Comparison of total nucleic acid expression in blood before and after cardiac surgery including maze surgery and application of marker for diagnosing complications including acute renal failure

Abstract

The present invention relates to a biomarker for diagnosing or predicting the onset of postoperative acute kidney injury, and a method for diagnosing or predicting the onset of postoperative acute kidney injury using same. Specifically, the present invention relates to a method for diagnosing or predicting the onset of acute kidney injury by using, as a biomarker, miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, or miR-548aq-3p in a blood sample following open-heart surgery.

Description

Comparison of total nucleic acid expression in blood before and after cardiac surgery including the Maze procedure and application of diagnostic markers for complications including acute renal failure

[0001] The present invention relates to a biomarker for diagnosing or predicting the onset of acute kidney injury after surgery and a method for diagnosing or predicting the onset of acute kidney injury after surgery using the same. Specifically, the invention relates to a method for diagnosing or predicting the onset of acute kidney injury using miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, or miR-548aq-3p in blood samples after open-heart surgery as biomarkers.

[0002] This application claims priority based on Korean Patent Application No. 10-2024-0185203 filed on December 12, 2024, and all contents disclosed in the specification and drawings of said application are incorporated into this application.

[0003] Acute Kidney Injury (AKI) is one of several pathological conditions that impair the structure and function of the kidneys and is characterized by a rapid decline in renal function. It is a broad clinical syndrome caused by complex and diverse factors, including acute tubular necrosis, interstitial nephritis, glomerulonephritis, vasculitis and ischemia, and secondary damage caused by nephrotoxic drugs. It is a severe complication that frequently occurs after open-heart surgery performed in cardiovascular and thoracic surgery. Generally, AKI is diagnosed by indirectly evaluating the degree of renal function through the measurement of serum creatinine. However, since serum creatinine is influenced by individual weight, age, gender, muscle mass, protein intake, and medications, it does not reflect changes in renal function in real time. Furthermore, because serum creatinine generally increases when renal function declines by more than 50%, it is difficult to diagnose AKI early. In particular, acute kidney injury occurring after surgery can drastically reduce patient survival rates, and if a patient fails to recover from acute kidney injury and undergoes renal replacement therapy, their quality of life is inevitably significantly degraded even if they survive (Korean Patent Publication No. 10-2024-0023874). Although acute kidney injury increases patient morbidity and mortality, it is a treatable disease through prevention and early diagnosis, and it has been reported that early recovery from acute kidney injury through appropriate treatment is significantly correlated with improved patient survival rates. Therefore, active research is currently being conducted in the medical field on methods to predict the risk of acute kidney injury occurring after surgery at an early stage. However, since acute kidney injury after surgery is caused by complex factors, early prediction is considerably difficult, and there is currently a lack of methods capable of diagnosing and predicting the likelihood of developing acute kidney injury after surgery with high accuracy.

[0004] The present invention was devised to solve the problems of the prior art described above. The inventors conducted extensive research on a method capable of diagnosing or predicting the onset of acute kidney injury after surgery with high accuracy and sensitivity, while detecting the condition quickly and easily enough to be measured in a standard laboratory of a general hospital using a non-invasive method. As a result, the inventors confirmed that acute kidney injury after surgery can be diagnosed early with high accuracy by using miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, or miR-548aq-3p of the present invention, thereby completing the present invention.

[0005] The present invention aims to provide a biomarker composition for diagnosing acute renal injury after heart surgery, comprising as an active ingredient one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0006] In addition, the present invention aims to provide a composition for diagnosing acute renal injury after cardiac surgery, comprising as an active ingredient a preparation capable of measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0007] In addition, the present invention aims to provide a kit for diagnosing acute renal injury after cardiac surgery comprising a composition for diagnosing acute renal injury after cardiac surgery, comprising as an active ingredient a preparation capable of measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0008] In addition, the present invention aims to provide a diagnostic device for acute kidney injury after heart surgery, comprising: a measuring unit for measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p; and a judgment unit for comparing the expression level of the miRNA with the expression level of the corresponding miRNA of a biological sample of a control group.

[0009] In addition, the present invention aims to provide a method for providing information regarding the diagnosis of acute kidney injury after heart surgery, comprising: a) measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p from a biological sample isolated from a heart surgery patient; and b) comparing the expression level with the expression level of the corresponding miRNA in a biological sample of a control group.

[0010] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art to which the present invention belongs from the description below.

[0011] The present invention provides a biomarker composition for diagnosing acute renal injury after heart surgery, comprising as an active ingredient one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0012] In addition, the present invention provides a biomarker composition for predicting the onset of acute kidney injury after heart surgery, comprising as an active ingredient one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0013] In addition, the present invention provides a composition for diagnosing acute renal injury after heart surgery, comprising as an active ingredient a preparation capable of measuring the expression level of one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0014] In addition, the present invention provides a composition for predicting the onset of acute renal injury after heart surgery, comprising as an active ingredient a preparation capable of measuring the expression level of one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0015] In addition, the present invention provides a kit for diagnosing acute renal injury after cardiac surgery comprising a composition for diagnosing acute renal injury after cardiac surgery, comprising as an active ingredient a preparation capable of measuring the expression level of one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0016] In addition, the present invention provides a kit for predicting the onset of acute kidney injury after cardiac surgery, comprising a composition for diagnosing acute kidney injury after cardiac surgery that includes, as an active ingredient, a preparation capable of measuring the expression level of one or more microRNAs (microRNAs; miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

[0017] In addition, the present invention provides a diagnostic device for acute kidney injury after heart surgery, comprising: a measuring unit for measuring the expression level of one or more microRNAs (microRNAs; miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p; and a judgment unit for comparing the expression level of the miRNA with the expression level of the corresponding miRNA of a biological sample of a control group.

[0018] In addition, the present invention provides a device for predicting the onset of acute kidney injury after heart surgery, comprising: a measuring unit for measuring the expression level of one or more microRNAs (microRNAs; miRNAs) selected from a group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p; and a judgment unit for comparing the expression level of the miRNA with the expression level of the corresponding miRNA of a biological sample of a control group.

[0019] In addition, the present invention provides a method for providing information regarding the diagnosis of acute kidney injury after heart surgery, comprising: a) measuring the expression level of one or more microRNAs (microRNAs; miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p from a biological sample isolated from a heart surgery patient; and b) comparing the expression level with the expression level of the corresponding miRNA in a biological sample of a control group.

[0020] In addition, the present invention provides a method for providing information regarding the prediction of acute kidney injury after heart surgery, comprising: a) measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p from a biological sample isolated from a heart surgery patient; and b) comparing the expression level with the expression level of the corresponding miRNA in a biological sample of a control group.

[0021] In addition, the present invention provides a method for diagnosing acute kidney injury after heart surgery, comprising: a) measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p from a biological sample isolated from a heart surgery patient; and b) comparing the expression level with the expression level of the corresponding miRNA in a biological sample of a control group.

[0022] In addition, the present invention comprises: a) treating cardiac cells with a candidate substance and measuring the expression level of one or more microRNAs (microRNAs; miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p; b) comparing the expression level with the expression level of the corresponding miRNA in a control group not treated with the candidate substance; and c) when the expression of one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p is increased, or when one or more miRNAs selected from the group consisting of miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p is decreased, the method for selecting a candidate substance as a drug for the prevention or treatment of acute renal injury after heart surgery is provided.

[0023] In addition, the present invention provides a composition comprising, as an active ingredient, a preparation capable of measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p, for the diagnosis of acute renal injury after cardiac surgery.

[0024] In addition, the present invention provides a use for a composition comprising, as an active ingredient, a preparation capable of measuring the expression level of one or more microRNAs (miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p for predicting the onset of acute renal injury after cardiac surgery.

[0025] In addition, the present invention comprises: a) measuring the expression level of one or more microRNAs (microRNAs; miRNAs) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p from a biological sample isolated from a heart surgery patient; b) comparing the expression level with the expression level of the corresponding miRNA in a biological sample of a control group; c) a step of diagnosing acute kidney injury when the expression of one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p is decreased, or when one or more miRNAs selected from the group consisting of miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p are increased; and d) a method for treating a patient who has developed acute kidney injury after surgery, wherein the patient or individual diagnosed with acute kidney injury undergoes treatment for acute kidney injury. The treatment for acute kidney injury may include, without limitation, all treatment methods generally performed on patients who have developed acute kidney injury or prophylactic treatment methods for acute kidney injury.

[0026] In one embodiment of the present invention, the heart surgery may be any one selected from the group consisting of Maze surgery, coronary artery bypass grafting (CABG), valve surgery, aortic surgery, heart transplantation, and LVAD insertion (Left Ventricular Assist Device), but is not limited thereto if the heart surgery is performed through open chest. Most preferably, the heart surgery is a Cox-Maze procedure.

[0027] In another embodiment of the present invention, the miRNA may be one or more selected from the group consisting of: a) miR-451a comprising the nucleotide sequence of SEQ ID NO. 1; b) miR-185-5p comprising the nucleotide sequence of SEQ ID NO. 2; c) miR-221-3p comprising the nucleotide sequence of SEQ ID NO. 3; d) miR-191-5p comprising the nucleotide sequence of SEQ ID NO. 4; e) miR-484 comprising the nucleotide sequence of SEQ ID NO. 5; f) miR-144-3p comprising the nucleotide sequence of SEQ ID NO. 6; g) miR-1972 comprising the nucleotide sequence of SEQ ID NO. 7; h) miR-4478 comprising the nucleotide sequence of SEQ ID NO. 8; i) miR-1273h-5p comprising the nucleotide sequence of SEQ ID NO. 9; j) miR-619-5p comprising the nucleotide sequence of SEQ ID NO. 10; k) miR-4430 comprising the nucleotide sequence of SEQ ID NO. 11; and l) miR-548aq-3p comprising the nucleotide sequence of SEQ ID NO. 12. Additionally, as per the entire claim below, any one or more variants of SEQ ID NOs 1 to 12 are included within the scope of the present invention. For example, the concept includes variants and mimics in which some nucleotide sequences of miRNA have been modified by deletion, substitution, or insertion, but which can perform the same function as the miRNA nucleic acid molecule. Specifically, it may have 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more, with one or more nucleotide sequences of SEQ ID NOs 1 to 12. Most preferably, it may include a nucleotide sequence having 98% or more sequence homology with one or more nucleotide sequences of SEQ ID NOs 1 to 12.The “% of sequence homology” is determined by comparing the optimally arranged sequence with a comparison region, which may include additions or deletions (i.e., gaps) compared to a reference sequence (without additions or deletions) for the optimal arrangement of the polynucleotide sequence in the comparison region. Alignment performed for the purpose of determining the percentage of sequence homology may be achieved in various ways within the common sense of a person skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MEGALIGN™ (DNASTAR) software. A person skilled in the art may determine appropriate parameters for measuring alignment, including any algorithm necessary to achieve maximum alignment over the entire length of the sequences being compared.

[0028] In another embodiment of the present invention, the agent capable of measuring the expression level may be an oligonucleotide, primer, or probe having a sequence complementary to one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p, but is not limited thereto as long as it is an agent generally known to specifically bind to miRNAs.

[0029] In another embodiment of the present invention, the method may further include, after step b), step c) classifying as a high-risk group for acute renal injury when the expression of one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p is decreased, or when one or more miRNAs selected from the group consisting of miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p is increased.

[0030] In another embodiment of the present invention, the method may further include, after step b), a step of diagnosing acute renal injury when the expression of one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p is decreased, or when one or more miRNAs selected from the group consisting of miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p is increased.

[0031] In another embodiment of the present invention, the “increase” or “decrease” is preferably increased or decreased by at least about 1.3 times compared to the control group, more preferably increased or decreased by at least about 1.5 times, and most preferably increased or decreased by at least 1.7 times.

[0032] In another embodiment of the present invention, the control group is a patient who has not developed acute kidney injury after heart surgery.

[0033] In another embodiment of the present invention, the biological sample may be blood, plasma, serum, bone marrow, tissue, cell, saliva, sputum, peritoneal fluid, or urine, but is not limited thereto as long as the sample can be obtained by a non-invasive method. Most preferably, the biological sample is blood or plasma.

[0034] In another embodiment of the present invention, it is preferable that the biological sample be separated within 0 to 48 hours after surgery. Most preferably, the blood or plasma be separated within 12 to 36 hours after surgery.

[0035] In another embodiment of the present invention, the measurement may be next-generation sequencing (NGS), reverse transcriptase-polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time-polymerase chain reaction (real-time-PCR), quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), RNase protection assay (RPA), Northern blotting, or a DNA chip method, but is not limited thereto as long as it is a method known to measure the expression level of miRNA. Most preferably, it is next-generation sequencing or quantitative reverse transcriptase chain reaction.

[0036] In another embodiment of the present invention, the treatment method for a patient who has developed acute kidney injury after surgery may be one or more selected from the group consisting of fluid supply, use of a vasopressor, blood transfusion, calcium injection, administration of bicarbonate, and dialysis.

[0037] In another embodiment of the present invention, the candidate substance is not limited to nucleotides, DNA, RNA, amino acids, aptamers, proteins, compounds, natural products, natural extracts, etc., as long as it is a substance that can be used as a drug for the prevention or treatment of acute kidney injury after heart surgery.

[0038] The biomarker according to the present invention measures the expression level of circulating nucleic acids contained in non-invasive biological samples, such as blood, in addition to the patient's tissue after surgery. As a method for diagnosing acute kidney injury that may occur after surgery or predicting high-risk groups for acute kidney injury, it is expected to greatly contribute to improving the survival rate and quality of life of patients after surgery by enabling early recovery from acute kidney injury through appropriate treatment, as it can predict acute kidney injury in the early postoperative period.

[0039] FIG. 1 is a schematic diagram briefly illustrating the research steps of discovering and verifying blood-based microRNA biomarkers using pre- and post-operative blood and surgical tissue obtained from a patient who underwent the Maze procedure according to one embodiment of the present invention, and further elucidating the pathological mechanism through a cell model.

[0040] FIG. 2 is a diagram showing the results of comparing and analyzing RNA expression patterns in plasma and RNA expression patterns in surgical tissue before and after surgery according to one embodiment of the present invention.

[0041] Figure 3 is a table showing three types of miRNAs exhibiting representative expression patterns in 10 identified clusters according to one embodiment of the present invention.

[0042] Figure 4 is a diagram showing the results of analyzing the similarity of expression patterns between each sample by calculating the Spearman correlation according to one embodiment of the present invention.

[0043] Figure 5 is a diagram showing the results of comparing and analyzing miRNA expression according to AKI in blood samples after surgery according to one embodiment of the present invention.

[0044] FIG. 6 is a diagram showing the results of analyzing miRNA expression according to surgical location within the tissue using the results of spatial whole transcriptome analysis according to one embodiment of the present invention.

[0045] FIG. 7 is a diagram showing the results of verifying a biomarker according to an embodiment of the present invention through quantitative PCR. * indicates statistical significance.

[0046] FIG. 8 is a diagram showing the results of an in vitro experiment conducted to confirm the pathological mechanism of the biomarker of the present invention according to one embodiment of the present invention, and observation using a phase-contrast microscope.

[0047] In all claims below, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0048] In all claims below, the terms of degree, such as “about,” “approximately,” “substantially,” “average,” “generally,” etc., are used in the sense of being at or close to the value when inherent manufacturing and material tolerances are presented in the sense mentioned, and are used to prevent unscrupulous infringers from unfairly exploiting the disclosure regarding the precise or absolute value mentioned to aid in understanding the present invention. For example, the terms “about,” “approximately,” “substantially,” “average,” “generally,” etc., may refer to amounts within 10%, within 5%, within 3%, within 1%, within 0.1%, and within 0.01% of the mentioned amount.

[0049] In the entirety of the following claims, "step of" or "step of" does not mean "step for".

[0050] In all claims below, the term “group consisting of” or “combination thereof” included in a Markush-type expression means one or more mixtures or combinations selected from a group consisting of components described in a Markush-type expression, and means including one or more selected from the group consisting of said components.

[0051] In the entirety of the following claims, the description of "A and / or B" means "A or B, or A and B".

[0052] In all claims below, the term “subject” in this specification refers to a mammal that is the subject of identification, distinction, classification, diagnosis, treatment, observation, or experiment, and is preferably interpreted to include mammals such as humans, primates including chimpanzees, pets such as dogs and cats, livestock such as cattle, horses, sheep, and goats, and rodents such as mice and rats. Additionally, “normal group” or “control group” is also interpreted in this sense and most preferably refers to a patient undergoing open-heart surgery to be detected. Furthermore, the term “subject in need thereof” may preferably refer to a subject undergoing heart surgery or a high-risk group for developing acute kidney injury after heart surgery, but is not limited thereto.

[0053] In all claims below, the term “isolate” means altered or removed from its natural state. For example, nucleic acids or peptides that naturally exist under normal conditions in a living object are not “isolated,” but the same nucleic acids or peptides are “isolated” by being partially or completely separated from coexisting materials under natural conditions. The isolated nucleic acids or proteins may exist in a substantially purified form or may exist in a non-natural environment, such as a host cell, for example.

[0054] In this specification, including all claims below, the term "biological sample" means any sample capable of confirming the concentration of circulating nucleic acids, i.e., miRNA, in the body, and preferably may be blood, plasma, serum, bone marrow, tissue, cell, saliva, sputum, peritoneal fluid, hair, urine, feces, cerebrospinal fluid, various secretions, etc., but is not limited thereto as long as it is a sample that can be obtained by a non-invasive method containing miRNA. The sample may be pretreated through methods such as homogenization, filtration, distillation, extraction, concentration, inactivation of interfering components, and addition of reagents before use for detection or diagnosis.

[0055] In all claims below, the term "kit" in this specification refers to a diagnostic device capable of predicting the therapeutic responsiveness to a biological agent in a patient who has undergone open-heart surgery, contained within a biological sample. Preferably, it is in the form of an oligonucleotide, primer, or probe that specifically binds to miRNA, a container for the sample, and instructions for the use of the components, but is not limited thereto as long as it is in the form capable of measuring the amount of miRNA from the biological sample. Preferably, it is one or more selected from the group consisting of a microarray kit, a reverse transcription polymerase chain reaction (RT-PCR) kit, and a qRT-PCR kit, but is not limited thereto. In addition to the compound or composition, the kit may include other components, compositions, solutions, devices, etc., that are typically required for the preparation, storage, administration, etc. of the said substances. For example, the kit may include instructions, etc., for the proper use and storage of the kit according to the present invention.

[0056] In all claims below, the term "diagnosis instrument" in this specification refers to an apparatus capable of measuring the miRNA of the present invention in vitro based on biological samples generated in the human body, such as blood, saliva, or urine, and preferably includes an inlet for adding a biological sample, a detector capable of measuring the amount of miRNA, a computational unit for comparing and calculating values, and an output unit for displaying analysis results, but is not limited thereto as long as the apparatus is of a form capable of predicting therapeutic responsiveness to a biological agent by measuring and analyzing the amount of miRNA contained in the biological sample.

[0057] In this specification, including all claims below, "expression level measurement" refers to a process of confirming the presence and / or expression amount of a biomarker, i.e., the miRNA of the present invention or a biomarker composition, in a biological sample to diagnose acute kidney injury or to confirm information regarding the prediction of a high-risk group for developing acute kidney injury. This can be measured by measuring or confirming the amount of miRNA using a primer set, probe set, antisense oligonucleotide, etc., that specifically bind to the miRNA of the present invention. Analysis methods for this purpose include next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), competitive reverse transcription polymerase chain reaction (Competitive RT-PCR), real-time reverse transcription polymerase chain reaction (real-time RT-PCR), RNase protection assay (RPA), Northern blotting, DNA microarray chips, etc., but are not limited thereto as long as they are methods capable of confirming the miRNA of the present invention. Accordingly, the diagnostic composition, kit, diagnostic device, etc. of the present invention may all include, in addition to each primer pair specific to the marker gene, a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase, RNase inhibitor, DEPC-water, sterile water, etc.

[0058] In this specification, including all claims below, the term “detection” includes both measuring and confirming the presence (expression) of a target substance and measuring and confirming a change in the level of presence (expression level) of the target substance. In the same context, detecting miRNA contained in the biomarker composition of the present invention means measuring the amount of miRNA, measuring the presence of miRNA (i.e., measuring its existence), or measuring the level of qualitative and quantitative change of said miRNA. Such measurements may be performed without limitation, including both qualitative methods (analysis) and quantitative methods. The types of qualitative and quantitative methods for measuring the presence of miRNA are well known in the art, and the experimental methods described in this specification are included therein.

[0059] In all claims below, the term "primer" refers to a short nucleic acid sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. The primer can initiate DNA synthesis in the presence of reagents for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different nucleotide triphosphates at an appropriate buffer and temperature. The primer specifically binds to a polynucleotide that serves as the template under suitable buffer and temperature conditions, and DNA is synthesized by the DNA polymerase adding and linking the nucleoside triphosphate, which has a base complementary to the template DNA, to the primer. The primer generally consists of 15 to 30 base sequences, and the melting temperature (Tm) at which it binds to the template strand varies depending on the base composition and length. The sequence of the primer does not need to be completely complementary to a portion of the template's nucleotide sequence; it is sufficient if it has a length and complementarity suitable for the purpose of measuring the amount of miRNA by amplifying a specific region of miRNA through DNA synthesis. Therefore, in the present invention, primer pairs can be easily designed by referring to the nucleotide sequence of the miRNA of the present invention. The primers for the amplification reaction consist of a set (pair) that bind complementarily to the template (or sense) and the opposite side (antisense) at both ends of the specific region of miRNA to be amplified, respectively. The PCR conditions and the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

[0060] In all claims below, the term "probe" in this specification refers to a fragment of a polynucleotide, such as RNA or DNA, with a length ranging from several to hundreds of base pairs, capable of specifically binding to the mRNA, cDNA (complementary DNA), DNA, etc., of a specific gene, and is labeled so as to confirm the presence or expression level of the target to which it binds, i.e., the miRNA of the present invention. Appropriate probes and hybridization conditions may be appropriately selected according to techniques known in the art.

[0061] In the entire specification including the following claims, “oligonucleotide” or “antisense oligonucleotide” is a base sequence that binds complementarily to the miRNA of the present invention to inhibit expression, and includes, but is not limited to, antisenseRNA and antagonist miRNA.

[0062] Including all claims below, the oligonucleotides, primers, or probes may be chemically synthesized using a phosphoramidite solid support synthesis method or other widely known methods. Additionally, the primers or probes may be modified in various ways according to methods known in the art to the extent that hybridization with the target polynucleotide to be detected is not interfered with. Examples of such modifications include methylation, capping, substitution with one or more homologues of the natural nucleotide, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonate, phosphotriester, phosphoromidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.), and the binding of fluorescent or enzymatic labeling materials.

[0063] In this specification, including all claims below, microRNA (miRNA) is a collective term for small non-coding RNA molecules composed of about 10 to 30 nucleotides. Such microRNAs are observed endogenously in plants, animals, viruses, etc., and are known to regulate protein production by participating in post-transcriptional gene expression and RNA silencing. Due to the action of these miRNAs, cells can precisely regulate gene expression in various physiological processes, and consequently, they are currently being actively researched as new therapeutic candidates for various intractable diseases. The miRNA of the present invention may exist in a single-stranded or double-stranded form. Mature miRNA molecules mainly exist as single strands, but precursor miRNA molecules may include a partially self-complementary structure (e.g., a stem-loop structure) capable of forming a double strand. In addition, the miRNA molecule of the present invention may be composed of a form such as RNA or PNA (peptide nucleic acids) and may include a fragment functionally equivalent thereto, and said fragment may be a polynucleotide containing the miRNA seed sequence of the present invention. The miRNA of the present invention may be isolated or manufactured using standard molecular biology techniques, e.g., chemical synthesis methods or recombination methods, or may be commercially available. The said seed sequence refers to a nucleotide sequence of a region within the miRNA that binds with complete complementarity when the miRNA recognizes a target, and since this is a part that is essential for the miRNA to bind to the target, it can be modified into various miRNA mimic forms containing the said seed sequence and used for the same function.In addition, the miRNA mimic of the present invention may partially include a phosphorothiolate structure in which the RNA phosphate backbone structure is substituted with other elements such as sulfur, and may be used in a form in which RNA is wholly or partially substituted with DNA and PNA (peptide nucleic acid) molecules, and may also be used in a form in which the hydroxyl group at the 2nd carbon of the RNA sugar is substituted with various functional structures, which include but are not limited to methylation, methoxylation, fluorination, etc. The miRNA sequence of the present invention was referenced from miRBase and is as shown in Table 1 below.

[0064] microRNA Name Sequence Sequence Number Hsa-miR-451aAAACCGUUACCAUUACUGAGUU1Hsa-miR-185-5pUGGAGAGAAAGGCAGUUCCUGA2Hsa-miR-221-3pAGCUACAUUGUCUGCUGGGUUUC 3Hsa-miR-191-5pCAACGGAAUCCCAAAAGCAGCUG4Hsa-miR-484UCAGGCUCAGUCCCCUCCCGAU5Hsa-miR-144-3pUACAGUAUAGAUGAUGUACU6Hsa-miR-1972UCAGGCCAGGCACAGUGGCUCA7Hsa-miR-4478GAGGC UGAGCUGAGGAG8Hsa-miR-1273h-5pCUGGGAGGUCAAGGCUGCAGU9Hsa-miR-619-5pGCUGGGAUUACAGGCAUGAGCC10Hsa-miR-4430AGGCUGGAGUGAGCGGAG11Hsa-miR-548aq-3pCAAAAACUGCAAUUACUUUUGC12

[0065] In this specification, including all claims below, the term “method for providing information,” i.e., “method for providing information,” refers to a method for providing information regarding the diagnosis of acute kidney injury after open-heart surgery, or a method for providing information regarding high-risk patients who may develop acute kidney injury after open-heart surgery, and means a method for obtaining or predicting information regarding the likelihood of acute kidney injury occurring after open-heart surgery. More specifically, it is a concept that includes diagnosing acute kidney injury in a patient after open-heart surgery, determining high-risk patients among those after open-heart surgery who may develop acute kidney injury, or determining the prognosis after open-heart surgery.

[0066] In this specification, including all claims below, "prognosis" refers to a prospect regarding future symptoms or course determined by diagnosing a disease. For patients undergoing open-heart surgery, prognosis typically refers to the occurrence of acute renal injury or survival time within a certain period following onset or surgical procedure. For the purposes of the present invention, prognosis refers to the likelihood of acute renal injury occurring after open-heart surgery. Predicting the prognosis is a very important clinical task, as it provides clues for the early diagnosis of acute renal injury in patients after heart surgery.

[0067] In all claims below, the term "prediction" relates to the likelihood of acute kidney injury occurring in patients after heart surgery. The prediction method of the present invention may be used clinically by selecting and applying the most appropriate treatment method for any specific patient diagnosed with acute kidney injury after heart surgery or a patient with a high likelihood of developing acute kidney injury.

[0068] In the entirety of the following claims, the term “diagnosis” does not mean the ability to determine the presence or absence of a specific disease or disorder with 100% accuracy, or that a given process or result is more likely not to occur. Instead, those skilled in the art will understand that the term “diagnosis” means an increased probability that a specific disease or disorder is present in a subject.

[0069] Including the full claims below, “Acute Renal Injury (AKI)” is generally defined as a sudden increase in serum creatinine (typically within 2 to 7 days or during the period of hospitalization). Traditionally, the use of serum creatinine increase to define and detect AKI has involved relatively large increases in serum creatinine, such as 100% or 200%, at least 100% increase for values ​​exceeding 2 mg / dL, and other definitions used to define AKI. While it has been reported that a relative increase in serum creatinine as small as 20% of the pre-injury value indicates acutely deteriorating renal function and increased health risk, it has been more commonly reported that the value used to define AKI and the increased health risk is a relative increase of at least 25%. Generally, AKI≥1 is defined as an increase in serum creatinine of at least 0.3 mg / dL (≥ 26.4 μmol / L), an increase of more than 150% (1.5 times) from baseline, or a urea production of less than 0.5 mL / kg per hour for more than 6 hours.

[0070]

[0071] Preferred embodiments are presented below to aid in understanding the present invention. However, the following embodiments are provided merely to facilitate a better understanding of the invention, and the scope of the invention is not limited by the following embodiments.

[0072]

[0073] [Example]

[0074] Example 1: Discovery of Biomarkers through MicroRNA / Spatial Transcriptome Analysis

[0075] To identify biomarkers capable of predicting acute kidney injury (AKI) that may occur during cardiac surgery, an experiment was conducted on 50 patients scheduled to undergo the Maze procedure. More specifically, 10 mL of blood was obtained immediately before surgery from 50 patients who underwent the original or combined Cox-Maze procedure between January 2022 and June 2023 and exhibited normal renal function (estimated glomerular filtration rate eGFR > 60 mL / min / 1.73 m²). The blood was placed in an EDTA bottle, centrifuged at 1,500 g for 10 minutes, and the plasma was stored at -80°C until analysis. Additionally, during the Maze procedure, a left atrial tissue sample of approximately 0.5 cm was obtained from the cryoablation site, rapidly frozen using liquid nitrogen, transported to the laboratory, and stored at -80°C until analysis. Some of the acquired tissues were fixed with 4% paraformaldehyde (PFA) for histological observation, paraffin blocks were prepared through paraffin embedding, and sections were prepared by cutting them to a thickness of approximately 3–5 μm. Subsequently, staining was performed using the H&E (Hematoxylin & Eosin) staining kit (Abcam Limited) and the Trichrome Stain (Masson) kit (Sigma-Aldrich) according to the manuals provided by the manufacturers. Additionally, 10 mL of the patient's blood was collected again 24 hours after surgery, placed in an EDTA bottle, and centrifuged at 1,500 g for 10 minutes to store the plasma at -80°C until analysis. And by measuring the patient's serum creatinine concentration, if the serum creatinine increases by at least 1.5 times or at least 0. according to the KDIGO (Kidney Disease: Improving Global Outcomes) criteria.The presence of AKI was checked according to the criteria defined as an increase of 3 mg / dL or more. Approximately 46% of patients were observed to have AKI stage 1 or higher (AKI≥1). The overall flow of the experiment is briefly shown in Figure 1.

[0076] Frozen plasma is thawed once and dispensed equally into 200μL volumes, then Trizol on ice TM reagent (Invitrogen TM ) was added and homogenized using a free homogenizer, and an RNase inhibitor and the in vitro oxidation blocker DFOM (Deferoxamine mesylate) were added. In the case of the acquired tissue, Trizol on ice TM RNA was extracted after adding reagents and completely lysing the tissue using a free homogenizer. To conduct a comprehensive discovery-level analysis of circulating nucleic acids in the blood, total RNA was extracted from plasma without size exclusion, and size selection was excluded during the library preparation process. Subsequently, an RNase inhibitor and DFOM were added to Trizol lysis buffer. The concentrations of the finally obtained plasma RNA and tissue RNA were measured using NanoDrop, and based on the assumption that plasma RNA is mostly microRNA (miRNA), SMARTer ® smRNA-Seq Kit for Illumina ®A small non-coding RNA (smRNA) library was constructed using TaKaRa. Briefly, polyA polymerase (PAP) was added to equal volumes of RNA to confer a poly(A) tail to the 3' end, and a reverse transcription reaction was performed using an oligo(dT) adapter. Subsequently, the final library was constructed via polymerase chain reaction (PCR) using dual-index primers (forward primer, reverse primer). The size of the constructed library was analyzed using a Bioanalyzer (Agilent Technologies) or TapeStation (Agilent Technologies), and Quantus TM Library quality was verified (quality control; QC) by checking concentration using a Fluorometer (Promega Corporation). The libraries that completed QC were NovaSeq ® Next Generation Sequencing (NGS) was performed using multiplexing with 6000, NovaSeqX, or NextSeq2000 (Illumina Inc.). Reads with a Q30 or higher (>99.9% base call accuracy) were selected for analysis. The raw data generated after sequencing was demultiplexed using Illumina bcl2fastq2, and Bowtie2 mapping for human mature miRNAs was performed with 2-mismatch allowed. The overall experimental methods were referenced from “Heeyoung S.et. al. Nature (2020) 584: 279-285”.

[0077] Spatial whole transcriptome analysis of tissue samples was performed using the Visium Spatial Gene Expression Platform (6.5 mm, V1, 10x Gemomics). Briefly, RNA was extracted from FFPE (Formalin-Fixed, Paraffin-Embedded) slide tissues after morphological observation was completed. Quality control (QC) was then conducted by verifying the DV200 value (ratio of RNA fragment length ≥ 200 nt) through size and concentration measurements, confirming that the result was approximately 30%. The FFPE slides were reacted with 18,000 human transcriptome probes (10x Gemomics) to hybridize complementarily with the mRNA at each location within the slide. Subsequently, a probe release reaction was performed using Visium CytAssist (10x Gemomics) to construct a primary library containing spatial barcodes and probe inserts. PCR was performed on the primary library using indexing primers to construct the final Visium spatial transcriptome library; quality control (QC) was conducted through size selection and concentration verification, followed by NGS. Transcriptome mapping based on spatial location was then performed using the Spacer-Ranger program (10x Genomics). Spatial whole transcriptome analysis was conducted using the Seurat program (R package, Satija lab.) through post-processing such as read normalization, clustering, and dimension reduction. The overall experimental methods were referenced from “Kanemaru, K. et al. Nature (2023) 619: 801-810”.

[0078] The results of comparing and analyzing RNA emission patterns in plasma and RNA expression patterns in surgical tissues before and after surgery are shown in Figure 2. All miRNAs were mapped to the human mature miRNA reference using Bowtie2, and subsequently, expression values ​​were normalized according to the DESeq2 analysis method to compare expression between groups. The left diagram of Figure 2 shows the results of visualizing the expression data as a heat map, and hierarchical clustering was performed on the miRNA expression levels. A total of 10 clusters were identified, and each cluster was indicated by a box in order on the vertical axis of the heat map. The 10 clusters could be further classified into the following four groups: i) Group 1 (clusters 1 to 4): miRNA groups showing high expression levels in surgical tissues, ii) Group 2 (clusters 5 and 6): miRNA groups showing high expression levels in preoperative blood, iii) Group 3 (clusters 7 and 8): miRNA groups showing high expression levels in postoperative blood, and iv) Group 4 (clusters 9 and 10): miRNAs in which expression is confirmed in surgical tissues and changes in expression levels are observed in preoperative and postoperative blood. The figure on the right in Fig. 2 is a violin plot showing these four groups, which allows visual confirmation of the range of variation and central trends of the miRNA expression patterns of each group.

[0079] Figure 3 shows the expression patterns of representative miRNAs in the 10 clusters identified in Figure 2, that is, the three most representative types of miRNAs.

[0080] As shown in Figure 3, the expression patterns in surgical tissues are prominent in clusters 1 to 4, and it was confirmed that the expression of hsa-miR-4484, hsa-miR-4284, hsa-miR-4485-5p in cluster 1, hsa-miR-4430, hsa-miR-1246, hsa-let-7b-5p in cluster 2, hsa-miR-548ap-3p, hsa-miR-1291, hsa-miR-320d in cluster 3, and hsa-miR-10400-5p, hsa-let-7f-5p, hsa-miR-130a-3p in cluster 4 is high. In clusters 5 and 6, the expression patterns in preoperative blood were prominent, and it was confirmed that the expression of hsa-miR-101-5p, hsa-miR-6724-5p, and hsa-miR-29c-3p was high in cluster 5, and hsa-miR-1268a, hsa-miR-125a-5p, and hsa-miR-99a-5p was high in cluster 6. In clusters 7 and 8, the expression patterns in postoperative blood were prominent, and it was confirmed that the expression of hsa-miR-6131, hsa-miR-5591-3p, and hsa-miR-331-3p was high in cluster 7, and hsa-miR-22-3p, hsa-miR-122-5p, and hsa-miR-30a-3p was high in cluster 8. In clusters 9 and 10, some differences in expression were observed between the AKI=0 and AKI≥1 groups in tissues, and while there were no changes in preoperative blood, distinct differences in expression were observed between the AKI=0 and AKI≥1 groups in postoperative blood. In cluster 9, the expression of hsa-miR-1273c, hsa-miR-4481, and hsa-miR-1825 in postoperative blood samples increased in the AKI≥1 group, and in cluster 10, the expression of hsa-miR-146a-5p, hsa-let-7d-3p, and hsa-miR-191-5p in postoperative blood samples and surgical tissue samples decreased in the AKI≥1 group.

[0081] Figure 4 shows the results of analyzing the similarity of expression patterns between samples by calculating the Pearson correlation coefficient based on the normalized expression matrix of miRNA in pre-operative blood, post-operative blood, and surgical tissue. The left side of Figure 4 shows a heatmap visualizing the correlation for all sample pairs, where a darker color indicates a higher similarity in expression patterns between the two samples. In the left side of the heatmap, the first column of the horizontal and vertical axes represents post-operative blood samples, the second column represents pre-operative blood samples, and the third column represents surgical tissue. The heatmap ranged from 0.13 to 1, showed an overall distribution between 0.5 and 0.9, and confirmed an average correlation of approximately 0.6. The figure in the upper right displays the average correlations for sample pairs as a heatmap. It was confirmed that the average correlation coefficient between postoperative blood samples was the highest at 0.688, while preoperative blood samples showed 0.617 and tissue samples 0.643. This indicates that while the expression patterns within each sample are highly consistent, the correlation coefficients between different samples are low. The average correlation coefficient between preoperative and postoperative blood samples was 0.403, indicating a moderate level, while the average correlation coefficients between tissue and blood samples were 0.325 and 0.375, respectively, showing a relatively weak correlation. The figure in the lower right is a box plot showing the correlation distribution between samples. It was confirmed that the correlation coefficient between postoperative blood samples and surgical tissue was significantly higher than that between preoperative blood samples and surgical tissue. The results of the Mann-Whitney U test showed a p-value of 1.33 × 10⁻⁶. -102It was confirmed that extremely high significance was observed. Through the above results, it was confirmed that the miRNA expression pattern observed in blood after surgery changes similarly to the miRNA expression pattern in surgical tissue, and through this, it was confirmed that postoperative blood samples can be used as non-invasive samples reflecting the condition of surgical tissue.

[0082] Subsequently, to identify biomarkers capable of predicting AKI, miRNA expression according to AKI in postoperative blood samples was compared and analyzed, and the results are shown in Figure 5. The left diagram at the top of Figure 5 is a heatmap showing the results of comparing normalized miRNA expression in postoperative blood samples from patients without AKI (AKI=0) and patients with AKI (AKI≥1). As shown in the heatmap results, it was confirmed that there were differences in miRNA expression patterns between the AKI=0 group and the AKI≥1 group. The right diagram at the top of Figure 5 is a volcano plot showing the degree of change in miRNA expression (log2 fold change) and statistical significance (-log10 p-value) for each. The miRNAs indicated in dark colors represent miRNAs that showed statistically significant differences in expression between the AKI=0 group and the AKI≥1 group. Many miRNAs showing significant differences in expression were observed in clusters 9 and 10; in cluster 9, hsa-miR-1972, hsa-miR-4430, and hsa-miR-1273h-5p were identified, while in cluster 10, hsa-miR-451a and hsa-miR-191-5p were identified. The expression levels of each major miRNA are graphed in the bottom section of Figure 5. In each graph, the left side of the x-axis (A) represents the AKI=0 group, and the right side (B) represents the AKI≥1 group. It was confirmed that miR-1972 increased by more than twofold in patients with AKI, while miR-451a decreased by more than twofold. In addition, it was confirmed that miR-4478, miR-1273h-5p, miR-619-5p, and miR-548aq-3p were increased in patients with AKI, while miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p were decreased.Through the above results, it was confirmed that the miRNAs can be used as biomarkers to predict the occurrence of AKI after surgery at an early stage.

[0083] In addition, the inventors utilized spatial whole-transcriptome analysis results to confirm miRNA expression according to surgical site within the tissue, and the results are shown in Fig. 6. Spatial whole-transcriptome analysis was performed using Visium Spatial Gene Expression (FFPE, V1) slides from 10x Genomics, and approximately 18,000 human transcriptome probes were transferred to spatial coordinates using Visium CytAssist. Prior to spatial whole-transcriptome analysis, observation was performed using a confocal microscope (Leica Microsystems) to evaluate the structural gene expression and cellular integrity of the surgical tissue, and the results are shown as fluorescent images in the upper left of Fig. 6. Green (lower left image of the fluorescent image) represents α-actin, a major protein constituting the sarcomeric muscle of myocardial cells. The confocal microscopy analysis results did not reveal differences sufficient to clearly distinguish the surgical site. H&E staining, Masson trichrome staining, and WGA (Wheat Germ Agglutinin) staining (Fluorescent WGA conjugates, Invitrogen) TMThe surgical site could not be clearly distinguished in the results either. Whole transcriptome analysis performed after preparing FFPE slides by serially sectioning them at 5 μm intervals yielded a total of 10 spatial transcriptome clusters. Among these, six clusters matching histological location and transcriptome pattern—namely, surgery, border1, border2, remote1, remote2, and remote3—were primarily defined, and the surgery site cluster was observed at the highest proportion among all clusters (middle and upper right diagrams of Fig. 6). When comparing the total transcriptome expression cumulative distribution function (CDF) of the surgery site cluster with the expression CDF of the miR-451a target gene set (n=567) selected as a representative sample of miRNAs, it was confirmed that the expression of miR-451a target genes was reduced in the surgery site cluster (bottom diagram of Fig. 6). The spatial transcriptome heatmap is shown in the middle diagram at the bottom of Fig. 6. As a result, expression levels were lower at the surgical site compared to other sites (cyan), which is consistent with the decrease in miR-451a in postoperative blood samples and once again confirms that this result supports the association between miR-451a and the development of AKI after surgery. Additionally, a bar graph comparing the expression of miR-451a target genes at the surgical site and other locations is shown on the right side at the bottom of Fig. 6; compared to the surgical site (light gray bar, reference value 1), a tendency for the expression of miR-451a target genes at other locations to increase by approximately 2 to 4 times (dark gray bar) was confirmed.Through the above results, spatial whole-transcriptome analysis of surgical tissue samples revealed that miR-451a target genes were reduced in the surgical tissues. This demonstrates that miR-451a can be used as a biomarker for predicting the onset of AKI after surgery, and that biomarkers selected from postoperative blood samples can be used to predict the onset of AKI after surgery in a non-invasive manner, rather than through surgical tissues.

[0084]

[0085] Example 2: Validation of Biomarkers

[0086] To confirm the accuracy of the biomarkers identified in Example 1, total RNA was extracted from postoperative blood samples and verified using the quantitative PCR (qPCR) method. Verification was performed using miR-451a, miR-185-5p, and miR-1972 as representative examples. qPCR was performed using the Applied Biosystems™ TaqMan™ MicroRNA Reverse Transcription kit (Thermo Fisher Scientific Inc.), Ct values ​​were normalized to U6, and the ΔΔCt method was applied based on the AKI=0 group to analyze expression differences. The overall experimental method was referenced from “Heeyoung S.et. al. Nature (2020) 584: 279-285”. The results are shown in Figure 7.

[0087] As shown in Figure 7, compared to Group A (AKI=0), it was confirmed that miR-451a and miR-185-5p were significantly decreased and miR-1972 was significantly increased in Group B (AKI≥1). The above results are identical to those confirmed through Example 1, confirming that the onset of AKI after surgery can be predicted with high accuracy by using all of the present invention’s miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p, as well as miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p as biomarkers in blood samples after surgery.

[0088]

[0089] Example 3: Confirmation of the pathological mechanism of the biomarker

[0090] To confirm the pathological mechanism of the biomarker of the present invention, experiments were conducted using an in vitro cell model. In the AC16 cell line (ATCC), a cardiac muscular-like cell line, Dharmacon TM inhibitor and Lipofectamin ® Using a reagent (Thermo Fisher Scientific Inc.), the expression of miR-451a and miR-185-5p was reduced via a transient knockdown method, and miRNA mimic (Bionia) and Lipofectamin ®The expression of miR-1972 was increased in a transient gain-of-function manner using a reagent (Thermo Fisher Scientific Inc.) and cultured. After culture, the culture supernatant was applied to the renal epithelial cell line 293 and cultured, and the cell phenotype was observed in real time using a phase-contrast microscope (live imaging). The results are shown in Figure 8.

[0091] As shown in Figure 8, phenomena such as decreased cell adhesion, increased apoptosis, and irregular cell morphology were observed in the kidney cell line treatment group (treat) treated with culture supernatant obtained from the cardiomyocyte cell line, confirming that changes in the expression of the corresponding miRNA in the heart affect kidney damage. Through these results, it was confirmed that the biomarkers of the present invention circulate in the blood after heart surgery and affect kidney tissue, thereby increasing the likelihood of AKI development, and that they can be used to accurately predict whether AKI will develop early after surgery.

[0092]

[0093] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

[0094] The biomarker of the present invention enables the early diagnosis of acute renal injury that may occur after open-heart surgery or the early prediction of the risk of onset with higher accuracy and speed compared to conventional creatinine concentration measurements; therefore, it is possible to effectively predict sequelae of open-heart surgery early and provide rapid response or treatment through non-invasive samples from patients after heart surgery.

Claims

1. A biomarker composition for diagnosing acute renal injury after cardiac surgery, comprising as an active ingredient one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430 and miR-548aq-3p.

2. A biomarker composition according to claim 1, wherein the heart surgery is any one selected from the group consisting of Maze surgery, Coronary Artery Bypass Grafting (CABG), Valve Surgery, Aortic Surgery, Heart Transplantation, and Left Ventricular Assist Device (LVAD).

3. A biomarker composition according to claim 1, wherein the miRNA is one or more selected from the group consisting of the following: a) miR-451a containing the nucleotide sequence of SEQ ID NO. 1; b) miR-185-5p containing the nucleotide sequence of SEQ ID NO. 2; c) miR-221-3p containing the nucleotide sequence of SEQ ID NO. 3; d) miR-191-5p containing the nucleotide sequence of SEQ ID NO. 4; e) miR-484 containing the nucleotide sequence of SEQ ID NO. 5; f) miR-144-3p containing the nucleotide sequence of SEQ ID NO. 6; g) miR-1972 containing the nucleotide sequence of SEQ ID NO. 7; h) miR-4478 containing the nucleotide sequence of SEQ ID NO. 8; i) miR-1273h-5p containing the nucleotide sequence of SEQ ID NO. 9; j) miR-619-5p containing the nucleotide sequence of SEQ ID NO. 10; k) miR-4430 comprising the nucleotide sequence of SEQ ID NO. 11; and l) miR-548aq-3p containing the nucleotide sequence of SEQ ID NO.

12.

4. A composition for diagnosing acute renal injury after cardiac surgery, comprising as an active ingredient a preparation capable of measuring the expression level of one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430 and miR-548aq-3p.

5. A diagnostic composition according to claim 4, wherein the heart surgery is any one selected from the group consisting of Maze surgery, Coronary Artery Bypass Grafting (CABG), Valve Surgery, Aortic Surgery, Heart Transplantation, and LVAD (Left Ventricular Assist Device) implantation.

6. A diagnostic composition according to claim 4, wherein the preparation capable of measuring the expression level is an oligonucleotide, primer, or probe having a sequence complementary to one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p.

7. A kit for diagnosing acute kidney injury after heart surgery, comprising the diagnostic composition of claim 4.

8. A measuring unit for measuring the expression level of one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430 and miR-548aq-3p; and A diagnostic device for acute kidney injury after heart surgery, comprising: a judgment unit that compares the expression level of the above miRNA with the expression level of the corresponding miRNA of a biological sample of a control group. 9.a) measuring the expression level of one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430 and miR-548aq-3p from a biological sample isolated from a cardiac surgery patient; and b) a method for providing information regarding the diagnosis of acute kidney injury after heart surgery, comprising the step of comparing the above expression level with the expression level of the corresponding miRNA of a biological sample of a control group.

10. The method of claim 9, wherein the method further comprises the step of diagnosing acute renal injury when, after step b) the expression of one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p is decreased, or one or more miRNAs selected from the group consisting of miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p is increased.

11. In claim 9, the control group is a patient who has not developed acute kidney injury after heart surgery.

12. In paragraph 9, the biological sample is blood, plasma, serum, bone marrow, tissue, cell, saliva, sputum, or urine.

13. The method according to paragraph 12, wherein the biological sample is a sample isolated within 0 to 48 hours after surgery.

14. In claim 9, the measurement is a next-generation sequencing (NGS), reverse transcriptase-polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time-polymerase chain reaction (real-time-PCR), quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), RNase protection assay (RPA), Northern blotting, or DNA chip method. 15.a) treating cardiac cells with a candidate substance and measuring the expression level of one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430 and miR-548aq-3p; b) a step of comparing the above expression level with the expression level of the corresponding miRNA of a control group not treated with the candidate substance; and c) A method for selecting a drug for the prevention or treatment of acute renal injury after heart surgery, comprising the step of selecting the candidate substance as a drug for the prevention or treatment of acute renal injury after heart surgery when the expression of one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p is increased, or one or more miRNAs selected from the group consisting of miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p is decreased. 16.a) A step of measuring the expression level of one or more microRNAs (microRNA; miRNA) selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430 and miR-548aq-3p from a biological sample isolated from a cardiac surgery patient; b) a step of comparing the above expression level with the expression level of the corresponding miRNA of a biological sample of a control group; c) a step of diagnosing acute renal injury when the expression of one or more miRNAs selected from the group consisting of miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, and miR-144-3p is decreased, or when one or more miRNAs selected from the group consisting of miR-1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, and miR-548aq-3p are increased; and d) A treatment method for a patient with acute kidney injury who has developed acute kidney injury after surgery, in which acute kidney injury treatment is performed on a patient diagnosed with acute kidney injury.

Images