Use of microorganism-derived small RNA for wound healing and skin regeneration
A composition using small RNA from oral or skin resident microorganisms addresses the challenge of chronic wound healing by promoting focal adhesion complexes and cell migration, effectively accelerating wound healing and reducing scarring.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- KYUNGPOOK NAT UNIV IND ACADEMIC COOP FOUND
- Filing Date
- 2025-12-10
- Publication Date
- 2026-06-18
AI Technical Summary
The rapid wound healing mechanism of the oral mucosa is not fully understood, and existing treatments for chronic skin wounds are inadequate, particularly in terms of promoting wound healing and reducing scarring.
A pharmaceutical or cosmetic composition comprising small RNA derived from oral or skin resident microorganisms, such as Streptococcus mutans, Streptococcus salivarius, Streptococcus sobrinus, and Staphylococcus aureus, formulated with lipid nanoparticles, liposomes, or extracellular vesicles, which promotes the formation of focal adhesion complexes and enhances cell migration.
The composition effectively accelerates wound healing by increasing cell migration and promoting the formation of focal adhesion complexes, thereby enhancing the healing process and reducing scarring.
Smart Images

Figure KR2025021198_18062026_PF_FP_ABST
Abstract
Description
Uses of Microbial-Derived Small RNA for Wound Healing and Skin Regeneration
[0001] The present invention relates to the use of microorganism-derived small RNA for wound healing and skin regeneration.
[0002] The human oral mucosa is known for its high regenerative capacity and serves as an ideal model for wound healing research because it heals rapidly without scarring, largely unaffected by factors such as age or gender. The rapid healing mechanism of the oral mucosa can be applied to skin wound healing and may lead to the development of new therapeutic strategies for chronic, non-healing skin wounds. The unique healing and regeneration of the oral mucosa can be attributed to cellular or non-cellular factors. In particular, saliva present in the oral cavity plays a crucial role in creating a moist environment that aids the survival and function of inflammatory cells. Furthermore, reports suggest that saliva contains various growth factors, which leads to faster wound healing and reduced scarring in the oral mucosa. Additionally, changes in the microbiome during the oral wound healing process have highlighted the need for new probiotic delivery methods for oral wounds. However, the precise reasons for the particularly rapid wound healing of the oral mucosa remain unclear, and little is known about the role of commensal streptococci in this process.
[0003] Meanwhile, recent advancements in high-throughput sequencing have revealed that non-coding RNA (ncRNA) is extensively involved in gene regulation in both prokaryotes and eukaryotes. In fact, considering the interactions between bacteria and hosts, the potential role of bacterial extracellular endoplasmic reticulum RNA is noteworthy. However, the function of full-length bacterial tRNA (75 bp or longer) delivered to eukaryotic cells via extracellular endoplasmic reticulum is not well known.
[0004]
[0005] The present invention aims to provide a pharmaceutical composition for wound treatment or skin regeneration.
[0006] The present invention aims to provide a cosmetic composition for skin regeneration.
[0007] The present invention aims to provide a method for wound treatment or skin regeneration.
[0008]
[0009] 1. A pharmaceutical composition for wound healing or skin regeneration comprising small RNA derived from oral or skin resident microorganisms.
[0010] 2. A pharmaceutical composition for wound healing or skin regeneration according to 1 above, wherein the microorganism is at least one selected from the group consisting of Streptococcus mutans, Streptococcus salivarius, Streptococcus sobrinus, and Staphylococcus aureus.
[0011] 3. A pharmaceutical composition for wound healing or skin regeneration according to 1 above, wherein the small RNA is at least one selected from the group consisting of nucleotide sequences represented by SEQ ID NOs. 1, 3, 6, 7, and 8.
[0012] 4. A pharmaceutical composition for wound healing or skin regeneration according to 1 above, further comprising any one of lipid nanoparticles, liposomes, polymer nanoparticles, extracellular vesicles, peptides, and RNA-nanostructures.
[0013] 5. A pharmaceutical composition for wound healing or skin regeneration that promotes the formation of a focal adhesion complex, in accordance with 1 above.
[0014] 6. A pharmaceutical composition for wound treatment or skin regeneration according to 1 above, formulated as any one selected from the group consisting of liquids, ointments, lotions, creams, sprays, gels, external liquids, pastes, liniments, aerosols, patches, and adhesive bandages.
[0015] 7. A cosmetic composition for skin regeneration comprising small RNA derived from oral or skin resident microorganisms.
[0016] 8. A cosmetic composition for skin regeneration according to 7, wherein the microorganism is at least one selected from the group consisting of Streptococcus mutans (S. mutans), Streptococcus salivarius (S. salivarius), Streptococcus sobrinus (S. sobrinus), and the skin resident microorganism is Staphylococcus aureus (S. aureus).
[0017] 9. A cosmetic composition for skin regeneration according to 7, wherein the small RNA is at least one selected from the group consisting of nucleotide sequences represented by SEQ ID NOs. 1, 3, 6, 7, and 8.
[0018] 10. A cosmetic composition for skin regeneration according to 7, further comprising any one of lipid nanoparticles, liposomes, polymer nanoparticles, extracellular vesicles, peptides, and RNA nanostructures.
[0019] 11. A cosmetic composition for skin regeneration that promotes the formation of a focal adhesion complex in accordance with 7 above.
[0020] 12. A cosmetic composition for skin regeneration according to 7, formulated as any one selected from the group consisting of lotion, liquid, cream, gel, aerosol, and powder.
[0021] 13. A method for wound healing or skin regeneration comprising the step of administering small RNA derived from oral or skin resident microorganisms to an animal other than a human.
[0022]
[0023] The composition of the present invention has excellent wound healing or skin regeneration effects.
[0024] The composition of the present invention promotes the formation of local adhesion complexes and increases cell migration to the wound site, thereby having an excellent effect of promoting wound healing.
[0025] The composition of the present invention utilizes small RNA derived from microorganisms residing in the human body, thereby eliminating the risk of bacterial infection and enabling safe and efficient production.
[0026]
[0027] Figure 1a is an NTA analysis graph and TEM image confirming the size, concentration, and morphology of extracellular vesicles (EVs) isolated from Streptococcus mutans (S. mutans).
[0028] Figure 1b is an NTA analysis graph and TEM image confirming the size, concentration, and morphology of extracellular vesicles (EVs) isolated from Streptococcus salivarius (S. salivarius).
[0029] Figure 1c is an NTA analysis graph and TEM image confirming the size, concentration, and morphology of extracellular vesicles (EVs) isolated from Streptococcus sobrinus (S. sobrinus).
[0030] Figure 1d is an NTA analysis graph and TEM image confirming the size, concentration, and morphology of extracellular vesicles (EVs) isolated from Staphylococcus aureus (S. aureus).
[0031] Figure 2a shows the total RNA size distribution of extracellular endoplasmic reticulum (EV) isolated from Streptococcus mutans (S. mutans) (number of reads >100).
[0032] Figure 2b shows the total RNA size distribution of extracellular endoplasmic reticulum (EV) isolated from Streptococcus salivarius (number of reads >100).
[0033] Figure 2c shows the total RNA size distribution of extracellular endoplasmic reticulum (EV) isolated from Streptococcus sobrinus (S. sobrinus) (number of reads >100).
[0034] Figures 3a–3e illustrate the promotion of cell proliferation by tRNA oligomers. tRNA oligomers 10 5 , 10 6 , 10 8 , 10 10 and 10 12 Electroporated E. coli EV at copy / mL concentration (10 7 Primary oral epithelial cells were treated with particles / mL) (*p<0.05, **p<0.01).
[0035] Figures 4a and 4b illustrate the promotion of cell migration in the Transwell by tRNA oligomers. 10 tRNA oligomers 12 Electroporated E. coli EV at copy / mL concentration (10 7 Primary oral epithelial cells in Transwell were treated with particles / mL, and the cells that migrated downward in Transwell were compared after 24 hours (*p<0.05, **p<0.01).
[0036] Figures 5a and 5b illustrate the wound healing effect of tRNA oligomers. After creating a wound line on a culture plate of primary oral epithelial cells, 10 tRNA oligomers 12 Electroporated E. coli EV at copy / mL concentration (10 7 The degree of wound healing was compared 5 days after treatment with particle / mL (**p<0.01).
[0037] Figures 6a and 6b compare the wound healing effects of epithelial growth factor (EGF), a representative existing wound healing agent, and tRNA oligomers in cell lines. After creating wound lines on human oral keratinocyte (HOK) culture plates, 1 ng / ml of EGF was treated for 24 hours. The tRNA oligomers 10 12Electroporated E. coli EV at copy / mL concentration (10 7 The degree of wound healing was compared after treating with particles / mL) for the same amount of time (**p<0.01).
[0038] Figures 6c–6d illustrate the promotion of cell migration in Transwell by EGF and tRNA oligomers. Transwell oral keratinocytes were treated with 1 ng / ml of EGF for 40 hours. 10 tRNA oligomers 12 Electroporated E. coli EV at copy / mL concentration (10 7 Primary oral epithelial cells were treated with particles / mL for the same amount of time, and the cells that migrated downward in the Transwell were compared (*p<0.05, **p<0.01).
[0039] Figure 7 illustrates the effect of tRNA oligomers on the division and proliferation of epithelial cells. In two types of organoids (Oral mucosal organoid 1 and Oral mucosal organoid 2) constructed using human-derived oral mucosal tissue and mouse-derived oral mucosal tissue, 10 tRNA oligomers 12 Electroporated E. coli EV at copy / mL concentration (10 7 (particle / mL) was treated.
[0040] Figures 8a and 8b illustrate the effect of tRNA oligomers on inducing the formation of localized adhesion complexes. 10 tRNA oligomers 12 Electroporated E. coli EV at copy / mL concentration (10 7 Organoids were treated with particle / mL) and increased paxilin and FAK phosphorylation was confirmed.
[0041] Figures 9a–9c show the wound healing effects of tRNA oligomers in a mouse model. After creating four wounds on the dorsal skin of mice, 10 tRNA oligomers 12Electroporated E. coli EV solution at a concentration of copy / mL (10 7 (particle / mL) was administered daily for 4 days. a: Experimental schematic of electroporating tRNA oligomers into E. coli EVs and administering them to mouse wound sites, b: Analysis of wound healing degree and wound area in mice (**p<0.01), c: Immune cell recruitment analysis (CD3, T cells; CD45, leukocytes).
[0042]
[0043] The present invention relates to a composition for wound healing or skin regeneration comprising small RNA derived from oral or skin resident microorganisms.
[0044] In this invention, "origin" refers to something that occurs due to a source. The said source may be the producer or starting point of a substance or phenomenon. "Microbial origin" includes everything generated or created by microorganisms or the action of microorganisms.
[0045] In the present invention, "derived from oral or skin resident microorganisms" may mean that it is generated or produced from the metabolic activity or biological action of oral or skin resident microorganisms, or from metabolic substances, proteins, lipids, polysaccharides, nucleic acids, extracellular vesicles, etc., contained in said microorganisms.
[0046] The composition of the present invention may include, without limitation, any small RNA present in relatively large copy numbers in oral or skin resident microorganisms as an active ingredient.
[0047] According to one embodiment of the present invention, the composition may include small RNA derived from extracellular vesicles contained in oral or skin resident microorganisms.
[0048] According to one embodiment of the present invention, the small RNA may be tRNA.
[0049] The tRNA of the present invention may have a phosphate group at the 5' end retained or modified.
[0050] The tRNA of the present invention may include, but is not limited to, at least one labeling substance selected from the group consisting of FAM, Cy3, Cy5, Dye594, HEX, ROX, IABkFQ, Bodipy, and Rhodamine at at least one of the 5'-terminus and 3'-terminus.
[0051] In the present invention, the small RNA may be at least one selected from the group consisting of nucleotide sequences represented by SEQ ID NOs 1, 3, 6, 7 and 8.
[0052] In the present invention, oral or skin resident microorganisms include microorganisms of the genus Abiotrophiaspp., Streptococcusspp., Peptostreptococcusspp., Actinomycespp., Bifidobacteriumspp., Corynebacteriumspp., Lactobacillusspp., Propionibacteriumspp., Pseudoramibacterspp., Moraxellaspp., Neisseriaspp., Selemonaspp., and Campylobacter It may be any one selected from the group consisting of microorganisms of the genus Campylobacterspp., microorganisms of the genus Staphylococcusspp., microorganisms of the genus Bacteroidesspp., microorganisms of the genus Enterobacterspp., microorganisms of the genus Enterococcusspp., microorganisms of the genus Escherichiaspp., and microorganisms of the genus Muribaculusspp.
[0053] In the present invention, the oral or skin resident microorganism may be at least one selected from the group consisting of Streptococcus mutans (S. mutans), Streptococcus salivarius (S. salivarius), Streptococcus sobrinus (S. sobrinus) and Staphylococcus aureus (S. aureus).
[0054] The oral or skin resident microorganisms of the present invention may be strains isolated from a human oral cavity, intestine, or skin, or commercially available strains may be used. To isolate the small RNA of the present invention, a step of culturing oral and skin resident or intestinal microorganisms may be performed, and an appropriate method may be selected depending on the characteristics of the strain.
[0055] The small RNA of the present invention may be isolated from extracellular vesicles, but is not limited thereto. The extracellular vesicles may be extracellular vesicles of oral or skin resident microorganisms.
[0056] In the present invention, 'extracellular vesicle' refers to a membrane-structured extracellular vesicle that is separated from a cell and released into the extracellular space, and may be, for example, exosomes, ectosomes, microvesicles, or multivesicles. The extracellular vesicle may be separated by methods commonly used in the industry, and an appropriate method may be selected depending on the characteristics of the strain.
[0057] The composition of the present invention may include, without limitation, any material capable of delivering the small RNA into the body. The material may be, for example, any one of lipid nanoparticles, liposomes, polymer nanoparticles, extracellular vesicles, peptides, and RNA nanostructures, but is not limited thereto. For example, extracellular vesicles of E. coli may be included as a carrier of tRNA.
[0058] The composition of the present invention can promote wound healing by inducing the formation of a focal adhesion complex.
[0059] In the present invention, the 'Focal Adhesion Complex (FAC)' is a complex formed when a cell binds to the extracellular matrix (ECM). Since the FAC functions to regulate cell migration, signal transduction, and cell-matrix interactions, it can play a key role in wound healing. The formation and function of the focal adhesion complex significantly influence the efficiency and quality of wound healing, thereby enabling cells to properly migrate to the wound site and restore tissue.
[0060] The composition of the present invention can promote wound healing or skin regeneration through the division and migration of epithelial cells.
[0061] In the present invention, 'wound treatment' may be used interchangeably with 'wound healing,' and wound treatment may refer to the reduction or regeneration of the wound area, but is not limited thereto.
[0062] In the present invention, 'wound' may be damage caused by burns, ulcers, trauma, sores, post-surgical procedures, childbirth, chronic wounds, or dermatitis, but is not limited thereto.
[0063] In the present invention, "skin regeneration" refers to the process of recovering skin tissue from damage caused by external or internal factors. Damage caused by external factors may include medical procedures, ultraviolet rays, external pollutants, wounds, trauma, radiation therapy, etc., while damage caused by internal factors may include inflammation, aging, stress, etc.
[0064] The composition of the present invention may be provided as a pharmaceutical composition or a cosmetic composition.
[0065] The pharmaceutical composition of the present invention may be prepared in a unit dose form or contained in a multi-dose container by formulation using pharmaceutically acceptable carriers and / or excipients according to conventional methods known in the art, in addition to the small RNA which is the active ingredient. In this case, depending on the oral or parenteral administration method, it may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet, capsule, or gel (e.g., hydrogel), and may additionally include a dispersant, lubricant, humectant, sweetener, flavoring agent, suspending agent, preservative, stabilizer, etc. Additionally, it may further include a pharmaceutically active ingredient or an active mixture that aids in the activity of the active ingredient.
[0066] The concentration of the active ingredient included in the pharmaceutical composition of the present invention may be determined by considering the therapeutic purpose, the patient's condition, the required duration, etc., and is not limited to a specific range of concentrations.
[0067] The pharmaceutical composition of the present invention may be administered to mammals, including humans, orally or parenterally in a pharmaceutically effective amount. A "pharmaceutically effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. Other pharmaceutical compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents, and may be administered simultaneously, separately, or sequentially with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by considering all of the above factors, and this can be easily determined by a person skilled in the art. The effective dose may vary depending on the patient's age, gender, condition, body weight, absorption rate, inactivation rate, and excretion rate of the active ingredient in the body, as well as the type of disease and concomitant drugs, and may be increased or decreased depending on the route of administration, severity of vaginitis, gender, body weight, age, etc.
[0068] In the present invention, the dosage of the active ingredient included in the pharmaceutical composition may vary depending on the subject's condition and body weight, the type and severity of the disease, the form of the drug, the route of administration, and the duration, and may be appropriately selected by a person skilled in the art, for example, the daily dosage may be 0.01 mg / kg to 200 mg / kg, preferably 0.1 mg / kg to 200 mg / kg, more preferably 0.1 mg / kg to 100 mg / kg. The administration may be performed once a day or divided into several doses, and the scope of the present invention is not limited by this.
[0069] The pharmaceutical composition of the present invention may be formulated into forms commonly used in the industry by including one or more pharmaceutically acceptable carriers. For example, it may be formulated into liquids, ointments, lotions, creams, sprays, gels, topical solutions, pastes, liniments, aerosols, patches, bandages, etc.
[0070] The cosmetic composition of the present invention may additionally include functional additives and ingredients included in general cosmetic compositions in addition to small RNA, which is an active ingredient. The functional additives may include ingredients selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high molecular weight peptides, high molecular weight polysaccharides, sphingolipids, and seaweed extracts. Other ingredients included in the formulation may include oil components, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, UV absorbers, preservatives, disinfectants, antioxidants, plant extracts, pH adjusters, alcohols, colorants, fragrances, blood circulation promoters, cooling agents, antiperspirants, purified water, etc.
[0071] The cosmetic composition of the present invention may be formulated in a commonly used form. For example, it may be formulated as any one selected from the group consisting of lotions, liquids, creams, gels, aerosols, and powders, but is not particularly limited and may be appropriately selected according to the purpose. For example, it may be prepared as one or more formulations selected from the group consisting of softening lotions, astringent lotions, nourishing lotions, astringent lotions, milk lotions, moisture lotions, nourishing lotions, massage creams, eye creams, nourishing creams, moisture creams, hand creams, oils, foundations, essences, nourishing essences, gels, powders, sprays, packs, soaps, cleansing waters, cleansing foams, cleansing lotions, cleansing creams, body lotions, and body cleansers, but is not limited thereto.
[0072] In the case where the formulation of the present invention is a paste, cream, or gel, animal fibers, plant fibers, wax, paraffin, starch, tracanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as carrier components.
[0073] In the case where the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.
[0074] In the case where the formulation of the present invention is a solution or emulsion, a solvent, a solvating agent, or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan.
[0075] In the case where the formulation of the present invention is a suspension, liquid diluents such as water, ethanol, or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used as carrier components.
[0076] In the case where the formulation of the present invention is a cleansing agent containing a surfactant, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative, or ethoxylated glycerol fatty acid ester, etc. may be used as a carrier component.
[0077] The cosmetic composition of the present invention may further include functional additives or carriers readily selected by a person skilled in the art, within a range that does not impair the purpose and effect of the present invention, depending on the formulation. A person skilled in the art may select the amount of any additional ingredient so that the advantageous properties of the composition according to the present invention are not adversely affected or are substantially affected by the expected addition.
[0078] The present invention provides a method for wound treatment or skin regeneration comprising the step of administering the aforementioned small RNA derived from oral or skin resident microorganisms to an animal.
[0079] The above wound treatment or skin regeneration is as described above.
[0080] The above animal may be an animal including humans or an animal excluding humans.
[0081] The above animal may be an animal requiring administration of small RNA derived from oral or skin resident microorganisms. The small RNA derived from oral or skin resident microorganisms may be an effective amount of small RNA derived from oral or skin resident microorganisms.
[0082] The above animals may be mammals, but are not limited thereto.
[0083] The animals other than the human mentioned above may be mammals such as cows, monkeys, birds, cats, mice, rats, hamsters, pigs, goats, dogs, rabbits, sheep, horses, etc.
[0084] In the present invention, "administration" means introducing an active ingredient to the animal by an appropriate method ordinarily accepted in the art.
[0085] In the present invention, the method of administration may be administered through any general route as long as it can reach the target tissue. For example, it may be administered intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermally, topically, intranasally, intrapulmonaryly, or rectally, but is not limited thereto. Specifically, it may be administered parenterally, and more specifically, subcutaneously or transdermally. Subcutaneous or transdermal administration may include general routes of absorption into the skin to reach the skin. For example, it may be applied directly to the skin. When applied to the skin, the pharmaceutical composition according to the present invention may be applied directly to the skin or sprayed, depending on its form.
[0086] In the present invention, the dosage of small RNA derived from oral or skin resident microorganisms refers to a sufficient amount with a reasonable benefit / risk ratio applicable to treatment or improvement, and the effective dose level may be determined based on factors including the type of wound, application site, type and severity of the target, age, gender, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field.
[0087] Since the above method of administration is determined in light of the various relevant factors mentioned above, the dosage, route of administration, frequency of administration, etc., should not be understood as limiting the scope of the present invention in any aspect.
[0088] The present invention will be described in detail below through examples. However, these are presented as preferred examples of the present invention and should not be interpreted as limiting the present invention.
[0089] Details not listed here can be sufficiently technically inferred by a person skilled in this field, so their explanation will be omitted.
[0090]
[0091] Example 1. Isolation and Characterization of Bacterial Extracellular Vesicles (EVs)
[0092] Streptococcus mutans (KCTC 3065, ATCC 25175) and Streptococcus salivarius (KCTC 3960, ATCC 7073) used for culture were purchased from the Korea Culture Collection Center (KCTC). Streptococcus sobrinus and Staphylococcus aureus (KCTC 3881, ATCC 6538) were purchased from the Korea Culture Collection Center (KCTC). The bacteria were cultured in BHI medium containing 3 μg / mL vitamin K and 5 μg / mL hemin in an aerobic environment at 37°C until the optical density measured at 600 nm reached 1.5 OD. The bacterial culture was centrifuged at 6,000 g for 20 minutes, the supernatant was filtered using a 0.22 μm pore filter (Merck Millipore), and then concentrated using a Tangential Flow Filtration (TFF) system. The mixture was then ultracentrifuged at 100,000 g at 4°C for 2 hours on a 45 Ti rotor (Beckman Coulter) to form a pellet. The final pellet was resuspended in phosphate-buffered saline (PBS) and stored at -80°C.
[0093] The isolated extracellular vesicles (EVs) were spherical in shape as a result of TEM (HT 7700) analysis and showed a size distribution of 50-300 nm as analyzed by the NTA System (Nanosight NS 300) (Figs. 1a-1d).
[0094]
[0095] Example 2. Total RNA sequencing of bacterial extracellular endoplasmic reticulum (EV)
[0096] Total RNA sequencing was performed on the extracellular vesicles (EVs) of three bacterial species: Streptococcus mutans, Streptococcus salivarius, and Streptococcus sobrinus. First, the collected extracellular vesicles (EVs) were treated with an RNase inhibitor (Applied Biosystems) at 37°C for 15 minutes, and then total RNA was isolated using the miRNeasy kit (Qiagen) according to the manufacturer's protocol. RNA quality was verified using the 2100 Bioanalyzer (Agilent Technologies), the library was validated using the Agilent Bioanalyzer according to the manufacturer's protocol, and RNA sequencing was performed on an Illumina NovaSeq instrument.
[0097] Analysis revealed RNA sequences ranging from 20 to 130 bp, with the number of bases varying by the number of reads among different bacteria (Figs. 2a–2c). Additionally, the RNA species with the highest copy number in the extracellular endoplasmic reticulum (EV) was identified as tRNA (Table 1).
[0098] MicroorganismRNASequencesbpS. mutanstRNA-Met(Sequence No. 1)CGCGGGAUGGAGCAGUUAGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUAGGUUCAAAUCCUGCUCCCGCAACC76tRNA-Ile(Sequence No. 2)GGGCGCGUAGCUCAGCUGGUUAGAGCGCACGCCUGAUAAGCGUGAGGUCGGUGGUUCGAGUCCACUCGUGCCCACC76tRNA-Met(Sequence No. 3)GCGGGAUGGAGCAGUUAGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUAGGUUCAAAUCCUGCUCCCGCAACC75tRNA-Val(Sequence No. 4)GGGAGUUUAGCUCAGUUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCAGCGGUUCGAGCCCGUUAACUCCCACC75tRNA-Asn(Sequence No. 5)AGGCGCAUGACUGUUAAUCAUGAUGUGCGUAGGUUCGAGUCCUCUGCCGGAGCC52S. salivariustRNA-Arg (SEQ ID NO: 6)AGAGUACCUGACUGCGAAUCAGGCGGUUAGAGGUUCGACUCCUCUAGGGUGCACC55S. sobrinusNot determined (SEQ ID NO: 7) AGAGAAGGGGGGAGAGGGAGG21S. aureustRNA-Asp (SEQ ID NO: 8)GGUCUCGUAGUGUAGCGGUUAACACGCCUGCCUGUCACGCAGGAGAUCGCGGGUUCGAUUCCCGUCGAGACCGCCA76
[0099] Example 3. Synthesis of tRNA oligomers and production of E. coli EVs containing the same
[0100] To test whether the tRNA identified with the highest copy number in the extracellular endoplasmic reticulum (EV) functions in the wound healing mechanism, tRNA oligomers were synthesized by applying 5' phosphate modification and 3' FAM labeling to the tRNA sequences in Table 1 (Table 2).
[0101] Name5' modSequences NO.3' modSm Oligo 1Phosphate Sequence No. 1FAMSm Oligo 2Phosphate Sequence No. 2FAMSm Oligo 3Phosphate Sequence No. 3FAMSm Oligo 4Phosphate Sequence No. 4FAMSm Oligo 5Phosphate Sequence No. 5FAMSsal Oligo 6Phosphate Sequence No. 6FAMSsob Oligo 7Phosphate Sequence No. 7FAMSaur Oligo 8Phosphate Sequence No. 8FAM
[0102] Extravesicular vesicles isolated from E. coli using the ExoBacteria EV Isolation Kit (SBI) (hereinafter referred to as E. coli EV) were used as the medium for delivering the synthesized tRNA oligomers to cells. Specifically, 150 μM of the oligomer was prepared in 500 μL of E. coli EV (10 7 Electroporation was performed on particles (mL). Afterwards, RNase A was treated at 37°C for 30 minutes.
[0103]
[0104] Example 4. Effect of tRNA oligomers on promoting cell proliferation and migration
[0105] Promoting cell proliferation
[0106] tRNA oligomers at various concentrations (10 5 copy / mL - 10 12 E. coli EV solution containing (10 copy / mL) 7 Primary epithelial cells derived from human oral tissue were treated with particles / mL of PBS, and cell proliferation was analyzed by MTT assay after 48 hours.
[0107] As a result, among the experimental groups, each E. coli EV treatment group, including Sm Oligo 1, Sm Oligo 3, Ssal Oligo 6, Ssob Oligo 7, and Saur Oligo 8, showed a high cell proliferation-promoting effect. In addition, 1012 Cell viability was highest when tRNA oligomers at a copy / mL concentration were infected into E. coli EVs (Figs. 3a-3e).
[0108] Promoting cell migration
[0109] To determine whether tRNA oligomers contribute to the promotion of wound healing, their effects on cell migration were investigated. Primary epithelial cells derived from human oral tissue were isolated for the experiment; the control group was given PBS, and the experimental groups were given Sm Oligo 1, Sm Oligo 3, Ssal Oligo 6, Ssob Oligo 7, and Saur Oligo 8 (10 12 It consisted of each E. coli EV containing copy / mL concentration. Pure E. coli EV was used as the control group.
[0110] Primary oral epithelial cells were cultured in a 24-well culture plate containing a transwell chamber (pore size 8 μm). Cells were suspended in serum-free medium and added to the upper chamber, while medium containing the E. coli EVs to be tested was placed in the lower chamber and cultured for 24–40 hours. Subsequently, non-migrating cells were carefully removed from the upper surface of the insert using a cotton swab. Migrating cells were stained using a 0.2% crystal violet solution dissolved in 10% ethanol and counted using a phase-contrast microscope. As a result, the experimental group treated with pure E. coli EVs showed no effect on cell migration, whereas all experimental groups treated with each E. coli EV, including Sm Oligo 1, Sm Oligo 3, Ssal Oligo 6, Ssob Oligo 7, and Saur Oligo 8, showed a significant increase in cell migration levels (Figs. 4a–4b).
[0111]
[0112] Example 5. Wound healing effect by promoting cell motility of tRNA oligomers
[0113] We investigated whether tRNA oligomers exhibit wound healing effects. Primary epithelial cells derived from human oral tissue were isolated for the experiment; the control group was treated with PBS, while the experimental groups were treated with Sm Oligo 1 and Sm Oligo 3 at a rate of 10 12 It consisted of each E. coli EV containing at a copy / mL concentration, and pure E. coli EV was used as a control group.
[0114] Primary oral epithelial cells were cultured in a 12-well culture plate for 16 hours. After cell attachment, a wound line was created on the bottom of the plate using a 200 μL sterile pipette tip, washed with PBS, and treated with each E. coli EV for the experiment. The cells were then cultured for 5 days. Subsequently, cell migration was monitored using a bright-field microscope, and the wound size was determined. As a result, compared to the experimental group treated with pure E. coli EV, the experimental group treated with each E. coli EV containing Sm Oligo 1 and Sm Oligo 3 showed significantly higher cell migration after 5 days of culture (Fig. 5a). Additionally, when comparing wound size, the area of the wound site was reduced more in the experimental group treated with each E. coli EV containing Sm Oligo 1 and Sm Oligo 3 (Fig. 5b). These results confirm the wound healing effect of the tRNA oligomer according to the present invention.
[0115]
[0116] Example 6. Comparison of the effects of tRNA oligomers and growth factor EGF on promoting hemorrhage healing
[0117] Using the same method as in Figure 5, the wound healing effects of EGF, a representative growth factor commonly used, and tRNA oligomers were compared through the promotion of cell motility. First, the EGF group showed a significantly increased wound healing effect compared to the experimental groups treated with NT and E. coli EV. Although the wound healing effects of Sm Oligo 1 and Saur Oligo 8 were slightly reduced compared to EGF, there was no statistical significance, while Ssal Oligo 6 showed a wound healing promoting effect similar to that of EGF (Figures 6a-6b).
[0118] To compare the degree of cell motility promotion with EGF, the number of cells passing through the Transwell was quantified 40 hours after treating oral keratinocytes in a Transwell chamber with EGF and oligomers. The EGF group showed a significant increase in cell motility compared to the experimental group treated with E. coli EV. Although the wound healing effects of Sm Oligo 1 and Saur Oligo 8 were slightly reduced compared to EGF, there was no statistical significance, while Ssal Oligo 6 showed a wound healing promotion effect similar to that of EGF (Figs. 6c-6d).
[0119]
[0120] Example 7. Effect of tRNA oligomer on promoting epithelial cell proliferation
[0121] Changes in epithelial cells induced by tRNA oligomers were confirmed using two different organoids constructed from human and mouse-derived oral mucosal tissues. The control group was treated with PBS, and the experimental groups were treated with Sm Oligo 1 and Sm Oligo 3 for 10 12 It consisted of each E. coli EV containing at a copy / mL concentration, and pure E. coli EV was used as a control group.
[0122] Five days after treating organoids with E. coli EVs, the proliferation and migration of epithelial cells surrounding the organoids were observed using a phase-contrast microscope. As a result, it was confirmed that cell division was promoted in all experimental groups treated with each E. coli EV, including Sm Oligo 1 and Sm Oligo 3, causing the epithelial cells surrounding the organoids to proliferate and extend. In contrast, no significant changes were observed in the experimental group treated with pure E. coli EVs (Fig. 7). Since the division and migration of epithelial cells are important for wound healing, it was confirmed through these changes in epithelial cells that the tRNA oligomer according to the present invention can contribute to the wound healing mechanism.
[0123]
[0124] Example 8. Induction of local adhesion complex formation of tRNA oligomers
[0125] When a wound occurs, intercellular connections and binding with the extracellular matrix (ECM) are severed; therefore, the formation of focal adhesion complexes (FACs) is crucial for wound healing. Focal adhesion complexes are formed when cells bind to the matrix and regulate cell migration, signal transduction, and cell-matrix interactions. We investigated whether tRNA oligomers induce focal adhesion complex formation by examining the phosphorylation level of FAK in oral epithelial organoids. The experimental group was Sm Oligo 1 at a rate of 10 12 The study consisted of E. coli EV containing E. coli EV and pure E. coli EV at a copy / mL concentration, and the positive control used extracellular endoplasmic reticulum of Streptococcus mutans (hereinafter referred to as Sm EV).
[0126] First, organoids were treated with E. coli EV containing Sm Oligo 1 and a control (PBS) for 48 hours, and immunofluorescence staining of paxillin (red) and F-actin (green) was observed. In the experimental group treated with E. coli EV containing Sm Oligo 1 (E. coliEV-Oligo 1), increased collocalization of paxillin and F-actin was confirmed at the anterior margin of migrating cells (Fig. 8a). In addition, Western blot analysis after treating organoids with E. coli EV containing Sm Oligo 1, pure E. coli EV, Sm EV, and a control for 24 hours showed that FAK phosphorylation was significantly increased in the experimental group treated with E. coli EV containing Sm Oligo 1 (E. coliEV-Oligo 1) (Fig. 8b). These results confirmed that the tRNA oligomer according to the present invention induces the formation of local adhesion complexes, thereby enhancing cell migration.
[0127]
[0128] Example 9. Confirmation of In vivo Wound Healing Effect of tRNA Oligomer
[0129] The wound healing effects of tRNA oligomers were investigated in a mouse model (Fig. 9a). The control group was given PBS, and the experimental group was given Sm Oligo 1 10 12 E. coli EV was administered at a concentration of copy / mL, and pure E. coli EV was used as a control group. The experiment was conducted on 4-week-old BALB / c black mice after stabilization for 2 weeks. Each mouse was anesthetized, four wounds were made on the dorsal epidermis using a 4mm biopsy punch, and the mice were randomly divided into three groups. The experimental and control groups were 10 710 μL of PBS at a copy / mL concentration and 10 μL of PBS as a control were applied to the wound site daily for 4 days. On the 4th day, the wound was photographed, measured using a meter, and analyzed using ImageJ software. As a result, the wound areas of the control group (PBS) and the comparison group (E. coliEV) were at similar levels with no significant difference, whereas the wound area of the experimental group (E. coliEV-Oligo 1) decreased significantly (Fig. 9b).
[0130] In addition, to evaluate immune cell recruitment during the initial wound healing phase, mice were sacrificed on day 2, and wound tissues were collected. IHC measurements of the wound site were performed using antibodies specific to CD3 and CD45, and hematoxylin and eosin (H&E) staining was also conducted simultaneously. As a result, CD3+ immune cell recruitment, which indicates early inflammation, was prominent in the experimental group, and CD45 staining, which indicates leukocytes such as macrophages, was also more prominent in the granular tissue of the wound in the experimental group. These results suggest that inducing an early inflammatory response increases the speed of wound healing. H&E staining reveals the overall wound structure and healing status, and active progression can be observed in the experimental group compared to the control and comparison groups (Fig. 9c). These results confirmed that the tRNA oligomer according to the present invention can accelerate wound recovery by enhancing immune cell infiltration during the early inflammatory response.
Claims
A pharmaceutical composition for wound healing or skin regeneration comprising small RNA derived from oral or skin resident microorganisms. A pharmaceutical composition for wound healing or skin regeneration according to claim 1, wherein the microorganism is at least one selected from the group consisting of Streptococcus mutans (S. mutans), Streptococcus salivarius (S. salivarius), Streptococcus sobrinus (S. sobrinus) and Staphylococcus aureus (S. aureus). A pharmaceutical composition for wound healing or skin regeneration according to claim 1, wherein the small RNA is at least one selected from the group consisting of nucleotide sequences represented by SEQ ID NOs. 1, 3, 6, 7, and 8. A pharmaceutical composition for wound healing or skin regeneration according to claim 1, further comprising any one of lipid nanoparticles, liposomes, polymer nanoparticles, extracellular vesicles, peptides, and DNA-nanostructures. A pharmaceutical composition for wound healing or skin regeneration according to claim 1, which promotes the formation of a focal adhesion complex. A pharmaceutical composition for wound treatment or skin regeneration according to claim 1, formulated as any one selected from the group consisting of liquids, ointments, lotions, creams, sprays, gels, external liquids, pastes, liniments, aerosols, patches, and adhesive bandages. A cosmetic composition for skin regeneration comprising small RNA derived from oral or skin resident microorganisms. A cosmetic composition for skin regeneration according to claim 7, wherein the microorganism is at least one selected from the group consisting of Streptococcus mutans (S. mutans), Streptococcus salivarius (S. salivarius), Streptococcus sobrinus (S. sobrinus) and Staphylococcus aureus (S. aureus). A cosmetic composition for skin regeneration according to claim 7, wherein the small RNA is at least one selected from the group consisting of nucleotide sequences represented by SEQ ID NOs. 1, 3, 6, 7, and 8. A cosmetic composition for skin regeneration according to claim 7, further comprising at least one selected from the group consisting of lipid nanoparticles, liposomes, polymer nanoparticles, extracellular vesicles, peptides, and DNA-nanostructures. A cosmetic composition for skin regeneration that promotes the formation of a focal adhesion complex, according to claim 7. A cosmetic composition for skin regeneration according to claim 7, formulated as any one selected from the group consisting of lotion, liquid, cream, gel, aerosol, and powder. A method for wound healing or skin regeneration comprising the step of administering small RNA derived from oral or skin resident microorganisms to animals other than humans.