Library construction method suitable for total RNA transcriptome sequencing of frozen mouse adipose tissue, kit, and use thereof
By fixing and perforating the cell nuclei of frozen mouse adipose tissue, and adding a poly(A) tail using yeast polyadenylate polymerase, the technical gap in RNA sequencing of frozen mouse adipose tissue was filled, achieving stable and efficient total RNA transcriptome sequencing and obtaining more comprehensive biological information.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHANGHAI OE BIOTECH CO LTD
- Filing Date
- 2025-10-20
- Publication Date
- 2026-06-18
AI Technical Summary
Current technology does not provide an effective method for total RNA transcriptome sequencing in the nuclei of frozen mouse adipose tissue cells, resulting in decreased RNA integrity and an inability to fully obtain biological information from adipose tissue.
Cell nuclei were fixed using dithiobis[succinimide propionate] solution and formaldehyde solution. The nuclear membrane was treated with perforation solutions A and B. A poly(A) tail was added using yeast polyadenylate polymerase to improve the stability and capture efficiency of nuclear RNA. A cDNA library was generated by reverse transcription.
This technology enables stable total RNA transcriptome sequencing in frozen mouse adipose tissue, improving RNA quality, obtaining more comprehensive biological information, and answering deeper biological questions.
Smart Images

Figure CN2025128814_18062026_PF_FP_ABST
Abstract
Description
A library preparation method, kit, and application for total RNA transcriptome sequencing of frozen mouse adipose tissue. Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a method and application for total RNA transcriptome sequencing in mouse adipose tissue. In particular, it relates to a library preparation method, kit, and application for total RNA transcriptome sequencing in the cell nucleus. Background Technology
[0002] RNA-seq (transcriptome sequencing) is a high-throughput sequencing technology that uses cDNA sequencing to comprehensively and rapidly obtain almost all transcripts from cells or tissues in a given state. Currently, most transcriptome sequencing technologies only include mRNA, specifically using Oligo-dT primers to capture mRNAs with poly(A) tails for subsequent gene expression analysis. This can lead to the omission of information from other RNA molecules without -poly(A) tails, which play a crucial regulatory role in cellular function and state.
[0003] Recent studies have shown a link between obesity and certain cancers, such as breast cancer and colorectal cancer. Inflammatory responses, hormonal changes, and their impact on the immune system within adipose tissue may play a crucial role in tumor development and progression. Therefore, in-depth research into the structure, function, metabolic regulation, and role of adipose tissue in disease will help elucidate the mechanisms underlying these diseases. Currently, mouse models are commonly used to study these diseases. Compared to other common mouse tissues (such as heart, liver, kidney, and lung), the cell nuclei in mouse adipose tissue are more fragile and easily degraded, leading to decreased RNA integrity. Therefore, performing total RNA transcriptome sequencing within the cell nuclei of mouse adipose tissue remains a significant challenge, and there is currently no technical solution for total RNA transcriptome sequencing of frozen mouse adipose tissue.
[0004] In summary, to solve the above problems, there is an urgent need to develop simple and easy-to-operate sequencing technologies. The present invention aims to provide a simple and easy-to-operate library preparation method for total RNA transcriptome sequencing in the cell nucleus. Summary of the Invention
[0005] In the prior art, there is no reported method for library construction for total RNA transcriptome sequencing within the cell nucleus. To fill this gap, the present invention provides a method for rapid and stable total RNA transcriptome sequencing in frozen mouse adipose tissue. The entire process is complex, and mouse adipose tissue is more complex than other tissues such as liver and heart, with various tissue types including brown and white adipose tissue, and significant differences in RNA degradation levels across different adipose tissue locations. Therefore, this invention provides a method for treating the cell nucleus with a fixation solution (dithiobis[succinimide propionate] solution, formaldehyde solution, and 1x PBS) to effectively maintain the integrity of the cell structure, enhance the stability of nucleic acids within the nucleus, and improve RNA quality. Simultaneously, perforation solution A (Tris (pH 7.5), vanadate ribonucleoside complex, and enzyme-free water) and perforation solution B (Triton X-100 and enzyme-free water) are used to improve nuclear membrane permeability, further enhancing A-tail addition efficiency and intranuclear reverse transcription efficiency. Simultaneously, this invention employs yeast polyadenylate polymerase to ensure the addition of a poly(A) tail to the nuclear non-coding RNA, enabling it to be captured by nuclear reverse transcription along with mRNA using dT primers. Therefore, the technology provided by this invention primarily addresses the aforementioned problems in sequencing the total RNA transcriptome from frozen mouse fat tissue cells. The technical solution described in this invention can further uncover more comprehensive biological information and answer deeper biological questions.
[0006] The purpose of this invention is to provide a library preparation method for total RNA transcriptome sequencing of frozen mouse adipose tissue, the specific steps of which are as follows:
[0007] Step 1: Punching cells into pores
[0008] 1.1 Prepare reagents: cell nucleus isolation kit, cell nucleus fixative, perforation solution A, perforation solution B, cell nucleus suspension buffer, etc.
[0009] The cell nucleus fixation solution includes: dithiobis[succinimide propionate] (DSP) solution (M / V), formaldehyde solution (V / V), 1x PBS, etc.
[0010] The perforation solution A includes: Tris (pH 7.5, V / V), vanadate ribonucleoside complex, enzyme-free water, etc.
[0011] The perforation fluid B includes: Triton X-100 (V / V), enzyme-free water, etc.
[0012] The cell nucleus suspension buffer includes: 1x PBS, ribonuclease inhibitors, etc.
[0013] 1.2 Preparation of cell nuclei: Follow the instructions of the cell nucleus isolation kit described in step 1.1 to obtain a suspension of cell nuclei from frozen mouse fat tissue.
[0014] 1.3 Nuclear membrane fixation: Take the cell nucleus suspension of the mouse fat frozen tissue obtained in step 1.2 into a new centrifuge tube and incubate it in cell nucleus fixation solution.
[0015] 1.4 Nuclear membrane perforation: After the incubation in step 1.3, perforation solution A is added for further incubation. After the incubation is completed, perforation solution B is added for further incubation. After the incubation is completed, the supernatant is discarded by centrifugation to obtain the cell nuclear precipitate.
[0016] 1.5 Washing: Resuspend the nuclear precipitate obtained in step 1.4 using nuclear suspension buffer, centrifuge and discard the supernatant to obtain the precipitate.
[0017] Step 2: Generation of total RNA transcriptome library
[0018] 2.1 Reagent preparation: poly(A) tail buffer, cell nuclear suspension buffer, reverse transcription buffer, template conversion buffer, membrane perforation agent, stop solution, nucleic acid elution buffer, cDNA amplification premix, library construction kit.
[0019] 2.2 Pretreatment before reverse transcription: Resuspend the precipitate from step 1.5 using poly(A) tail buffer, transfer it to a 2 mL centrifuge tube, mix well and incubate, centrifuge and discard the supernatant, then resuspend the centrifuged precipitate with 20 μL of nuclear suspension buffer to obtain a nuclear suspension, and transfer the obtained nuclear suspension to a new PCR tube.
[0020] 2.3 Reverse transcription reaction: Add 100 μL of reverse transcription buffer to the nuclear suspension obtained in step 2.2 and mix well. Place the tube on a PCR instrument and run the program. After PCR, transfer the solution in the PCR tube to a 2 mL centrifuge tube, add 800 μL of nuclear suspension buffer, mix well, centrifuge and discard the supernatant. Then, resuspend the precipitate with 60 μL of nuclear suspension buffer to obtain a nuclear suspension. Transfer the obtained nuclear suspension to a new PCR tube.
[0021] 2.4 Cell nucleus lysis: Add the cell nucleus suspension obtained in step 2.3 to the cell membrane lysis agent at a ratio of 1:1, mix well, and incubate in a metal bath.
[0022] 2.5 Termination of pyrolysis: After the incubation in step 2.4 is completed, add the termination solution, mix well, and let stand for incubation.
[0023] 2.6 Purification: After the incubation in step 2.5, add AMPure XP magnetic bead reagent at a volume ratio of 1:(1.1~1.2), mix well, let stand, wash twice with 80% ethanol, and then elute with nucleic acid elution buffer. Transfer the obtained elution buffer to a new PCR tube. Preferably, after the incubation in step 2.5, add AMPure XP magnetic bead reagent at a volume ratio of 1:1.2 and mix well.
[0024] 2.7 Template Conversion: Add template conversion buffer to the elution buffer obtained in step 2.6, mix well, and incubate in a metal bath. After incubation, add AMPure XP magnetic bead reagent at a volume ratio of 1:(1-1.1), mix well, let stand, wash twice with 80% ethanol, then elute with nucleic acid elution buffer, and transfer the obtained elution buffer to a new PCR tube. Preferably, after incubation, add AMPure XP magnetic bead reagent at a volume ratio of 1:1 and mix well.
[0025] 2.8 cDNA Amplification: Add the cDNA amplification premix to the elution buffer obtained in step 2.7, mix well, and run PCR on a PCR instrument. After the run, add SPRIselect magnetic beads at a volume ratio of 1:(0.5-0.6) for enrichment and incubation, and elute with nucleic acid elution buffer to a new PCR instrument. Measure the cDNA concentration using a Qubit fluorescence spectrophotometer (Thermo Fisher Scientific, model Qubit 4.0). Preferably, after the run, add SPRIselect magnetic beads at a volume ratio of 1:0.6 for enrichment and incubation.
[0026] 2.9 Total RNA Library Construction and Quality Control: Library construction was performed according to the instructions of the library construction kit. The library concentration was determined using a Qubit fluorescence spectrophotometer (Thermo Fisher Scientific, model Qubit 4.0). The library peak chromatogram was quality controlled using a bioanalyzer (Agilent Technologies, model 4150 TapeStation).
[0027] In step 1.1, the cell nucleus isolation kit was purchased directly from 10x Genomics, kit number 1000493.
[0028] In step 1.1, the composition and concentration of the cell nuclear fixation solution are: 0.8~1.2 mg / mL dithiobis[succinimide propionate] solution (M / V), 0.3%~0.5% formaldehyde solution (V / V), 1x PBS, etc.; preferably, it is 1.2 mg / mL dithiobis[succinimide propionate] solution (M / V), 0.3% formaldehyde solution (V / V), and 1x PBS.
[0029] In step 1.1, the perforation solution A consists of the following components and concentrations: 0.5-0.8M Tris (pH 7.5), 8-10mM vanadate ribonucleoside complex, and enzyme-free water; preferably, it consists of 0.5M Tris (pH 7.5), 10mM vanadate ribonucleoside complex, and enzyme-free water.
[0030] In step 1.1, the composition and concentration of the perforation solution B are: 3%~5% Triton X-100 (V / V), enzyme-free water, etc.; preferably, it is 5% Triton X-100 (V / V) and enzyme-free water.
[0031] In step 1.1, the composition and concentration of the cell nuclear suspension buffer are: 0.5~1U / μL nuclease inhibitor, 1x PBS, etc.; preferably, it is 1U / μL nuclease inhibitor and 1x PBS.
[0032] In step 1.1, the components were purchased from: dithiobis[succinimide propionate] (Thermo Fisher Scientific, product number A35393), formaldehyde solution (Thermo Fisher Scientific, product number 28906), Tris (pH 7.5) (Thermo Fisher Scientific, product number 15567027), PBS (Gibco, product number 10010023), Triton X-100 (Sigma, product number 94334), nuclease inhibitor (Thermo Fisher Scientific, product number AM2696), oxonium ribonucleoside complex (NEB, product number S1402), and enzyme-free water (Thermo Fisher Scientific, product number 10977015).
[0033] In step 1.2, the concentration of the cell nucleus suspension in the frozen mouse fat tissue is 1000-2000 cells / μL; preferably, it is 2000 cells / μL.
[0034] In step 1.3, the incubation conditions are 4℃~6℃ for 20~25 minutes; preferably, 4℃ for 20 minutes.
[0035] In step 1.4, the incubation conditions for adding perforation solution A are 4℃~6℃ for 15~20 min, preferably 4℃ for 15 min; the incubation conditions for adding perforation solution B are 4℃~6℃ for 5~7 min, preferably 4℃ for 5 min.
[0036] In step 2.1, the components and concentration of the poly(A) tail buffer are as follows: 1x~1.3x yeast polyadenylate polymerase buffer (this buffer is a buffer reagent contained in the yeast polyadenylate polymerase product and is compatible with yeast polyadenylate polymerase), 120~150U / μL yeast polyadenylate polymerase, 0.5~1mM adenosine triphosphate, 0.2~0.4U / μL ribonuclease inhibitor, etc.; preferably, it is 1x yeast polyadenylate polymerase buffer, 120U / μL yeast polyadenylate polymerase, 0.4U / μL ribonuclease inhibitor, and 0.5mM adenosine triphosphate.
[0037] In step 2.1, the reverse transcription buffer comprises the following components and concentrations: 15-20 U / μL reverse transcriptase, 1x-1.2x reverse transcriptase buffer (this buffer is a buffer reagent contained in the reverse transcriptase product and is compatible with the reverse transcriptase), 0.5-1 mM dNTP, 4%-4.4% PEG8000 (V / V), 0.02-0.04 U / μL ribonuclease inhibitor, 3-5 μM reverse transcription primer (the reverse transcription primer sequence is ACGAGCATCAGCAGCATACGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO.1), where V refers to any one of the three bases A, G, and C, and N refers to any one of the four bases A, T, C, and G), and enzyme-free water. Preferably, the composition is 15 U / μL reverse transcriptase, 1x reverse transcriptase buffer, 0.5 mM dNTP, 4.4% PEG8000 (V / V), 0.04 U / μL ribonuclease inhibitor, 5 μM reverse transcription primer, and enzyme-free water.
[0038] In step 2.1, the template conversion buffer comprises and contains the following components and concentrations: 1x~1.2x reverse transcriptase buffer, 8~10 U / μL reverse transcriptase, 1~3 U / μL ribonuclease inhibitor, 2.0~2.5 μM template conversion oligonucleotide TSO, and enzyme-free water. Preferably, it comprises 1x reverse transcriptase buffer, 10 U / μL reverse transcriptase, 2 U / μL ribonuclease inhibitor, 2.5 μM template conversion oligonucleotide TSO (TSO: AGAGACAGATTGCGCAATGNNNNNNNNrGrGrG (SEQ ID NO.2), where rG refers to riboguanosine and N refers to any one of the four bases A, T, C, and G), and enzyme-free water.
[0039] In step 2.1, the composition and concentration of the membrane-breaking agent are: 1~2 mg / mL proteinase K, 50~70 mM NaCl, 0.8 mM~1 mM EDTA, 2%~3% sodium dodecyl sulfate SDS (V / V), etc.; preferably, it is 2 mg / mL proteinase K, 70 mM NaCl, 1 mM EDTA, and 3% SDS (V / V).
[0040] In step 2.1, the components and concentration of the terminating solution are 80~100mM PMSF (phenylmethylsulfonyl fluoride), enzyme-free water, etc.; preferably, it is 100mM PMSF (phenylmethylsulfonyl fluoride) and enzyme-free water.
[0041] In step 2.1, the nucleic acid elution buffer was purchased directly from QIAGEN, catalog number 19086.
[0042] In step 2.1, the components and concentration of the cDNA amplification premix are as follows: 0.5~0.6μM amplification primer 1 (nucleotide sequence as shown in SEQ ID NO.3), 0.5~0.6μM amplification primer 2 (nucleotide sequence as shown in SEQ ID NO.4), 1 x KAPA2G Fast HotStart ReadyMix (PCR amplification reagent) (this reagent is the commercial reagent name of the product on the KAPA reagent website, a complex composed of multiple components, used for PCR amplification), enzyme-free water, etc.; preferably, it is 0.5μM amplification primer 1, 0.5μM amplification primer 2, 1x KAPA2G Fast HotStart ReadyMix, and enzyme-free water.
[0043] In step 2.1, the composition and concentration of the cell nucleus suspension buffer are the same as in step 1.1.
[0044] In step 2.1, the library construction kit is a Tn5 transposase library construction kit purchased from Illumina, catalog number FC-131-1096.
[0045] In step 2.1, the components were purchased from: yeast polyadenylate polymerase (Thermo Fisher Scientific, catalog number 74225Z25KU), adenosine triphosphate (NEB, catalog number P0756), nuclease inhibitor (TaKaRa, catalog number 2313B), reverse transcriptase (Thermo Fisher Scientific, catalog number EP0753), NaCl (Thermo Fisher Scientific, catalog number AM9760G), deoxyribonucleotide triphosphate (dNTP) (NEB, catalog number N0447L), SDS (sodium dodecyl sulfate) (Invitrogen, catalog number AM9820), proteinase K (NEB, catalog number P8107S), EDTA (ethylenediaminetetraacetic acid) (Thermo Fisher Scientific, catalog number AM9260G), benzyl sulfonyl fluoride (Sigma Aldrich, catalog number P7626), PEG8000 (Sigma Aldrich, catalog number P1458), and KAPA2G Fast HotStart ReadyMix (KAPA, catalog number KK5603).
[0046] In step 2.2, the incubation conditions are 25°C for 10-15 minutes; preferably, 25°C for 10 minutes.
[0047] In step 2.3, the PCR program is as follows: 8℃ for 12s, {15℃ for 45s, 20℃ for 45s, 30℃ for 30s, 42℃ for 120s, 50℃ for 180s} for 3 cycles, and finally 50℃ for 5min.
[0048] In step 2.4, the incubation conditions in the metal bath are 55°C for 1.5-2 hours and 200-300 rpm, preferably 55°C for 2 hours and 300 rpm.
[0049] In step 2.5, the static incubation conditions are 25℃~28℃ for 10~15 minutes, preferably room temperature for 10 minutes.
[0050] In step 2.6, the AMPure XP magnetic bead reagent was purchased directly from Beckman Coulter Ltd., product number A63881.
[0051] In step 2.6, the settling temperature is 25℃~28℃, and the settling time is 10~15min; preferably, the settling temperature is room temperature, and the settling time is 10min.
[0052] In step 2.7, the incubation conditions in the metal bath are 42°C for 90-100 min and 300-500 rpm, preferably 42°C for 90 min and 500 rpm.
[0053] In step 2.7, the settling temperature is 25℃~28℃, and the settling time is 10~15min; preferably, the settling temperature is room temperature, and the settling time is 10min.
[0054] In step 2.8, the PCR program is 16 cycles of 98℃ for 3 min, {98℃ for 15 s, 65℃ for 15 s, 72℃ for 3 min}, and finally 72℃ for 5 min and 4℃.
[0055] In step 2.8, the SPRIselect magnetic bead reagent was purchased directly from Beckman Coulter Ltd., product number B23318.
[0056] In step 2.8, the enrichment incubation temperature is 25℃~28℃, and the enrichment incubation time is 10~15min; preferably, the enrichment incubation temperature is room temperature, and the enrichment incubation time is 10min.
[0057] In the method described in this invention, the centrifugation conditions are all 8500~10000 rpm for 5~7 min; preferably, 8500 rpm for 5 min; the primers mentioned above are all synthesized by Shanghai Sangon Biotech Co., Ltd.
[0058] The frozen mouse adipose tissue described in this invention refers to mouse adipose tissue that has been extracted and then rapidly frozen in liquid nitrogen.
[0059] The library construction method for single-cell whole transcriptome sequencing provided by this invention mainly includes the following core technical aspects:
[0060] (1) This invention provides a scheme for total RNA transcriptome sequencing in the nucleus of mouse adipose tissue;
[0061] (2) The present invention provides a method for fixing cell nuclei in mouse adipose tissue.
[0062] (3) The present invention provides a technique for perforating the nuclear membrane of mouse adipose tissue cells, which can effectively improve total RNA transcriptome sequencing.
[0063] In one specific embodiment, the method includes the following steps:
[0064] Step 1: Punching cells into pores
[0065] 1.1 Reagent preparation: cell nucleus isolation kit, cell nucleus fixative, perforation solution A, perforation solution B, cell nucleus suspension buffer.
[0066] 1.2 Preparation of cell nuclei: Follow the instructions of the cell nucleus isolation kit in step 1.1 to obtain a suspension of cell nuclei from frozen mouse fat tissue.
[0067] 1.3 Nuclear membrane fixation: Take 1 mL of the cell nucleus suspension of the frozen mouse fat tissue obtained in step 1.2 into a new 15 mL centrifuge tube (cell nucleus concentration of 2000 cells / μL), add 4 mL of cell nucleus fixation solution and incubate at 4℃ for 20 min.
[0068] 1.4 Nuclear membrane perforation: After the incubation in step 1.3, add 210 μL of perforation solution A, mix well, and incubate at 4°C for 15 min. Then add 190 μL of perforation solution B, mix well, and incubate at 4°C for 5 min. Centrifuge and discard the supernatant to obtain the nuclear precipitate.
[0069] 1.5 Washing: Resuspend the nuclear pellet obtained in step 1.4 in 3 mL of nuclear suspension buffer, centrifuge and discard the supernatant to obtain the pellet.
[0070] Step 2: Generation of total RNA transcriptome library
[0071] 2.1 Reagent preparation: poly(A) tail buffer, cell nuclear suspension buffer, reverse transcription buffer, template conversion buffer, membrane perforation agent, stop solution, nucleic acid elution buffer, cDNA amplification premix, library construction kit.
[0072] 2.2 Pretreatment before reverse transcription: Resuspend the precipitate from step 1.5 in 100 μL of poly(A) tail buffer and transfer it to a 2 mL centrifuge tube. Mix well and incubate at 25 °C for 10 min. Add 1 mL of nuclear suspension buffer, centrifuge and discard the supernatant. Finally, resuspend the centrifuged precipitate in 20 μL of nuclear suspension buffer and transfer the obtained nuclear suspension to a new PCR tube.
[0073] 2.3 Reverse Transcription Reaction: Add 100 μL of reverse transcription buffer to the nuclear suspension obtained in step 2.2 and mix well. Place the tube on a PCR instrument and run the program. The PCR program is as follows: 8℃ 12s, {15℃ 45s, 20℃ 45s, 30℃ 30s, 42℃ 120s, 50℃ 180s} for 3 cycles, and finally 50℃ 5min. After PCR, transfer the PCR tube solution to a 2mL centrifuge tube, add 800 μL of nuclear suspension buffer, mix well, centrifuge, and discard the supernatant. Finally, resuspend the precipitate with 60 μL of nuclear suspension buffer to obtain a nuclear suspension, and transfer the obtained nuclear suspension to a new PCR tube.
[0074] 2.4 Cell nucleus lysis: In step 2.3, the cell nucleus suspension was mixed with the membrane-disrupting agent at a ratio of 1:1 and then incubated in a metal bath at 55°C for 2 hours at 300 rpm.
[0075] 2.5 Termination of lysis: After the incubation in step 2.4 is completed, add 5 μL of termination solution, mix well, and incubate at room temperature for 10 min.
[0076] 2.6 Purification: After incubation in step 2.5, add AMPure XP magnetic beads at a volume ratio of 1:1.2 and mix well. Let stand at room temperature for 10 min, wash twice with 80% ethanol, and finally elute with 20 μL of nucleic acid elution buffer. Transfer the elution buffer to a new PCR tube.
[0077] 2.7 Template Conversion: Add 100 μL of template conversion buffer to the elution buffer obtained in step 2.6, mix well, and incubate in a metal bath at 42°C for 90 min at 500 rpm. After incubation, add AMPure XP magnetic beads at a 1:1 volume ratio, mix well, let stand at room temperature for 10 min, wash twice with 80% ethanol, and finally elute with 40 μL of nucleic acid elution buffer. Transfer the elution buffer to a new PCR tube.
[0078] 2.8 cDNA Generation: Add 60 μL of cDNA amplification premix to the elution buffer obtained in step 2.7, mix well, and transfer to a PCR instrument. Run PCR using the following program: 98℃ for 3 min, {98℃ for 15 s, 65℃ for 15 s, 72℃ for 3 min} for 16 cycles, followed by a final incubation at 72℃ for 5 min and a hold at 4℃. After PCR, add SPRIselect magnetic beads at a volume ratio of 1:0.6 for enrichment and incubation, then elute with 20 μL of nucleic acid elution buffer to a fresh PCR instrument. Determine the cDNA concentration using a Qubit fluorescence spectrophotometer (Thermo Fisher Scientific, Qubit 4.0).
[0079] 2.9 Total RNA Library Construction and Quality Control: The library was constructed according to the instructions of the library construction kit (Tn5 transposase library construction kit, Illumina, product number FC-131-1096). The library concentration was determined using a Qubit fluorescence spectrophotometer (Thermo Fisher Scientific, model Qubit4.0). The library peak chromatogram was quality controlled using a bioanalyzer (Agilent Technologies, model 4150 TapeStation).
[0080] In the above method, the centrifugation conditions are 8500 rpm and 5 min.
[0081] The sequence involved in this invention is as follows:
[0082] Name Primer Sequence (5'→3') Reverse Transcription Primer ACGAGCATCAGCAGCATACGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO.1) Template Conversion Oligonucleotide TSOAGAGACAGATTGCGCAATGNNNNNNNNrGrGrG (SEQ ID NO.2) Amplification Primer 1TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG (SEQ ID NO.3) Amplification Primer 2ACGAGCATCAGCAGCATACGA (SEQ ID NO.4)
[0083] This invention also provides cDNA and libraries obtained by the above-described library preparation method that can be used for total RNA analysis of single cells in frozen mouse fat tissue.
[0084] This invention also provides the application of the library construction method in total RNA transcriptome sequencing of frozen mouse adipose tissue.
[0085] The present invention also provides a reagent kit comprising a nuclear fixation solution, a perforation solution A, and a perforation solution B, the specific components of which are as follows: the nuclear fixation solution comprises 0.8~1.2 mg / mL dithiobis[succinimide propionate] solution, 0.3%~0.5% formaldehyde solution (V / V), 1x PBS, etc.; the perforation solution A comprises 0.5~0.8M Tris (pH 7.5), 8~10mM vanadate ribonucleoside complex, enzyme-free water, etc.; the perforation solution B comprises 3%~5% Triton X-100 (V / V), enzyme-free water, etc.
[0086] Preferably, the composition and concentration of the nuclear fixation solution are: 1.2 mg / mL dithiobis[succinimide propionate] solution (M / V), 0.3% formaldehyde solution (V / V), and 1x PBS; the composition and concentration of the perforation solution A are: 0.5 M Tris (pH 7.5), 10 mM vanadate ribonucleoside complex, and enzyme-free water; and the composition and concentration of the perforation solution B are: 5% Triton X-100 (V / V) and enzyme-free water.
[0087] The present invention also provides the application of the kit described above in cell nuclear fixation.
[0088] The present invention also provides the application of the kit described above in intranuclear reverse transcription.
[0089] The present invention also provides the application of the library construction method described above, or the cDNA and library described above, or the kit described above in cell nuclear fixation, intranuclear reverse transcription, and total RNA transcriptome sequencing of mouse fat frozen tissue.
[0090] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention fills a current technological gap: there is currently no library construction technology for total RNA transcriptome sequencing in frozen mouse adipose tissue, and the technical solution provided by this invention precisely solves this problem. The technical solution of this invention provides nuclear fixation solution and perforation solution, improving sample utilization efficiency; the technical solution provided by this invention can obtain more meaningful data from the same sample, leading to a deeper understanding of biological questions and underlying biological mechanisms, thus contributing to the advancement of research in the life sciences. Attached Figure Description
[0091] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0092] Figure 1 shows the microscopic examination results of the fixed cell nuclei in Example 1 of the present invention.
[0093] Figure 2 shows the cDNA quality control results in Example 1 of this invention.
[0094] Figure 3 shows the quality inspection results of the Chinese library in Embodiment 1 of the present invention.
[0095] Figure 4 shows the percentage of each type of RNA in Example 1 of the present invention. Detailed Implementation
[0096] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.
[0097] The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the invention or its application or use. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.
[0098] In all examples shown and discussed herein, any specific values should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may have different values.
[0099] This invention discloses a library construction method, kit, and application for total RNA transcriptome sequencing of frozen mouse adipose tissue. The library construction method includes cell nuclear perforation and total RNA transcriptome library generation steps. This invention also discloses a kit and its application in cell nuclear fixation, intranuclear reverse transcription, and total RNA transcriptome sequencing of frozen mouse adipose tissue. The library construction method proposed in this invention fills a current technological gap: there is currently no library construction technology for total RNA transcriptome sequencing in mouse adipose tissue; it overcomes the sample limitations of mouse adipose tissue, improving sample utilization efficiency; and it enables the acquisition of more meaningful data from the same sample, allowing for deeper analysis of biological questions and underlying biological mechanisms, thus contributing to the advancement of research in the life sciences. This invention has broad application prospects.
[0100] Unless otherwise specified, the experimental materials used in the examples are all conventional biochemical reagents.
[0101] Example 1
[0102] Step 1: Punching cells into pores
[0103] 1.1 Reagent preparation: cell nucleus isolation kit, cell nucleus fixation solution, perforation solution A, perforation solution B, cell nucleus suspension buffer.
[0104] The cell nucleus isolation kit was purchased directly from 10x Genomics, product number 1000493.
[0105] The cell nucleus fixation solution consisted of 1.2 mg / mL dithiobis[succinimide propionate] (DSP) solution (M / V), 0.3% formaldehyde (V / V), and 1x PBS.
[0106] The perforation solution A consists of 0.5M Tris (pH 7.5) (V / V), 10mM vanadate ribonucleoside complex, and enzyme-free water.
[0107] The perforation solution B consists of 5% Triton X-100 (V / V) and enzyme-free water.
[0108] The cell nucleus suspension buffer consisted of 1x PBS and 1 U / μL ribonuclease inhibitor.
[0109] 1.2 Preparation of cell nuclei: Follow the instructions of the cell nucleus isolation kit in step 1.1 to obtain a suspension of cell nuclei from frozen mouse fat tissue.
[0110] 1.3 Nuclear membrane fixation: Take 1 mL of the cell nucleus suspension of the frozen mouse fat tissue obtained in step 1.2 into a new 15 mL centrifuge tube (cell nucleus concentration of 2000 cells / μL), add 4 mL of cell nucleus fixation solution and incubate at 4℃ for 20 min.
[0111] 1.4 Nuclear membrane perforation: After the incubation in step 1.3, add 210 μL of perforation solution A and mix well. Incubate at 4°C for 15 min, then add 190 μL of perforation solution B, mix well, and incubate at 4°C for 5 min. After the incubation, centrifuge and discard the supernatant to obtain the nuclear precipitate.
[0112] 1.5 Washing: Resuspend the nuclear pellet obtained in step 1.4 in 3 mL of nuclear suspension buffer, centrifuge at 8500 rpm for 5 min, discard the supernatant, and obtain the pellet.
[0113] Step 2: Generation of total RNA transcriptome library
[0114] 2.1 Reagent preparation: poly(A) tail buffer, cell nuclear suspension buffer, reverse transcription buffer, template conversion buffer, membrane perforation agent, stop solution, nucleic acid elution buffer, cDNA amplification premix, library construction kit.
[0115] The composition and concentration of the poly(A) tail buffer are as follows: 1x yeast polyadenylate polymerase buffer, 120 U / μL yeast polyadenylate polymerase, 0.5 mM adenosine triphosphate, and 0.4 U / μL ribonuclease inhibitor.
[0116] The composition and concentration of the cell nuclear suspension buffer are: 1 U / μL nuclease inhibitor and 1xPBS.
[0117] The reverse transcription buffer consists of the following components and concentrations: 15 U / μL reverse transcriptase, 1x reverse transcriptase buffer, 0.5 mM dNTP, 4.4% PEG8000 (V / V), 0.04 U / μL ribonuclease inhibitor, 5 μM reverse transcription primer, and enzyme-free water.
[0118] The template conversion buffer consists of the following components and concentrations: 1x reverse transcriptase buffer, 10 U / μL reverse transcriptase, 2 U / μL ribonuclease inhibitor, 2.5 μM template conversion oligonucleotide (TSO), and enzyme-free water.
[0119] The composition and concentration of the membrane-breaking agent are: 2 mg / mL proteinase K, 70 mM NaCl, 1 mM EDTA, and 3% SDS (V / V).
[0120] The components and concentration of the termination solution are: 100mM benzyl sulfonyl fluoride and enzyme-free water.
[0121] The nucleic acid elution buffer was purchased directly from QIAGEN, catalog number 19086.
[0122] The cDNA amplification premix consists of the following components and concentrations: 0.5 μM amplification primer 1, 0.5 μM amplification primer 2, 1x KAPA2G Fast HotStart ReadyMix, and enzyme-free water.
[0123] The library construction kit is a Tn5 transposase library construction kit, purchased from Illumina, catalog number FC-131-1096.
[0124] 2.2 Pretreatment before reverse transcription: Resuspend the precipitate from step 1.5 with 100 μL poly(A) tail buffer, transfer it to a 2 mL centrifuge tube, mix well, incubate at 25 °C for 10 min, add 1 mL of nuclear suspension buffer, centrifuge and discard the supernatant, and finally resuspend the centrifuged precipitate with 20 μL of nuclear suspension buffer and transfer it to a new PCR tube to obtain a nuclear suspension. Transfer the obtained nuclear suspension to a new PCR tube.
[0125] 2.3 Reverse Transcription Reaction: Add 100 μL of reverse transcription buffer to the nuclear suspension obtained in step 2.2, mix well, place on a PCR instrument, and run the program. The PCR program is as follows: 8℃ 12s, {15℃ 45s, 20℃ 45s, 30℃ 30s, 42℃ 120s, 50℃ 180s} for 3 cycles, and finally 50℃ 5min. After PCR, transfer the solution in the PCR tube to a 2mL centrifuge tube, add 800 μL of nuclear suspension buffer, mix well, centrifuge, and discard the supernatant. Finally, resuspend the precipitate with 60 μL of nuclear suspension buffer to obtain a nuclear suspension, and transfer the obtained nuclear suspension to a new PCR tube.
[0126] 2.4 Cell nucleus lysis: The cell nucleus suspension obtained in step 2.3 was mixed with the membrane-disrupting agent at a 1:1 ratio and then incubated in a metal bath at 55°C for 2 hours at 300 rpm.
[0127] 2.5 Termination of lysis: After the incubation in step 2.4 is completed, add 5 μL of termination solution, mix well, and incubate at room temperature for 10 min.
[0128] 2.6 Purification: After incubation in step 2.5, add AMPure XP magnetic beads at a volume ratio of 1:1.2 and mix well. Let stand at room temperature for 10 min, wash twice with 80% ethanol, and finally elute with 20 μL of nucleic acid elution buffer. Transfer the elution buffer to a new PCR tube.
[0129] 2.7 Template Conversion: Add 100 μL of template conversion buffer to the elution buffer obtained in step 2.6, mix well, and incubate in a metal bath at 42°C for 90 min at 500 rpm. After incubation, add AMPure XP magnetic beads at a 1:1 volume ratio, mix well, let stand at room temperature for 10 min, wash twice with 80% ethanol, and finally elute with 40 μL of nucleic acid elution buffer. Transfer the elution buffer to a new PCR tube.
[0130] 2.8 cDNA Amplification: Add 60 μL of cDNA amplification premix to the elution buffer obtained in step 2.7, mix well, and transfer to a PCR instrument. Run PCR with the following program: 98℃ for 3 min, {98℃ for 15 s, 65℃ for 15 s, 72℃ for 3 min} for 16 cycles, followed by a final incubation at 72℃ for 5 min and a hold at 4℃. After PCR, add SPRIselect magnetic beads at a volume ratio of 1:0.6 for enrichment, and elute with 20 μL of nucleic acid elution buffer to a fresh PCR instrument. Determine the cDNA concentration using a Qubit fluorescence spectrophotometer (Thermo Fisher Scientific, Qubit 4.0).
[0131] 2.9 Total RNA Library Construction and Quality Control: The library was constructed according to the instructions of the Tn5 transposase library construction kit (Illumina, catalog number FC-131-1096). The library concentration was determined using a Qubit fluorescence spectrophotometer (Thermo Fisher Scientific, model Qubit 4.0); the library peak chromatogram was quality controlled using a bioanalyzer (Agilent Technologies, model 4150 TapeStation).
[0132] Comparative Example 1
[0133] 100% methanol (V / V) + 1.2 mg / mL dithiobis[succinimide propionate] (DSP) (M / V) was used as the main component of the nuclear fixation solution.
[0134] 1.1 Reagents to be prepared: nuclear isolation kit, nuclear fixation solution, and nuclear suspension buffer.
[0135] The cell nucleus isolation kit was purchased directly from 10x Genomics, product number 1000493.
[0136] The cell nucleus fixation solution was 100% methanol (V / V) + 1.2 mg / mL dithiobis[succinimide propionate] (M / V).
[0137] The cell nucleus suspension buffer consisted of 1x PBS and 1 U / μL ribonuclease inhibitor.
[0138] 1.2 Preparation of cell nuclei: The cell nuclei suspension of frozen mouse fat tissue was obtained by following the instructions of the cell nucleus isolation kit.
[0139] 1.3 Nuclear membrane fixation: Take 1 mL of the nuclear suspension of mouse fat frozen tissue obtained in step 1.2 into a 15 mL centrifuge tube (nuclear concentration of 2000 cells / μL), add 4 mL of nuclear fixation solution and incubate at 4℃ for 20 min. Centrifuge at 8500 rpm for 5 min, discard the supernatant, and resuspend the precipitate in 1 mL of nuclear suspension buffer.
[0140] 1.4 Microscopic examination of cell nuclei: Take 9 μL of the cell nucleus suspension obtained in step 1.3 above and mix it with 1 μL of trypan blue staining solution for microscopic examination to determine the total number of cell nuclei, the proportion of fragments and the proportion of cell nuclei clumping.
[0141] The results are shown in Table 1.
[0142] Comparative Example 2
[0143] 0.3% formaldehyde (v / v) + glacial acetic acid was used as the main components of the cell nuclear fixation solution. The remaining procedures were the same as in Comparative Example 1. The results are shown in Table 1.
[0144] Comparative Example 3
[0145] 0.3% formaldehyde (V / V) + 1.2 mg / mL dithiobis[succinimide propionate] (DSP) (M / V) was used as the main component of the nuclear fixation solution. The remaining procedures were the same as in Comparative Example 1. The results are shown in Table 1.
[0146] Comparative Example 4
[0147] 5% Tween 20 (V / V) was used as the main component of perforation fluid B.
[0148] Step 1: Punching cells into pores
[0149] 1.1 Reagent preparation: cell nucleus isolation kit, cell nucleus fixation solution, perforation solution B, cell nucleus suspension buffer.
[0150] The cell nucleus isolation kit was purchased directly from 10x Genomics, product number 1000493.
[0151] The cell nucleus fixation solution consisted of 1.2 mg / mL dithiobis[succinimide propionate] (DSP) solution, 0.3% formaldehyde (V / V), and 1x PBS.
[0152] The perforation solution B consists of 5% Tween 20 (V / V) and enzyme-free water.
[0153] The cell nucleus suspension buffer consisted of 1x PBS and 1 U / μL ribonuclease inhibitor.
[0154] 1.2 Preparation of cell nuclei: Follow the instructions of the cell nucleus isolation kit in step 1.1 to obtain a suspension of cell nuclei from frozen mouse fat tissue.
[0155] 1.3 Nuclear membrane fixation: Take 1 mL of the cell nucleus suspension of the frozen mouse fat tissue obtained in step 1.2 into a 15 mL centrifuge tube, add 4 mL of cell nucleus fixation solution, mix well, and incubate at 4℃ for 20 min.
[0156] 1.4 Nuclear membrane perforation: Add perforation solution B and incubate at 4°C for 5 min. After incubation, centrifuge and discard the supernatant to obtain the nuclear precipitate.
[0157] 1.5 Washing: Resuspend the nuclear pellet obtained in step 1.4 using nuclear suspension buffer to obtain a nuclear suspension.
[0158] 1.6 Microscopic examination of cell nuclei: Take 9 μL of the cell nucleus suspension obtained in step 1.5 above and mix it with 1 μL of trypan blue staining solution for microscopic examination to determine the total number of cell nuclei, the proportion of fragments and the proportion of cell nuclei clumping.
[0159] The results are shown in Table 2.
[0160] Comparative Example 5
[0161] 5% Tritonx-100 (V / V) was used as the main component of perforation fluid B. The remaining operating steps were the same as in Comparative Example 4, and the results are shown in Table 2.
[0162] Comparative Example 6
[0163] 5% NP40 (V / V) was used as the main component of perforation fluid B. The remaining operating steps were the same as in Comparative Example 4, and the results are shown in Table 2.
[0164] Comparative Example 7
[0165] 0.5M Tris (pH 7.5) was used as the main component of perforation solution A.
[0166] Step 1: Punching cells into pores
[0167] 1.1 Reagent preparation: cell nucleus isolation kit, cell nucleus fixation solution, perforation solution A, cell nucleus suspension buffer.
[0168] The cell nucleus fixation solution consisted of 1.2 mg / mL dithiobis[succinimide propionate] (DSP) solution, 0.3% formaldehyde (V / V), and 1x PBS.
[0169] The perforation solution A consists of 0.5M Tris (pH 7.5) and enzyme-free water.
[0170] The cell nucleus suspension buffer consists of 1x PBS and a ribonuclease inhibitor.
[0171] 1.2 Preparation of cell nuclei: Follow the instructions of the cell nucleus isolation kit in step 1.1 to obtain a suspension of cell nuclei from frozen mouse fat tissue.
[0172] 1.3 Nuclear membrane fixation: Take 1 mL of the cell nucleus suspension (cell nucleus concentration of 2000 cells / μL) of frozen mouse adipose tissue obtained in step 1.2 into a 15 mL centrifuge tube, add 4 mL of cell nucleus fixation solution, mix well, and incubate at 4℃ for 20 min.
[0173] 1.4 Nuclear membrane perforation: After the incubation in step 1.3, add 210 μL of perforation solution A, mix well, incubate at 4℃ for 15 min, centrifuge and discard the supernatant to obtain the nuclear precipitate.
[0174] 1.5 Washing: Resuspend the nuclear pellet obtained in step 1.4 using nuclear suspension buffer, centrifuge and discard the supernatant, then resuspend the nuclear pellet in 1 mL of nuclear suspension buffer.
[0175] 1.6 Microscopic examination of cell nuclei: Take 9 μL of the cell nucleus suspension obtained in step 1.5 above and mix it with 1 μL of trypan blue staining solution for microscopic examination to determine the total number of cell nuclei, the proportion of fragments and the proportion of cell nuclei clumping.
[0176] The results are shown in Table 2.
[0177] Comparative Example 8
[0178] 0.5M Tris (pH 8.0) was used as the main component of perforation solution A. The remaining operating procedures were the same as in Comparative Example 7. The results are shown in Table 2.
[0179] Comparative Example 9
[0180] 0.2M MES (pH 7.0) was used as the main component of perforation solution A. The remaining operating procedures were the same as in Comparative Example 7. The results are shown in Table 2.
[0181] Comparative Example 10
[0182] RiboLock RNase inhibitor was added to the perforation solution A, which was 0.5M Tris (pH 7.5).
[0183] Step 1: Punching cells into pores
[0184] 1.1 Reagent preparation: cell nucleus isolation kit, cell nucleus fixation solution, perforation solution A, cell nucleus suspension buffer.
[0185] The cell nucleus isolation kit was purchased directly from 10x Genomics, product number 1000493.
[0186] The cell nucleus fixation solution consisted of 1.2 mg / mL dithiobis[succinimide propionate] (DSP) solution, 0.3% formaldehyde (V / V), and 1x PBS.
[0187] The perforation solution A consists of 0.5M Tris (pH 7.5), RiboLock RNase inhibitor, and enzyme-free water.
[0188] The cell nucleus suspension buffer consists of 1x PBS and a ribonuclease inhibitor.
[0189] 1.2 Preparation of cell nuclei: Follow the instructions of the cell nucleus isolation kit in step 1.1 to obtain a suspension of cell nuclei from frozen mouse fat tissue.
[0190] 1.3 Nuclear membrane fixation: Take 1 mL of the cell nucleus suspension of the frozen mouse fat tissue obtained in step 1.2 into a 15 mL centrifuge tube (cell nucleus concentration of 2000 cells / μL), add 4 mL of cell nucleus fixation solution and incubate at 4℃ for 20 min.
[0191] 1.4 Nuclear membrane perforation: After the incubation in step 1.3, add 210 μL of perforation solution A, mix well and incubate at 4°C for 15 min, then centrifuge and discard the supernatant to obtain the nuclear precipitate.
[0192] 1.5 Washing: Resuspend the nuclear pellet obtained in step 1.4 using nuclear suspension buffer, centrifuge and discard the supernatant, then resuspend the nuclear pellet in 1 mL of nuclear suspension buffer.
[0193] 1.6 Microscopic examination of cell nuclei: Take 9 μL of the cell nucleus suspension obtained in step 1.5 above and mix it with 1 μL of trypan blue staining solution for microscopic examination to determine the total number of cell nuclei, the proportion of fragments and the proportion of cell nuclei clumping.
[0194] 1.7 Extraction of nuclear RNA: The RNA extraction kit (QIAGEN, 74004) was used, and the operation was performed according to the instructions of the RNA extraction kit, and the RNA quality was determined.
[0195] The results are shown in Table 2.
[0196] Comparative Example 11
[0197] The RiboLock RNase inhibitor was replaced with an RNase inhibitor, and the remaining procedures were the same as in Comparative Example 10. The results are shown in Table 2.
[0198] Comparative Example 12
[0199] The RiboLock RNase inhibitor was replaced with an oxonium ribonucleoside complex, and the remaining procedures were the same as in Comparative Example 10. The results are shown in Table 2.
[0200] Comparative Example 13
[0201] Perforation solution A (0.5M Tris (pH 7.5), 10mM vanadate ribonucleoside complex, enzyme-free water) and perforation solution B (5% Tween 20 (V / V), enzyme-free water) were used.
[0202] I. Cell nuclear perforation
[0203] 1.1 Reagent preparation: cell nucleus isolation kit, cell nucleus fixative, perforation solution A, perforation solution B, cell nucleus suspension buffer.
[0204] The cell nucleus isolation kit was purchased directly from 10x Genomics, product number 1000493.
[0205] The cell nucleus fixation solution consisted of 1.2 mg / mL dithiobis[succinimide propionate] (DSP) solution (M / V), 0.3% formaldehyde (V / V), and 1x PBS.
[0206] Perforation solution A: 0.5M Tris (pH 7.5), 10mM vanadate ribonucleoside complex, enzyme-free water.
[0207] Perforation solution B: 5% Tween 20 (V / V), enzyme-free water.
[0208] The cell nucleus suspension buffer consists of 1x PBS and a ribonuclease inhibitor.
[0209] 1.2 Preparation of cell nuclei: Follow the instructions of the cell nucleus isolation kit in step 1.1 to obtain a suspension of cell nuclei from frozen mouse fat tissue.
[0210] 1.3 Nuclear membrane fixation: Take 1 mL of the cell nucleus suspension of the frozen mouse fat tissue obtained in step 1.2 into a 15 mL centrifuge tube, add 4 mL of cell nucleus fixation solution and incubate at 4 °C for 20 min.
[0211] 1.4 Nuclear membrane perforation: After adding 210 μL of perforation solution A in step 1.3, mix well and incubate at 4°C for 15 min. Then add 190 μL of perforation solution B, mix well, and incubate at 4°C for 5 min. After the incubation, centrifuge and discard the supernatant.
[0212] 1.5 Washing: Resuspend the nuclear pellet from step 1.4 with 3 mL of nuclear suspension buffer, centrifuge and discard the supernatant, resuspend the centrifuged pellet with 20 μL of nuclear suspension buffer, and transfer the obtained nuclear suspension to a new PCR tube.
[0213] Step 2: cDNA generation
[0214] 2.1 Reagent preparation: reverse transcription buffer, template conversion buffer, membrane breaking agent, stop solution, cDNA amplification premix.
[0215] The reverse transcription buffer consists of the following components and concentrations: 15 U / μL reverse transcriptase, 1x reverse transcriptase buffer, 0.5 mM dNTP, 4.4% PEG8000 (V / V), 0.04 U / μL ribonuclease inhibitor, and 5 μM reverse transcription primer.
[0216] The template conversion buffer consists of the following components and concentrations: 1x reverse transcriptase buffer, 10 U / μL reverse transcriptase, 2 U / μL ribonuclease inhibitor, 2.5 μM template conversion oligonucleotide (TSO), and enzyme-free water.
[0217] The composition and concentration of the membrane-breaking agent are as follows: 2 mg / mL proteinase K, 70 mM NaCl, 1 mM EDTA, and 3% sodium dodecyl sulfate SDS (V / V).
[0218] The terminating solution consists of 100 mM PMSF (phenylmethylsulfonyl fluoride) and enzyme-free water.
[0219] The nucleic acid elution buffer was purchased directly from QIAGEN, catalog number 19086.
[0220] The cDNA amplification premix consists of the following components and concentrations: 0.5 μM amplification primer 1, 0.5 μM amplification primer 2, 1 x KAPA2G Fast HotStart ReadyMix (PCR amplification reagent), and enzyme-free water.
[0221] 2.2 Reverse Transcription Reaction: Add 100 μL of reverse transcription buffer to the nuclear suspension obtained in step 1.5 and mix well. Place the tube on a PCR instrument and run the program. The PCR program is 8℃ for 12 s, {15℃ for 45 s, 20℃ for 45 s, 30℃ for 30 s, 42℃ for 120 s, 50℃ for 180 s}, for 3 cycles, with a final incubation at 50℃ for 5 min. After PCR, transfer the solution from the PCR tube to a 2 mL centrifuge tube, add 800 μL of nuclear suspension buffer, mix well, centrifuge, and discard the supernatant. Finally, resuspend the precipitate with 60 μL of nuclear suspension buffer to obtain a nuclear suspension, and transfer the obtained nuclear suspension to a new PCR tube.
[0222] 2.3 Cell nucleus lysis: The cell nucleus suspension obtained in step 2.2 was mixed with a membrane-disrupting agent at a ratio of 1:1 and then incubated in a metal bath at 55°C for 2 hours at 300 rpm.
[0223] 2.4 Termination of lysis: After the incubation in step 2.3 is completed, add 5 μL of termination solution, mix well, and incubate at room temperature for 10 min.
[0224] 2.5 Purification: After incubation in step 2.4, add AMPure XP magnetic beads at a volume ratio of 1:1.2 and mix well. Incubate at room temperature for 10 min, wash twice with 80% ethanol, and finally elute with 20 μL of nucleic acid elution buffer. Transfer the elution buffer to a new PCR tube.
[0225] 2.6 Template Conversion: Add 100 μL of template conversion buffer to the elution buffer obtained in step 2.5, mix well, and incubate in a metal bath at 42°C for 90 min at 500 rpm. After incubation, add AMPure XP magnetic beads at a 1:1 volume ratio, mix well, let stand at room temperature for 10 min, wash twice with 80% ethanol, and finally elute with 40 μL of nucleic acid elution buffer. Transfer the elution buffer to a new PCR tube.
[0226] 2.7 cDNA Generation: Add 60 μL of cDNA amplification premix to the elution buffer obtained in step 2.6, mix well, and run PCR on a PCR instrument. Perform 16 cycles of 98℃ for 3 min, {98℃ for 15 s, 65℃ for 15 s, 72℃ for 3 min}, followed by a final hold at 72℃ for 5 min and 4℃. After PCR, add SPRIselect magnetic beads at a volume ratio of 1:0.6 for enrichment, and elute with nucleic acid elution buffer to a new PCR instrument.
[0227] 2.8 cDNA quality control: The concentration of cDNA was determined using a Qubit fluorescence spectrophotometer (Thermo Fisher Scientific, model Qubit4.0), and the total amount of cDNA was calculated.
[0228] The results are shown in Table 2.
[0229] Comparative Example 14
[0230] The 5% Tween 20 (V / V) in perforation solution B was replaced with 5% Tritonx-100 (V / V), and the remaining steps were the same as in Comparative Example 13. The results are shown in Table 2.
[0231] Comparative Example 15
[0232] The 5% Tween 20 (V / V) in perforation fluid B was replaced with 5% NP40 (V / V), and the remaining steps were the same as in Comparative Example 13. The results are shown in Table 2.
[0233] Furthermore, based on the experimental results of Embodiment 1 of the present invention provided in Figures 1-3, it is shown that the technical solution provided by the present invention meets the requirements of various experimental quality indicators, and successfully detects information on mRNA and non-coding RNA. The total RNA type percentage is shown in Figure 4.
[0234] The main technical problem addressed by this invention is the sequencing of total RNA transcriptome within the nuclei of mouse adipose tissue cells. According to the experimental procedures, sample integrity is the most critical and primary issue, closely related to the feasibility of subsequent total RNA transcriptome sequencing within the nuclei. Therefore, the core issues to be addressed are: first, to determine suitable fixative components that effectively ensure the integrity of the adipose tissue nuclei; and second, to effectively enhance the free passage of biomolecules across the nuclear membrane and facilitate biological reactions through perforation treatment. Based on this, a large amount of preliminary validation experimental data is not presented in this invention, such as fixative concentration, perforation solution concentration, washing conditions, fixative concentration, reaction conditions, reverse transcription process, cDNA generation, etc. The main validation and comparison experiments addressing the core issues are presented below:
[0235] Because mouse adipose tissue cell nuclei are relatively fragile, and considering that the technical solution of this invention is time-consuming and the process is relatively complex, the requirements for cell nucleus integrity are higher. Based on this, the present invention attempts to fix mouse adipose tissue cell nuclei using a composite fixative. Comparative Examples 1-3 were prepared using 100% methanol (V / V) + 1.2 mg / mL dithiobis[succinimidylpropionate] (DSP) (M / V), 0.3% formaldehyde (V / V) + glacial acetic acid, and 0.3% formaldehyde (V / V) + 1.2 mg / mL dithiobis[succinimidylpropionate] (DSP) (M / V), respectively. The results showed that the cell nuclei fixed with 100% methanol + 1.2 mg / mL dithiobis[succinimidylpropionate] (DSP) (M / V) and formaldehyde + glacial acetic acid were not intact and could not be used for subsequent experiments. The cell nuclei fixed with 0.3% formaldehyde (V / V) + 1.2 mg / mL dithiobis[succinimidylpropionate] (M / V) had better integrity and met the requirements for subsequent experiments. This is likely because DSP contains two active ester groups that can react with the amino groups in intracellular amino acids (such as lysine) to form cross-links, thereby fixing the cell nuclear structure through the formation of stable covalent bonds. Formaldehyde enhances the fixation effect, further maintaining nucleic acids within the cell nucleus and enhancing nuclear stability. Therefore, the combination of formaldehyde and dithiobis[succinimide propionate] (DSP) can improve the quality of fixation. In summary, the components of the fixative described in this invention are (dithiobis[succinimide propionate] (DSP) solution, formaldehyde, PBS, etc.).
[0236] Table 1. Experimental data for comparing and verifying the composition of the fixative in this invention.
[0237] Fixative Main Components | Cell Nucleus Mass | Total Cell Nuclei (number) | Comparative Example 1 | 100% Methanol (V / V) + 1.2 mg / mL Dithiobis[Succinimidylpropionate] (DSP) | Fragmentation Ratio: 40% | Agglomeration Ratio: 32% | 200,000 | Comparative Example 2 | 0.3% Formaldehyde (V / V) + Glacial Acetic Acid (V / V) | Fragmentation Ratio: 46% | Agglomeration Ratio: 35% | 180,000 | Comparative Example 3 | 0.3% Formaldehyde (V / V) + 1.2 mg / mL Dithiobis[Succinimidylpropionate] (DSP) | Fragmentation Ratio: 15% | Agglomeration Ratio: 8% | 340,000 |
[0238] Based on the determination of the fixative components, formaldehyde + dithiobis[succinimide propionate] (DSP) was then used to bind the fixed cell nuclei for subsequent experiments. The results showed low cDNA yield. It is speculated that this may be because the fixed cell nuclei have a dense and compact structure, resulting in less penetration of the external solution into the nucleus and thus failing to achieve the desired effect. Therefore, the fixed cell nuclei need to be permeabilized to allow external biological reagents to quickly and efficiently enter the nucleus. This invention attempts to use a perforation solution to perforate the fixed cell nuclei. Comparative Examples 4-6 used 5% Tween 20 (V / V), 5% Tritonx-100 (V / V), and 5% NP40 (V / V) to treat the fixed cell nuclei, respectively. The results showed that the integrity of the cell nuclei was damaged to varying degrees, with increased fragmentation and clumping rates, making it impossible to complete subsequent experiments smoothly. This may be because adipose tissue cell nuclei are relatively fragile and sensitive to changes in the chemical environment. Therefore, this invention attempts to treat the nucleus with a buffer solution first to bring the nuclear membrane to a relatively stable state. Comparative Examples 7-9 used 0.5M Tris (pH 7.5), 0.5M Tris (pH 8.0), and 0.2M MES (pH 7.0) for treatment. The results showed that after treatment with 0.5M Tris (pH 8.0) and MES, the proportion of cell nucleus fragmentation and clumping was higher; 0.5M Tris (pH 7.0)... 7.5) The results after treatment showed that the proportion of nuclear fragments and clumping were both below 4%, and the nuclear structure could be maintained in a relatively stable state. Furthermore, considering that Tris (pH 7.5) can help maintain a relatively stable pH value in the environment after nuclear fixation, various chemical reactions and intermolecular interactions exist within the cell nucleus. To avoid RNA degradation, this invention attempted to add inhibitors to the perforation solution A. Comparative Examples 10-12 used RiboLock RNase inhibitor (Thermo Fisher Scientific, EO0381), RNase inhibitor (Thermo Fisher Scientific, N8080119), and vanadium ribonucleoside complex (NEB, S1402), respectively. The results showed that after the addition of vanadium ribonucleoside complex (NEB, S1402), the RIN value of RNA was above 8.5, while the RIN values of RNA after the addition of the other two inhibitors were below 7.5, indicating that vanadium ribonucleoside complex can effectively inhibit the activity of various ribonucleases.
[0239] In summary, the components of perforation solution A are Tris (pH 7.5), vanadate ribonucleoside complex, etc. After determining the formulation of perforation solution A, comparative examples 13-15 were performed using 5% Tween 20 (V / V), 5% Tritonx-100 (V / V), and 5% NP4 (V / V), respectively. The results showed that the cDNA yield was higher after treatment with 5% Tritonx-100 (V / V) than that after treatment with 5% Tritonx-100 (V / V). This indicates that adjusting the environment with perforation solution A before adding Tritonx-100 allows for more precise control of the increase in nuclear membrane permeability. It can dissolve lipid components in the cell membrane and nuclear membrane without damaging the cell structure, effectively removing lipid components on the nuclear membrane and thus increasing nuclear permeability. In summary, the components of perforation solution B are (Trionx-100, enzyme-free water, etc.).
[0240] Table 2 Comparison and verification data of main components of perforation fluid
[0241]
[0242] In summary, the solutions to the core problems described above include the following steps: 1. The components of the cell nucleus fixation solution: dithiobis[succinimide propionate] (DSP) solution, formaldehyde, PBS, etc.; 2. The components of the perforation solution: perforation solution A (Tris (pH 7.5), vanadate ribonucleoside complex, enzyme-free water, etc.) and perforation solution B (Trionx-100, enzyme-free water, etc.).
[0243] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0244] As used in this invention, the terms "comprising" and "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.
[0245] As used in this invention, the term "and / or" includes any one or more of the related listed items and all combinations thereof.
[0246] The scope of protection of this invention is not limited to the above embodiments. Any variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of this invention are included in this invention and are protected by the appended claims.
Claims
1. A library preparation method for total RNA transcriptome sequencing of frozen mouse adipose tissue, characterized in that the specific steps of the library preparation method are as follows: Step 1: Punching cells into pores 1.1 Reagents preparation: Nuclear isolation kit, nuclear fixation solution, perforation solution A, perforation solution B, nuclear suspension buffer; 1.2 Preparation of cell nuclei: Following the operating instructions of the cell nucleus isolation kit described in step 1.1, a suspension of cell nuclei from frozen mouse adipose tissue was obtained; 1.3 Nuclear membrane fixation: Take the cell nucleus suspension of the mouse fat frozen tissue obtained in step 1.2 into a new centrifuge tube and incubate it in cell nucleus fixation solution; 1.4 Nuclear membrane perforation: After the incubation in step 1.3, perforation solution A is added for incubation. After the incubation is completed, perforation solution B is added for further incubation. After the incubation is completed, the supernatant is discarded by centrifugation to obtain the nuclear precipitate. 1.5 Washing: Resuspend the nuclear precipitate obtained in step 1.4 using nuclear suspension buffer, centrifuge and discard the supernatant to obtain the precipitate; Step 2: Generation of total RNA transcriptome library 2.1 Reagent preparation: poly(A) tail buffer, cell nuclear suspension buffer, reverse transcription buffer, template conversion buffer, membrane perforation agent, stop solution, nucleic acid elution buffer, cDNA amplification premix, library construction kit; 2.2 Pretreatment before reverse transcription: Resuspend the precipitate from step 1.5 using poly(A) tail buffer, transfer it to a 2 mL centrifuge tube, mix well and incubate, centrifuge and discard the supernatant, then resuspend the centrifuged precipitate with 20 μL of nuclear suspension buffer to obtain a nuclear suspension, and transfer the obtained nuclear suspension to a new PCR tube; 2.3 Reverse transcription reaction: Add 100 μL of reverse transcription buffer to the nuclear suspension obtained in step 2.2, mix well, place on a PCR instrument and run the program. After PCR, transfer the solution in the PCR tube to a 2 mL centrifuge tube, add 800 μL of nuclear suspension buffer, mix well, centrifuge and discard the supernatant, then resuspend the precipitate with 60 μL of nuclear suspension buffer to obtain a nuclear suspension, and transfer the obtained nuclear suspension to a new PCR tube; 2.4 Cell nucleus lysis: Add the cell nucleus suspension obtained in step 2.3 to the cell membrane lysis agent at a ratio of 1:1, mix well, and incubate in a metal bath; 2.5 Termination of pyrolysis: After the incubation in step 2.4 is completed, add the termination solution, mix well, and let stand for incubation; 2.6 Purification: After the incubation in step 2.5, add AMPure XP magnetic bead reagent at a volume ratio of 1:(1.1-1.2), mix well, let stand, wash twice with 80% ethanol, then elute with nucleic acid elution buffer, and transfer the obtained elution buffer to a new PCR tube; 2.7 Template conversion: Add template conversion buffer to the elution buffer obtained in step 2.6, mix well, and incubate in a metal bath; after incubation, add AMPure XP magnetic bead reagent at a volume ratio of 1:(1-1.1), mix well, let stand, wash twice with 80% ethanol, then elute with nucleic acid elution buffer, and transfer the obtained elution buffer to a new PCR tube; 2.8 cDNA amplification: Add the cDNA amplification premix to the elution buffer obtained in step 2.7, mix well, and run PCR on a PCR instrument. After the PCR is completed, add SPRIselect magnetic bead reagent at a volume ratio of 1:(0.5-0.6) for enrichment and incubation, and elute with nucleic acid elution buffer to a new PCR instrument. Use a Qubit fluorescence spectrophotometer to determine the concentration of cDNA. 2.9 Total RNA Library Construction and Quality Control: The library was constructed according to the instructions of the library construction kit, and the library concentration was determined using a Qubit fluorescence spectrophotometer; the library peak chromatogram was quality controlled using a bioanalyzer.
2. The library construction method according to claim 1, characterized in that, in step 1.1, the composition and concentration of the nuclear fixation solution are: 0.8~1.2 mg / mL dithiobis[succinimide propionate] solution (M / V), 0.3%~0.5% formaldehyde solution (V / V), 1x PBS; and / or, the composition and concentration of the perforation solution A are: 0.5~0.8M Tris (pH 7.5), 8~10mM vanadate ribonucleoside complex, enzyme-free water; and / or, the composition and concentration of the perforation solution B are: 3%~5% Triton X-100 (V / V), enzyme-free water; and / or, the composition and concentration of the nuclear suspension buffer are: 0.5~1 U / μL nuclease inhibitor, 1x PBS.
3. The method as described in claim 1, characterized in that, In step 1.2, the concentration of the cell nucleus suspension of the frozen mouse adipose tissue is 1000-2000 cells / μL; and / or, in step 1.3, the incubation conditions are 4℃~6℃ for 20~25 min; and / or, in step 1.4, the incubation conditions with the addition of perforation solution A are 4℃~6℃ for 15~20 min; and / or, in step 1.4, the incubation conditions with the addition of perforation solution B are 4℃~6℃ for 5~7 min.
4. The method as described in claim 1, characterized in that, In step 2.1, the components and concentration of the poly(A) tail buffer are: 1x~1.3x yeast polyadenylate polymerase buffer, 120~150U / μL yeast polyadenylate polymerase, 0.5~1mM adenosine triphosphate, and 0.2~0.4U / μL ribonuclease inhibitor; and / or, the components and concentration of the reverse transcription buffer are: 15~20U / μL reverse transcriptase, 1x~1.2x reverse transcriptase buffer, 0.5~1mM dNTP, 4%~4.4% PEG8000 (V / V), 0.02~0.04U / μL ribonuclease inhibitor, 3~5μM reverse transcription primer, and enzyme-free water; and / or, the components and concentration of the template conversion buffer are: 1x~1.2x reverse transcriptase buffer, 8~10U / μL reverse transcriptase, and 1~3U / μL reverse transcriptase. The membrane-breaking agent comprises: ribonuclease inhibitor, 2.0-2.5 μM template conversion oligonucleotide (TSO), and enzyme-free water; and / or, the membrane-breaking agent comprises: 1-2 mg / mL proteinase K, 50-70 mM NaCl, 0.8 mM-1 mM EDTA, and 2%-3% sodium dodecyl sulfate (SDS) (V / V); and / or, the stop solution comprises: 80-100 mM benzyl sulfonyl fluoride (PMSF) and enzyme-free water; and / or, the cDNA amplification premix comprises: 0.5-0.6 μM amplification primer 1, 0.5-0.6 μM amplification primer 2), 1 x KAPA2G Fast HotStart ReadyMix PCR amplification reagent, and enzyme-free water; and / or, the cell nuclear suspension buffer comprises: 0.5-1 U / μL nuclease inhibitor and 1 x PBS.
5. The method as described in claim 1, characterized in that, In step 2.2, the incubation conditions are 25℃ for 10-15 min; and / or, in step 2.3, the PCR program is 8℃ for 12 s, {15℃ for 45 s, 20℃ for 45 s, 30℃ for 30 s, 42℃ for 120 s, 50℃ for 180 s} for 3 cycles, with a final incubation at 50℃ for 5 min; and / or, in step 2.4, the metal bath incubation conditions are 55℃ for 1.5-2 h at 200-300 rpm.
6. The method as described in claim 1, characterized in that, In step 2.5, the static incubation conditions are 25℃~28℃ for 10~15 min; and / or, in step 2.6, the static temperature is 25℃~28℃ and the static time is 10~15 min; and / or, in step 2.7, the metal bath incubation conditions are 42℃ for 90~100 min and 300~500 rpm; and / or, in step 2.7, the static temperature is 25℃~28℃; and / or, in step 2.7, the static time is 10~15 min.
7. The method as described in claim 1, characterized in that, In step 2.8, the PCR program is 16 cycles of 98℃ for 3 min, {98℃ for 15 s, 65℃ for 15 s, 72℃ for 3 min}, followed by a final incubation at 72℃ for 5 min and a hold at 4℃; and / or, the enrichment incubation temperature is 25℃~28℃, and the enrichment incubation time is 10~15 min.
8. The method as described in claim 1, characterized in that, The centrifugation conditions were all 8500~10000 rpm for 5~7 min.
9. The method as described in claim 1, characterized in that, The nucleotide sequence of the reverse transcription primer is shown in SEQ ID NO.1; and / or, the nucleotide sequence of the template conversion oligonucleotide TSO is shown in SEQ ID NO.2; and / or, the nucleotide sequence of the amplification primer 1 is shown in SEQ ID NO.3; and / or, the nucleotide sequence of the amplification primer 2 is shown in SEQ ID NO.
4.
10. The cDNA and library prepared by the library preparation method according to any one of claims 1-9, which can be used for total RNA analysis of single cells in frozen mouse fat tissue.
11. A reagent kit, characterized in that, The kit includes a nuclear fixation solution, perforation solution A, and perforation solution B. Specifically, the nuclear fixation solution consists of: 0.8–1.2 mg / mL dithiobis[succinimide propionate] solution, 0.3%–0.5% formaldehyde solution (V / V), and 1x PBS; perforation solution A consists of: 0.5–0.8 M Tris (pH 7.5), 8–10 mM vanadate ribonucleoside complex, and enzyme-free water; and perforation solution B consists of: 3%–5% Triton X-100 (V / V) and enzyme-free water.
12. The library construction method as described in any one of claims 1-9, or the kit as described in claim 11, is used in cell nuclear fixation, intranuclear reverse transcription, and total RNA transcriptome sequencing of frozen mouse adipose tissue.