000 bases or base pairs, about 8000 to about 9000 bases or base pairs, or about 9000 to about 10000 bases or base pairs in length. In some examples, a polyA sequence is at least about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides in length. A polyA sequence can comprise a length of for example, at least 1 base or base pair, 2 bases or base pairs. 3 bases or base pairs, 4 bases or base pairs, 5 bases or base pairs, 6 bases or base pairs, 7 bases or base pairs, 8 bases or base pairs, 9 bases or base pairs, 10 bases or base pairs, 20 bases or base pairs, 30 bases or base pairs, 40 bases or base pairs, 50 bases or base pairs, 60 bases or base pairs, 70 bases or base pairs, 80 bases or base pairs, 90 bases or base pairs, 100 bases or base pairs. 200 bases or base pairs. 300 bases or base pairs, 400 bases or base pairs, 500 bases or base pairs, 600 bases or base pairs, 700 bases or base pairs, 800 bases or base pairs, 900 bases or base pairs, 1000 bases or base pairs, 2000 bases or base pairs, 3000 bases or base pairs, 4000 bases or base pairs, 5000 bases or base pairs, 6000 bases or base pairs, 7000 bases or base pairs, 8000 bases or base pairs, 9000 bases or base pairs, or 10000 bases or base pairs in length. A polyA sequence can comprise a length of at most 100 bases or base pairs, 90 bases or base pairs, 80 bases or base pairs, 70 bases or base pairs, 60 bases or base pairs, 50 bases or base pairs, 40 bases or base pairs, 30 bases or base pairs, 20 bases or base pairs, 10 bases or base pairs, or 5 bases or base pairs.Gene Editing Payload

[0192] The LNPs of the present disclosure can comprise one or more components for gene editing, such as, but not limited to, a guide RNA, a tracr RNA, a sgRNA, an mRNA encoding a gene or base editing protein, a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a clustered regularly interspaced short palindromic repeats (CRISPR) nuclease (e.g, Cas9). a DNA template for gene editing, or a combination thereof. In some embodiments, the payload of the LNPs can be suitable for agenome editing technique. In some embodiments, the genome editing technique can be CRISPR or TALEN. In some embodiments, the LNPs can comprise one or more mRNAs, which can encode a gene editing or base editing protein. In some embodiments, the LNPs can comprise both a gene- or baseediting protein encoding mRNA and one or more guide RNAs. In some embodiments, the LNPs can comprise at least one nucleic acid suitable for a genome editing technique, such as a CRISPR RNA (crRNA), a trans-activating crRNA (tracrRNA), a guide RNA (gRNA), and a DNA repair template. In some embodiments, CRISPR nucleases can have altered activity, forAttorney Docket No. 061529-516001WOexample, modifying the nuclease so that it can be a nickase instead of making double-strand cuts or so that it can bind the sequence specified by the guide RNA but has no enzymatic activity. In some embodiments, the base editing protein can be a fusion protein comprising a deaminase domain and a sequence-specific DNA binding domain, such as an inactive CRISPR nuclease.

[0193] In some embodiments, an LNP of the disclosure comprises one or more components for gene editing.

[0194] In some embodiments, the LNP comprises a gene editing system, wherein the gene editing system comprises a gRNA and the mRNA of the base editor. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar ratio that is 1: 1. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar ratio that is not 1:1. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar or weight ratio less than 1:1. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar or weight ratio of at most about 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:21, 1:22, 1:23, 1:24, 1:25, 1:26, 1:27, 1:28, 1:29, or 1:30. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar or weight ratio of at least about 1:30, 1:29, 1:28, 1:27, 1:26, 1:25, 1:24, 1:23, 1:22, 1:21, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7. 1:6, 1:5, 1:4, 1:3, 1:2, or 1:1. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar or weight ratio of about 1:1, 1:2, 1:3. 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1: 14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:21, 1:22, 1:23, 1:24, 1:25, 1:26, 1:27, 1:28, 1:29, or 1:30, or a range between any two of the foregoing values.

[0195] In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio that is not 1:1. In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio less than 1: 1. In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio of at most about 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9. 1:10. 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:21, 1:22, 1:23, 1:24, 1:25, 1:26, 1:27, 1:28, 1:29, or 1:30. In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio of at least about 1:30, 1:29, 1:28, 1:27, 1:26, 1:25, 1:24, 1:23, 1:22, 1:21, 1:20, 1:19, 1: 18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, or 1:1. In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio of about 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20,Attorney Docket No. 061529-516001WO1:21, 1:22, 1:23, 1:24, 1:25, 1:26, 1:27, 1:28, 1:29, or 1:30, or a range between any two of the foregoing values.Gene Editing Methods

[0196] The presently described LNPs or pharmaceutical composition can comprise a payload of any conventional gene editing methods. In some embodiments, gene editing components can be selectively delivered to the cells of target organ. In some embodiments, the target organ can be lungs. In some embodiments, the cells of target organ can be lung cells. In some embodiments, the cells can be ciliated cells, goblet cells, secretory7cells, club cells, basal cells or ionocytes.

[0197] In some embodiments, the gene editing can be targeted editing. Targeted editing can be achieved either through a nuclease-independent approach or through a nuclease-dependent approach.

[0198] The nuclease-independent targeted editing, such as base-editing and / or prime editing, can involve precise modifications to DNA sequences without creating double-strand breaks. Homologous recombination can be guided by homologous sequences flanking an exogenous polynucleotide to be introduced into an endogenous sequence through the enzy matic machinery of the cells of target organ.

[0199] Base editing can allow for the conversion of one DNA base pair into another at a specific target site. In some embodiments, the nuclease can be a fusion of a deaminase enzyme to a modified Cas9 protein (dCas9) or other engineered Cas variants. In some embodiments, base editing can change C (cytosine) to T (thymine) or A (adenine) to G (guanine) in the endogenous DNA. A guide RNA can be designed to target the specific genomic location of interest in the cells of target organ.

[0200] Prime editing can allow for more complex and precise DNA modifications, including insertions, deletions, and all 12 possible base-to-base conversions (A, C, G, T) without doublestrand breaks. A prime editing guide RNA, which can consist of a guide sequence and a template for the desired edit, can be designed. The prime editor protein (PE2), which can combine a reverse transcriptase and a Cas9 variant, can be guided to the target site by the prime editing guide RNA. The Cas9 variant can generate a single-strand break (nick) in the DNA. The reverse transcriptase then can use the prime editing guide RNA’s template sequence to copy the desired changes into the nicked strand of DNA. Subsequently, the cellular repair machinery of the cells of target organ can repair the nick, incorporating the edited sequence, via homology-directed repair (HDR).Attorney Docket No. 061529-516001WO

[0201] The nuclease-dependent approach can achieve targeted editing with higher frequency through the specific introduction of double strand breaks (DSBs) by specific rare-cutting nucleases (e.g., endonucleases). Such nuclease-dependent targeted editing can also utilize DNA repair mechanisms, for example, non-homologous end joining (NHEJ), which can occur in response to DSBs. In some embodiments, DNA repair by NHEJ can lead to random insertions or deletions (indels) of a small number of endogenous nucleotides. In contrast to NHEJ mediated repair, repair can also occur by a homology directed repair (HDR). When a donor template containing exogenous genetic material flanked by a pair of homology arms is present, the exogenous genetic material can be introduced into the genome by HDR, which can result in targeted integration of the exogenous genetic material. In some embodiments, a nuclease of the nuclease-dependent targeted editing can include, but not limited to, CRISPR-Cas9, CRISPR-Casl2 (Cpfl), CRISPR-Casl3, C2c2, C2c6, NgAgo, and / or TALEN.

[0202] Methods of using CRISPR-Cas gene editing technology to create a genomic deletion in a cell (e.g., to knock out a gene in a cell) are well-known techniques. See for example, Bauer et al.. J Vis Exp. 95:e52118 (2015). Available endonucleases capable of introducing specific and targeted DSBs can include, but not limited to, ZFN, TALEN, and CRISPR / Cas9.

[0203] In some embodiments, targeted gene editing can be achieved via dual integrase cassette exchange (DICE) system utilizing phiC31 and Bxbl integrases.Base editors

[0204] In some embodiments, the methods provided herein comprises the administration of an LNP, wherein the LNP comprises a nucleic acid encoding a base editor. Base editors comprise fusions between impaired Cas enzymes which are unable to create double stranded breaks (DSBs), and a base-modification enzyme that modifies single-stranded nucleic acids only. Base editing can precisely convert one nucleic acid or base pair into another in genomic DNA or cellular RNA without double-strand breaks. DNA repair templates, or relying on repair mechanisms. Two classes of DNA base editors can convert a base pair to another: cytosine base editors (CBEs) can convert a C-G base pair into a T-A base pair, and adenine base editors (ABEs) can convert an A-T base pair to a G-C base pair. These editors can be used to perform all possible transition mutations. However, while base editors avoid the generation of indels, due to target sequence requirements, the base editing window is more restricted. Of note, cytosine to guanine base editors (CBGEs) have recently also been under development (Kurt, EC., Zhou, R., Iyer, S. et al. CRISPR C-to-G base editors for inducing targeted DNAAttorney Docket No. 061529-516001WOtransversions in human cells. Nat Biotechnol 39, 41-46 (2021), which is incorporated by¬ reference herein in its entirety).

[0205] In some embodiments, the gene editing system comprises a base editor and a guide RNA (gRNA). In some embodiments, the base editor is an adenine base editor (ABE). In other embodiments, the base editors is a cytosine base editor (CBE). An ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. A CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the present disclosure provides base editors having adenosine deaminase domains that are mutated (e.g., evolved to have mutations) that enable the deaminase domain to have improved activity when used with Cas homologs (e.g., homologs other than SpCas9). Accordingly, the present disclosure provides variants of adenosine deaminases (e.g., variants of TadA-7.10). One example of an adenosine deaminase variant is TadA-8e, which contains eight additional mutations relative to the TadA-7.10 deaminase domain (where TadA-7.10 contains the mutations W23R, H36L, P48A, R51L, L84F. A106V, D108N. H123Y, S146C. D147Y, R152P. E155V, I156F, and K157N in the ecTadA sequence). TadA-8e is broadly compatible with diverse Cas9 or Casl2 homologs, and exhibits improved editing efficiencies when paired with previously incompatible Cas9 or Casl2 homologs. For instance, disclosed adenosine deaminase variants such as TadA-8e exhibit higher editing efficiencies when paired in a base editor with certain Cas9 variants, such as circularly permuted variants CP 1041 and CP 1028, than exhibited by the TadA-7.10 deaminase. In some embodiments, the adenosine deaminase is TadA-7.10. In some embodiments, the adenosine deaminase is TadA-8e.

[0206] In some embodiments, any of the disclosed base editors are capable of deaminating adenosine in a nucleic acid sequence (e.g., DNA or RNA). In various embodiments, the adenosine deaminases of the base editors hydrolytically deaminate a targeted adenosine in a nucleic acid of interest to an inosine, which is read as a guanosine (G) by DNA polymerase enzymes. In some embodiments, the base editor is an ABE. In another embodiment, the base editor is ABE8e. In other embodiments, the base editor is a CBE. In some embodiments, the gene editing system comprises a ABE and a guide RNA (gRNA). In some embodiments, the gene editing system comprises a CBE and a guide RNA (gRNA).Attorney Docket No. 061529-516001WOCytosine base editors (CBEs)

[0207] In some embodiments, the base editor is a cytosine base editor. The first generation of CBEs were made up of a cytidine deaminase enzyme, such as an Apolipoprotein B MRNA Editing Enzyme Catalytic Subunit 1 (APOBEC 1 ), fused to the amino terminus of a catalytically impaired Cas, which can only edit single-stranded DNA. The Cas protein can either be a catalytically inactive dCas, or a partially inactive Cas nickase (nCas), which includes mutations that only allow the enzy me to nick the non-edited strand (Porto, E. M., Komor, A. C., et al. Base editing: advances and therapeutic opportunities. Nat Rev Drug Discov 19, 839-859 (2020); Huang, T. P., Newby, G. A. & Liu, D. R. Precision genome editing using cytosine and adenine base editors in mammalian cells. Nat Protoc 16, 1089-1128 (2021), which are incorporated by reference herein in its entirety). The use of nCas9 promotes repair of the non-edited strand using the deaminated strand as template, which increases editing efficiency (Huang, T. P., Newby, G. A. & Liu, D. R. Precision genome editing using cytosine and adenine base editors in mammalian cells. Nat Protoc 16, 1089-1128 (2021 ), which is incorporated by reference herein in its entirety). Improved versions also include uracil glycosylase inhibitor (UGI) in the CBE fusion complex to improve editing efficiency. UGI inhibits uracil DNA glycosylase (UNG), an enzyme which eliminates uracil bases through the base-excision repair (BER) pathway.

[0208] The CBE base editing process begins with sgRNA directing the Cas protein to the target locus. Cas binding to the target denatures the DNA duplex to generate a ssDNA R-loop formation that exposes a region of DNA with target cytosines that the cytidine deaminase enzyme can deaminate. CBEs convert a C-G base pair to a T-A base pair by deaminating the target cytosine to generate uracil, which will be read as a thymine by polymerases (Porto, E. M., Komor, A. C., et al. Base editing: advances and therapeutic opportunities. Nat Rev Drug Discov 19, 839-859 (2020), which is incorporated by reference herein in its entirety). Further fusion proteins have been developed as cytosine base-editors to improve base-editing efficiency, modify the editing window, and reduce indel formation during base-editing (Kim, Y., Komor, A., Levy, J. et al. Increasing the genome-targeting scope and precision of base editing with engineered Cas9-cytidine deaminase fusions. Nat Biotechnol 35, 371-376 (2017), which is incorporated by reference herein in its entirety).Adenine base editors (ABEs)

[0209] Adenine base editors can deaminate an adenosine that leads to a point mutation from adenine (A) to guanine (G). The adenine base editors can comprise the canonical SpCas9, orAttorney Docket No. 061529-516001WOany ortholog Cas9 protein, or any variant Cas9 protein including any naturally occurring variant, mutant, or otherwise engineered version of Cas9 that is known, or which can be made or evolved through a directed evolutionary or otherwise mutagenesis process.

[0210] As methylated cytosines undergo high rates of spontaneous cytosine deamination, and almost half of the pathogenic point mutations identified can be corrected by a base pair conversion from an A-T base pair to a G-C base pair, ABEs are highly relevant in the context of correcting disease-causing mutations. ABEs contain a catalytically impaired Cas protein, either a dCas, with no endonuclease activity, ornCas, which yield single-stranded breaks, fused to a DNA modifying enz me. Escherichia coli tRNA adenosine deaminase (ecTadA). As ssDNA adenosine deaminase enzy mes are not naturally occurring, TadA required extensive engineering and development through the directed mutagenesis to produce the first generation of ABE. Similar to CBEs, sgRNA guides the Cas domain to the intended target locus, which exposes a stretch of ssDNA in an R-loop for editing. TadA deaminates an adenine’s exocyclic amine to yield inosine, which is read as guanine by poly merases, converting A-T base pairs to G-C base pairs (Porto, E. M.. Komor, A. C., et al. Base editing: advances and therapeutic opportunities. Nat Rev Drug Discov 19, 839-859 (2020). which is incorporated by reference herein in its entirety).

[0211] In contrast to CBEs, which are compatible with a variety' of Cas homologs, ABEs are more restricted. Optimization and protein engineering of ABEs have been performed to improve editing efficiency and expand the targeting range. For example, a previous version of ABE, ABE7.10, was compatible with limited Cas9 enzymes and exhibited lower DNA editing efficiency than CBEs. Through directed evolution, the adenosine deaminase enzyme of ABE7.10, TadA-7.10, was evolved to include 8 additional mutations, yielding TadA-8e, which allowed for greater compatibility with more Cas9 and Cas 12a homologs, higher deamination rates, and overall improved DNA editing efficiency. The base editor variant ABE8e contains an ecTadA-8e fused to a Streptococcus pyogenes Cas9 nickase (SpCas9n). ABE8e has a broader base-editing window' than ABE7.10, resulting in an editing window' that is on par with that of CBEs (Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW. Zeng J. Bauer DE, Doudna JA, Liu DR. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility’ and activity’. Nat Biotechnol. 2020 Jul;38(7): 883-891, which is incorporated by reference herein in its entirety).

[0212] In some embodiments, the adenine base editor is an ABE8. In some embodiments the adenine base editor is ABES.20. In some embodiments the adenine base editor is used for analytical methods. In some embodiments, the gene editing payload comprises an ABE8 and aAttorney Docket No. 061529-516001WOTIE2 gRNA targeting payload. In some embodiments, the payload further comprises a spacer. In some embodiments the spacer has a sequence comprising: AGTTAAAGTAGCTGGTAGGA (SEQ ID NO: 13).

[0213] In certain embodiments, the adenine base editors contemplated herein can include a Cas9 protein that is of smaller molecular weight than the canonical SpCas9 sequence. In some embodiments, the smaller-sized Cas9 variants may facilitate delivery to cells, e.g.. by an expression vector, nanoparticle, or other means of delivery. The canonical SpCas9 protein is 1368 amino acids in length and has a predicted molecular weight of 158 kilodaltons. Smaller-sized Cas9 variants can be at least 1300 amino acids, or at least less than 1290 amino acids, or than less than 1280 amino acids, or less than 1270 amino acid, or less than 1260 amino acid, or less than 1250 amino acids, or less than 1240 amino acids, or less than 1230 amino acids, or less than 1220 amino acids, or less than 1210 amino acids, or less than 1200 amino acids, or less than 1190 amino acid, or less than 1180 amino acids, or less than 1170 amino acids, or less than 1160 amino acids, or less than 1150 amino acids, or less than 1140 amino acids, or less than 1130 amino acids, or less than 1120 amino acids, or less than 1110 amino acids, or less than 1100 amino acids, or less than 1050 amino acids, or less than 1000 amino acids, or less than 950 amino acids, or less than 900 amino acids, or less than 850 amino acids, or less than 800 amino acids, or less than 750 amino acids, or less than 700 amino acids, or less than 650 amino acids, or less than 600 amino acids, or less than 550 amino acids, or less than 500 amino acids, but at least larger than about 400 amino acids and retaining the required functions of the Cas9 protein.

[0214] In one embodiment, the base editor is ABE 0.1, ABE 0.2, ABE 1.1, ABE 1.2, ABE 2.1, ABE 2.2, ABE 2.3, ABE 2.4, ABE 2.5, ABE 2.6, ABE 2.7, ABE 2.8, ABE 2.9, ABE 2.10, ABE 2.11, ABE 2.12, ABE 3.1. ABE 3.2, ABE 3.3, ABE 3.4, ABE 3.5, ABE 3.6, ABE 3.7, ABE 3.8, ABE 4.1, ABE 4.2, ABE 4.3, ABE 5.1, ABE 5.2, ABE 5.3, ABE 5.4, ABE 5.5, ABE 5.6, ABE 5.7, ABE 5.8, ABE 5.9, ABE 5.10, ABE 5.11, ABE 5.12, ABE 5.13, ABE 5.14, ABE 6.1, ABE 6.2, ABE 6.3, ABE 6.4, ABE 6.5, ABE 6.6, ABE 7.1, ABE 7.2, ABE 7.3, ABE 7.4, ABE 7.5. ABE 7.6, ABE 7.7, ABE 7.8, ABE 7.9, ABE 7.10, or ABEmax, as described in US 2020 / 0308571. which is hereby incorporated by reference in its entirety. In another embodiment, the base editor is an ABE8 variant. In some embodiments, the base editor is ABE8e.

[0215] Exemplary ABEs include, but are not limited to, ABE7.10 (or ABEmax), ABE8e, SaKKH-ABE8e, NG-ABE8e, ABE-xCas9, SaKKH-ABE7.10, NG-ABE7.10, ABE7.10-VRQR, ABE8e-NRTH, ABE8e-NRRH, ABE8e-NRCH, NG-CP1041-ABE8e,Attorney Docket No. 061529-516001WOABE8eCP1041, ABE8e-CP 1028, and ABE8e-VRQR. In certain embodiments, the ABE used in the disclosed methods is an ABE8e or an ABE7.10. ABE8e may be referred to herein as ■‘ABE8” or 'A. BE8.0.” The ABE8e base editor and variants thereof may comprise an adenosine deaminase domain containing a Tad A- 8 e adenosine deaminase monomer (monomer form) or a TadA-8e adenosine deaminase homodimer or heterodimer (dimer form). ABE8e is further described in Richter MF, Zhao KT, Eton E. Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW, Zeng J, Bauer DE. Doudna JA, Liu DR. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat Biotechnol.2020 Jul;38(7):883-891, which is incorporated by reference herein in its entirety. Other ABEs can be used to deaminate a target adenosine in accordance with the disclosure.

[0216] In some embodiments, the adenosine deaminase domain of any of the disclosed base editors comprises a single adenosine deaminase, or a monomer. In some embodiments, the adenosine deaminase domain comprises 2, 3, 4 or 5 adenosine deaminases. In some embodiments, the adenosine deaminase domain comprises two adenosine deaminases, or a dimer. In some embodiments, the deaminase domain comprises a dimer of an engineered (or evolved) deaminase and a wild-type deaminase, such as a wild-type E. coli-derived deaminase. Base editors are further described in International Publication No. WO 2018 / 027078, published August 2, 2018; International Publication No. WO 2019 / 079347 on April 25, 2019; international Application No PCT / US2019 / 033848, filed May 23, 2019, which published as International Publication No. WO 2019 / 226953 on November 28, 2019; U. S. Patent Publication No. 2018 / 0073012, published March 15, 2018, which issued as U. S. Patent No.10,113,163, on October 30, 2018; U. S. Patent Publication No. 2017 / 0121693, published May 4, 2017, Which issued as U. S. Patent No. 10,167,457 on January71, 2019; International Publication No. WO 2017 / 070633, published April 27, 2017; U. S. Patent Publication No.2015 / 0166980, published June 18, 2015; U. S. Patent No. 9,840,699, issued December 12, 2017; and U. S. Patent No. 10,077,453, issued September 18, 2018, and International Patent Application No. PCT / US2020 / 28568, filed April 16, 2020: all of w hich are incorporated herein by reference in their entireties.CRISPR-Cas9 Gene Editing System

[0217] The CRISPR-Cas9 system is a naturally occurring defense mechanism in prokaryotes that has been repurposed as an RNA-guided DNA-targeting platform used for gene editing. It can rely on the DNA nuclease Cas9, and two noncoding RNAs. crisprRNA (crRNA) and transactivating RNA (tracrRNA), to target the cleavage of DNA. CRISPR is a family of DNAAttorney Docket No. 061529-516001WOsequences found in the genomes of bacteria and archaea that contain fragments of DNA (spacer DNA) with similarity to foreign DNA previously exposed to the cell, for example, by viruses that have infected or attacked the prokaryote. These fragments of DNA can be used by the prokaryote to detect and destroy similar foreign DNA upon re-introduction, for example, from similar viruses during subsequent attacks. Transcription of the CRISPR locus can result in the formation of an RNA molecule comprising the spacer sequence, which can associate with and target Cas (CRISPR-associated) proteins able to recognize and cut the foreign, exogenous DNA. Numerous types and classes of CRISPR / Cas systems have been described in e.g., Koonin et al., Curr Opin Microbiol 37:67-78 (2017).

[0218] crRNA can drive sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing typically with about 20 nucleotide sequence in the target DNA. Changing the sequence of the 5’ 20 nucleotides in the crRNA can allow targeting of the CRISPR-Cas9 complex to specific loci. The CRISPR-Cas9 complex can only bind DNA sequences that contain a sequence match to the first 20 nucleotides of the crRNA, if the target sequence is followed by a specific short DNA motif (with the sequence NGG) referred to as a protospacer adjacent motif (PAM).

[0219] tracrRNA can hybridize with the 3’ end of crRNA to form an RNA-duplex structure that can be bound by the Cas9 endonuclease to form the catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA.

[0220] Once the CRISPR-Cas9 complex is bound to DNA at a target site, two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, leaving a double-strand break (DSB) where both strands of the DNA terminate in a base pair (a blunt end).

[0221] After binding of CRISPR-Cas9 complex to DNA at a specific target site and formation of the site-specific DSB, cells can use two main DNA repair pathways to repair the DSB: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ is a repair mechanism that is highly active in the majority7of cell ty pes, including non-dividing cells. NEIEJ can be error-prone and can often result in the removal or addition of between one and several hundred nucleotides at the site of the DSB. though such modifications can typically be less than 20 nucleotides. The resulting insertions and deletions (indels) can disrupt coding or noncoding regions of genes. Alternatively, HDR can use along stretch of homologous donor DNA, provided endogenously or exogenously, to repair the DSB with high fidelity. HDR is active only in dividing cells and can occur at a relatively low frequency in most cell types.Attorney Docket No. 061529-516001WO

[0222] CRISPR Endonuclease: In some embodiments, Cas9 endonuclease can be used in a CRISPR method for genetically engineering cells of the target organ of the LNPs described herein. In some embodiments, Cas9 enzyme can be from Streptococcus pyogenes, although other Cas9 homologs can also be used. In some embodiments, the Cas9 enzyme can be wildtype Cas9. In some embodiments, the Cas9 enzy me can be a modified version of Cas9 (e.g., evolved versions of Cas9, or Cas9 orthologues or variants). In some embodiments, Cas9 can be substituted with another RNA-guided endonuclease, such as Cpfl (class II CRISPR / Cas system).

[0223] In some embodiments, the CRISPR / Cas system can comprise components derived from a Type-I, Type-II, or Type-Ill system. In some embodiments, the CRISPR / Cas system can comprise components derived from Class 1 and Class 2 CRISPR / Cas systems, having Types I to V or Types II, V, and VI, respectively (Makarova et al., Nat Rev Microbiol 13(ll):722-36 (2015); Shmakov et al., Mol Ce / / 60:385-397 (2015)).

[0224] Class 2 CRISPR / Cas systems can have single protein effectors. Cas proteins of Types II, V, and VI can be single-protein, RNA-guided endonucleases, herein called Class 2 Cas nucleases. Class 2 Cas nucleases can include, for example, but not limited to, Cas9, Cpfl, C2cl, C2c2, and C2c3 proteins. The Cpfl nuclease is homologous to Cas9 and contains a RuvC-like nuclease domain.

[0225] In some embodiments, the Cas nuclease can be from a Type-II CRISPR / Cas system (e.g, a Cas9 protein from a CRISPR / Cas9 system). In some embodiments, the Cas nuclease can be from a Class 2 CRISPR / Cas system (a single-protein Cas nuclease, such as a Cas9 protein or a Cpfl protein). The Cas9 and Cpfl family of proteins are enzymes with DNA endonuclease activity7, and they can be directed to cleave a desired nucleic acid target by designing an appropriate guide RNA, which is further explained infra.

[0226] In some embodiments, a Cas nuclease can compnse more than one nuclease domain. In some embodiments, a Cas9 nuclease can comprise at least one RuvC-like nuclease domain e.g., Cpfl) and at least one HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 nuclease can introduce a DSB in the target sequence. In some embodiments, the Cas9 nuclease can be modified to contain only one functional nuclease domain. For example, the Cas9 nuclease can be modified such that one of the nuclease domains can be mutated or fully or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, the Cas9 nuclease can be modified to contain no functional RuvC-like nuclease domain. In other embodiments, the Cas9 nuclease can be modified to contain no functional HNH-like nuclease domain. In some embodiments in which only one of the nuclease domains can be functional.Attorney Docket No. 061529-516001WOthe Cas9 nuclease can be a nickase that can introduce a single-stranded break (nick) into the target sequence. In some embodiments, a conserved amino acid within a Cas9 nuclease domain can be substituted to reduce or alter anuclease activity. In some embodiments, the Cas nuclease nickase can comprise an amino acid substitution in the RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC-like nuclease domain can include D10A (based on the S. pyogenes Cas9 nuclease). In some embodiments, the nickase can comprise an amino acid substitution in the HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH-like nuclease domain can include, but not limited to, E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 nuclease).

[0227] In some embodiments, the Cas nuclease can be from a Type-I CRISPR / Cas system. In some embodiments, the Cas nuclease can be a component of the Cascade complex of a Type-I CRISPR / Cas system. For example, the Cas nuclease can be a Cas3 nuclease. In some embodiments, the Cas nuclease can be derived from a Type-III CRISPR / Cas system. In some embodiments, the Cas nuclease can be derived from Type-IV CRISPR / Cas system. In some embodiments, the Cas nuclease can be derived from a Type-V CRISPR / Cas system. In some embodiments, the Cas nuclease can be derived from aType-Vl CRISPR / Cas system.

[0228] A Type I CRISPR / Cas system can utilize a large effector complex known as Cascade (CRISPR-associated complex for antiviral defense) for target binding and interference. The Cascade complex can contain multiple Cas proteins, including Cas3, which can be responsible for the destruction of the target DNA. A Type II CRISPR / Cas system, particularly the CRISPR-Cas9 system, can utilize a single Cas9 protein, guided by a synthetic guide RNA (sgRNA), to introduce double-strand breaks in target DNA for subsequent repair or modification. A Type III CRISPR / Cas system can utilize a Csm (CRISPR-Cas subtype multiprotein) or Cmr (CRISPR-Cas subtype ribonucleoprotein) complex for interference. Type III CRISPR / Cas system can target RNA molecules in addition to DNA. A Type V CRISPR / Cas system, including Cpfl (also known as Casl2) and C2c2 (also known as Casl3), can utilize a single effector protein to perform interference. A Type VI CRISPR / Cas system can utilize a single Cas protein, such as C2c2 (also known as Cas 13), to target and cleave RNA molecules, making it useful for RNA editing and manipulation.

[0229] Guide RNAs (gRNAs): The CRISPR technology can involves the use of a genometargeting nucleic acid that can direct one or more endonucleases to a specific target sequence within a target gene for gene editing at the specific target sequence. The genome-targeting nucleic acid can be an RNA. A genome-targeting RNA is referred to as a “guide RNA"’ or “gRNA” herein. A guide RNA can comprise at least one spacer sequence that can hybridizeAttorney Docket No. 061529-516001WOto a target nucleic acid sequence within a target gene for editing, and a CRISPR repeat sequence.

[0230] In Type II systems, the gRNA can also comprise a second RNA called the tracrRNA sequence. In the Type II gRNA, the CRISPR repeat sequence and tracrRNA sequence can hybridize to each other to form a duplex. In the Type V gRNA, the crRNA can form a duplex. In both systems, the duplex can bind a site-directed polypeptide, such that the guide RNA and site-direct polypeptide can form a complex. In some embodiments, the genome-targeting nucleic acid can provide target specificity to the complex by virtue of its association with the site-directed polypeptide. The genome-targeting nucleic acid can thus direct the activity of the site-directed polypeptide.

[0231] As is understood by the person of ordinary skill in the art, each guide RNA can be designed to include a spacer sequence complementary to its genomic target sequence. See Jinek et al., Science 337:816-821 (2012); Deltcheva et al., Nature 471:602-607 (2011).

[0232] In some embodiments, the genome-targeting nucleic acid (e.g., gRNA) can be a double-stranded guide RNA. comprising two strands of RNA molecules. The first strand can comprise in the 5’ to 3’ direction, an optional spacer extension sequence, a spacer sequence, and a minimum CRISPR repeat sequence. The second strand can comprise a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3’ tracrRNA sequence, and an optional tracrRNA extension sequence.

[0233] In some embodiments, the genome-targeting nucleic acid (e.g., gRNA) can be a single-molecule guide RNA (sgRNA). sgRNA in a Type II system can comprise, in the 5’ to 3’ direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3’ tracrRNA sequence, and an optional tracrRNA extension sequence. The optional tracrRNA extension can comprise elements that can contribute additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker can link the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension can comprise one or more hairpins. A single-molecule guide RNA in a Type V system can comprise, in the 5’ to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence.

[0234] A spacer sequence in a gRNA is a sequence (e.g., a 20-nucleotide sequence) that can define the target sequence (e.g., a DNA target sequences, such as a genomic target sequence) of a target gene of interest (e.g., DNAI1 or CFTR). In some embodiments, the spacer sequence can range from 15 to 30 nucleotides. For example, the spacer sequence can contain 15, 16, 17,Attorney Docket No. 061529-516001WO18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, a spacer sequence can contain 20 nucleotides.

[0235] The target sequence is in a target gene (e.g., DNAI 1 or CFTR) that can be adjacent to a PAM sequence and can be the sequence to be modified by an RNA-guided nuclease (e.g., Cas9). The target sequence is on the PAM strand in a target nucleic acid, which is a doublestranded molecule containing the PAM strand and a complementary non-PAM strand. One of skill in the art recognizes that the gRNA spacer sequence can hybridize to the complementary sequence located in the non-PAM strand of the target nucleic acid of interest. Thus, the gRNA spacer sequence can be the RNA equivalent of the target sequence. The spacer of a gRNA can interact with a target nucleic acid of interest in a sequence-specific manner via hybridization (i. e., base pairing). The nucleotide sequence of the spacer thus can vary depending on the target sequence of the target nucleic acid of interest.

[0236] In a CRISPR / Cas system, the spacer sequence can be designed to hybridize to a region of the target nucleic acid that is located 5' of a PAM recognizable by a Cas9 enzyme used in the system. The spacer can perfectly match the target sequence or can have mismatches. Each Cas9 enzyme can have a particular PAM sequence that it can recognize in a target DNA. For example, S. pyogenes can recognize in a target nucleic acid a PAM that comprises the sequence 5’-NRG-3’, where R can comprise either A or G, where N can be any nucleotide and N can be immediately 3‘ of the target nucleic acid sequence targeted by the spacer sequence.

[0237] In some embodiments, the target nucleic acid sequence can have about 20 nucleotides in length. In some embodiments, the target nucleic acid can have less than about 20 nucleotides in length. In some embodiments, the target nucleic acid can have more than about 20 nucleotides in length. In some embodiments, the target nucleic acid can have at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25. 30 or more nucleotides in length. In some embodiments, the target nucleic acid can have at most 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid sequence can have 20 bases immediately 5’ of the first nucleotide of the PAM. For example, in a sequence comprising 5'-NNNNNNNNNNNNNNNNNNNNNRG-3'. the target nucleic acid can be the sequence that corresponds to the Ns, wherein N can be any nucleotide, and the underlined NRG sequence can be the S. pyogenes PAM.

[0238] The guide RNA can target any sequence of interest via the spacer sequence in the crRNA. In some embodiments, the degree of complementarity between the spacer sequence of the guide RNA and the target sequence in the target gene can be about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the spacerAttorney Docket No. 061529-516001WOsequence of the guide RNA and the target sequence in the target gene can be 100% complementary. In other embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene can contain up to 10 mismatches, e.g., up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2, or up to 1 mismatch.

[0239] The length of the spacer sequence in gRNAs can depend on the CRISPR / Cas9 system and components used for editing any of the target genes (e g., DNAI1 or CFTR). For example, different Cas9 proteins from different bacterial species can have varying optimal spacer sequence lengths. Accordingly, the spacer sequence can have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more than 50 nucleotides in length. In some embodiments, the spacer sequence can have 18-24 nucleotides in length. In some embodiments, the targeting sequence can have 19-21 nucleotides in length. In some embodiments, the spacer sequence can comprise 20 nucleotides in length.

[0240] In some embodiments, the gRNA can be an sgRNA, which can comprise a 20-nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA can comprise a less than 20 nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA can comprise a more than 20 nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA can comprise a variable length spacer sequence with about 17-30 nucleotides at the 5’ end of the sgRNA sequence.

[0241] In some embodiments, the gRNAs can comprise unmodified ribonucleic acid. In some embodiments, the gRNAs can comprise modified ribonucleic acid. Various types of RNA modifications can be introduced during or after chemical synthesis and / or enzymatic generation of RNAs, e.g., modifications that can enhance stability, reduce the likelihood or degree of innate immune response, and / or enhance other attributes, as described in the art. In some embodiments, non-natural modified nucleobases can be introduced into any of the gRNAs during synthesis or post-synthesis. In some embodiments, modifications can be on intemucleoside linkages, purine or pyrimidine bases, or sugar. In some embodiments, a modification can be introduced at the terminal of a gRNA with chemical synthesis or with a polymerase enzyme.

[0242] In some embodiments, more than one guide RNAs can be used with a CRISPR / Cas nuclease system. Each guide RNA can contain a different targeting sequence, such that the CRISPR / Cas system can cleave more than one target nucleic acid. In some embodiments, one or more guide RNAs can have the same or differing properties, such as activity or stability within the Cas9 RNP complex. Where more than one guide RNA can be used, each guideAttorney Docket No. 061529-516001WORNA can be encoded on the same or on different vectors. The promoters used to drive expression of the more than one guide RNA can be the same or different.

[0243] In some embodiments, enzymatic or chemical ligation methods can be used to conjugate polynucleotides or their regions with different functional moieties, such as targeting or delivery7agents, fluorescent labels, liquids, nanoparticles, and the like.

[0244] In some embodiments, the CRISPR / Cas nuclease system can contain multiple gRNAs, for example, 2, 3. or 4 gRNAs. Such multiple gRNAs can target different sites in a same target gene. Alternatively, the multiple gRNAs can target different genes. In some embodiments, the guide RNA(s) and the Cas protein can form a ribonucleoprotein (RNP), e.g., a CRISPR / Cas complex. The guide RNAs can guide the Cas protein to a target sequence(s) on one or more target genes (e.g., DNAI1 and CFTR), where the Cas protein can cleave the target gene at the target site. In some embodiments, the CRISPR / Cas complex can be a Cpfl / guide RNA complex. In some embodiments, the CRISPR complex can be a Type-II CRISPR / Cas9 complex. In some embodiments, the Cas protein can be a Cas9 protein. In some embodiments, the CRISPR / Cas9 complex can be a Cas9 / guide RNA complex.

[0245] In some embodiments, the indel frequency (editing frequency) of a particular CRISPR / Cas nuclease system, comprising one or more specific gRNAs, can be determined using a TIDE analysis, which can be used to identify highly efficient gRNA molecules for editing a target gene. In some embodiments, a highly efficient gRNA can yield a gene editing frequency of higher than 80%. For example, a gRNA can be considered to be highly efficient if it can yield a gene editing frequency of at least 80%, at least 85%, at least 90%, at least 95%, or 100%.Other Gene Editing Methods

[0246] Besides the CRISPR system disclosed herein, additional gene editing systems as known in the art can also be used as a payload of the LNPs described herein. In some embodiments, the additional gene editing system can comprise zinc finger nuclease (ZFN), transcription activator-like effector nucleases (TALEN), restriction endonucleases, meganucleases homing endonucleases, or the like.

[0247] ZFNs are targeted nucleases comprising a nuclease fused to a zinc finger DNA binding domain (ZFBD), which can be a polypeptide domain that can bind DNA in a sequencespecific manner through one or more zinc fingers. A zinc finger can be a domain of about 30 amino acids within the zinc finger binding domain whose structure can be stabilized through coordination of a zinc ion. Examples of zinc fingers include, but not limited to, C2H2 zincAttorney Docket No. 061529-516001WOfingers. C3H zinc fingers, and C4 zinc fingers. A designed zinc finger domain can be a domain not occurring in nature whose design / composition results principally from rational criteria, e.g., application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. A selected zinc finger domain can be a domain not found in nature whose production can result primarily from an empirical process such as phage display, interaction trap or hybrid selection. In some embodiments, a ZFN can be a fusion of the FokI nuclease with a zinc finger DNA binding domain.

[0248] A TALEN is a targeted nuclease comprising a nuclease fused to a TAL effector DNA binding domain. A “transcription activator-like effector DNA binding domain”, “TAL effector DNA binding domain”, or “TALE DNA binding domain” is a polypeptide domain of TAL effector proteins that is responsible for binding of the TAL effector protein to DNA. TAL effector proteins can be secreted by plant pathogens of the genus Xanthomonas during infection. These proteins can enter the nucleus of the plant cell, bind effector-specific DNA sequences via their DNA binding domain, and activate gene transcription at these sequences via their transactivation domains. TAL effector DNA binding domain specificity can depend on an effector- variable number of imperfect 34 amino acid repeats, which can comprise polymorphisms at select repeat positions called repeat variable-diresidues (RVD). In some embodiments, a TALEN can be a fusion polypeptide of the FokI nuclease to a TAL effector DNA binding domain.

[0249] Additional examples of targeted nucleases suitable for use can include, but not limited to, Bxbl, phiC31, PhiBTl, and Wp / SPBc / TP901-l, whether used individually or in combination. The Bxbl nuclease, also known as the Bxbl integrase, is a site-specific recombinase enzyme derived from the mycobacteriophase Bxbl. The Bxbl integrase can catalyze site-specific recombination between two specific DNA sequences, referred to as attachment (att) sites. The Bxbl integrase can recognize a specific 48 base-pair sequence within the attachment sites. The phiC31 nuclease, also known as the phiC31 integrase, is derived from the bacteriophage phiC31. The phiC31 nuclease can catalyze site-specific recombination between two specific DNA sequences, referred to as attB (attachment site in bacteriophage) and attP (attachment site in the phage). The phiC31 nuclease can promote integration of a DNA fragment flanked by attB and attP into the genome in cells of target organ. The phiBTl nuclease can integrate into a different attachment site than phiC31. The Wp / SPBc / TP901-l nuclease, also known as bacteriophage P2 Bxbl Cre nuclease, is a sitespecific recombination enzyme derived from the temperate bacteriophage P2.Attomey Docket No. 061529-516001WOLipids

[0250] The present disclosure contemplates LNP compositions comprising a polynucleotide and a mixture of lipids for delivery to a host cell. Exemplary lipids contemplated for the LNP compositions described herein comprise ionizable cationic lipids, selective organ targeting lipids, helper lipids, structural lipids and polyethylene glycol -conjugated lipids (PEG-lipids).Ionizable cationic lipids

[0251] In some embodiments, the lipid composition comprises an ionizable cationic lipid. In some embodiments, the ionizable cationic lipids contains one or more groups which is protonated at physiological pH but may deprotonate and has no charge at a pH above the pKa of the lipid. The ionizable group may contain one or more protonatable amines which are able to form a cationic group at physiological pH. The ionizable cationic lipid compound may also further comprise one or more lipid components such as two or more fatty acids with C6-C24 alkyl or alkenyl carbon groups. These lipid groups may be attached through an ester linkage or may be further added through a Michael addition to a sulfur atom. In some embodiments, these compounds may be a dendrimer, a dendron, a polymer, or a combination thereof.

[0252] A lipid nanoparticle composition may include one or more ionizable (e.g, ionizable amino) lipids (e.g. lipids that may have a positive or partial positive charge at physiological pH). Ionizable cationic lipids may be selected from the non-limiting group consisting of 3-(didodecy lamino)-N 1, N1,4-tridodecy 1-1 -piperazineethanamine (KL 10), N1 - [2- (didodecylamino)ethyl]N 1, N4, N4-tridodecy 1 -1,4-piperazinedi ethanamine (KL22), 14,25-di tri decy 1-15,18,21, 24-tetraaza-octatriacontane (KL25), l,2-dilinoleyloxy-N, N-dimethylaminopropane (DLin-DMA), 2.2-dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31 -tetraen-19-yl -4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2 dimethylaminoethyl)- [1,3] -di oxolane (DLin-KC2-DMA), l,2-dioleyloxy-N, Ndimethylaminopropane (DODMA), 2-({8[(3(3)-cholest-5-en-3-yloxy ]octy II oxy )N, Ndimethyl-3-[(9Z.12Z)-octadeca-9.12-dien-l-yloxy]propan-l -amine (Octyl-CLinDMA), (2R)-2-({8-[(3(3)-cholest-5-en-3-yloxy]octylIoxy)-N, N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-l-amine(Octyl-CLinDMA (2R)), and (2S) 2-({8-[(3(3)-cholest-5-en-3 -yloxy] octyl } oxy)-N, N-dimethyl-3 -[(9Z,12Z)-octadeca-9,12-di en-1 -yloxy]propan-l-amine (Octyl-CLinDMA (2S)), 4-hydroxybutyl ) azanediyl)bis (hexane-6,l-diyl)bis(2-hexyldecanoate(ALC-0315), or heptadecan-9-yl 8-((2-hydroxy ethyl) (6-oxo-6-Attorney Docket No. 061529-516001WO(undecyloxy) hexyl) amino) octanoate (SM-102). In addition to these, an ionizable cationic lipid may also be a lipid including a cyclic amine group.

[0253] Ionizable cationic lipids can also be the compounds disclosed in International Publication No. WO2017075531, hereby incorporated by reference in its entirety. Ionizable cationic lipids can also be the compounds disclosed in International Publication No. WO2015199952, hereby incorporated by reference in its entirety. In one embodiment, the ionizable cationic lipid may be selected from, but not limited to, an ionizable cationic lipid described in International Publication Nos. W02012040184, WO201 1153120, WO2011149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365. WO2012044638, W02010080724, W0201021865, W02008103276, WO2013086373, WO2015199952, W02015074085. and WO2013086354, US Patent Nos.7,893,302, 7,404,969, 8,283,333, and 8,466,122 and US Patent Publication No. US20100036115, US20120202871, US20130064894, US20130129785, US20130150625, US20130178541 and S20130225836; the contents of each of which are herein incorporated by reference in their entirety.

[0254] Chemical formulas used to represent ionizable cationic lipids of the present application will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups. Similarly, many types of imine groups exist in equilibrium with enamine groups. Regardless of which tautomer is depicted for a given formula, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended.

[0255] The ionizable cationic lipids of the present disclosure may also have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and / or have a better pharmacokinetic profile (e.g, higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise. In some embodiments, the ionizable cationic lipid exhibits low toxicity' in vitro. In some embodiments, the ionizable cationic lipid exhibits low toxicity in vivo. In some embodiments, the ionizable cationic lipid exhibits liver-specific delivery in vivo.

[0256] In addition, atoms making up the ionizable cationic lipids of the present application are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general exampleAttorney Docket No. 061529-516001WOand without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include13C and14C.

[0257] It should be recognized that the particular anion or cation forming a part of any salt form of an ionizable cationic lipids provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002). which is incorporated herein by reference.

[0258] In some embodiments, the ionizable cationic lipid comprises an ammonium group which is positively charged at physiological pH and contains at least two hydrophobic groups. In some embodiments, the ammonium group is positively charged at a pH from about 6 to about 8. In some embodiments, the ionizable cationic lipid is a dendrimer or dendron. In some embodiments, the ionizable cationic lipid comprises at least two C6-C24 alkyl or alkenyl groups.

[0259] In some embodiments, an ionizable cationic lipid comprises between 2 and 6 hydrophobic tails, often alkyl or alkenyl such as C6-C24 alkyl or alkenyl groups, but may have at least 1, at least 2, at least 3, at least 4, at least 5. or more than 6 tails.Compounds of Formula (D-I)

[0260] In some embodiments of the lipid composition, the ionizable cationic lipid comprises at least two C8-C24 alkyl groups. In some embodiments, the ionizable cationic lipid is further defined by the formula:Core-(Repeating Unit)n-Terminating Group (D-I)wherein one or more hydrogen atoms of the core are replaced with a repeating unit and wherein:the core has the formula:a(D-II)wherein:Xi is amino or C1-C12 alkylamino, C1-C12 dialkylamino, C3-C12 heterocycloalkyl, C5-C12 heteroaryl, or a substituted version thereof; Ri is amino, hydroxy, mercapto, C1-C12 alkylamino, or Ci-C 12 di alkyl amino, or a substituted version of either of these groups; and a is 1, 2, 3, 4, 5, or 6; orthe core has the formula:Attorney Docket No. 061529-516001WOX2'L> R2'j\ b / z(D.ni)wherein:X2is N(R5)y;Rs is hydrogen. Ci-Cis alkyl, or substituted Ci-Cis alkyl; andy is 0, 1, or 2, provided that the sum of y and z is 3;R2is amino, hydroxy, mercapto, C1-C12 alkylamino, or C1-C12 dialkylamino, or a substituted version of either of these groups;b is 1. 2, 3, 4, 5, or 6; andz is 1. 2, or 3; provided that the sum of z and y is 3; orthe core has the formula:R3-X^X3^R4c k'd (D-IV)wherein:X3 is -NRe-, wherein Re is hydrogen, Ci-Cs alkyl, or Ci-Cs substituted alkyl, -O-, or Ci-Cs alkylaminodiyl, Ci-Cs alkoxy diyl, Ce-Cs arenediyl, C5- C§ heteroarenediyl, Cs-Cgheterocycloalkanediyl, or a substituted version of any of these groups;R3 and R4 are each independently amino, hydroxy, mercapto, C1-C12 alkydamino, or C1-C12 dialkylamino, or a substituted version of either of these groups; or a group of the formula: -N(Rf)i(CH2CH2N(Rc))cR.d.Rc^.3 alkyl RcN-^— CH2CH2- N~ y RdN-t— CH2CH2- N— j— Rd' 4, orRc CH2CH2 — N — j-4 wherein:e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3;Rc, Rd, and Rf are each independently hydrogen, Ci-Ce alkyl, or substituted Ci-Ce alky l;c and d are each independently 1, 2, 3, 4, 5, or 6; orAttorney Docket No. 061529-516001WOthe core is Ci-Cis alkylamine, C1-C36 dialkylamine, C3-C12 heterocycloalkane, or a substituted version of any of these groups;wherein the repeating unit comprises a degradable diacyl or a degradable diacyl and a linker;the degradable diacyl group has the formula:R9 (D-VII)wherein:Ai and A2 are each independently -O-, -S-, or -NRa~, wherein: Ra is hydrogen, Ci-Cg alkyl, or substituted C1-G5 alkyl;Y3 is C1-C12 alkanediyl, C1-C12 alkenediyl, C6-C12 arenediyl, or a substituted version of any of these groups; or a group of the formula:wherein:X3 and X4 are C1-C12 alkanediyl, C2-C12 alkenediyl, C6-C12 arenediyl, or a substituted version of any of these groups;Ys is a covalent bond, C1-C12 alkanediyl, C1-C12 alkenediyl, G,- C12 arenediyl, or a substituted version of any of these groups; andR9 is Ci-Cs alkyl or substituted Ci-Cs alkyl:the linker group has the formula:wherein:Yi is C1-C12 alkanediyl, Ci-C 12 alkenediyl, C6-C12 arenediyl, or a substituted version of any of these groups; andAttorney Docket No. 061529-516001WO*wherein eachindependently denotes a point of attachment to another repeating unit or a terminating group; andthe terminating group has the formula:'Y-RK10(D-VIII)wherein:Y4 is alkanediyl or an Ci-Cis alkanediyl wherein one or more of the hydrogen atoms on the Ci-Cis alkanediyl has been replaced with -OH, -F, -Cl, -Br, -I, -SH, -OCH3, -OCH2CH3, -SCH3, or-OC(O)CH3;Rio is hydrogen, carboxy, hydroxy,Ce-Cnaryl, C1-C12 alkylamino. C1-C12 dialkylamino, C3-C12N- heterocycloalkyl, -C(O)N(Rn)- Ci-Ce alkanediyl- C3-C12 heterocycloalkyl, -C(O)- C1-C12 alkylamino, -C(O)- C1-C12 dialkylamino, or -C(O)- CYCY / V-heteroc cloalk l. wherein:R11 is hydrogen, Ci-Ce alkyl, or substituted Ci-Ce alkyl;wherein the final degradable diacyl in the chain is attached to a terminating group;n is 0, 1, 2, 3, 4, 5, or 6;or a pharmaceutically acceptable salt thereof.

[0261] In some embodiments, the terminating group is further defined by the formula:S R10 (D-VIII)wherein:Y4 is Ci-Cis alkanediyl; andRio is hydrogen. In some embodiments, Ai and A2 are each independently -O- or NRa.

[0262] In some embodiments of the dendrimer of formula (D-I), the terminating group is a structure selected from the structures in Table 4.

[0263] In some embodiments of the dendrimer of formula (D-I), the core is further defined by the formula:Attorney Docket No. 061529-516001WO x2(D-III)wherein:X2is N(R5)y;Rs is hydrogen or Ci-Cs alkyl, or substituted Ci-Cis alkyl; and y is 0, 1, or 2, provided that the sum of y and z is 3;R2is amino, hydroxy, or mercapto, or C1-C12 alkylamino, C1-C12 dialkylamino, or a substituted version of either of these groups;b is 1. 2, 3, 4, 5, or 6; andz is 1. 2, 3; provided that the sum of z and y is 3.

[0264] In some embodiments of the dendrimer of formula (D-I), the core is further defined by the formula:cd (D-IV)wherein:X3 is -NRe-, wherein Re is hydrogen, Ci-Cs alkyl, or substituted Ci-Cs alkyl, ~O~, or Ci-Cs alkylaminodiyl, Ci-Cs alkoxydiyl, Ci-Cs arenediyl, Ci-Cs heteroarenediyl, Ci-Csheterocycloalkanediyl, or a substituted version of any of these groups;R3 and R4 are each independently amino, hydroxy, or mercapto, or C1-C12 alkylamino, dialkylamino, or a substituted version of either of these groups; or a group ofRc H f I \ - N— r- CH2CH2- N— j— Rdthe formula: -N(Rf)KCH2CH2N(Rc))eRd, ' C1-3 alkyl RcRC- N I— r (— CH2CH2- N I— \ 4— Rd— k / — CH2CH2— N I— Rd\ 4, or ' 4;;wherein:e and f are each independently 1. 2, or 3; provided that the sum of e and f is 3;Rc, Rd, and Ri are each independently hydrogen, Ci-Ce alkyl, or substituted Ci-Ce alkyl;c and d are each independently 1, 2, 3, 4. 5, or 6.Attorney Docket No. 061529-516001WO

[0265] In some embodiments of the dendrimer of formula (I), the terminating group is represented by the formula:^10 (D-VIII),wherein:Y4 is alkanediyl(c<i8); andRio is hydrogen.

[0266] In some embodiments of the dendrimer of formula (D-I), a core of the structure of formula (D-IV) is:H2N 0, or a pharmaceutically acceptable salt thereof.

[0267] In some embodiments of the dendrimer of formula (D-I), the core comprises a structural formula set forth in Table 1 and pharmaceutically acceptable salts thereof, wherein * indicates a point of attachment of the core to a repeating unit (i.e., where a hydrogen of the core is replaced with a repeating unit).Attorney Docket No. 061529-516001WO

[0268] In some embodiments of the dendrimer of formula (D-I), the degradable diacyl is further defined as:0 0

[0269] In some embodiments of the dendrimer of formula (D-I), the linker is further definedN(D-VI), wherein Yi is Ci-Cs alkanediyl or substituted C1-C12 alkanediyl.

[0270] In some embodiments, in the core of formula (D-IV), Re is H. In some embodiments, in the core of formula (D-IV), Re is Ci-Cs alkyl. In some embodiments, in the core of formula (D-IV), Re is substituted alkyl (e.g, alkyd substituted with -NH2, alkyl substituted with -NHCH3, or alkyl substituted with -NHCH2CH3).

[0271] In some embodiments one or two hydrogen atoms of the core are replaced with a repeating unit. In some embodiments three or four hydrogen atoms of the core is replaced with a repeating unit. In some embodiments five hydrogen atoms of the core is replaced with a repeating unit. In some embodiments six hydrogen atoms of the core is replaced with a repeating unit.

[0272] In some embodiments, wherein in compound of the disclosure, the core of Formula D-II, D-III, or D-IV has a structure of Table 1 and the terminating group of formula D-VII has a structure of Table 4. In each of the structures of Tables 1 and 2,denotes a point ofwattachment to the following structure:0wherein the core of Table 1 and the terminating group of Table 2 are attached at opposite ends of the structure.Table 1. Example core structuresID # Structure1A1 — vt \i — |1A2 \ / 1A3HO^ ' — 'Attorney Docket No. 061529-516001WOID # Structure, 11A411A51 JL2A1— N _H2N2A2X\l—2A32A4N — |2A52A6\2A7 / — \0X2A8N—O N, 12A9 / y^'N2A102A11 AN N NAi i i2A12 A / N N AX1 1Attorney Docket No. 061529-516001WOID # Structure3A1ry3A2x'3 A33A4ANZ3A51 J™.4A14A2 04A34A4 YNX^^O'X\-'°\^NA5A1~r H %5A2 AN^. N^N^N^NA1 H |5A3 A N N N N AI | H |VT^N^Ty5A4yNH5A5Attorney Docket No. 061529-516001WOID# Structure6A11 H |6A2 A N N N N6A3yNy6A41H11H2Zx / X / X / XJL / X / Xz^^'1H32H12H22H32H42H52H6Table 2. Example terminating group / peripheries structures ID# StructureSCI ys-J^SC2 •^s^ / SC3SC4SC5Attorney Docket No. 061529-516001WOID # StructureSC6 AxXXXSC7SC8SC9 VW W NSCIOsenSC12SC14SC16SC18 / WX-XSC19 QTzyS^^yOHSOI0Z SO20yS^ / x^^^XyOnSO30SO4 AS^OHHO SO5 yS^A^°HSO6 yS_^0HSO7 yS'- / x / xOHSO8yS^^ / x^x^x^x^OHSO9SN1 VS'^ / X'N / X1SN2 yS^^N^x^xxHysxxx-N / \SN3SN4 ysx^^N^2^SN5 ysxx^N^X]Attorney Docket No. 061529-516001WOID # StructureSN6VS^NQSN7SN80SN9O SN10X 1 < N / 1O SN11 1 N0

[0273] In some embodiments, the ionizable cationic lipid is a compound of Formula A:oD1a RD2aO | O RD2aCH3(CH2)^aSH^O^oJ^N^zuH^N^^O^O¥^24;(CH2)z3aCH3O O O' O pD2a^ pD2a CH3(CH2)z^-z4a- ° °' ' f ^J;(CH2)z3aCH3O Oz4a(A), or a pharmaceutically acceptable salt thereof, wherein:RDlais a C1-C4 alkyl;RD2ais H or a C1-C4 alkyl;zla and z2a are each independently 1, 2, or 3;z3ais 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14; andz4a is 0 or 1

[0274] In some embodiments of the compound of Formula A, RDlais methyl.

[0275] In some embodiments of the compound of Formula A, RD2ais methyl. In some embodiments of the compound of Formula A, RD2ais H.Attorney Docket No. 061529-516001WO

[0276] In some embodiments of the compound of compound of Formula A, zla and z2a are each 1. In some embodiments of the compound of Formula A, zla and z2a are each 2.

[0277] In some embodiments of the compound of Formula A, z3a is 6, 7, or 8.

[0278] In some embodiments of the compound of Formula A, z4a is 0. In some embodiments of the compound of Formula A, z4a is 1.

[0279] In some embodiments, the ionizable cationic lipid is a compound of Formula B:, \ o o,.z5bSon $oXb.OZCH2 / CH3|02S0|O oz5b(B), or a pharmaceutically acceptable salt thereof, wherein

[0281] Xb and Yb are each independently N or CH;

[0282] zlb, z2b, z3b, z4b are each independently 1, 2, or 3; and

[0283] z5b is 3, 4, 5. 6, 7, 8. 9, 10. 11. 12. 13. or 14.

[0284] In some embodiments of the compound of Formula B, zlb, z2b, z3b, and z4b are each 1.

[0285] In some embodiments of the compound of Formula B, z5b is 6, 7, or 8.

[0286] In some embodiments of the compound of Formula B, Xb is N.

[0287] In some embodiments of the compound of Formula B, Yb is N.Attorney Docket No. 061529-516001WO

[0288] In some embodiments, the ionizable cationic lipid is selected from those set forth in Table 3 and pharmaceutically acceptable salts thereof.Table 3. Example ionizable cationic lipid compoundsID# Structure2A2- SC14o / V5 / — d2 CMH,, 0 / (A6- o <y — ' 0SC14 0---Z P '00=3 / N— / d 0-~\0 \, — sf C.4H290 '0 0Attorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WO 10 # Structure / S" C0HHCsH-^ %0Ar°5A3-1- SC8 (5- % < Aartn)% AoX-> 1 C0H170^x-S~Cy? Hy$^ T'O^'O5 % A6YN5A4-1- 0^0 QSC12(5-anii) S VA>°Y° S SACY °Y°L. °y° AT >2H26CISHJSS-CsH,,-s> % AAr°^oA SH° rA5A.4-I- zk < SISC8 (5- oY > 9aim)Y 5.A A^ YAH17V: A ^ CGg HHl7VgY"Attorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WO Structure. o° o'^O OC)2H2S| 0 HN Y^oV5A2-4- SC120S(6 -arm) ° K ’S 0C,xH?50° > S--C12H250^0nS~C12HZS / C)0H21i 0° <y0Jr'N> o5A2-4- SCIO < A t1 6S(6-arm) 0 0C’«H^6 Lo^oS~CJC; H21Attorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOID# Structure3A5- g2-SCSXs Jk,,- £o'AoS ''N'^X>06^0 k^C3H17— SK-k z-x.✓ Q „k 0,sC6H;;; £ <S->'Y° oX, ''<%°"1 cA?%0Y0^0y k^OyO°Y° X\ A S-C8HI7oX S-CGHI7c^py£05A2- SC8 0 <>- -- •• -Z‘X, A z-k v. 0,..--s '- X\? X> XA. XVW#A. y z'^ ^ $ ^N -.•• -•■.•-'A -- <‘A■:? >; &:& x S ■ys..x> ■■•er -c?>.•4. xv. ■•-•<v X.$.-> y-s-...- z-v \..-..x. <•• «...6?>' \0 19 / \ CH3ICHy^O^oA^N^N^^N^^o^Oy^s4cH2)8CH380 / k 0IL-1oX oXcXHXQ0^ nxk \ ^ 0XHS) °CH380 0 CH^CH4s^O^o^^N^Lo^O1^s>CHyH30 0IL-20 N0 f1°men,5Y -0- -0' y'"NTo-.OACH%8CH30 0Attorney Docket No. 061529-516001WOOther Ionizable cationic lipids

[0289] In some embodiments of the lipid composition, the ionizable cationic lipid comprises a structural formula (D-T):wherein:a is 1 and b is 2, 3, or 4; or, alternatively, b is 1 and a is 2, 3, or 4;m is 1 and n is 1; or, alternatively, m is 2 and n is 0; or, alternatively, m is 2 and n is 1; andR1, R2, R’. R4, R5, and R6are each independently selected from the group consisting of H, -CH2CH(OH)R7, -CH(R7)CH2OH, -CH2CH2C(=O)OR7, -CH2CH2C(=O)NHR7, and -CH2R7, wherein R7is independently selected from C3-C18 alkyl, C3-C18 alkenyl having one C=C double bond, a protecting group for an amino group. -C(=NH)NH2, a poly(ethylene glycol) chain, and a receptor ligand;provided that at least two moieties among R1to R6are independently selected from -CH2CH(OH)R7, -CH(R7)CH2OH, -CH2CH2C(=O)OR7, -CH2CH2C(=O)NHR7, or -CH2R7, wherein R7is independently selected from C3-C18 alkyl or C3-C18 alkenyl having one C=C double bond; andwherein one or more of the nitrogen atoms indicated in formula (D-I’) may be protonated to provide a ionizable cationic lipid.

[0290] In some embodiments of the ionizable cationic lipid of formula (D-I’), a is 1. In some embodiments of the ionizable cationic lipid of formula (D-I'), b is 2. In some embodiments of the ionizable cationic lipid of formula (D-I’), m is 1. In some embodiments of the ionizable cationic lipid of formula (D-I’), n is 1. In some embodiments of the ionizable cationic lipid of formula (D-I’), R1, R2, R3, R4, R5, and R6are each independently H or -CH2CH(OH)R7. In some embodiments of the ionizable cationic lipid of formula (D-I’), R1, R2. R3. R4, R5, and R6OHare each independently H or. In some embodiments of the ionizable cationic lipid OHof formula (D-I’), R1, R2, R3, R4, R5, and R6are each independently H or'R7. In some embodiments of the ionizable cationic lipid of formula (D-I’), R7is C3-C18 alkyl (e.g., C6-C12alkyl).Attorney Docket No. 061529-516001WO

[0291] In some embodiments, the ionizable cationic lipid of formula (D-I’) is 13,16,20-tris(2 -hydroxy dodecyl)-! 3, 16, 20, 23-tetraazapentatricontane- 11,25 -diol:

[0292] In some embodiments, the ionizable cationic lipid of formula (D-I’) is (117?, 257?)-13, 16,20-tris((7?)-2-hy droxy dodecyl)- 13, 16, 20, 23-tetraazapentatricontane- 11,25-diol:

[0293] Additional ionizable cationic lipids that can be used in the compositions and methods described herein include those ionizable cationic lipids as described in International Patent Publication W02010144740, W02013149140, WO2016118725. WO2016118724, WO2013063468, WO2016205691, WO2015184256, W02016004202, WO2015199952, W02017004143, WO2017075531, WO2017117528, WO2017049245, WO2017173054 and W02015095340, which are incorporated herein by reference for all purposes. Examples of those ionizable cationic lipids include but are not limited to those as shown in Table 4.Attorney Docket No. 061529-516001WO Table 4. Example Ionizable cationic lipidsAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WOX. -'~SZN / AS^^ ■■'X., -z Ayxyxzxsyx1InJ'N / N / 'NZ N'' NzXZ ^ / N / N / NZ X / N / \Z 1 il / \ '■%x O: <>0R4= -(CH2)2OH, -(CH2)3OH, -(CH2)4OH;^"■■-^'■.^'"■■.^4-. 4'-.‘•^ "'''0, XTCSR4 = -(CH2)2OH, -(CH2)3OH, -(CH2)4OH;pA(YxZxzXYXZ,, A.. / k / x-'X / '-'Z 'R4= -(CH2)2OH, -(CH2)3OH, -(CH2)4OH;•>A / x^ / x ZX / 1 / '... XY\ZX., zXzXz'XZAttorney Docket No. 061529-516001WOAttorney Docket No. 061529-516001WO

[0294] In some embodiments, the ionizable cationic lipid is a dendrimer lipid. In some embodiments, the ionizable cationic lipid is a dendrimer lipid according to Formula (I) or Formula (X). In some embodiments, the ionizable cationic lipid is 4A3-SC7. In some embodiments, the ionizable cationic lipid is 5A2-SC8. In some embodiments, the ionizable cationic lipid is present in the composition at a molar percentage from about 10% to about 35%.

[0295] In some embodiments of the lipid composition, the ionizable cationic lipid is present in the composition at a molar percentage about 5%, about 10%. about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60%.

[0296] In some embodiments of the lipid composition, the ionizable cationic lipid is present in the composition at a molar percentage from about 5% to about 60%, from about 10% to about 50%, from about 10% to about 40%, from about 10% to about 30%, from about 10% to about 25%, from about 10% to about 20%, from about 15% to about 60%, from about 15% to about 50%, from about 15% to about 40%, from about 15% to about 30%, from about 15% to about 20%. from about 20% to about 60%, from about 20% to about 50%, from about 20% to about 40%, from about 20% to about 30%, or from about 10% to about 25%.

[0297] In some embodiments of the lipid composition, the ionizable lipid is present at a molar percentage of at least (about) 5%, at least (about) 10%, at least (about) 15%, at least (about) 20%, at least (about) 25%, or at least (about) 30%. In some embodiments of the lipid composition, the ionizable lipid is present at a molar percentage of at most (about) 5%, at mostAttorney Docket No. 061529-516001WO(about) 10%, at most (about) 15%, at most (about) 20%, at most (about) 25%, or at most (about) 30%.Selective organ targeting (SORT) lipids

[0298] The lipid component of the lipid compositions disclosed herein includes a second (i.e., (“additional”) separate from the first lipid wherein the second lipid is an ionizable cationic lipid, or permanently cationic lipid. In some embodiments of the lipid composition, the lipid (e., nanoparticle) composition is preferentially delivered to a target organ.

[0299] In some embodiments, the second comprises a permanently positively charged moiety (i.e., is a permanently cationic lipid). The permanently positively charged moiety may be positively charged at a physiological pH such that the second (e.g., SORT lipid) comprises a positive charge upon delivery of a polynucleotide to a cell. In some embodiments the positively charged moiety is quaternary amine or quaternary ammonium ion. In some embodiments, the second (e g., SORT lipid) comprises, or is otherwise complexed to or interacting with, a counterion.

[0300] In some embodiments, the second is a permanently cationic lipid (i.e., comprising one or more hydrophobic components and a permanently cationic group). The permanently cationic lipid may contain a group which has a positive charge regardless of the pH. One permanently cationic group that may be used in the permanently cationic lipid is a quaternary ammonium group. The permanently cationic lipid may comprise a structural formula:Y2 A1(S-I), wherein:Yi, Y2, or Y3 are each independently XiC(O)Ri or X2N R3R4R5;provided at least one of Yi, Y2, and Y3 is X2N R3R4R5;Ri is C1-C24 alkyl, C1-C24 substituted alkyl, C1-C24 alkenyl, C1-C24 substituted alkenyl;Xi is O orNRa, wherein Rais hydrogen, C1-C4 alkyl, or C1-C4 substituted alky l;X2 is Ci-Ce alkanediyl or Ci-Cg substituted alkanediyl;R3, R4, and R5 are each independently C1-C24 alkyl, C1-C24 substituted alkyl, C1-C24 alkenyl, C1-C24 substituted alkenyl; andAi is an anion with a charge equal to the number of X2N R3R4R5 groups in thecompound.Attorney Docket No. 061529-516001WO

[0301] In some embodiments, the permanently cationic second (e.g., SORT lipid) has a D +,R6 -R9'N A2structural formula: R 8 ^7 (S-II), wherein:R5-R9 are each independently C1-C24 alky l, C1-C24 substituted alkyl, C1-C24 alkenyl, C1-C24 substituted alkenyl; provided at least one of R6-R9 is a group of C8-C24; andA2 is a monovalent anion.

[0302] In some embodiments, the permanently cationic lipids is l,2-dilauroyl-sn-glycero-3-ethylphosphocholine (12:0 EPC), l,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:0 EPC), l,2-dipalmitoyl-sn-glycero-3-ethylphosphocholine (16:0 EPC), 1,2-distearoyl-sn-glycero-3-ethylphosphocholine (18:0 EPC), l,2-dioleoyl-sn-glycero-3-ethylphosphocholine (18:1 EPC), l-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (16:0-18:0 EPC), 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1 EPC), Dimethyldioctadecylammonium (18:0 DDAB), l,2-dimyristoyl-3-trimethylammonium-propane(14:0 TAP), l,2-dipalmitoyl-3-trimethylammonium-propane (16:0 TAP), 1,2-stearoyl-3-trimethylammonium-propane (18:0 TAP), l,2-dioleoyl-3-trimethylammonium-propane (18:1 TAP, DOTAP), or l,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA).

[0303] In some embodiments, the SORT (additional) lipid is an ionizable cationic lipid (e.g., comprising one or more hydrophobic components and an ionizable group, e.g., a tertiary amino group). The ionizable positively charged moiety may be positively charged at a physiological pH. One ionizable group that may be used in the ionizable cationic lipid is a tertiary7ammine group. In some embodiments of the lipid compositions disclosed herein, the second (e.g.,Osecond (e.g, SORT lipid)) has a structural formula:R2 (S-I’a), wherein:Ri and R2 are each independently C8-C24 alkyl, C8-C24 alkenyl, or a substituted version of either group; andR3 and R3' are each independently Ci-Cr, alkyl or substituted Ci-Ce alkyl.

[0304] In some embodiments of formula (S-I’a) Ri and R2are each independently C8-C24 alkenyl (e.g., hexadecane, heptadecene, or octadecene). In some embodiments of formula (S-Ta), R3 and R3' are each independently Ci-Ce alkyl (e.g., methyl or ethyl). In some embodiments of formula (S-I’a) Ri and R2 are each independently C8-C24 alkenyl, (e.g.,Attorney Docket No. 061529-516001WOhexadecane, heptadecene, or octadecene) and R3 and R3' are each independently Ci-Ce alkyd (e.g, methyl or ethyl).

[0305] In some embodiments, the ionizable cationic lipids is l,2-distearoyl-3-dimethylammonium-propane (18:0 DAP), l,2-dipalmitoyl-3-dimethylammonium-propane (16:0 DAP), l,2-dimyristoyl-3-dimethylammonium-propane (14:0 DAP), l,2-dioleoyl-3-dimethylammonium-propane (18:1 DAP, DODAP), or l,2-dioleyloxy-3-dimethylaminopropane (DODMA).

[0306] In some embodiments, the additional ionizable cationic lipid or permanently cationic lipid comprises ahead group of a particular structure. In some embodiments, the second (e.g., second (e.g., SORT lipid)) comprises a headgroup having a structural formula:’ ’, wherein L is a linker; Z is positively charged moiety and X’ is a counterion. In some embodiment, the linker is a biodegradable linker. The biodegradable linker may be degradable under physiological pH and temperature. The biodegradable linker may be degraded by proteins or enzy mes from a subject. In some embodiments, the positively charged moiety7is a quaternary ammonium ion or quaternary amine.In some embodiments, the SORT (additional ionizable cationic lipid or permanently OR1^C) VL-Z+,X‘cationic) lipid has a structural formula:R2, wherein R1and R2are each independently an optionally substituted C6-C24 alkyl, or an optionally substituted C6-C24 alkenyl.

[0307] In some embodiments, the second (e.g., second (e.g., SORT lipid)) has a structuralformula:R2, wherein R1and R2are each independently an optionally substituted C6-C24 alkyd, or an optionally substituted C6-C24 alkenyl, and R”, R ”, and R”’ are an optionally substituted C1-C4 alkyl.

[0308] In some embodiments, the second (e.g, second (e.g., SORT lipid)) comprises aLinker (L). In some embodiments, L is, wherein:Attorney Docket No. 061529-516001WOp and q are each independently 1, 2, or 3; andR4is an optionally substituted Ci-Ce alkyl

[0309] In some embodiments, a second or third lipid (e.g., SORT lipid) has a structural O XR< - --xxx °P'°o" Vo'Pb 1<R3'R3V R?R3'formula:(IA). wherein:Ri and R2 are each independently C8-C24 alkyl, C8-C24 alkenyl, or a substituted version of either group;R3, R3', and R3" are each independently Ci-Ce alkyl or substituted Ci-Cg alkyd;R4 is Ci-Ce alkyl or substituted Ci-Cg alkyl; andX is a monovalent anion.

[0310] In some embodiments, a second or third lipid (e g., SORT lipid) is a phosphatidylcholine (e.g., 14:0 EPC). In some embodiments, the phosphatidylcholine O XR< N:R3'R3R3'compound is further defined as:R2(I A), wherein:Ri and R2 are each independently C8-C24 alkyl, C8-C24 alkenyl, or a substituted version of either group;R3, R3', and R3" are each independently Ci-Cg alkyl or substituted Ci-Cg alkyl; and X is a monovalent anion.

[0311] In some embodiments, a second or third lipid (e.g., SORT lipid) is a phosphocholine lipid. In some embodiments, a second or third lipid (e.g., SORT lipid) is an ethylphosphocholine. The ethylphosphocholine may be, by way of example, without being limited to, 1.2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14: 1 EPC). 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (18: 1 EPC), l,2-distearoyl-sn-glycero-3-ethylphosphocholine (18:0 EPC), l,2-dipalmitoyl-sn-glycero-3-ethylphosphocholine (16:0 EPC), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:0 EPC), l,2-dilauroyl-sn-glycero-3-ethylphosphocholine (12:0 EPC), l-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (16:0-18:0 EPC).Attorney Docket No. 061529-516001WOO X"0^,0 R3R3

[0312] In some embodiments, the lipid has a structural formula:(S- I’), wherein:Ri and R2 are each independently Cs-C’24 alkyl. C8-C24 alkenyl, or a substituted version of either group;R3, R3', and R3" are each independently Ci-Ce alkyl or substituted Ci-Ce alkyl; X is a monovalent anion.

[0313] By way of example, and without being limited thereto, a second or third (e.g., SORT lipid) of the structural formula of the immediately preceding paragraph is l,2-dioleoyl-3-trimethylammonium-propane (18:1 DOTAP) (e.g, chloride salt).

[0314] In some embodiments, a second or third lipid (e.g., SORT lipid) has a structural X2R4'"\ ’,R4formula:R4"R4(S-IT), wherein:R4 and R4' are each independently alkyl(C6-c24), alkenyl(C6-c24), or a substituted version of either group;R4" is alkyl(c 24), alkenylc24). or a substituted version of either group;R4"' is alkyl(ci-cs), alkenyl(C2-c8), or a substituted version of either group; andX2 is a monovalent anion.

[0315] By way of example, and without being limited thereto, a second or third lipid (e.g., SORT lipid) of the structural formula of the immediately preceding paragraph is dimethyldioctadecylammonium (DDAB).

[0316] In some embodiments, the second lipid (e.g.. additional (e.g., SORT lipid)) is

[0317] 0l,2-dioleoyl-sn-glycero-3-phosphate (18:1 PA).

[0318] In any of the foregoing embodiments, X or X2 is selected from F, Cl, Br, and I.

[0319] In some embodiments, the second and third lipids are selected from the lipids set forth in Table 5, Table 6A, or Table 6B.Attorney Docket No. 061529-516001WOTable 5. Example second lipids (e.g., additional lipids, e.g., SORT lipids)) y i* i s:~~ — Lipid Name Structure0l,2-Dioleoyl-3- p \ \ i / di m ethyl am monium -propane(18.1 DODAP)0 ©NC1,2-dimyristoyl-3- trimethy 1 ammonium -propane(14:0 TAP) (e.g., chloride salt)01,2 -dipalmitoyl -3- tri m ethy 1 am monium -propane(16:0 TAP) (e.g., chloride salt)0l,2-stearoyl-3- trimethylammonium-propane(18:0 TAP) (e g, chloride salt) x^xx^x^Xx / X^xx^x^^xx^OX^ ( o=4 Oi» 0 l,2-Dioleoyl-3- 0 trimethylammonium-propane O6 oo~=- (18:1 DOTAP) (e.g., chloride / Q - I* salt) 01,2-Di-O-octadeceny 1-3 - trimethylammonium propane \ / x (DOTMA) (e.g., chloride salt) © Dimethyldioctadecylammonium (DDAB) (e.g., bromide salt)1,2-dilauroy 1 -sn -glycero-3- ethy 1 phosphocboline(12:0 EPC) (e.g., chloride salt)Attorney Docket No. 061529-516001WO© © 0 0 ®z— A / j A / x x ii ii @z— l 1,2-Dio!eoyl-sn-glycero-3- ethylphosphocholine (14:0 1 ON Z / ) O O — — EPC) (e.g., chloride salt) O0a-=O OOx--- 0 d d 1 O Zun.. >,2-dimyri stoleoyl-sn-glycero- / 3 -ethylphosphocholine o Zco \=(14:1 EPC) (e.g., tritiate salt)0 ' R "],2-dipalmitoyl-sn-glycero-3- ethylphosphocholine(16:0 EPC) (e.g., chloride salt)1,2-distearoy 1 -sn-glycero-3- ethylphosphocholine(18:0 EPC) (e.g., chloride salt)1,2-dioleoyl-sn-glycero-3- 5X^^xxx^_x^X^^Yr0^^-'0A0'^®; ethylphosphocholine x x.z,, / x,z O ^ A!x® (18:1 EPC) (e.g., chloride salt)( Zo= 0 ‘ l-palmitoyl-2-oleoyl-sn- ° / Zglycero-3-ethylphosphocholine(16:0-18:1 EPC) (e.g, chloridesalt) pOO-D-- 1.2-di~()~octadecenyl-3- bJ.... trimethylammonium propane(18:1 DOTMA) (e g, chloride © Z — / \ Xsalt) 0 X0© X' is a counterion (e.g., Cl', Br', etc.)Table 6A. Example second lipids (e.g., additional lipids, e.g., SORT lipids)Lipid Name Structure1,2-dioleoyl-sn- 0 p glycero-3-phosphate\ f / X X x-x x-'x __ zx x'x x-x o H O ' (18:1 PA) X-.. / ■ x,x \zs, - x X, Z X,x61,2-distearoyl-sn- 9 o glycero-3-phosphate XX X - XX X-. - x - X. / xz \ / \z x / X / AozN^ ■XO" Pfi" OH -X zx x-x x-X X-X / X x-x x-X Z-X,d H 6" (18:0 PA) X / vX,x x,x- -, / vx,x xx- yNg+OAttorney Docket No. 061529-516001WOLipid Name Structure1,2-dipalmitoyl-sn-+X o glycero-3-phosphate l TO 000..- - 2 b(16:0 PA) / \1,2-dimyristoyl-sn- 0 (X 0Jj b I! glycero-3-phosphate\ °- (14:0 PA) x. ^X.^-"x ° "( < ]j ^a+01,2-dilauroyl-sn- glycero-3-phosphate(12:0 PA)? <4-(2,3- bis(tetradecanoyloxy) 1 crpropyl)-4- $ Amethylmorpholin-4- ium chloride \A y rr(MO-14:0-TAP)3- 0 q morpholinopropane- / SB1,2-diyl + Q ditetradecanoate Xo(MO-14:0-DAP)(DEA-14-DAP) 0X.^ *xx'X x-xz..-xx0(Me-14-EPC) r is. ■A*0'CH?"4-(2,3- bis(palmitoyloxy)pro I crpyl)-4- methylmorpholin-4- ium chloride(MO-16:0-TAP)4-methyl-4-(2- Br”(tetradecyloxy)-3- pXXo(tridecyloxy)propyl) / X Xx / / X X. / / X X / Z' Xx / / X X. / X Xx / zOx xz AxzzN^t / Attorney Docket No. 061529-516001WO Lipid Name Structuremorpholin-4-iumbromide(TDMO)TABLE 6B. Additional example second lipids (e.g., additional lipids, e.g., SORT lipids) Lipid name Structure14:0 DAP Oz*x'x..xx^x^vxxxxxy 'Ho16:0 DAP' OO18:0 DAP o zXzX / N / N / N / XzXzxAx x~x XV - xx ^X_xx XX ^x -O H' IfO16:1 EPC / s,0., p 1XX,Xx „z, x^x’ 'XX“ JI. -Q'.1 O'"0" Jj. '.. x'X..., ^........KzO016:1 DAPO °Y^NZ. / X / X / X A JDEA-16:1- 0DAP0> pAttorney Docket No. 061529-516001WOPN-16:1 ODAP0A\P-16:l DAP X / '( o —)Vo( 'MO-16:1- 0oDAP.^^x^x^^x. / XZ?\ / \ ZX Av -AO14-AllylPC o o Me,xxX. xx.xX xX / sv / X X-V.<x, X~~.0 A 0 Me( > 016-AllylPC 'X z ^x.^Xx~x x'-v x'Xx'X<0 o Me<a' ■AO rx / - Q' xi.'O xx Me

[0320] In some embodiments, the permanently cationic lipid is selected from 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (12:0 EPC), l,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:0 EPC), l,2-dipalmitoyl-sn-glycero-3-ethylphosphocholine (16:0 EPC), l,2-distearoyl-sn-glycero-3-ethylphosphocholine (18:0 EPC), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (18:1 EPC), l-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (16:0-18:0 EPC), 1.2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1 EPC), Dimethyldioctadecylammonium (18:0 DDAB), l,2-dimyristoyl-3-trimethylammonium-propane(14:0 TAP), l,2-dipalmitoyl-3-trimethylammonium-propane (16:0 TAP), 1,2-stearoyl-3-trimethylammonium-propane (18:0 TAP), l,2-dioleoyl-3-trimethylammonium-propane (18:1 TAP. DOTAP), or l,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA). In some embodiments, the ethylphosphocholine is 1.2-dipalmitoyl-sn-glycero-3-ethylphosphocholine (16:0 EPC) or 2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:0 EPC).Attorney Docket No. 061529-516001WO

[0321] In some embodiments, the second lipid (e.g., additional lipid, e.g. SORT lipid) is 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (12:0 EPC), l,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (14:0 EPC), l,2-dipalmitoyl-sn-glycero-3-ethylphosphocholine (16:0 EPC), l,2-distearoyl-sn-glycero-3-ethylphosphocholine (18:0 EPC), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (18:1 EPC), l-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (16:0-18:0 EPC), l,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1 EPC), Dimethyldioctadecylammonium (18:0 DDAB), l,2-dimyristoyl-3-trimethylammonium-propane(14:0 TAP), l,2-dipalmitoyl-3-trimethylammonium-propane (16:0 TAP), 1,2-stearoyl-3-trimethylammonium-propane (18:0 TAP), l,2-dioleoyl-3-trimethylammonium-propane (18:1 TAP, DOTAP), or 1,2-di-O-octadeceny 1-3 -trimethylammonium propane (DOTMA), l,2-dioleoyl-sn-glycero-3 -phosphate (18:1 PA), l,2-distearoyl-sn-glycero-3-phosphate (18:0 PA), l,2-dipalmitoyl-sn-glycero-3 -phosphate (16:0 PA), l,2-dimyristoyl-sn-glycero-3-phosphate (14:0 PA), or l,2-dilauroyl-sn-glycero-3-phosphate (12:0 PA).

[0322] In some embodiments, the second lipid (e.g., additional lipid, e.g. SORT lipid) selected from the group shown in Table 5, Table 6A, and Table 6B. In some embodiments, the second lipid (e.g., additional lipid, e.g. SORT lipid) is present in the composition at a molar percentage from about 5% to about 65%. In some embodiments, the second lipid (e.g., additional lipid, e.g. SORT lipid) is present in the composition at a molar percentage from about 5% to about 35%.

[0323] In some embodiments of the lipid composition, the second lipid (e.g., additional lipid, e.g. SORT lipid) is present in the composition at a molar percentage about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60%.

[0324] In some embodiments of the lipid composition, the second lipid (e.g., additional lipid, e.g. SORT lipid) is present in the composition at a molar percentage from about 5% to about 60%, from about 5% to about 50%, from about 5% to about 40%, from about 5% to about 30%, from about 5% to about 20%, from about 5% to about 10%, from about 10% to about 50%, from about 10% to about 40%, from about 10% to about 30%, from about 10% to about 25%, from about 10% to about 20%, from about 15% to about 60%, from about 15% to about 50%, from about 15% to about 40%, from about 15% to about 30%, from about 15% to about 20%, from about 20% to about 60%, from about 20% to about 50%, from about 20% to about 40%, from about 20% to about 30%, or from about 20% to about 25%.

[0325] In some embodiments of the lipid composition, the second lipid (e.g., additional lipid, e.g. SORT lipid) is present at a molar percentage of at least (about) 5%, at least (about) 10%,Attomey Docket No. 061529-516001WOat least (about) 15%, at least (about) 20%, at least (about) 25%, at least (about) 30%, at least (about) 35%, at least (about) 40%, at least (about) 45%, at least (about) 50%, or at least (about) 55%. In some embodiments of the lipid composition, the ionizable lipid is present at a molar percentage of at most (about) 60%, at most (about) 55%, at most (about) 50%, at most (about) 45%, at most (about) 40%, at most (about) 35%, at most (about) 30%, or at most (about) 25%.Phospholipids

[0326] Phospholipids, as defined herein, are any lipids that comprise a phosphate group. The lipid component of a lipid nanoparticle composition may include one or more phospholipids, such as one or more (poly) unsaturated lipids. Phospholipids may assemble into one or more lipid bilayers. In general, phospholipids may include a phospholipid moiety and one or more fatty acid moieties. A phospholipid moiety may be selected from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 24ysophosphatidyl choline, and a sphingomyelin. A fatty acid moiety may be selected from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0327] Non-natural species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid may be functionalized with or cross-linked to one or more alkynes (e.g.. an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group may undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions may be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).

[0328] Phospholipids useful or potentially useful in the compositions and methods may be selected from: l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1.2-dilinoleoyl-sn-glycero-3 -phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), l-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), l-oleoyl-2-Attorney Docket No. 061529-516001WOcholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC). l,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, l,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-diphytanoyl-sn-glycero-3-phosphocholine (4ME 16:0 PC), l,2-diphytanoyl-sn-glycero-3-phospho-(l'-rac-glycerol) (sodium salt) (4ME 16:0 PG), 1.2-diphytanoyl-sn-glycero-3-phospho-L-serine (sodium salt) (4ME 16:0 PS), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, l,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, l,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, and l,2-dioleoyl-sn-glycero-3-phospho-rac-(l -glycerol) sodium salt (DOPG), and sphingomyelin.

[0329] In some embodiments, the phospholipid may contain one or two long chain (e.g., G,-C24) alkyd or alkenyl groups, a glycerol or a sphingosine, one or two phosphate groups, and, optionally, a small organic molecule. The small organic molecule may be an amino acid, a sugar, or an amino substituted alkoxy group, such as choline or ethanolamine. In some embodiments, the phospholipid is a phosphatidylcholine. In some embodiments, the phospholipid is distearoylphosphatidylcholine or dioleoylphosphatidylethanolamine. In some embodiments, other zwitterionic lipids are used, where zwitterionic lipid defines lipid and lipid-like molecules with both a positive charge and a negative charge.

[0330] In some embodiments, the phospholipid is 1.2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0331] In some embodiments, the phospholipid is present in the composition at a molar percentage from about 5% to about 35%.

[0332] In some embodiments of the lipid composition, the phospholipid is present in the composition at a molar percentage from about 7.5% to about 30%.

[0333] In some embodiments of the lipid composition, the phospholipid is present in the composition at a molar percentage about 5%, about 7.5%. about 10%, about 11%, about 12%, about 13%. about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60%.

[0334] In some embodiments of the lipid composition, the phospholipid is present in the composition at a molar percentage from about 5% to about 50%, from about 10% to about 50%, from about 10% to about 40%, from about 10% to about 30%, from about 10% to aboutAttorney Docket No. 061529-516001WO25%, from about 10% to about 20%, from about 15% to about 60%, from about 15% to about 50%, from about 15% to about 40%, from about 15% to about 30%, from about 15% to about 20%, from about 20% to about 60%, from about 20% to about 50%, from about 20% to about 40%, from about 20% to about 30%, or from about 10% to about 25%.

[0335] In some embodiments of the lipid composition, the phospholipid is present at a molar percentage of at least (about) 5%, at least (about) 10%, at least (about) 15%, at least (about) 20%. at least (about) 25%, or at least (about) 30%. In some embodiments of the lipid composition, the ionizable lipid is present at a molar percentage of at most (about) 5%, at most (about) 10%, at most (about) 15%, at most (about) 20%, at most (about) 25%, or at most (about) 30%.Structural lipids

[0336] The lipid nanoparticle may include one or more structural lipids. Structural lipids can be steroids or steroid derivatives. In some embodiments of the lipid composition, the lipid composition further comprises a steroid or steroid derivative. In some embodiments, the steroid or steroid derivative comprises any steroid or steroid derivative. As used herein, in some embodiments, the term "steroid” is a class of compounds with a four ring 17 carbon cyclic structure which can further comprises one or more substitutions including alkyl groups, alkoxy groups, hydroxy groups, oxo groups, acyl groups, or a double bond between two or more carbon atoms. In one aspect, the ring structure of a steroid comprises three fused cyclohexylrings and a fused cyclopentyl ring as shown in the formula:In some embodiments, a steroid derivative comprises the ring structure above with one or more nonalkyl substitutions. In some embodiments, the steroid or steroid derivative is a sterol whereinthe formula is further defined as:In some embodiments, the steroid or steroid derivative is a cholestane or cholestane derivative. In a cholestane, the ring structureAttorney Docket No. 061529-516001WOderivative includes one or more non-alkyl substitution of the above ring system. In some embodiments, the cholestane or cholestane derivative is a cholestene or cholestene derivative or a sterol or a sterol derivative. In other embodiments, the cholestane or cholestane derivative is both a cholesterol and a sterol or a derivative thereof.

[0337] Sterols useful in the compositions and methods described herein may be selected from: cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, and alpha-tocopherol.

[0338] In some embodiments, the sterol is cholesterol. In some embodiments, the sterol is sitosterol. In some embodiments, the cholesterol is present in the composition at a molar percentage from about 20% to about 50%.

[0339] In some embodiments of the lipid composition, the sterol is present in the composition at a molar percentage about 10%, about 15%, about 20%, about 21%, about 22%, about 23%, about 24%. about 25%, about 30%, about 35%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 50%, about 55%, or about 60%.

[0340] In some embodiments of the lipid composition, the sterol is present in the composition at a molar percentage from about 10% to about 60%, from about 20% to about 50%, from about 20% to about 40%, from about 20% to about 30%, from about 20% to about 25%. from about 25% to about 50%, from about 25% to about 40%, from about 25% to about 30%, from about 30% to about 50%, from about 30% to about 40%, from about 30% to about 35%, from about 35% to about 50%, from about 35% to about 45%, from about 35% to about 40%, from about 40% to about 50%, from about 40% to about 45%, or from about 45% to about 50%.

[0341] In some embodiments of the lipid composition, the sterol is present at a molar percentage of at least (about) 20%, at least (about) 25%, at least (about) 30%, at least (about) 35%, at least (about) 40%, or at least (about) 50%. In some embodiments of the lipid composition, the ionizable lipid is present at a molar percentage of at most (about) 60%, at most (about) 15%. at most (about) 45%, at most (about) 40%. at most (about) 35%, at most (about) 30%, at most (about) 25%, or at most (about) 20%.Attorney Docket No. 061529-516001WOPolyethylene glycol-conjugated lipids (PEG-lipids)

[0342] The lipid compositions of the disclosure may include lipids conjugated to polymers, such as lipids conjugated to polyethylene glycol (“PEG-lipid”). Illustrative methods for making and using PEG-lipids are described for example in Int'l Pat. Pub. No. WO2012099755 and U. S. Pat. Pub No. 2014 / 0200257.

[0343] A PEG-lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG-lipid may be PEG-c-DOMG, PEG-DMG (e.g. PEG2000-DMG), PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.

[0344] In one embodiment, PEG-lipids can be PEG-lipids described in Int’l Pat. Pub. No. WO 2012 / 099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG-lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG-lipid is a PEG-OH lipid. As generally defined herein, a “PEG-OH lipid” is a PEG-lipid having one or more hydroxyl ( — OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-OH or hydroxy -PEG-lipid comprises an — OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment.

[0345] In some embodiments of the lipid composition, the lipid composition further comprises a polymer conjugated lipid. In some embodiments, the polymer conjugated lipid is a PEG-lipid. In some embodiments, the PEG-lipid is a diglyceride which also comprises a PEG chain attached to the glycerol group. In other embodiments, the PEG-lipid is a compound which contains one or more C6-C24 long chain alkyl or alkenyl group or a C6-C24 fatty acid group attached to a linker group with a PEG chain. Some non-limiting examples of a PEG-lipid includes a PEG modified phosphatidy lethanolamine and phosphatidic acid, a PEG ceramide conjugated, PEG modified dialkylamines and PEG modified l,2-diacyloxypropan-3-amines, PEG modified diacylglycerols and dialkylglycerols. In some embodiments, PEG modified diastearoylphosphatidylethanolamine or PEG modified dimynstoyl-sw-glycerol. In some embodiments, the PEG modification is measured by the molecular w eight of PEG component of the lipid. In some embodiments, the PEG modification has a molecular weight from about 100 to about 15,000. In some embodiments, the molecular weight is from about 200 to about 500, from about 400 to about 5,000, from about 500 to about 3,000, or from about 1,200 to about 3,000. The molecular weight of the PEG modification is from about 100, 200, 400, 500,Attorney Docket No. 061529-516001WO600, 800, 1,000, 1.250, 1,500, 1,750, 2,000, 2,250, 2,500, 2,750, 3,000, 3,500, 4,000, 4,500, 5,000, 6.000, 7.000, 8,000, 9,000. 10,000, 12,500, to about 15,000. Some non-limiting examples of lipids that may be used are taught by U. S. Patent 5,820,873, WO 2010 / 141069, or U. S. Patent 8,450,298, which is incorporated herein by reference.

[0346] In some embodiments of the lipid composition, the PEG-lipid has a structuralOalkenyl<c 24). or a substituted version of either of these groups; Re is hydrogen, alkyl<c<8), or substituted alkyl(c<8): and x is 1-250. In some embodiments. Re is alkyl(c<8) such as methyl. 12 and R13 are each independently alkyl(c 4-20). In some embodiments, x is 5-250. In one embodiment, x is 5-125 or x is 100-250. In some embodiments, the PEG-lipid is 1,2-dimyristoyl-sw-glycerol. methoxypolyethylene glycol.In some embodiments of the lipid composition, the PEG-lipid has a structuralformula:n3, wherein: m is an integer between 1 and 100 and m and ns are each independently selected from an integer between 1 and 29. In some embodiments, m is 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55. 60. 65, 70, 75, 80, 85, 90, 95, or 100, or any range derivable therein. In some embodiments, m is from about 30 to about 50. In some embodiments, n2 is from 5 to 23. In some embodiments, m is 11 to about 17. In some embodiments, ns is from 5 to 23. In some embodiments, ns is 11 to about 17.

[0347] In some embodiments of the lipid composition, the PEG-lipid is present in the composition at a molar percentage from about 0.5% to about 10%.

[0348] In some embodiments of the lipid composition, the PEG-lipid is present in the composition at a molar percentage about 0.5%, about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, or about 10%.

[0349] In some embodiments of the lipid composition, the PEG-lipid is present in the composition at a molar percentage from about 0.5% to about 10%, from about 0.5% to aboutAttorney Docket No. 061529-516001WO5%, from about 0.5% to about 4%, from about 0.5% to about 3%, from about 0.5% to about 2%, from about 0.5% to about 1%. from about 1% to about 5%, from about 1% to about 4.5%, from about 1% to about 4%, from about 1% to about 3.5%, from about 1% to about 3%, from about 1% to about 2%, from about 2% to about 5%, from about 2% to about 4.5%, from about 2% to about 4%, from about 2% to about 3.5%, from about 2% to about 3%, from about 3% to about 5%, from about 3% to about 4.5%, from about 3% to about 4%, from about 3% to about 3.5%, from about 4% to about 5%, or from about 4% to about 4.5%.

[0350] In some embodiments of the lipid component of the present disclosure, the lipid component comprises the polymer-conjugated lipid at a molar percentage from about 0.5% to about 10%. In some embodiments of the lipid component of the present disclosure, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 1% to about 8%. In some embodiments of the lipid component of the present disclosure, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 2% to about 7%. In some embodiments of the lipid component of the present application, the lipid component comprises the polymer-conjugated lipid at a molar percentage from about 3% to about 5%. In some embodiments of the lipid component of the present disclosure, the lipid component comprises the polymer-conjugated lipid at a molar percentage from about 5% to about 10%. In some embodiments of the lipid component of the present disclosure, the lipid component comprises the polymer-conjugated lipid at a molar percentage of at least (about) 0.5%, at least (about) 1%, at least (about) 1.5%, at least (about) 2%, at least (about) 2.5%, at least (about) 3%, at least (about) 3.5%, at least (about) 4%, at least (about) 4.5%, at least (about) 5%, at least (about) 5.5%, at least (about) 6%, at least (about) 6.5%, at least (about) 7%, at least (about) 7.5%, at least (about) 8%, at least (about) 8.5%, at least (about) 9%, at least (about) 9.5%, or at least (about) 10%. In some embodiments of the lipid component of the present disclosure, the lipid component comprises the polymer-conjugated lipid at a molar percentage of at most (about) 0.5%, at most (about) 1%, at most (about) 1.5%, at most (about) 2%, at most (about) 2.5%, at most (about) 3%, at most (about) 3.5%, at most (about) 4%, at most (about) 4.5%, at most (about) 5%, at most (about) 5.5%, at most (about) 6%, at most (about) 6.5%, at most (about) 7%, at most (about) 7.5%, at most (about) 8%, at most (about) 8.5%, at most (about) 9%, at most (about) 9.5%, or at most (about) 10%.

[0351] In some embodiments of the lipid composition, the PEG-lipid is present at a molar percentage of at least (about) 0.5%, at least (about) 1%, at least (about) 2%, at least (about) 2.5%, at least (about) 3%, or at least (about) 3.5%. In some embodiments of the lipid composition, the ionizable lipid is present at a molar percentage of at most (about) 10%, atAttorney Docket No. 061529-516001WOmost (about) 9%, at most (about) 8%, at most (about) 7%, at most (about) 6%, or at most (about) 5%.

[0352] In some embodiments, the LNP composition comprises mRNA at a lipid: mRNA (weight / weight) ratio between 5:1 and 40:1. In some embodiments, the LNP composition comprises mRNA at a lipid:mRNA ratio between 10:1 and 40:1, between 15:1 and 40:1, between 20:1 and 40:1, between 25:1 and 40:1, between 30:1 and 40:1, between 35:1 and 40:1, between 20:1 and 35:1, between 25:1 and 35:1, between 30: 1 and 35: 1, between 20:1 and 30:1, between 25:1 and 30:1, between 20:1 and 25:1, between 25: 1 and 30:1, between 25:1 and 35:1, between 20:1 and 36:1, between 25:1 and 36:1, or between 5:l and 45:1.I. Pharmaceutical Compositions

[0353] The disclosure also provides pharmaceutical compositions for the LNP compositions described herein. Such pharmaceutical compositions can be used for generating an immune response against an infectious disease in a subject. The pharmaceutical compositions of the disclosure may include a pharmaceutically acceptable carrier. A thorough discussion of such carriers is available in Chapter 30 of Remington: The Science and Practice of Pharmacy (23rded., 2021).

[0354] In some embodiments, the pharmaceutical composition comprises Tris buffer, optionally at a pH from 6-9. In some embodiments, the pharmaceutical composition comprises sucrose, optionally at 5-15%. In some embodiments, the pharmaceutical composition comprises citrate buffer, optionally at a pH 4-6. In some embodiments, the pharmaceutical composition comprises 15mM Tris buffer, optionally at a pH from 6-9, and / or 5-15% sucrose. In some embodiments, the composition comprises lOmM citrate buffer, optionally at a pH from 4-6.

[0355] In some embodiments, the pharmaceutical compositions include one or more of a poloxamer (e.g., Poloxamer 188) polyethylene glycol (“PEG”), sucrose, and a buffer, wherein the buffer comprises a citrate buffer, an acetate buffer, or a Tris buffer.

[0356] In some embodiments, the pharmaceutical composition comprises a citrate buffer. For example, the citrate buffer is at a pH from 4 to 8. In some embodiments, the buffer is an acetate buffer and has a pH from 4 to 8. In some embodiments, the pharmaceutical composition comprises a Tris buffer, and the Tris buffer has a pH from 4 to 8.Attorney Docket No. 061529-516001WO

[0357] In some embodiments, the pharmaceutical composition comprises sucrose. In some embodiments, the sucrose is at a concentration from 1% to 15% w / v, 5% to 15% w / v, 1% to 10% w / v, or 5% to 10% w / v.

[0358] In some embodiments, the pharmaceutical composition can also include excipients and / or additives. Examples of these are surfactants, stabilizers, complexing agents, antioxidants, or preservatives which prolong the duration of use of the finished...

Claims

Attorney Docket No. 061529-516001WOCLAIMS1. A lipid nanoparticle (LNP) comprising a lipid component comprising:(i) a first lipid wherein the first lipid is an ionizable cationic lipid, (ii) a second lipid wherein the second lipid is separate from the first lipid, and wherein the second lipid is a permanently cationic or ionizable cationic lipid, and (iii) a third lipid wherein the third lipid is separate from the first and second lipid, and wherein the third lipid is a permanently cationic or ionizable cationic lipid.

2. The LNP of claim 1, wherein the second lipid is an ionizable cationic lipid.

3. The LNP of claim 1, wherein the second lipid is a permanently cationic lipid.

4. The LNP of claim 1, wherein the second lipid is a trimethylammoniumpropane, a dimethylammoniumpropane or an ethylphosphocholine, or a modified version, derivative, or variant thereof.

5. The LNP of claim 1 or 2, wherein the second lipid is selected from:JI(DEA-16-DAP)<> (PN-16-DAP),o* (P-16 DAP),(DEA- 16: 1 -DAP),(PN-16:1 DAP),(P-16: 1 DAP),Attorney Docket No. 061529-516001WO o, -s-. N(MO-16: l-DAP),cr 'N +C > O (MO-14:0-TAP),o (MO-16:0-TAP), and(TDMO).

6. The LNP of claim 1 or 2, wherein the second lipid is selected from l,2-dimyristoyl-3- dimethylammonium-propane (14:0 DAP), l,2-dipalmitoyl-3-dimethylammonium- propane (16:0 DAP), and l,2-distearoyl-3-dimethylammonium-propane (18:0 DAP).The LNP of claim 1 or 2, wherein the second lipid is(16:1 DAP).

8. The LNP of claim 1 or 2, wherein the second lipid is l,2-dioleoyl-3- dimethylammonium-propane (18:1 DAP, DODAP).

9. The LNP of any one of claims 1-8, wherein the third lipid is a permanently cationic lipid.

10. The LNP of any one of claims 1-8, wherein the third lipid is an ionizable cationic lipid.

11. The LNP of any one of claims 1-9, wherein the third lipid is a trimethylammoniumpropane, a dimethylammoniumpropane or an ethylphosphocholine, or a modified version, derivative, or variant thereof.

12. The LNP of any one of claims 1-9, wherein the third lipid is l,2-dioleoyl-3- trimethylammonium-propane (14:0 TAP).Attorney Docket No. 061529-516001WO13. The LNP of claim 1, 8 or 9, wherein the third lipid is l,2-dimyristoyl-sn-glycero-3- ethylphosphocholine (14:0 EPC).

14. The LNP of claim 1, 8 or 9, wherein the third lipid is l,2-dipalmitoyl-sn-glycero-3- ethylphosphocholine (16:0 EPC).

15. The LNP of claim 1, 8 or 9, wherein the third lipid is:(16:1 EPC).

16. The LNP of claim 1, 8 or 9, wherein the third lipid is l,2-distearoyl-sn-glycero-3- ethylphosphocholine (18:0 EPC).

17. The LNP of claim 1, 8 or 9, wherein the third lipid is l,2-dioleoyl-sn-glycero-3- ethylphosphocholine (18:1 EPC).

18. The LNP of claim 1, 8 or 9, wherein the third lipid is selected from:o r-°-K(Pr-16-EPC),(16-AllylPC),(16-PrgPC),(16-PrAPC), andAttorney Docket No. 061529-516001WO(16:l-PrPC).

19. The LNP of any one of claims 1-18, wherein the lipid component comprises the second lipid in an amount of from about 5 mol% to about 30 mol% of the total lipids in the lipid component.

20. The LNP of any one of claims 1-18, wherein the lipid component comprises the second lipid in an amount of from about 10 mol% to about 30 mol% of the total lipids in the lipid component.

21. The LNP of any one of claims 1-18, wherein the lipid component comprises the second lipid in an amount of from about 10 mol% to about 20 mol% of the total lipids in the lipid component.

22. The LNP of any one of claims 1-18, wherein the lipid component comprises the second lipid in an amount of about 15 mol% of the total lipids in the lipid component.

23. The LNP of any one of claims 1-22, wherein the lipid component comprises the third lipid in an amount of from about 5 mol% to about 30 mol% of the total lipids in the lipid component.

24. The LNP of any one of claims 1-22. wherein the lipid component comprises the third lipid in an amount of from about 10 mol% to about 30 mol% of the total lipids in the lipid component.

25. The LNP of any one of claims 1-22. wherein the lipid component comprises the third lipid in an amount of from about 10 mol% to about 20 mol% of the total lipids in the lipid component.

26. The LNP of any one of claims 1-22. wherein the lipid component comprises the third lipid in an amount of about 13 mol% of the total lipids in the lipid component.

27. The LNP of any one of claims 1-22, wherein the lipid component comprises the third lipid in an amount of about 12.5 mol% of the total lipids in the lipid component.Attorney Docket No. 061529-516001WO28. The LNP of any one of claims 1-22, wherein the lipid component comprises the third lipid in an amount of about 17.5% of the total lipids in the lipid component.

29. The LNP of any one of claims 1-22, wherein the lipid component comprises the third lipid in an amount of about 20% of the total lipids in the lipid component.

30. The LNP of any one of claims 1-22, wherein the lipid component comprises the third lipid in an amount of about 25% of the total lipids in the lipid component.

31. A lipid nanoparticle (LNP) comprising a lipid component comprising:an ionizable cationic lipid, 14:0 DAP and 14:0 TAP.

32. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 16:0 DAP and 14:0 TAP.

33. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 18:0 DAP and 14:0 TAP.

34. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DEA-16-DAP and 14:0 TAP.

35. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, PN-16-DAP and 14:0 TAP.

36. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, P-16 DAP and 14:0 TAP.

37. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 16:1 DAP and 14:0 TAP.

38. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DEA-16: 1-DAP and 14:0 TAP.

39. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, PN-16:1 DAP and 14:0 TAP.

40. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, P-16:l DAP and 14:0 TAP.Attorney Docket No. 061529-516001WOA lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, MO-16: 1-DAP and 14:0 TAP.A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and 14-AllylPC.

43. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and Me-16-EPC.A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and Pr-16-EPC.

45. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and 16-AllylPC.A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and 16-PrgPC.

47. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and 16-PrAPC.A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and 16: 1 EPC.

49. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and 16:l-PrPC.

50. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and 18:0 EPC.

51. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and 18:1 EPC.A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and MO 14:0 TAP.

53. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and MO 16:0 TAP.Attorney Docket No. 061529-516001WO54. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP and TDMO.

55. A lipid nanoparticle (LNP) comprising a lipid component comprising:an ionizable cationic lipid, 14:0 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

56. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 16:0 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

57. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 18:0 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

58. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DEA-16-DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

59. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, PN-16-DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

60. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, P-16 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

61. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, 16:1 DAP in an amount of from about 10 mol% to about 30 mol%,Attorney Docket No. 061529-516001WOoptionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

62. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DEA-16: 1-DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

63. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, PN-16:1 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

64. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, P-16: 1 DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

65. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, MO-16: 1-DAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14:0 TAP in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

66. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 14-AllylPC in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

67. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and Me-16-EPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

68. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%,Attorney Docket No. 061529-516001WOoptionally about 15 mol % and Pr-16-EPC in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

69. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 16-AllylPC in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

70. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 16-PrgPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

71. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 16-PrAPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

72. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 16: 1 EPC in an amount of from about 5 mol% to about 20 mol%, optionally about 12.5 mol% of the total lipids in the lipid component.

73. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 16: 1-PrPC in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

74. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol % and 18:0 EPC in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

75. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%,Attorney Docket No. 061529-516001WOoptionally about 15 mol% and 18: 1 EPC in an amount of from about 5 mol% to about 20 mol%. optionally about 12.5 mol% of the total lipids in the lipid component.

76. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and 14:0 TAP in an amount of from about 15 mol% to about 30 mol%. optionally about 20 mol% or about 27.5 mol % of the total lipids in the lipid component.

77. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and 14:0 EPC in an amount of from about 15 mol% to about 30 mol%, optionally about 20 mol %, about 25 mol%, or about 27.5 mol % of the total lipids in the lipid component.

78. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and MO-14:0 TAP in an amount of from about 15 mol% to about 30 mol%, optionally about 20 mol %, about 25 mol%. or about 27.5 mol % of the total lipids in the lipid component.

79. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and MO-16:0 TAP in an amount of from about 15 mol% to about 30 mol%, optionally about 20 mol %, about 25 mol%, or about 27.5 mol % of the total lipids in the lipid component.

80. A lipid nanoparticle (LNP) comprising a lipid component comprising: an ionizable cationic lipid, DODAP in an amount of from about 10 mol% to about 30 mol%, optionally about 15 mol% and TDMO in an amount of from about 15 mol% to about 30 mol%. optionally about 20 mol %, about 25 mol%, or about 27.5 mol % of the total lipids in the lipid component.

81. A lipid nanoparticle (LNP) comprising a lipid component comprising:Attorney Docket No. 061529-516001WOa first lipid, wherein the first lipid is a permanently cationic or ionizable cationic lipid, and wherein the lipid component comprises the lipid in an amount of from about 10 mol% to about 20 mol % of the total lipids in the lipid component.

82. The LNP of claim 81, wherein the first lipid is a permanently cationic lipid.

83. The LNP of claim 81, wherein the first lipid is an ionizable cationic lipid.

84. The LNP of claim 81, wherein the first lipid is a trimethylammoniumpropane, a dimethylammoniumpropane or an ethylphosphocholine, or a modified version, derivative, or variant thereof.

85. The LNP of claim 81, wherein the first lipid is selected from: DEA-16-DAP, PN-16- DAP. P-16 DAP, DEA- 16:1 -DAP, PN- 16:1 DAP, P-16: 1 DAP, MO-16: 1-DAP, 14:0 DAP, 16:0 DAP, 18:0 DAP, 16:1 DAP, 18:1 DAP, DODAP, 14:0 TAP, 14:0 EPC, 16:0 EPC, 16:1 EPC, 18:0 EPC, 18:1 EPC, 14-AllylPC, Me-16-EPC, Pr-16-EPC, 16- AllylPC, 16-PrgPC, 16-PrAPC, and 16:l-PrPC.

86. The LNP of claim one of claims 81-85, wherein the lipid component comprises the first lipid in an amount of from about 10 mol% to about 15 mol % of the total lipids in the lipid component.

87. The LNP of any one of claims 81-85, wherein the lipid component comprises the first lipid in an amount of about 13 mol% of the total lipids in the lipid component.

88. The LNP of any one of claims 81-85, wherein the lipid component comprises the first lipid in an amount of about 12.5 mol% of the total lipids in the lipid component.

89. The LNP of any one of claims 81-85, wherein the lipid component further comprises an ionizable cationic lipid separate from the first lipid.

90. The LNP of any one of claims 1-80 and 89, wherein the ionizable cationic lipid is a compound of Formula D-A:Attorney Docket No. 061529-516001WOCH3(CH2)z3aSH^°^OA' da(CH2)z3aCH3pharmaceutically acceptable salt thereof,wherein:RDlais a C1-C4 alkyd;RD2ais a Ci-C4alkyl;zla and z2a are each independently 1, 2, or 3;z3a is 3. 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, or 14; and z4a is 0 or 191. The LNP of any one of claims 1-80 and 89, wherein the ionizable cationic lipid is a compound selected from Table 3.

92. The LNP of any one of claims 1-80 and 89, wherein the ionizable cationic lipid is a compound selected from Table 4.

93. The LNP of any one of claims 1-80 and 89, wherein the ionizable cationic lipid is 4A3- SC7:CH3(CH23CH3o oO' T^SSC7).

94. The LNP of any one of claims 1-93, wherein the lipid component comprises the ionizable cationic lipid in an amount of from about 5 mol% to about 30 mol% of the total lipids in the lipid component.

95. The LNP of any one of claims 1-93, wherein the lipid component comprises the ionizable cationic lipid in an amount of from about 20 mol% to about 40 mol% of the total lipids in the lipid component.Attorney Docket No. 061529-516001WO96. The LNP of any one of claims 1-93, wherein the lipid component comprises the ionizable cationic lipid in an amount of from about 10 mol% to about 30 mol% of the total lipids in the lipid component.

97. The LNP of any one of claims 1-93, wherein the lipid component comprises the ionizable cationic lipid in an amount of from about 10 mol% to about 20 mol% of the total lipids in the lipid component.

98. The LNP of any one of claims 1-93, wherein the lipid component comprises the ionizable cationic lipid in an amount of about 15 mol% of the total lipids in the lipid component.

99. The LNP of any one of claims 1-93, wherein the lipid component comprises the ionizable cationic lipid in an amount of about 14.8 mol% of the total lipids in the lipid component.

100. The LNP of any one of claims 1-99, wherein the lipid component further comprises a phospholipid.

101. The LNP of claim 100, wherein the phospholipid is selected from 1,2-dilinoleoyl-sn- gly cero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn- gly cero-3-phosphocholine (DPPC). 1.2-distearoyl-sn-gly cero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), l-palmitoyl-2-oleoyl- sn-glycero-3 -phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), l-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC). 1 -hexadecyl-sn-glycero-3 -phosphocholine (C16 Lyso PC), l,2-dilmolenoyl-sn-glycero-3-phosphocholine, l,2-diarachidonoyl-sn-glycero-3- phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl- sn-glycero-3-phosphoethanolamine (DOPE), l,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3- phosphoethanolamine, L2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinolenoyl-sn-glycero-3-phosphoethanolamine, l,2-diarachidonoyl-sn-glycero-3- phosphoethanolamine, l,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, l,2-dioleoyl-sn-glycero-3-phospho-rac-(l -glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamineAttorney Docket No. 061529-516001WO(POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), l,2-Dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), l-stearoyl-2-oleoyl-phosphatidy ethanolamine (SOPE), l-stearoyl-2-oleoyl- phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, and lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) sphingomyelin.

102. The LNP of claim 101, wherein the phospholipid is DOPE or DSPC.

103. The LNP of any one of claims 100-102, wherein the lipid component comprises the phospholipid in an amount of from about 5 mol% to about 35 mol% of the total lipids in the lipid component.

104. The LNP of any one of claims 100-102, wherein the lipid component comprises the phospholipid in an amount of from about 10 mol% to about 30 mol% of the total lipids in the lipid component.

105. The LNP of any one of claims 100-102, wherein the lipid component comprises the phospholipid in an amount of about 22 mol% of the total lipids in the lipid component.

106. The LNP of any one of claims 100-102, wherein the lipid component comprises the phospholipid in an amount of about 22.2 mol% of the total lipids in the lipid component.

107. The LNP of any one of claims 1-106 wherein the lipid component further comprises a PEG lipid.

108. The LNP of claim 107, wherein the PEG lipid is selected from: 1,2-dimyristoyl-sn- glycerol methoxypolyethylene glycol (PEG-DMG), l,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-dis ter l glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG- diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG- DPPE), and PEG-1, 2-dimyristyloxlpropyl-3-amine (PEG-c-DMA).

109. The LNP of claim 107, wherein the PEG lipid is l,2-dimyristoyl-sn-glycero-3- methoxypolyethylene gly col-2000 (PEG2000-DMG).Attorney Docket No. 061529-516001WO110. The LNP of any one of claims 107-109, wherein the lipid component comprises the PEG lipid in an amount of from about 0.5 mol% to about 5 mol% of the total lipids in the lipid component.

111. The LNP of any one of claims 107-109, wherein the lipid component comprises the PEG lipid in an amount of from about 2 mol% to about 4 mol% of the total lipids in the lipid component.

112. The LNP of any one of claims 107-109, wherein the lipid component comprises the PEG lipid in an amount of about 3 mol% of the total lipids in the lipid component.

113. The LNP of any one of claims 1-112, wherein the lipid component further comprises a sterol.

114. The LNP of claim 113, wherein the sterol is cholesterol.

115. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of from about 25 mol% to about 45 mol% of the total lipids in the lipid component.

116. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of from about 25 mol% to about 40 mol% of the total lipids in the lipid component.

117. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of from about 30 mol% to about 35 mol% of the total lipids in the lipid component.

118. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of about 33 mol% of the total lipids in the lipid component.

119. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of about 32.5 mol% of the total lipids in the lipid component.

120. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of from about 15 mol% to about 30 mol% of the total lipids in the lipid component.Attorney Docket No. 061529-516001WO121. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of about 20 mol% of the total lipids in the lipid component.

122. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of about 25 mol% of the total lipids in the lipid component.

123. The LNP of claim 113 or 114, wherein the lipid component comprises the sterol in an amount of about 27.5 mol% of the total lipids in the lipid component.

124. A lipid nanoparticle (LNP) comprising a lipid component comprising:An ionizable cationic lipid in an amount of about 16 mol% of the total lipids of the lipid component;a phospholipid in an amount of about 21 mol% of the total lipids of the lipid component;a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component;a sterol in an amount of about 44 mol% of the total lipids of the lipid component; and14:0 TAP in an amount of about 12.5 mol% of the total lipids of the lipid component.

125. A lipid nanoparticle (LNP) comprising a lipid component comprising:An ionizable cationic lipid in an amount of about 30 mol% of the total lipids of the lipid component;a phospholipid in an amount of about 22 mol% of the total lipids of the lipid component;a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component;a sterol in an amount of about 32.5 mol% of the total lipids of the lipid component; and14:0 TAP in an amount of about 12.5 mol% of the total lipids of the lipid component.

126. A lipid nanoparticle (LNP) comprising a lipid component comprising:Attorney Docket No. 061529-516001WOAn ionizable cationic lipid in an amount of about 19 mol% of the total lipids of the lipid component;a phospholipid in an amount of about 21 mol% of the total lipids of the lipid component;a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component;a sterol in an amount of about 44 mol% of the total lipids of the lipid component; and14:0 EPC in an amount of about 12.5 mol% of the total lipids of the lipid component.

127. A lipid nanoparticle (LNP) comprising a lipid component comprising:An ionizable cationic lipid in an amount of about 15 mol% of the total lipids of the lipid component;a phospholipid in an amount of about 17 mol% of the total lipids of the lipid component;a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component;a sterol in an amount of about 25 mol% of the total lipids of the lipid component; andMO-14:0 TAP in an amount of about 25 mol% of the total lipids of the lipid component.

128. A lipid nanoparticle (LNP) comprising a lipid component comprising:An ionizable cationic lipid in an amount of about 15 mol% of the total lipids of the lipid component;a phospholipid in an amount of about 17 mol% of the total lipids of the lipid component;a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component;a sterol in an amount of about 25 mol% of the total lipids of the lipid component; andMO- 16:0 TAP in an amount of about 25 mol% of the total lipids of the lipid component.Attorney Docket No. 061529-516001WO129. A lipid nanoparticle (LNP) comprising a lipid component comprising:An ionizable cationic lipid in an amount of about 15 mol% of the total lipids of the lipid component;a phospholipid in an amount of about 17 mol% of the total lipids of the lipid component;a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component;a sterol in an amount of about 25 mol% of the total lipids of the lipid component; andTDMO in an amount of about 25 mol% of the total lipids of the lipid component.

130. A lipid nanoparticle (LNP) comprising a lipid component comprising:An ionizable cationic lipid in an amount of about 30 mol% of the total lipids of the lipid component;a phospholipid in an amount of about 22 mol% of the total lipids of the lipid component;a PEG lipid in an amount of about 3 mol% of the total lipids of the lipid component;a sterol in an amount of about 32.5 mol% of the total lipids of the lipid component; and14:0 EPC in an amount of about 12.5 mol% of the total lipids of the lipid component.

131. The LNP of any one of claims 124- 130, wherein the ionizable cationic lipid is 4A3SC7.

132. The LNP of any one of claims 124-131, wherein the phospholipid is DOPE.

133. The LNP of any one of claims 124-132, wherein the PEG lipid is PEG-DMG.

134. The LNP of any one of claims 124-133, wherein the sterol is cholesterol.

135. The LNP of any one of claims 1-134, wherein the LNP does not induce significant cytotoxicity in a tissue or cell of the subject.Attorney Docket No. 061529-516001WO136. The LNP of any one of claims 1-134, wherein the LNP does not induce significant cytotoxicity’ in a lung tissue or lung cell of the subject.

137. The LNP of any one of claims 1-134, further comprising a payload.

138. The LNP of claim 137. wherein the payload comprises a polypeptide or a protein.

139. The LNP of claim 138, wherein the polypeptide or protein is selected from: a cystic fibrosis transmembrane conductance regulator (CFTR) protein, Dynein axonemal heavy chain 5, Dynein axonemal heavy chain 11, Bone morphogenetic protein receptor type 2, Fumarylacetoacetate hydrolase, Phenylalanine hydroxylase, Alpha-L- iduronidase, Collagen type IV alpha 3 chain, Collagen type IV alpha 4 chain, Collagen type IV alpha 5 chain, Poly cystin 1, Poly cystin 2, Fibrocystin (or poly ductin), Solute carrier family 3 member 1, Solute carrier family 7 member 9, Paired box gene 9, Myosin VII A, Cadherin related 23. Usherin, Clarin 1, Gap junction beta-2 protein. Gap junction beta-6 protein, Rhodopsin, dystrophia myotonica protein kinase, Dystrophin, Sodium voltage-gated channel alpha subunit 1, Sodium voltage-gated channel beta subunit 1, Coagulation factor VIII, Coagulation factor IX, N-glycanase 1, Palmitoyl-protein thioesterase 1, Tripeptidyl peptidase l, Kvl 1.1 (alpha subunit of potassium ion channel), Palmitoyl-protein thioesterase 1, ATM serine / threonine kinase. Fibrillin 1, MUC5A, MUC5B, matrix metalloproteinase- 1 (MMP1), a disintegrin and metalloproteinase 10 (ADAM10), CXCL8 (interleukin-8; IL-8), telomerase reverse transcriptase (TERT), Interleukin 1 receptor antagonist (IL1RN), alpha-1 antitrypsin (AAT), FK506-binding protein 51 (FKBP5), miR-145-5p, and autophagy protein 5 (ATG5).

140. The LNP of claim 138, wherein the polypeptide or protein is a protein expressed by SERF INAL141. The LNP of claim 137, wherein the payload comprises a nucleic acid.

142. The LNP of claim 141, wherein the nucleic acid is selected from an siRNA, a miRNA, a pri-miRNA, a messenger RNA (mRNA), a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), a plasmid DNA (pDNA), a transfer RNA (tRNA), an antisense oligonucleotide (ASO), a guide RNA, aAttorney Docket No. 061529-516001WOdouble stranded DNA (dsDNA), a single stranded DNA (ssDNA), a single stranded RNA (ssRNA). and a double stranded RNA (dsRNA).

143. The LNP of claim 141, wherein the nucleic acid encodes a base editor, optionally an adenine base editor.

144. The LNP of claim 143, wherein the adenine base editor is an ABE8, optionally an ABE8.20.

145. The LNP of claim 144. further comprising a TIE2 gRNA targeting pay load.

146. The LNP of claim 137, wherein the payload comprises a small interfering RNA (siRNA).

147. The LNP of claim 137, wherein the payload comprises a micro RNA (miRNA).

148. The LNP of claim 147, wherein the miRNA is miR-145-5p.

149. The LNP of claim 137, wherein the payload comprises an mRNA.

150. The LNP of claim 149, wherein the mRNA encodes a protein selected from: a cystic fibrosis transmembrane conductance regulator (CFTR) protein, Dynein axonemal heavy chain 5, Dynein axonemal heavy chain 11, Bone morphogenetic protein receptor type 2, Fumarylacetoacetate hydrolase, Phenylalanine hydroxylase, Alpha-L- iduronidase, Collagen ty pe IV alpha 3 chain, Collagen type IV alpha 4 chain, Collagen type IV alpha 5 chain, Poly cystin 1, Poly cystin 2, Fibrocystin (or poly ductin). Solute carrier family 3 member 1, Solute carrier family 7 member 9, Paired box gene 9, Myosin VII A, Cadherin related 23, Usherin, Clarin 1, Gap junction beta-2 protein, Gap junction beta-6 protein, Rhodopsin, dystrophia myotonica protein kinase, Dystrophin, Sodium voltage-gated channel alpha subunit 1, Sodium voltage-gated channel beta subunit 1, Coagulation factor VIII, Coagulation factor IX, N-glycanase 1. Palmitoyl-protein thioesterase 1, Tripeptidyl peptidase l, Kvl 1.1 (alpha subunit of potassium ion channel), Palmitoyl-protein thioesterase 1, ATM serine / threonine kinase, Fibrillin 1, MUC5A, MUC5B, matrix metalloproteinase- 1 (MMP1), a disintegrin and metalloproteinase 10 (ADAM10), CXCL8 (interleukin-8; IL-8), telomerase reverse transcriptase (TERT), Interleukin 1 receptor antagonist (IL1RN), FK506-binding protein 51 (FKBP5), and autophagy protein 5 (ATG5).Attorney Docket No. 061529-516001WO151. The LNP of claim 150, wherein the mRNA encodes a gene-editing system or component thereof.

152. The LNP of claim 151, wherein the gene-editing system or component thereof comprises a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a transactivating crRNA (tracrRNA), and a guide RNA.

153. The LNP of claim 137, wherein the payload comprises a guide RNA.

154. The LNP of any one of claims 137-153, wherein the concentration of the pay load in the LNP is from about 0.5 mg / mL to about 4 mg / rnL.

155. The LNP of any one of claims 137-154, wherein the concentration of the pay load in the LNP is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / rnL to about 2.0 mg / rnL.

156. The LNP of any one of claims 137-154, wherein the concentration of the pay load in the LNP is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL. about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / rnL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / rnL, about 1.4 mg / rnL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL.

157. The LNP of any one of claims 137-154, wherein the concentration of the mRNA in the LNP is from about 0.5 mg / mL to about 4 mg / rnL.

158. The LNP of any one of claims 137-154, wherein the concentration of the mRNA in the LNP is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / rnL to about 2.0 mg / rnL.

159. The LNP of any one of claims 137-154, wherein the concentration of the mRNA in the LNP is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / rnL, about 0.9 mg / mL, about 1.0 mg / rnL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / rnL, about 1.4 mg / rnL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mLAttorney Docket No. 061529-516001WO160. The LNP of any one of claims 137-159, wherein the LNP has a diameter of from about 65 nm to about 100 nm.

161. The LNP of any one of claims 137-159, wherein the LNP has a diameter of from about 70 nm to about 90 nm.

162. The LNP of any one of claims 137-161, wherein a plurality of the LNPs has a poly dispersity index (PDI) of from about 0.05 to about 0.3.

163. The LNP of any one of claims 137-161, wherein a plurality of the LNPs has a poly dispersity index (PDI) of from about 0.7 to about 0.3.

164. The LNP of any one of claims 137-161, a plurality of the LNPs has a poly dispersity index (PDI) of from about 0.03 to about 0.2.

165. The LNP of any one of claims 137-161, a plurality of the LNPs has a polydispersity index (PDI) of from about 0.04 to about 0.1.

166. The LNP of any one of claims 137-165, wherein the LNP has an encapsulation efficiency (%EE) of from about 90% to about 100%.

167. The LNP of any one of claims 137-165, wherein the LNP has an encapsulation efficiency (%EE) of from about 95% to about 99%168. A pharmaceutical composition comprising the LNP of any one of claims 1-167 and a pharmaceutically acceptable excipient.

169. An aerosolized pharmaceutical composition comprising the LNP of any one of claims 1-167.

170. The aerosolized pharmaceutical composition of claim 169, wherein the aerosolized pharmaceutical composition is a nebulized pharmaceutical composition.

171. The aerosolized pharmaceutical composition of claim 169 or 170, wherein the concentration of the payload in the aerosolized pharmaceutical composition is from about 0.5 mg / mL to about 4 mg / mL.Attorney Docket No. 061529-516001WO172. The aerosolized pharmaceutical composition of claim 169 or 170, wherein the concentration of the payload in the aerosolized pharmaceutical composition is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL.

173. The aerosolized pharmaceutical composition of claim 169 or 170, wherein the concentration of the payload in the aerosolized pharmaceutical composition is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL. about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL.

174. The aerosolized pharmaceutical composition of claim 169 or 170, wherein the concentration of the mRNA in the aerosolized pharmaceutical composition is from about 0.5 mg / mL to about 4 mg / mL.

175. The aerosolized pharmaceutical composition of claim 169 or 170, wherein the concentration of the mRNA in the aerosolized pharmaceutical composition is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL.

176. The aerosolized pharmaceutical composition of any claim 169 or 170, wherein the concentration of the mRNA in the aerosolized pharmaceutical composition is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL. about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL.

177. The aerosolized pharmaceutical composition of any one of claims 169-176, wherein the aerosolized composition comprises aerosol particles.

178. The aerosolized pharmaceutical composition of claim 177, wherein the aerosol particles have a Mass Median Aerodynamic Diameter (MMAD) from about 1 pm to about 9 pm, or from about 1 pm to about 8 pm, or from about 1 pm to about 7 pm, or from about 1 pm to about 6 pm, or from about 1 pm to about 5 pm, or from about 1 pm to about 4 pm, or from about 1 pm to about 3 pm, or from about 1 pm to about 2 pm, or from about 2 pm to about 5 pm, or from about 3 pm to about 5 pm, or from about 2 pm to about 6 pm, or from about 3 pm to about 6 pm.Attorney Docket No. 061529-516001WO179. The aerosolized pharmaceutical composition of claim 177, wherein the aerosol particles have an MMAD of about 1 pm, about 2 pm, about 3 pm. about 4 pm, about 5 pm, or about 6 pm.

180. The aerosolized pharmaceutical composition of claim 177, wherein the aerosol particles have an MMAD of from about 3 pm to about 5 pm.

181. The aerosolized pharmaceutical composition of claim 177, wherein the aerosol particles have an MMAD of about 3.0 pm, about 3.1 pm. about 3.2 pm, about 3.3 pm, about 3.4 pm. about 3.5 pm, about 3.6 pm, about 3.7 pm. about 3.8 pm, about 3.9 pm, 4.0 pm, about 4.1 pm. about 4.2 pm, about 4.3 pm, about 4.4 pm. about 4.5 pm, about 4.6 pm, about 4.7 pm. about 4.8 pm, about 4.9 pm, about 5.0 pm, about 5.1 pm. about 5.2 pm, about 5.3 pm, about 5.4 pm. about 5.5 pm, about 5.6 pm, about 5.7 pm. about 5.8 pm, about 5.9 pm, or about 6 pm.

182. The aerosolized pharmaceutical composition of any one of claims 177-181, wherein the aerosol particles have a GSD from about 1 to about 4.

183. The aerosolized pharmaceutical composition of any one of claims 177-181, wherein the aerosol particles have a GSD from about 1 to about 3.

184. The aerosolized pharmaceutical composition of any one of claims 177-181, wherein the aerosol particles have a GSD from about 1 to about 2.

185. The aerosolized pharmaceutical composition of any one of claims 177-181, wherein the aerosol particles have a GSD of about 1, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.

7. about 1.8, about 1.

9. or about 2.

186. The aerosolized pharmaceutical composition of any one of claims 177-185, wherein the aerosol particles have a fine particle fraction of from about 50% to about 80%.

187. The aerosolized pharmaceutical composition of any one of claims 177-185, wherein the aerosol particles have a fine particle fraction of from about 60% to about 70%.

188. The aerosolized pharmaceutical composition of any one of claims 177-185, wherein the aerosol particles have a fine particle fraction of about 55%, of about 60%, of about 70%, of about 75%, of about 80%, of about 85%, or of about 90%.Attorney Docket No. 061529-516001WO189. The aerosolized pharmaceutical composition of any one of claims 169-188, wherein the aerosolized composition further comprises a buffer.

190. A liquid pharmaceutical composition for use in making the aerosolized pharmaceutical composition of any one of claims 169-189.

191. The liquid pharmaceutical composition of claim 190, wherein the concentration of the payload in the liquid pharmaceutical composition is from about 0.5 mg / mL to about 4.0 mg / mL.

192. The liquid pharmaceutical composition of claim 190, wherein the concentration of the payload in the liquid pharmaceutical composition is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL.

193. The liquid pharmaceutical composition of claim 190, wherein the concentration of the payload in the liquid pharmaceutical composition is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL. about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL. about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL.

194. The liquid pharmaceutical composition of claim 190, wherein the concentration of the mRNA in the liquid pharmaceutical composition is from about 0.5 mg / mL to about 4 mg / mL.

195. The liquid pharmaceutical composition of claim 190, wherein the concentration of the mRNA in the liquid pharmaceutical composition is from about 0.5 mg / mL to about 3.0 mg / mL or from about 0.5 mg / mL to about 2.0 mg / mL.

196. The liquid pharmaceutical composition of claim 190, wherein the concentration of the mRNA in the liquid pharmaceutical composition is about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, or about 2.0 mg / mL.

197. The liquid pharmaceutical composition of any one of claims 190-196, wherein the liquid pharmaceutical composition further comprises a buffer.Attorney Docket No. 061529-516001WO198. The aerosolized pharmaceutical composition of claim 189, or the liquid pharmaceutical composition of claim 197, wherein the buffer is a citrate buffer, an acetate buffer, or a tris(hydroxymethyl)aminomethane (Tris) buffer.

199. The aerosolized pharmaceutical composition of claim 189, or the liquid pharmaceutical composition of claim 197, wherein the buffer is a Tris buffer.

200. The aerosolized pharmaceutical composition of claim 189, or the liquid pharmaceutical composition of claim 197, wherein the buffer comprises Tris and phosphate buffered saline (PBS).

201. The aerosolized pharmaceutical composition of claim 189, or the liquid pharmaceutical composition of claim 197, wherein the buffer comprises lx PBS, 15 mM Tris buffer.

202. The aerosolized pharmaceutical composition of claim 189, or the liquid pharmaceutical composition of claim 197, wherein the buffer is a citrate buffer.

203. The aerosolized pharmaceutical composition of claim 189. or the liquid pharmaceutical composition of claim 197, wherein the buffer comprises citrate at a concentration of from about 5 mM to about 20 mM.

204. The aerosolized pharmaceutical composition of claim 189. or the liquid pharmaceutical composition of claim 197 wherein the buffer comprises citrate at a concentration of about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, or about 20 mM.

205. The aerosolized pharmaceutical composition of claim 189, or the liquid pharmaceutical composition of claim 197, wherein the buffer comprises tris at a concentration of from about 5 mM to about 20 mM.

206. The aerosolized pharmaceutical composition of claim 189, or the liquid pharmaceutical composition of claim 197, wherein the buffer comprises tris at a concentration of about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, or about 20 mM.Attorney Docket No. 061529-516001WO207. The aerosolized pharmaceutical composition or the liquid pharmaceutical composition of any one of claims 189 and 197-206. wherein the buffer further comprises sucrose.

208. The aerosolized pharmaceutical composition or the liquid pharmaceutical composition of claim 207, wherein the buffer comprises the sucrose in an amount of from about 5% to about 15%.

209. The aerosolized pharmaceutical composition or the liquid pharmaceutical composition of claim 207, wherein the buffer comprises the sucrose in an amount of about 5%, about 6%. about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, or about 15%.

210. The aerosolized pharmaceutical composition or the liquid pharmaceutical composition of any one claims 189 and 197-209, wherein the buffer has a pH of about 7.5.

211. The aerosolized pharmaceutical composition or the aerosol formulation of any one of claims 189 and 197-209, wherein the buffer has a pH of about 6.

212. The aerosolized pharmaceutical composition or the aerosol formulation of any one of claims 189 and 197-209, wherein the buffer has a pH of about 4.

213. A method of delivering a payload to a cell, comprising contacting the cell with the LNP of any one of claims 137-167, the pharmaceutical composition of claim 168, or the aerosolized pharmaceutical composition of any one of claims 1 9-189.

214. A method of expressing a protein or an RNA in a cell, comprises contacting the cell with the LNP of any one of claims 137-167, the pharmaceutical composition of claim 168, or the aerosolized pharmaceutical composition of any one of claims 169-189.

215. The method of claim 213 or 214. wherein the cell is a lung cell.

216. The method of claim 215, wherein the lung cell is a secretory cell.

217. The method of claim 215, wherein the lung cell is an ionocyte.

218. The method of claim 215, wherein the lung cell is a ciliated cell.

219. The method of claim 215, wherein the lung cell is a human bronchial epithelial cell.Attorney Docket No. 061529-516001WO220. The method of claim 215, wherein the lung cell is a basal cell.

221. The method of claim 216, wherein the method specifically transduces the secretory cells compared to other lung cells.

222. The method of claim 217, wherein the method specifically transduces the ionocyte compared to other lung cells.

223. The method of claim 218, wherein the method specifically transduces the ciliated cell compared to other lung cells.

224. The method of claim 219, wherein the method specifically transduces the human bronchial epithelial cell compared to other lung cells.

225. The method of claim 220, wherein the method specifically transduces the human bronchial epithelial cell compared to other lung cells.

226. The method of any one of claims 213-225, wherein the method comprises nebulizing the LNP to generate an aerosolized composition, then contacting the aerosolized composition with the cell.

227. The method of any one of claims 213-225, wherein the LNP is an aerosolized composition, and the method comprises contacting the aerosolized composition with the cell.

228. A method of delivering a payload to lungs of a subj ect. comprising administering to the subject the LNP of any one of claims 137-167, the pharmaceutical composition of claim 168, or the aerosolized pharmaceutical composition of any one of claims 169-189.

229. A method of treating or preventing lung disease in a subject, comprising administering to the subject the LNP of any one of claims 137-167. the pharmaceutical composition of claim 168, or the aerosolized pharmaceutical composition of any one of claims 169- 189.

230. The method of claim 229, wherein the disease or disorder is Acute Interstitial Pneumonia (A1P), alpha- 1 antitrypsin deficiency (AATD), asthma, bronchiectasis, Bronchiolitis obliterans with Organizing Pneumonia (BOOP), bronchitis, Chronic Obstructive Pulmonary' Disease (COPD), coronavirus, cystic fibrosis, DesquamativeAttorney Docket No. 061529-516001WOInterstitial Pneumonia (DIP), emphysema, Idiopathic Interstitial Pneumonia (IIP), influenza, Interstitial Lung Disease (ILD), Interstitial Pulmonary Fibrosis (IPF), Legionnaire’s disease, lung cancer, Non-Specific Interstitial Pneumonia (NSIP), pleurisy, pneumonia, Primary Ciliary Dyskinesia (PCD), pulmonary arterial hypertension, pulmonary7edema, pulmonary' fibrosis, pulmonary hypertension, Respiratory Bronchiolitis-associated Interstitial Lung Disease (RBILD), restrictive lung disease, sarcoidosis, Severe Acute Respiratory Syndrome, or tuberculosis.

231. The method of any one of 228-230, comprising nebulizing the LNP prior to the administering step.

232. The method of any one of claims 228-231, wherein the LNP is administered, as an aerosolized composition, by inhalation.

233. The method of any one of claims 228-232, wherein the method delivers an effective amount of the LNP to the lungs.

234. The method of any one of claims 228-233, wherein the method delivers an effective amount of the LNP to the lungs to treat the lung disease.

235. The method of any one of claims 228-234, wherein the method comprises nebulizing the liquid pharmaceutical composition of any one of claims 181 -188 to generate an aerosolized LNP.

236. Use of the LNP of any one of claims 137-167, the pharmaceutical composition of claim 168, or the aerosolized pharmaceutical composition of any one of claims 169-189 in the manufacture of a medicament for treating a lung disease.

237. The LNP of any one of claims 137-167, the pharmaceutical composition of claim 168, or the aerosolized pharmaceutical composition of any one of claims 169-189 for treatment of a lung disease.

238. A method for expressing a protein in the lung of a subject, the method comprising administering the LNP of any one of claims 137-167, the pharmaceutical composition of claim 168, or the aerosolized pharmaceutical composition of any one of claims 169- 189 for treatment of a lung disease.Attorney Docket No. 061529-516001WO239. The method of any one of claims 213-238, wherein the LNP does not induce significant cytotoxicity’ in a tissue or cell of the subject, optionally a lung tissue or cell.

240. The method of any one of claims 213-238, wherein the LNP does not induce significant cytotoxicity' in a lung tissue or lung cell of the subject.

241. A kit comprising the LNP of any one of claims 137-167, the pharmaceutical composition of claim 168, or the aerosolized pharmaceutical composition of any one of claims 169-189, and a nebulizer mask and / or a mesh suitable for use in a nebulizer.

242. A compound selected from:(DEA-16-DAP) and(DEA- 16:1 -DAP).

243. A compound selected from:(PN-16-DAP),(P-16 DAP).o(PN-16:1 DAP),(P-16:l DAP), ando,. L a6 (MO- 16:1 -DAP).

244. A compound selected from:Attorney Docket No. 061529-516001WO Me,CMGfete cr(14-AllylPC),0Me," + ',. MeTN.' O Me°'CH3CR(Me-16-EPC),(Pr-16-EPC),(16-AllylPC),(16-PrgPC),(16-PrAPC),(16:l-PrPC),(MO-14:0-TAP),(MO-16:0-TAP), and29