Padlock probes for multiplexed nucleic acid sequence detection

The method uses padlock probes with unique melting-curve spacing and fluorescence-detection channel combinations to achieve reliable detection of multiple microbial targets in a single reaction, addressing primer interference and contamination issues, and enhancing detection efficiency.

WO2026127764A1PCT designated stage Publication Date: 2026-06-18BIOMIRIS CAPITAL GRP BV

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
BIOMIRIS CAPITAL GRP BV
Filing Date
2025-12-09
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Existing multiplex nucleic acid detection methods face challenges such as primer interference, limited throughput, and contamination risks, particularly in detecting multiple targets like antimicrobial resistance genes, which require separate reaction vessels and result in inconsistent results.

Method used

A method using padlock probes with unique melting-curve spacing and fluorescence-detection channel combinations in a single reaction, allowing for high-resolution melting curve analysis and fluorescence detection, enabling reliable discrimination and quantification of multiple targets without cross-reactions or signal loss.

🎯Benefits of technology

Enables reliable detection of over 40 distinct microbial targets in a single closed-container qPCR reaction, exceeding prior art multiplexing levels and preventing contamination, with chemically protected detection probes ensuring probe integrity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000071_0001
    Figure IMGF000071_0001
  • Figure IMGF000061_0001_TABLE
    Figure IMGF000061_0001_TABLE
  • Figure 00000080_0000
    Figure 00000080_0000
Patent Text Reader

Abstract

The present invention provides a method for detecting at least one nucleic acid molecule in a sample, the method comprising the steps of: a) contacting said sample with at least one padlock probe wherein said padlock probe comprises: 3' and 5' terminal regions complementary to a target nucleic acid sequence comprised in said at least one nucleic acid molecule, a linker region connecting said terminal regions, at least one primer binding region for binding of at least one amplification primer, and optionally, at least one probe binding region for binding of at least one detection probe; b) hybridizing the complementary terminal regions of said at least one padlock probe to said target nucleic acid sequence; c) circularising said at least one padlock probe by ligating the termini of said at least one padlock probe to provide a circularized padlock probe sequence; d) hybridizing at least one amplification primer to said primer binding region in said circularized padlock probe, and amplifying at least a part of said circularized padlock probe sequence comprising said optional probe binding region, to thereby generate as amplicon from said circularized padlock probe; e) recording the high resolution melting curve of said amplicon and / or hybridizing at least one detection probe to said optional probe binding region in said amplicon and recording the detection signal of said at least one detection probe, and f) determining the presence or absence of said at least one nucleic acid molecule in said sample on the basis of the recorded melting curve of said padlock probe amplicon and / or on the basis of the recorded detection signal from said detection probe.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] P138022PC00

[0002] Title: Padlock probes for multiplexed nucleic acid sequence detection

[0003] FIELD OF THE INVENTION

[0004] The invention is in the field of diagnostics. In particular, the invention relates to multiplexed nucleic acid sequence detection, useful for detecting the presence of large numbers of genes in clinical samples, such as antimicrobial resistance genes in samples comprising antimicrobial -resistant microorganisms.

[0005] BACKGROUND OF THE INVENTION

[0006] In clinical laboratories, routine detection of specific nucleic acid targets plays a critical role in diagnosing, monitoring, and managing various diseases. Nucleic acid detection has become pivotal in cancer diagnostics and prenatal testing, and rapid detection of microbial nucleic acids is essential in the management of viral, bacterial and fungal infections.

[0007] Nucleic acid targets to be detected include, for instance, viral structural and nonstructural protein genes, and genes encoding bacterial and fungal ribosomal RNA to aid in the species identification of the infectious agent(s), as well as antimicrobial resistance genes for guiding prophylactic or curative therapy.

[0008] The nucleic acids sequences that encode specific genes, or the RNA transcripts thereof, can be detected by using individual assays for each gene separately, and usually include the performance of a nucleic acid amplification test (NAAT). To improve diagnostic efficiency, the detection of multiple nucleic acid targets, such as a panel of gene targets that cause different antimicrobial resistance phenotypes, may be combined in a single assay. This is mostly done using multiplexed qPCR, wherein multiple targets are amplified and detected simultaneously by a single nucleic acid amplification reaction. This requires the presence of many different oligonucleotide primers, from which the various nucleic acid amplification reactions are initiated.

[0009] However, this provides a number of drawbacks, because the presence of many different sets of primers may, for instance, result in interference and primer dimer formation, which leads to inconsistent results and a decrease in amplification efficiency. Therefore, multiplex qPCR can only support a limited number of targets per reaction, which hampers the throughput. Other multiplex approaches, such as microarrays or next-generation sequencing (NGS) can identify many more targets simultaneously, but such methods are slow and complicated.

[0010] WO 2020 / 132515 discloses methods for multiplexed detection of a nucleic acid sequence in a sample including the use of a plurality of oligonucleotide target-specific probes (TSPs) configured to bind to a distinct target nucleic acid sequence, where each of the TSPs includes one or more copies of a first fluorescent probe (FP) binding region and one or more copies of a second FP binding region, and where a predetermined ratio of the one or more copies of the first FP binding region to the one or more copies of the second FP binding region is indicative of the distinct target nucleic acid sequence the TSP is configured to bind to.

[0011] CN 102 719533 A and Szemes et al. 2005, NAR 33(8), pp E70-1 both disclose padlock probes for diagnosing nucleic acids using real-time PCR and microarray detection. The drawback of using microarray detection is that the reaction container must be opened to contact the reaction mixture with the array. This may result in contamination of the analytical environment.

[0012] The use of primers against evolutionary conserved target regions, such as present in ribosomal RNA genes, facilitates amplification of many different genetic bacterial or fungal targets with only a few primers. But many examples of gene targets exist that have no conserved regions, such as in the diagnosis of viruses, antimicrobial resistance (AMR) genes, virulence genes or species-specific markers for closely related microbial species. When many different primer pairs are needed to amplify the targets of diagnostic interest, there is currently no other option than to distribute distinct multiplex amplification reactions over separate reaction vessels. For instance, in the case of specific detection of bacteria such as Streptococcus mitis and Streptococcus pneumoniae, or Escherichia coli and Shigella spp., it is difficult to design a broad multi-target NAAT, and use must be made of several smaller-scale qPCR panels. The present invention aims to provide a solution to this problem. It is therefore an aim of the present invention to provide an assay that can detect and identify many nucleic acid targets simultaneously, while keeping the assay and interpretation straightforward.

[0013] SUMMARY OF THE INVENTION

[0014] The present invention overcomes many of the drawbacks of the prior art by combining two orthogonal read-outs (melting-curve spacing plus detection probe channel identity). The dual-dimension multiplex discrimination is obtained by designing different padlock-probes in a way that each padlock-probe amplicon is uniquely defined by (a) its high-resolution melting (HRM) peak position within the melting-curve space, preferably differing from other amplicons by at least 0.5–2 °C, and (b) the fluorescence-detection channel of a qPCR instrument in which its associated detection probe is read. This increases the number of detectable targets by a factor n-1, wherein n is the number of fluorescence-detection channels of the qPCR instrument used, whereby one channel may be reserved for recording the HRM curve of the padlock-probe amplicon(s). This combines sequence-encoded melting domains with colour-coded probe channels in a single reaction.

[0015] Usually, a set of padlock probes is first designed such that each probe is complementary to a specific sequence in a nucleic acid molecule from a different microorganism in a corresponding set of predefined microorganisms. The set of padlock probes is further designed such that each padlock probe amplicon is uniquely identified by the position of the primary –dF / dT melting peak within the overall melting-temperature range spanned by all amplicons in the set, and (b) the presence or absence of a target nucleic acid sequence within the amplicon that is detectable by a fluorescently-labelled detection probe. The pre-designed padlock probe amplicons are first generated by contacting said set of padlock probes with a sample comprising or suspected of comprising nucleic-acid targets of said set of predefined microorganisms, allowing for hybridization of said padlock probes to their complementary nucleic-acid target and ligation of hybridized padlock probes to provide circularized padlock probes. Then, unligated padlock probes are usually removed by exonuclease digestion, and at least a part of the sequence of circularized padlock probes is amplified through a primer-extension–based amplification reaction to generate padlock probe amplicons. Finally, the high-resolution melting curve of said amplicons is determined together with the presence or absence of a target nucleic acid sequence in the amplicons that is detectable by one or more fluorescently labelled detection probes. The amplification and detection reactions may be performed in single closed-container format (or microfluidic cartridge format). Preferably, in aspects of this invention, steps d) and e) of amplification and detection are performed in a single closed reaction container.

[0016] Preferably, detection probes are used that are chemically protected against exonuclease digestion while retaining target-hybridisation performance (e.g. by 3'-phosphorothioate bonds, or LNA caps) so that the detection probes resist exonuclease digestion used in the removal of unligated padlock probes.

[0017] The inventors have shown that this combination results in very reliable detection of over 40 distinct microbial targets in a single closed- container qPCR reaction, a multiplexing level far exceeding that of the prior art, with no cross-reaction or signal loss.

[0018] The present invention provides a multiplex nucleic-acid detection method that enables reliable discrimination and quantification of a very high number of targets. By performing said method in a single closed container, whereby both amplification and detection takes place in a single closed reaction container, cross-contamination or contamination of the postamplification area may be prevented or minimized. Further by using chemically protected detection probes, loss of probe integrity during exonuclease treatment of unligated padlock probes is prevented or minimized.

[0019] The present invention provides in a first aspect a method for detecting at least one nucleic acid molecule in a sample, the method comprising the steps of:

[0020] a) contacting said sample with at least one padlock probe wherein said padlock probe comprises:

[0021] - 3’ and 5’ terminal regions complementary to a target nucleic acid sequence comprised in said at least one nucleic acid molecule,

[0022] - a linker region connecting said terminal regions,

[0023] - at least one primer binding region for binding of at least one amplification primer,

[0024] - optionally at least one probe binding region for binding of at least one detection probe,

[0025] b) hybridizing the complementary terminal regions of said at least one padlock probe to said target nucleic acid sequence;

[0026] c) circularising said at least one padlock probe by ligating the termini of said at least one padlock probe to provide a circularized padlock probe sequence;

[0027] d) hybridizing at least one amplification primer to said primer binding region in said circularized padlock probe, and amplifying at least a part of said circularized padlock probe sequence comprising said optional probe binding region, to thereby generate an amplicon from said circularized padlock probe,

[0028] e) i) recording the high resolution melting curve of said amplicon and / or ii) hybridizing at least one detection probe to said optional probe binding region in said amplicon and recording the detection signal of said at least one detection probe, and

[0029] f) determining the presence or absence of said at least one nucleic acid molecule in said sample on the basis of i) the recorded melting curve of said padlock probe amplicon and / or ii) the recorded detection signal from said detection probe.

[0030] In preferred embodiments of the present invention, both a melting curve from the at least one padlock probe amplicon, and at least one detection probe signal from hybridizing a detection probe to the at least one padlock probe amplicon are obtained. Hence, at least one padlock probe comprises a probe binding region in aspects of this invention.

[0031] After recording of the high resolution melting curve of the padlock probe amplicon, the recorded melting curve may be compared with a reference melting curve for said padlock probe amplicon generated using the same amplification primer(s) and a reference sequence of said at least one nucleic acid molecule. The reference sequence preferably comprising a sequence that is at least identical to the padlock probe target sequence of the nucleic acid molecule that is to be detected. The step of determining the presence or absence of said at least one nucleic acid molecule in said sample on the basis of the recorded melting curve then comprises confirming that the recorded melting curve agrees with the reference melting curve.

[0032] In aspects of this invention, the at least one padlock probe is preferably one of a set of padlock probes in which each probe is complementary to a specific sequence in a nucleic acid molecule from a distinct microorganism in a corresponding set of predefined microorganisms. the presence or absence of each of which is to be determined in a sample. Hence, the at least one padlock probe is preferably a set of padlock probes specific for a predefined set of distinct microorganisms and each padlock probe targets one distinct microorganism. Hence, a method of the invention may comprise the step of predefining a set of distinct microorganisms and designing a padlock probe sequence that is complementary to a target nucleic acid sequence present in the genome of only one microorganism in said defined set of distinct microorganisms.

[0033] In preferred aspects of this invention, the at least one padlock probe is one of a set of padlock probes the respective amplicons of which exhibit primary —dF / dT melting peaks with peak positions that are collectively within a range of 5 to 20 °C, more preferably 8 to 15 °C. Said range may be understood as a temperature window within which all amplicons of the set have their peak position of the primary –dF / dT melting peak. Said set of padlock probes may comprise from 2-40, preferably from 5-20, more preferably from 8-12 padlock probes, such as 10 padlock probes. Preferably, in a set of padlock probes in accordance with aspects of this invention, said set comprises multiple probes each of which is for a distinct microorganism species, and the peak position of the primary —dF / dT melting peak of the amplicon of each distinct padlock probe in the set is separated by at least 0.5 °C from any other padlock probe in the set. The peak position of the primary —dF / dT melting peak of the amplicon of a padlock probe is also for referred to herein as the position of said peak. As used herein, the y- value at the top of a peak is referred to as the peak value, the corresponding x-coordinate is referred to as the peak position.

[0034] Preferably, in aspects of this invention, said at least one detection probe comprises a set of at least two detection probes, preferably a plurality of detection probes, and each detection probe of said set of at least two detection probes carries a fluorescent label detectable in a defined fluorescence channel of a qPCR instrument and wherein said fluorescent label of each of said detection probes is distinct for amplicons of which the melting curves are not distinguishable from one another, because the position of at least one peak, preferably all peaks, in the melting curve are essentially not distinguishable. Preferably, said melting curves are understood as being not distinguishable if the position of all peaks, more preferably of the primary peak (i.e. the peak having the greatest magnitude), of the first derivative (~dF / dT) of their melting curve differs from that of other amplicons by less than 0.5 °C. The first derivative (-dF / dT) of a DNA melting curve is the negative of the rate of change of fluorescence with respect to temperature. The (position of the) primary peak in —dF / dT usually marks the Tm.

[0035] In aspects of this invention, the position of the primary peak of the first-derivative (-dF / dT) in the melting curve refers to its position in the overall range of the peak positions of all primary peaks of all amplicons from a set of padlock probes, whereby two primary peaks have a different or distinguishable position when their position is separated by at least 0.5-2 °C, preferably at least 0.5 °C.

[0036] Alternatively or additionally, in aspects of this invention, each detection probe of said set of at least two detection probes, each carries a fluorescent label detectable in the same fluorescence channel of a qPCR instrument as the fluorescent label of any probe for detecting amplicons of which the melting curve are distinguishable, because the position of at least one peak, preferably all peaks, in the melting curve are distinguishable. Preferably, melting curves are distinguishable if the position of at least one peak, preferably the primary peak, of the first derivative (-dF / dT) of their melting curve differs from that of other amplicons by at least 0.5–2 °C.

[0037] As used herein, the difference in position between two peaks in the melting curve to be compared, e.g. the difference in position between two primary peaks in the melting curves of each amplicon, is determined by calculating the difference between the temperatures corresponding to the tops (i.e. highest values or peak values on the y-axis) of each (primary) peak. One of skill will readily understand that such distinctions can be readily made for simple melting curves (e.g., based on two-state melting padlock probes), as well as for more complex melting curves, wherein the amplicons of the padlock probes may exhibit multiple melting domains, resulting in a distinct signature or peak pattern consisting of multiple peaks and / or shouldered peaks.

[0038] Accordingly, the invention further relates to a method comprising classifying said at least one nucleic acid molecule on the basis of i) the recorded melting curves of said set of at least two padlock probe amplicons and / or ii) the recorded detection signals from said set of at least two detection probes, preferably classifying said at least one nucleic acid molecule on the basis of i) the recorded melting curve of a first padlock probe amplicon of said set of at least two padlock probes, if the recorded detection signal from said first detection probe is the same as the recorded detection signal from a second detection probe of said set of at least two padlock probes and / or on the basis of ii) the recorded detection signals from said set of at least two detection probes if the position of the primary peak of the first derivative (-dF / dT) of the recorded melting curve of said amplicon of said first padlock probe from said set of at least two detection probes differs from that of said amplicon of said second padlock probe by less than 0.5 °C.

[0039] In a preferred embodiment of a method of the invention, said padlock probe comprises at least two primer binding regions for binding of at least one set of bidirectional amplification primers, and wherein step d) comprises PCR amplifying at least a part of said circularized padlock probe sequence comprising said probe binding region. PCR amplifying at least a part of said circularized padlock probe sequence preferably comprises primer extension using a set of bidirectional amplification primers to thereby generate a double stranded amplicon from said circularized padlock probe.

[0040] In an alternative embodiment of a method of the invention, step d) comprises isothermally amplifying at least a part of said circularized padlock probe sequence comprising said probe binding region. In such embodiments, the amplicon may comprise of single stranded or double stranded DNA. An example of an isothermal amplification is that of rolling circle amplification (RCA) as described herein, wherein a single stranded concatemer of the circularized padlock probe sequence is generated.

[0041] Through hairpin formation, such amplicons may comprise regions of double stranded DNA, that also provide for the possibility that a melting curve of the double stranded (parts of the) amplicon may be recorded.

[0042] In another preferred embodiment of a method of the invention, following the circularization in step c) and prior to the amplification in step d), a step dl) is included wherein any non-circularized padlock probe is digested by exonuclease digestion, preferably using Exonuclease I or Exonuclease III. In preferred embodiments wherein exonuclease digestion of linear single stranded DNA (to remove non-circularized padlock probes) is applied, the at least one amplification primer and the at least one detection probe used are rendered resistant to said exonuclease digestion. In a preferred embodiment of a method of the invention, said at least one amplification primer and said at least one detection probe are rendered resistant to exonuclease digestion by the presence of consecutive phosphorothioate bonds and / or consecutive LNA bases in the amplification primers and / or detection probes, preferably at the 3’ terminus. Preferably, in the detection probes, both consecutive phosphorothioate bonds and consecutive LNA bases are present.

[0043] In another preferred embodiment of a method of the invention, following the circularization in step c) and the optional exonuclease digestion of non-circularized padlock probes of step dl), and prior to the PCR amplification step of step e), a step d2) is included wherein concatenated sequence copies of said circularized padlock probe sequence are generated by rolling circle amplification (RCA).

[0044] One of skill will understand that the part of step d) comprising amplifying at least a part of said circularized padlock probe sequence comprising said optional probe binding region to generate an amplicon from said circularized padlock probe, may involve isothermal amplification such as by the use of RCA, and that PCR is an embodiment that is exemplified in the Examples below, but not an essential element of the method of the invention.

[0045] It is further envisioned as an embodiment that in a method of the present invention the nucleic acid molecule in the sample is amplified by a nucleic acid amplification reaction prior to contacting the sample with the at least one padlock probe. Such an initial nucleic acid amplification reaction may be performed by using one or more suitable target- specific primers, i.e. primers that allow amplification by a primer extension reaction of the nucleic acid molecule that is to be detected, for instance a pair of bidirectional suitable target- specific primers in case that a PCR reaction is used. One of skill in the art is well aware of suitable amplification reactions to perform an initial nucleic acid amplification step prior to padlock probe annealing. Isothermal nucleic acid amplification reactions may also be used. The initial nucleic acid amplification step prior to padlock probe annealing may comprise one or more target nucleic acid molecules in the sample. In particular, and preferably, target nucleic acid molecules in the sample that are expected to be present at very low concentrations (i.e. at very low copy numbers), are subjected to such an initial nucleic acid amplification reaction.

[0046] In another preferred embodiment of a method of the invention, in particular wherein PCR is used, a double stranded padlock probe amplicon is generated. Such a double stranded padlock probe amplicon is preferably between 40-400 base pairs, preferably 80-300 base pairs, more preferably 150-250 base pairs in length.

[0047] In another preferred embodiment of a method of the invention, said at least one nucleic acid molecule in a sample is selected from an antimicrobial resistance gene, a virulence gene, a viral nucleic acid, a fungal nucleic acid, a bacterial nucleic acid, a ribosomal RNA gene or an rDNA internal transcribed spacer (ITS) region, a gene comprising a mutation that is associated with cancer, a gene comprising a mutation associated with a prenatal disorder, and nucleic acid transcripts of those genes.

[0048] In another preferred embodiment of a method of the invention, steps a) through c) are performed in a first reaction mixture and steps d) through e), optionally including dl) and / or d2), are performed in a second reaction mixture. Preferably in the second reaction mixture, the activation of the successive enzymatic reactions is temperature controlled, preferably wherein the exonuclease digestion, rolling circle amplification and PCR amplification reactions are initiated at consecutively higher temperatures.

[0049] Steps a) through e) may be successively performed in a single reaction container, preferably in a single closed reaction container, wherein in a first reaction mixture at least the steps of padlock probe hybridization and padlock probe ligation are performed, and wherein in a second reaction mixture, prepared by adding additional reactants to the first mixture, at least the step of padlock probe amplicon generation is performed. In preferred embodiments, the second reaction mixture supports the steps of exonuclease digestion of non-circularized padlock probes, rolling circle amplification of the circularized padlock probe sequence to generate linear concatemers from the circular padlock probe sequence, and PCR amplification of the padlock probe sequence concatemer. The order of the reactions in the second reaction mixture is preferably temperature controlled based on the activation temperature or optimal performance temperature of the enzyme involved. In another preferred embodiment of a method of the invention, said at least one padlock probe comprises a set of at least two padlock probes each targeting a different target nucleic acid sequence in the same or different sample nucleic acid molecule(s), wherein each padlock probe amplicon generated from said set of at least two padlock probes is individually distinguishable on the basis of its melting curve profile and / or on the basis of padlock probe amplicon-specific detection probe signal (s). In practice, the melting curve profile of each double stranded padlock probe amplicon may be rendered distinguishable by a difference in length and / or sequence of the linking region of said padlock probe that is amplified and that comprises the binding region(s) for the detection probe(s), and / or by comprising at least one detection probe binding region that is different from the detection probe binding region(s) in other double stranded padlock probe amplicons in said set.

[0050] In another preferred embodiment of a method of the invention, said set of at least two padlock probes consists of a plurality of padlock probes, each targeting a different target nucleic acid sequence, wherein said set comprises: a) multiple padlock probes whose amplicons have melting curves with first derivative (–dF / dT) primary peak positions that differ by at least 0.5 °C recorded in a first fluorescent channel and have identical probe binding regions detectable by a single detection probe having a fluorescent label detectable in a second fluorescent channel, and b) multiple padlock probes whose amplicons have melting curves with first derivative (–dF / dT) primary peak positions that differ by less than 0.5 °C recorded in said first fluorescent channel and have different probe binding regions detectable by distinct detection probes having distinct fluorescent labels detectable in a third and further fluorescent channel. Preferably, said set under a) comprises from 5-15 padlock probes and said set under b) comprises padlock probes with 2, 3, 4, 5, or more different probe binding regions between them. In another preferred embodiment of a method of the invention, each double stranded padlock probe amplicon in said set of at least two double stranded padlock probe amplicons is detectable by multiple detection probes. The term multiple in this context indicates that each of said multiple detection probes has a distinct target in the padlock probe amplicon (i.e. targets a distinct padlock probe amplicon sequence).

[0051] In another preferred embodiment of a method of the invention, each double stranded padlock probe amplicon in said set of at least two double stranded padlock probe amplicons is detectable by using at least two detection probes, wherein each of said at least two detection probes detects the amplicon of a subset selection of amplicons selected from said set, wherein said combination of detection signals from said at least two different detection probes partitions said set into distinct subsets wherein each amplicon of said set of amplicons is in one and only one of these distinct subsets.

[0052] Said sample further preferably comprising or is suspected of comprising at least one nucleic acid molecule, more preferably at least one nucleic acid molecule of a single strain or single species of a micro-organism.

[0053] The present invention further provides a method for detecting and distinguishing nucleic-acid targets of distinct microorganisms in a single closed-container reaction, the method comprising the steps of:

[0054] a) providing a plurality of padlock probes to target nucleic acids, each padlock probe being specific for a nucleic-acid target of a distinct microorganism, wherein each padlock probe comprises:

[0055] - 3’ and 5’ terminal regions complementary to a target nucleic acid sequence comprised in its nucleic acid target,

[0056] - a linker region connecting said terminal regions and comprising at least one melting-curve determining region,

[0057] - at least two primer binding regions for binding of at least one set of bidirectional amplification primers, - at least one probe binding region for binding of at least one detection probe;

[0058] b) contacting said plurality of padlock probes with a sample comprising or suspected of comprising nucleic-acid targets of distinct microorganisms and allowing the complementary terminal regions of said plurality of padlock probes to hybridize to their respective nucleic acid targets;

[0059] c) circularising hybridized padlock probes by ligating their termini to provide circularized padlock probe sequences;

[0060] d) contacting at least a part of said circularized padlock probe sequences with a reaction mixture comprising:

[0061] - an exonuclease,

[0062] - bidirectional amplification primers for amplifying a region from each of said circularized padlock probe sequences that comprises at least said melting-curve determining region and said probe binding region and for generating padlock probe amplicons,

[0063] - a plurality of detection probes that are chemically protected against exonuclease degradation and that each carry a fluorescent label detectable in a defined fluorescence channel of a qPCR instrument and wherein said fluorescent label of each of said probes is distinct for amplicons of which the position of the primary peak of the first derivative (–dF / dT) of their melting curve differs from that of other amplicons by less than 0.5 °C, and

[0064] - a plurality of detection probes that are chemically protected against exonuclease degradation and that each carry a fluorescent label detectable in the same fluorescence channel of a qPCR instrument as the fluorescent label of any probe for detecting amplicons of which the position of the primary peak of the first derivative (–dF / dT) of their melting curve differs from that of other amplicons by at least 0.5–2 °C;

[0065] e) allowing digestion of unligated padlock probes by said exonuclease; f) amplifying the circularised padlock probes to produce corresponding padlock-probe amplicons; and

[0066] g) recording high-resolution melting curves of the amplicons and recording the detection signal of said detection probes;

[0067] wherein each distinct padlock-probe amplicon is identified by (i) the position of the peak of the first derivative of its high-resolution melting curve, and (ii) the fluorescence channel in which its corresponding detection probe is detected, and determining the presence or absence of said nucleic- acid targets of distinct microorganisms in said sample on the basis of the recorded high-resolution melting curve of said padlock probe amplicon and the recorded detection signal from said detection probe.

[0068] In another aspect, the present invention provides a kit of parts comprising:

[0069] a) at least one padlock probe wherein said padlock probe comprises:

[0070] - 3’ and 5’ terminal regions complementary to a target nucleic acid sequence comprised in said at least one nucleic acid molecule,

[0071] - a linker region connecting said terminal regions,

[0072] - at least one primer binding region for binding of at least one amplification primer,

[0073] - optionally, at least one probe binding region for binding of at least one detection probe;

[0074] said kit of parts further comprising at least one of:

[0075] b) a ligase for ligating the termini of said at least one padlock probe when said at least one padlock probe is hybridized at its complementary terminal regions to said target nucleic acid sequence to generate a circularized padlock probe sequence;

[0076] c) an exonuclease for degrading non-circularized padlock probe sequences; d) at least one amplification primer for amplifying at least a part of a circularized padlock probe sequence and for generating a padlock probe amplicon comprising said optional at least one probe binding region; e) a DNA polymerase for generating a padlock probe amplicon through a nucleic acid amplification reaction;

[0077] f) at least one detection probe comprising a targeting sequence for targeting a complementary nucleotide target sequence in said padlock probe amplicon, and comprising a detectable label.

[0078] In a preferred embodiment of a kit of parts of the invention, the kit of parts comprises as separate mixtures:

[0079] i) a ligation mixture comprising at least component a) (at least one padlock) and optionally b) (a ligase), and

[0080] ii) an amplification mixture comprising at least one of components c) through f) (exonuclease, at least one amplification primer, at least one detection probe).

[0081] Said kit preferably comprises at least one padlock probe comprising at least one probe binding region for binding of at least one detection probe, more preferably a set of at least two padlock probes, more preferably a plurality of padlock probes, each targeting a different target nucleic acid sequence in the same or different sample nucleic acid molecule(s), wherein each padlock probe amplicon generated from said set of at least two padlock probes is individually distinguishable on the basis of its melting curve profile and / or on the basis of padlock probe amplicon-specific detection probe signal(s). More preferably each detection probe carries a fluorescent label detectable in a defined fluorescence channel of a qPCR instrument and wherein said fluorescent label of each of said detection probes is distinct for amplicons of which the position of the primary peak of the first derivative (–dF / dT) of their melting curve differs from that of other amplicons by less than 0.5 °C, and / or wherein each detection probe each carries a fluorescent label detectable in the same fluorescence channel of a qPCR instrument as the fluorescent label of any probe for detecting amplicons of which the position of the primary peak of the first derivative (– dF / dT) of the melting curve differs from that of other amplicons by at least 0.5–2 °C

[0082] Said kit further preferably comprises at least one set of bidirectional amplification primers for amplifying at least a part of a circularized padlock probe sequence and for generating a padlock probe amplicon comprising said at least one probe binding region and / or wherein said at least one amplification primer and / or said at least one detection probe are rendered resistant to said exonuclease digestion, preferably by the presence of consecutive phosphorothioate bonds and / or consecutive LNA bases at the 3’ end.

[0083] In another aspect, the present invention provides a system comprising

[0084] a) a kit of parts according to the invention as described above;

[0085] b) a device for recording a high-resolution melting curve of said padlock probe amplicon, said device preferably further comprising multiple color channels for detecting a signal from a detectable label of said at least one detection probe. Said device may suitably be a thermal cycler (also known as a thermocycler, PCR machine or DNA amplifier), preferably a qPCR machine, preferably comprising 4, 5, 6 or more color channels.

[0086] DESCRIPTION OF THE DRAWINGS

[0087] Figure 1 shows a graphical representation of the assay of the invention. Panel A: Representation of the first reaction (ligation reaction). At least one padlock probe is mixed with a sample. Upon reaction and hybridization of the padlock probe’s 3’ and 5’ annealing regions to their complementary target sequence in the nucleic acid molecule to be detected, the hybridized padlock probe is ligated into a circular DNA fragment. Panel B: In a second reaction, unligated (non-circularized) padlock probe molecules are degraded, while the circularized padlock probe serves as template for an amplification reaction, e.g. a qPCR reaction, optionally preceded by a rolling circle amplification as described herein. The second reaction mixture therefore comprises an Exonuclease that degrades noncircularized DNA as well as DNA polymerase enzyme for amplification. The padlock probe sequence therefore comprises at least one primer binding region for binding of at least one amplification primer. When using PCR amplification, the padlock probe sequence comprises binding regions for a forward and reverse amplification primer, allowing for PCR amplification of the padlock probe sequence bordered by these two PCR primers defining the padlock probe amplicon sequence. The padlock probe amplicon sequence comprises at least a part of the linker region connecting the 3’ and 5’ terminal regions of the padlock probe, and preferably comprises a specific detection probe recognition sequence, i.e., a binding region for binding of at least one detection probe. The padlock probe amplicon exhibits a specific melting curve profile, which profile can be tailored by altering the linker region. In case the padlock probe amplicon comprises a binding region for a detection probe, the detection probe signal may be recorded during or after the (PCR) amplification reaction. It can be determined from the resulting detection probe signal and / or the melting curve analysis whether the padlock probe was circularized meaning that its corresponding target sequence was present in the original sample.

[0088] Figure 2 shows an example of 11 different melting curves generated from padlock probes targeting antimicrobial resistance genes. Targets of melting curves that overlap may be distinguished using the detection probe (qPCR probe) signal.

[0089] Figure 3 shows the concept of the coding scheme for the highly multiplexed detection reaction using HrMC and detection probes. The different detection outcomes are coded with a unique detection probe / HrMC signal. Both the detection probe sequence and the amplicon melt temperature are part of the PLP design. The number of possible results is determined by the number of probe channels times the number of unique meltcurve profiles. For instance, if five detection probes and 10 distinct melt curves are used, then 50 separate outcomes can be distinguished.

[0090] Figure 4: Detection probe amplification curves (A) and hrMC results (B) of a clinical UTI sample (solid black lines) versus a negative control (dotted grey lines). The combination of positive probe2 signal and the melt curve profile identify the genotypic antibiotic resistance.

[0091] Figure 5: Detection of 250 (solid black lines) and 25 (solid grey lines) CFU of Klebsiella pneumoniae strain TY07161, harbouring the KPC- 3 gene (solid) or water controls (grey dotted lines). To the ligation reaction are added KPC specific primers, dNTPs and a thermal stable polymerase (A& B) or only primers and dNTP’s as control (C& D). The amplification curve of the intercalating dye is shown on the left, the HrMC profile is shown on the right. A KPC specific amplification is only observed in the presence of the polymerase in the case of 25 CFU input.

[0092] Figure 6: Results of Example 3. Different probes (lOOnM) were subjected to nuclease treatment for Ih at 37 °C. Shown is the mean raw fluorescence with SD as error bars of two replicates. Ctrl: no nuclease treatment; Exonuclease III buffer. DNasel: 0.05U / uL DNase I in DNAse I buffer. Exol: Exonuclease I (0.25 U / uL) in Exonuclease I buffer. ExoIII:

[0093] Exonuclease III (0.25 U / uL) in Exonuclease III buffer. ExoIII+Exol:

[0094] Exonuclease III (0.25 U / uL) + Exonuclease I (0.25 U / uL) in Exonuclease III buffer.

[0095] Figure 7. Recorded HR melting curves of several target amplicons. The amplicon meltcurves are designed such that their meltcurves do not overlap (different rows). Moreover, the targets can be differentiated by their detection probe (different columns), enabling reusage of the meltcurve space and a high level of multiplexing

[0096] Figure 8. Comparison between the predicted Tm of the meltcurve and the observed Tm of the recorder meltcurve. Every dot represents a different target. The data is colored and shaped according to the associated detection probe.

[0097] DETAILED DESCRIPTION OF THE INVENTION

[0098] Definitions

[0099] The terms “nucleic acid sequence”, and “nucleotide sequence”, which terms can be used interchangeably herein, refer to the nucleotide composition of base sequence of a DNA or RNA molecule in single or double stranded form, such as a DNA sequence encoding a gene or a part thereof. The term “nucleic acid sequence” is for example also used to refer to a DNA or RNA molecule.

[0100] An "isolated nucleic acid sequence" refers to a nucleic acid molecule which is no longer in the natural environment from which it was isolated. The term inter alia refers to a nucleic acid molecule that has been separated from at least about 50%, 75%, 90%, or more of proteins, lipids, carbohydrates, or other materials with which it is naturally associated, e.g. in a microbial host cell or virus.

[0101] The term “microbial”, as used herein, refers to an element as originating from a microorganism, or microbe, which generally refers to an organism that is microscopic, which means too small to be seen by the unaided human eye. Microorganisms in the context of this invention include archaea, bacteria, viruses, protozoa, and fungi. Preferably, a microorganism is a (opportunistic) pathogenic microorganism capable of causing disease, preferably selected from pathogenic bacteria, viruses, protozoa, or fungi, most preferably pathogenic bacteria or fungi.

[0102] The term “strain”, as used herein, refers to the lowest taxonomic rank, that is below the level of the species. The term “strain” includes reference to an “isolate” or a group of isolates exhibiting characteristics that set it apart from other isolates belonging to the same species. The term “polymerase chain reaction (PCR)”, as used herein refers to the well-known in vitro technique to make numerous copies of a specific segment of target DNA from a template DNA - i.e., the DNA that contains the target sequence to be amplified. During the reaction a mixture containing the template DNA, primers, dNTPs, and a heat-stable DNA polymerase is heated to 90-95°C to denature the strands of the template DNA. The solution is cooled to a temperature that allows the primers (single-stranded DNA molecules of about 18 to 30 nucleotides long) to anneal to their complementary sequence on the template DNA and provide the 3'-OH required for DNA synthesis. Subsequently, the DNA polymerase synthesizes a new DNA strand complementary to the target sequence by extending the primer, usually at a temperature of about 72°C. The thermal cycling scheme of denaturing / primer annealing / primer extension is repeated numerous times with the DNA synthesized during the previous cycles serving as a new template for each subsequent cycle. The result is a doubling of the target DNA present in the template with each cycle, and exponential accumulation of target DNA sequences over the course of 20-40 cycles. A heating block with an automatic thermal cycler is generally used for precise temperature control. The method of the invention for example comprises qPCR amplification (also known as real-time PCR), wherein typically the amplification of a targeted DNA molecule is monitored during the PCR (i.e., in real time), using non-specific fluorescent dyes that intercalate with any double-stranded DNA (e.g. SYBR® Green or EvaGreen®), or sequence-specific DNA probes consisting of oligonucleotides that are labelled with a fluorescent reporter for the detection of PCR products in real-time.

[0103] The term “template”, as used herein, refers to the nucleic acid from which an amplicon is generated in a nucleic acid amplification reaction. The template comprises primer binding sites for hybridization of amplification primers. As used herein, the term “target” generally refers to a nucleic acid molecule or nucleic acid sequence that is specifically recognized by primers or probes as described herein. The target of a padlock probe, as described herein, is a nucleic acid the presence of which is to be detected in a biological sample, e.g., for diagnostic purpose, and is generally referred to as the target nucleic acid sequence. The target of an amplification primer, as described herein, is the circularized padlock probe sequence, which serves as a template in an amplification reaction as described herein. The target of a detection probe, as described herein, is the padlock probe amplicon. Hence, various targets as described herein represent various detectable molecules in the context of the present detection assay.

[0104] The term “target sequence”, as used herein, generally refers to the nucleotide sequence within the nucleic acid target that is complementary to the padlock probe, detection probe or primer sequence.

[0105] The terms “nucleic acid target” or “nucleic acid target sequence”, as used herein, are generally used to refer to a nucleic acid the presence of which is to be detected in a biological sample. A nucleic acid target may, for instance, be a nucleic acid encoding a antimicrobial resistance gene, a viral structural or nonstructural protein gene, or a gene encoding a bacterial and fungal ribosomal RNA or internal transcribed spacer (ITS) region between such genes.

[0106] As used herein, the term "primer” or “amplification primer” refers to an oligonucleotide, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product is induced which primer extension product is complementary to a target nucleic acid strand. Such conditions generally include in the presence of different nucleotide triphosphates (dNTPs) and a polymerase enzyme in an appropriate buffer ("buffer" includes one or more buffering compounds at specific pH and ionic strength, optionally comprising cofactors etc.) and at a suitable temperature. One or more of the nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. The term "forward primer" as used herein means a primer that anneals to the anti-sense strand of double-stranded DNA (dsDNA). A "reverse primer" anneals to the sense-strand of dsDNA. An amplification primer is typically at least 10, 15, 20, 30, 40 or 50 nucleotides in length. In some embodiments, primers are preferably between about 15 to about 40 nucleotides in length, and most preferably between about 20 to about 35 nucleotides in length. An optimal length for a particular primer application may be readily determined in the manner described in PCR Technology, Principles and Application for DNA Amplification, Henry A. Erlich (ed.), 1st ed. 1989, Palgrave Macmillan, London.

[0107] As used herein, the term "primer pair" refers to a forward and reverse primer pair (i.e., a left and right, or bidirectional, primer pair) that can be used together to amplify a given region of a double stranded nucleic acid of interest.

[0108] As used herein, the term "probe" refers to an oligonucleotide that interacts with a target nucleic acid via hybridization and facilitates detection of its target DNA due to enhanced detectability, e.g, as a result of comprising a detectable label or as result of being amplifiable. A probe may be fully complementary to a target nucleic acid sequence or partially complementary. The level of complementarity will depend on many factors based, in general, on the function of the probe. Probes are for example labeled or unlabeled, or modified in any of a number of ways well known in the art. A probe will specifically hybridize to its target nucleic acid. Probes are for example DNA, RNA or a RNA / DNA hybrid. Probes are for example oligonucleotides, peptide nucleic acid (PNA), locked nucleic acid (LNA), oligomer of cyclic heterocycles, or conjugates of nucleic acid. Probes may comprise modified nucleobases, modified sugar moieties, and modified internucleotide linkages. Probes are typically at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length.

[0109] The term “padlock probe” is used herein in its art-recognized meaning (Nilsson.et al., 1994, Science 265, 2085–88). Padlock probes are 5’ phosphorylated single stranded DNA fragments (oligonucleotides) consisting of two target-complementary regions, connected by a linker sequence. The padlock probe oligonucleotide thus comprises 3’ and 5’ target-complementary annealing regions, which regions, when end-to-end positioned on a target strand, in combination recognize a complementary target region on the nucleic acid target of interest, wherein said target region consists of a sequence of consecutive or near-consecutive nucleotides. Upon hybridization of these complementary regions to said target region, and when the 3’ and 5’ ends of the linear padlock probe are lined up in complete juxtaposition (optionally preceded by closing of a “gap” between the annealed ends), the ends can be covalently joined by the action of a DNA ligase. Padlock probes are typically synthesised and used in the form of double-stranded gBlocks® (synthetic dsDNA fragments) about 125-3000 bp in length, when using padlock probes in the form of dsDNA, the step of contacting said sample with at least one padlock probe comprises a denaturing step wherein the dsDNA (both the double stranded target nucleic acid and the double stranded padlock probe) are heated (e.g., to about 95°C) and separated into single stranded DNA. Padlock probes may also be synthesised directly as a single stranded DNA. The single stranded padlock probes are then annealed to the single stranded DNA by lowering the temperature to enable the single stranded padlock probes to attach to the single stranded target nucleic acid. The 3’ and 5’ target-complementary annealing regions of the padlock probe are each typically at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length.

[0110] The term “termini”, as used herein, refers to the 3’ and 5’ ends of the linear padlock probe. These termini, when annealed to the target sequence and lined up end-to-end, can be ligated.

[0111] The term “detection probe” refers to a probe used in the method of the present invention comprising a targeting sequence for targeting (i.e. capable of binding to) a complementary nucleotide target sequence in a padlock probe amplicon. A detection probe preferably comprises a detectable label facilitating the direct or indirect generation of a detection signal when the probe target sequence is present in the padlock probe amplicon and the detection probe is hybridized thereto. Typically, the detection signals of different detection probes are individually detectable. At least two detection probes generating different detection signals may be used to detect a single padlock probe amplicon. The combination of at those least two different detection signals can be used to determined the presence or absence of the padlock probe amplicon in a method of this invention. Detection probes may suitably be provided in the form of hydrolysis probes.

[0112] The term “hydrolysis probe”, as used herein, refers to an oligonucleotide labeled with one or more fluorescent reporters at or near the 5' end and one or more quenchers of fluorescence at or near the 3' end (or vice versa) or at other positions in the oligonucleotide. Hydrolysis probes are also known as Taqman™ probes. The background fluorescence of probe is prevented by the presence of the quencher in close proximity. During the annealing step in PCR, both probe and primers anneal to the DNA target. Once Taq polymerase reaches the probe in the extension step, its 5' to 3' exonuclease activity degrades the probe, breaking the reporter-quencher proximity and thus allowing the emission of fluorescence. The amount of nucleic acid present during each amplification cycle is based on the level of the fluorescence signal, while increase in fluorescent signal is directly proportional to the quantity of exponentially accumulating amplicons produced during amplification. Suitable fluorescent reporters (with emission maxima) for use in aspects of this invention are, for instance, 6-FAM (6-carboxyfluorescein, 520nm), TET (tetrachlorofluorescein, 539nm), YAK (Yakima Yellow®, 549nm), VIC (CAS # 1414265-81-8, 554), SUN (Integrated DNA Technologies, 554nm), HEX (hexachlorofluorescein, 555nm), JOE (5'- dichloro-dimethoxy-fluorescein, 548nm), which may be used in combination with quenchers such as TAMRA (tetramethylrhodamine), Black Hole Quencher 1 (BHQ®-1) or Iowa Black FQ (single-quenched) or ZEN-Iowa Black FQ (double-quenched); alternatively, or in addition, suitable fluorescent reporters (with emission maxima) for use in aspects of this invention are, for instance, Cy3® (564nm), ATTO ™ 550 (575nm), TAMRA (583), ATTO 565 (591nm), PET® (595nm), ROX (carboxy-X-rhodamine, 608nm), Texas Red®-X (617nm), JUN® (617nm), ATTO 590 (622nm), ATTO 633 (657nm), LIZ® (655nm), Cy5® (668nm), ATTO 647 (669nm), ATTO 647N (669nm) and Cy 5.5 (710nm) which may be used in combination with quenchers such as Black Hole Quencher-2 (BHQ-2), Iowa Black RQ (singlequenched), or TAO— Iowa Black RQ (double-quenched). All these fluorophores and quenchers are commercially available.

[0113] A detection probe is typically at least 10, 15, 20, 30, 40 or 50 nucleotides in length. In some embodiments, detection probes are preferably between about 15 to about 40 nucleotides in length, and most preferably between about 20 to about 35 nucleotides in length. An optimal length for a particular detection probe in embodiments of this invention application may be readily determined in the manner described in PCR Technology, Principles and Application for DNA Amplification, Henry A. Erlich (ed.), 1st ed. 1989, Palgrave Macmillan, London. The term “molecular beacon”, as used herein, may suitably be used as a detection probe in aspects of this invention. The term refers to a dye-labeled oligonucleotide probe (25-40 nt) that forms a hairpin structure with a stem and a loop. The 5' and 3' ends of the probe have complementary sequences of 5-6 nucleotides that form the stem structure. The loop portion of the hairpin is designed to specifically hybridize to a 15—30 nucleotide section of the amplicon, which section equals the molecular beacon’s target sequence. A fluorescent reporter molecule is attached to the 5' end of the molecular beacon, and a quencher is attached to the 3' end or in close proximity of those positions. Formation of the hairpin brings the reporter and quencher together, so no fluorescence is emitted. During the annealing step of the amplification reaction, the loop portion of the molecular beacon binds to its target sequence, causing the stem to denature. The reporter and quencher are thus separated, quenching is abolished, and the reporter fluorescence is detectable. Because fluorescence is emitted from the probe only when it is bound to the target, the amount of fluorescence detected is proportional to the amount of target in the reaction. Unlike hydrolysis assays, molecular beacons are displaced but not destroyed during amplification due to the use of a DNA polymerase lacking 5' exonuclease activity. Reporter and quencher pairs can be as described for hydrolysis probes.

[0114] The term “degenerate”, as used herein for primers and probes refer to mixtures of similar oligonucleotide sequences that incorporate variations at specific positions to account for the degeneracy of the genetic code.

[0115] The term “isolating”, as used herein in the context of isolating nucleic acid sequences from a biological sample, refers to an in vitro process wherein nucleic acids, preferably DNA or RNA, are extracted from a sample of interest.

[0116] The term “PCR mixture”, as used herein, refers to the small volume of biochemical reactants in aqueous liquid for performing the PCR reaction, preferably comprising the (genomic) template DNA comprising the target DNA sequence(s), a set of at least two oligonucleotide primers that hybridize to opposite strands of the target DNA sequence(s) and flank the region to be amplified, a thermo-stable DNA polymerase, the four deoxyribonucleoside triphosphates (dNTPs), and Mg2+ ions.

[0117] The term “amplification primers”, as used herein, refers to the oligonucleotide primers that hybridize to opposite strands of the target DNA sequence(s) and flank the region to be amplified.

[0118] The terms “amplification product”, and “amplicon”, as used interchangeably herein, refer to a nucleic acid fragment that is the product of a nucleic acid amplification or replication event, such as for instance formed in the polymerase chain reaction (PCR). The term “PCR amplicon”, as used herein, refers to the PCR product or amplified target DNA.

[0119] The term "specific" as used herein in reference to a primer pair or probe means that the primer pair generates no amplicons from, and that the probe does not bind to, any targets other than the target of interest. This is, inter alia, deemed to be the case when the nucleotide sequence of the primer(s) or probe has a high level of sequence identity with a portion of the nucleic acid to be amplified when the primer and the target nucleic acid are aligned. An amplification primer or hybridization probe that is specific for a nucleic acid is one that, under stringent hybridization conditions, hybridizes to the target of interest and not to nucleic acids which are not of interest. Higher levels of sequence identity between the primer and the target are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 85-95% and more preferably at least 95% sequence identity.

[0120] Sequence identity is based on the percentage of identical bases over the entire length of the comparison window when target and primer or probe are aligned, or, preferably, over the entire length of the primer or probe. Sequence identity can be determined using a commercially available computer program with a default setting that employs algorithms well known in the art.

[0121] A non-specific PCR amplicon may result from primers that are not “specific”, as used herein, and is a potential by-product in PCR, consisting of amplified DNA that is not a copy of the target DNA, usually resulting from a-specific annealing (hybridization) of the primer molecules to other, similar or identical, nucleic acid sequences in the template DNA, such as human DNA or non-target DNA in general. A non-specific PCR amplicon exhibits a hrMC that is different from that of the PCR amplicon generated from the target DNA sequence. In addition, a non-specific PCR amplicon may not comprise the DNA target sequence that is to be detected by a specific detection probe as described herein, whereas the PCR amplicon generated from the target DNA sequence will comprise the detection probe target sequence.

[0122] The term “high-resolution melting curve (hrMC) analysis”, as used herein, refers to a post-PCR analysis method used to identify variations in nucleic acid sequences. The method is based on detecting small differences in PCR melting (dissociation) curves. The temperature-dependent dissociation between two DNA-strands can be measured using a DNA-intercalating fluorophore such as SYBR green, EvaGreen or a "saturation dye" (a dye that does not inhibit PCR even if used at concentrations that give maximum fluorescence (saturation)) like LCGreen® I, LCGreen Plus or Cyto9, in conjunction with real-time PCR instrumentation that has precise temperature ramp control and advanced (fluorescence) data capture capabilities. Data may be analyzed and manipulated using software designed specifically for hrMC analysis. For hrMC analysis, software is often included in the qPCR equipment, but can also be obtained from third parties. High-resolution melting curves may be generated by ramping through a temperature gradient with a high level of accuracy (e.g. 0.1 °C or less), and measuring the level of fluorescence of an intercalating dye at each step. A melting curve of an amplicon, as described herein, may for instance be determined by incubating the reaction container following the PCR amplification reaction at 90 °C for 60 s, 40 °C for 60 s and from 65 °C to 95 °C with an increment 0.2 °C for 10 s while performing a readout of the level of fluorescence from said container. The melting temperature of a DNA molecule is determined by nucleic acid sequence and length, and differences in these nucleotide sequences between samples result in melting profiles that are unique to a particular species, even when amplicons are generated using universal primers. Details of the hrMC analysis procedure are well known to those skilled in the art and are for instance described in Reed et al., 2007, Pharmacogenomics 8:597-608; US7,297,484; US7,387,887;

[0123] US7,524,632; US20090117553 and US20100041044, which contents are incorporated herein by reference. The terms “high-resolution melting curve (hrMC)” and “melting curve”, “melting curve profile”, as used herein, may be used interchangeable herein, unless expressty indicated otherwise, and refer to the dissociation curve describing the temperature-dependent dissociation between two DNA-strands, preferably as measured using a DNA-intercalating fluorophore. The high-resolution melting curve may refer to the graph of the negative first derivative of the dissociation curve which makes it easier to pin-point the temperature of dissociation (defined as 50% dissociation between the DNA strands), by virtue of the peaks thus formed.

[0124] In order to determining the presence or absence of said at least one nucleic acid molecule in a sample of interest on the basis of the recorded melting curve of a padlock probe amplicon, it is preferred that use is made in aspects of this invention of a library or database of reference melting curves of padlock probe amplicons, wherein the melting curve profile, signature, peak pattern or peak position is annotated to the nucleic acid molecule that is the target of the padlock probe, such as a resistance gene or a gene to determine the species identity of a microorganism, such as a ribosomal RNA gene or an Internal Transcribed Spacer (ITS) region of ribosomal RNA genes.

[0125] In aspects of this invention, a melting curve is preferably a high resolution melting curve.

[0126] The term “negative control reaction”, as used herein, refers to a post-PCR mixture comprising no PCR amplicon(s) as a result of the deliberate absence of target nucleic acid sequences or target DNA in the pre-PCR mixture.

[0127] The term "quantification cycle" or " Cq" as used herein includes reference to a measurement taken in a real time PCR assay or qPCR assay, whereby a positive reaction is detected by accumulation of a signal, such as a fluorescent signal. The Cq (quantification cycle) can be defined as the number of cycles required for the signal to cross the threshold (i.e. exceeds background level). Cq levels are inversely proportional to the amount of target nucleic acid in the sample (i.e. the lower the Cq level the greater the amount of target nucleic acid in the sample). " Cq" is also known as " Ct" The term “color channel” as used herein generally refers to the output response band of an optical color scanner, such as that employed in commercial real-time PCR machines. Such instruments have three or more discrete channels with photodiodes for detecting fluorescence emitted from the fluorophores in the amplification reaction mixture. In order to separate different fluorescence wavelengths, narrow band filters and dichromatic mirrors are used to allow fluorescence with the required wavelength to reach the corresponding sensor of the channel. If other instruments than PCR machines are used, the term “color channel” refers to the detection signal-specific sensor(s) in that instrument.

[0128] The term "biological sample", as used herein, includes reference to a sample from the body of a human or animal subject, or an environmental sample wherein a nucleic acid target is to be detected. The term includes reference to a clinical sample obtained from a human patient. D

[0129] The term "subject", as used herein is intended to refer to any individual or patient a biological sample of which is to be investigated using a method as described herein. Generally the subject is human, although as will be appreciated by those in the art, the subject may be an animal. Thus other animals, including mammals and birds are included within the definition of subject.

[0130] The term “gene”, as used herein, refers to a polynucleotide comprising a protein-coding or RNA-coding sequence, in general comprising an open reading frame that encodes a polypeptide, including both exon and (optionally) intron sequences, as well as non-coding sequences such as promoter or enhancer sequences. The term "intron" refers to a DNA sequence present in a given gene that is not translated into protein and is generally found between exons. Hence, the gene that may be detected in aspects of this invention includes both DNA and RNA forms of the gene.

[0131] The term “mutation” as used herein indicates an alteration in the nucleotide sequence of a gene, typically resulting from errors during DNA replication or other types of damage to DNA. Mutations can result in insertion, substitution, or deletion of single nucleotides (point mutations) or of segments of DNA. The mutation may be a non-sense, missense, or frameshift mutation.

[0132] Detailed description of preferred embodiments

[0133] The present inventors have developed a multiplexed nucleic acid sequence detection assay that overcomes a number of problems associated with multiplex PCR. The assay method of the invention employs multiple sequence-specific probes, in the form of so-called padlock probes, for detecting target-specific nucleic acid sequences in a clinical sample, and amplification of these probes by a limited number of primer pairs. In the presence of their specific nucleic acid targets, the 3’ and 5’ ends of a padlock probe anneal to their target sequences, which are chosen such that these ends can be ligated. Following specific binding of the padlock probe to its target, the probes are circularized through ligation of the opposite padlock probe ends. Upon circularization of the padlock probe, the circularized probe is amplified, for instance by PCR.

[0134] For the purpose of PCR amplification, the padlock probes comprise at least two regions suitable for at least two bidirectional PCR amplification primers to anneal. Successful amplification of the intended region of the padlock probe is indicative of the presence of the padlock probe-specific target nucleic acid in the sample. The selective amplification of circularized padlock probes over non-circularized padlock probes present in the reaction mixture, may be improved by selective degradation or digestion of non-circularized padlock probes, preferably by using exonuclease activity. The undigested circular padlock probes may then serve as a single-stranded template in a conventional PCR amplification reaction.

[0135] Different target- specific circularized padlock probes may be PCR amplified by the same set of bidirectional PCR amplification primers.

[0136] Following or during amplification the amplified circularized padlock probe sequences may conveniently be selectively detected by using a (q)PCR probe, for the purpose of which the padlock probes comprise at least one region suitable for a PCR probe to anneal. qPCR probes may be used for real time detection of amplified padlock probe sequences during the amplification reaction.

[0137] In addition to having target-specific 3’ and 5’ free end annealing regions, each target-specific padlock probe is provided with its own spacer sequence, the design of which ensures that the melting curve of the amplicon of at least one target- specific padlock probe is distinguishable from the melting curve of the amplicon of at least one other target- specific padlock probe. Hence, the amplicons of the various target- specific padlock probes are distinguishable based on a difference between their melting curve profiles. Following the PCR amplification reaction, the melting curve of the amplicons present in the reaction mixture is determined by performing a DNA melting curve analysis. Because it is an aim of the present invention to provide an assay for detection of multiple target sequences, there may generally be multiple padlock probe amplicons present in the sample. In order to distinguish the melting curve profile from a first padlock probe amplicon from that of a second, different, padlock probe amplicon, use may be made of multiple padlock probe-specific PCR probes, which may differ either in sequence on in their detectable fluorescent label, or both. As indicated, the padlock probes are provided with specific spacer sequences that provide each padlock probe amplicon with a unique melting curve profile. Upon recording of the melting curve of the amplicons in the assay, the melting curves obtained may be compared to a database comprising a collection of reference melting curves for known reference padlock probe amplicons generated using the same set of PCR primers. Following said comparison, the presence of specific target sequences in the sample of interest, to which these padlock probes hybridize, may be determined. The combined information of detection probe signal and melting curve analysis can be used to distinguish and individually detect many targets in a single PCR reaction.

[0138] Now that the target sequence of all detection probes used in combination in a single reaction container can be designed, as they are part of the padlock probe sequence, it is possible also to design a specific combination of probes that is able to very efficiently detect each individual padlock probe amplicon in the reaction, without the need to provide each padlock probe amplicon with a unique probe-binding region. Instead, some padlock probes may be provided with multiple probe-binding regions, and the specific combination of detection probe signals (e.g., blue, green, red) that is obtained from each of the multiple detection probes may then ensure detection of many distinct amplicon sequences. Samples and optional nucleic acid extraction

[0139] In aspects of this invention, the method is performed on a biological sample. In preferred embodiments, a sample is a tissue or bodily fluid collected from a subject. Sample sources include, but are not limited to, a cell, mucus, sputum, bronchial alveolar lavage (BAL), bronchial wash (BW), synovial fluid, blood, blood cells, bodily fluids, skin or skin lesions, cerebrospinal fluid (CSF), urine, vaginal secretion, lymph fluid, mucosa secretion, peritoneal fluid, ascitic fluid, fecal matter, body exudates, plasma, serum, amniotic fluid, or tissue (e.g., biopsy material), pus, saliva, samples taken from the oral cavity, throat or nose, nails or parts thereof. The term "biological sample" also includes reference to environmental samples, such as samples of sewage treatment plants, rivers and other water bodies, plants, soil, air, etc. The sample may be processed or unprocessed.

[0140] The isolation or extraction of nucleic acids from the biological sample is not always required. In some embodiments, the sample, or an aliquot thereof, may be used directly in the amplification reaction. In many applications, however, nucleic acid extraction may improve the sensitivity of the assay. The process of nucleic acid extraction or isolation may generally involve, but is not limited to, lysis of a (cells in) biological sample using a guanidine-detergent lysing solution that permits selective precipitation of genomic DNA from a (cell) lysate, and precipitation of the DNA from the lysate with ethanol. Following an ethanol wash, precipitated DNA may be solubilized in either water or 8 mM NaOH and used as template in a PCR reaction. Genomic DNA samples analysis for diagnostic purpose may be obtained by using generally known techniques for DNA isolation. The total genomic DNA may be purified by using, for instance, a combination of physical and chemical methods. Very suitably commercially available systems for DNA isolation may be used, such as the NucliSENS® easyMAG® nucleic acid extraction system (bioMerieux, Marcy 1'Etoile, France) or the MagNA Pure 96 System (Roche Diagnostics GmbH, Mannheim, Germany). RNA isolation and purification procedures preferably take place in the presence of RNase inhibitory agents, such as guanidine salts, sodium dodecylsulfate (SDS), or phenol-based compounds that are designed to lower the risk of RNA degradation in a sample. Suitably, use may be made of organic extraction methods for RNA preparation, comprising homogenization of the sample in a phenol-containing solution followed by centrifugation. During centrifugation, the sample separates into three phases: a lower organic phase, a middle phase that contains denatured proteins and gDNA, and an upper aqueous phase that contains RNA. The upper aqueous phase is recovered and RNA is collected by alcohol precipitation and rehydration. Very suitably commercially available systems for RNA isolation may be used, such as the Tempus™ Spin RNA Isolation Kit (Thermo Fisher Scientific Inc.). Prior to PCR, the RNA is preferably reverse transcribed into cDNA using a reverse transcriptase enzyme.

[0141] Nucleic acid target sequences to be detected

[0142] In aspects of this invention, the nucleic acid sequence to be detected in the biological sample may be an antimicrobial resistance gene or nucleic acid transcript thereof. Preferably, said antimicrobial resistance gene targets is a gene presented in table 1. A particular group of interest include the genes that encode proteins that confer resistance to the betalactam antibiotics such as penicillins, cephalosporins, and carbapenems. A non-limited list of antimicrobial resistance genes (with exemplary GenBank accession no.) that may be detected in aspects of this invention include the beta-lactamases genes blaTEM (KT867019.1), blaSHV (NG_050001.1), blaCTX-M (KT867021.1), blaKPC (NG_049250.1), blaIMP (MK388919.1), bl VIM (NG_062231.1), blaOXA (NG_056183.1), blaNDM (KY524489.1), and cfxA (FJ875532.1). Further antimicrobial resistance genes of interest include the (fluoro)quinolone resistance genes gyrA (KX819743.1), gyrB (EU014648.1), parC (MH933957.1), parE (MH933958.1), qnrA (DQ356006.1), qnrB (EF634464.1), qnrC (NG_048054.1), qnrD (HM056769.1),,qnrS (MT335866.1) and oqxA (MG028669.1), the methicillin resistance genes mecA (OM574584.1), mecB (NG_047954.1), mecC (KT192641.1) and mecD (NG_054960.1), the glycopeptide / vancomycin resistance genes vanA (MG460318.1), vanB (NG_048341.1), vanC

[0143] (NG_ 048353.1), vanH (NG_055635.1), vanR (NG_055631.1), vanS (NG_055632.1), vanW (NG_055634.1), vanX(NG_048481.1), vanY (NG_055633.1), the aminoglycoside resistance genes aac(6')-Ib (NG_052506.1), aadE (AY602213.1), aph(3)-IIb (NG_047423.1), and aph(6)-Ia (NG_047459.1), the chloramphenicol resistance genes catD (NG_047622.1) and catP (NG_047623.1), the fosfomycin resistance gene fosA (MG028671.1), the MLS antibiotics resistance genes erm(B) (NG_047794.1), erm(F) (NG_047823.1), lnu(AN2) (NG_047920.1), and msr(C) (NG_048004.1), and the tetracycline resistance genes tet(A) (NG_048148.1) - tet(X) (NG_048306.1). One of skill in the art will appreciate that further antimicrobial resistance gene or nucleic acid transcript thereof may be obtained from such public databases as MicroBIGG-E or ResFinder, using available online browsers (ncbi.nlm.nih.gov / pathogens / microbigge and genepi.food.dtu.dk / resfinder, respectively). Further, one of skill will appreciate that for certain sample types, other screening panels may be used.

[0144] In preferred embodiments of aspects of this invention, the panel of nucleic acid molecules that is to be detected in a sample may comprise at least 2, 3, 4, 5, 6, 7, 8, or more of the above-recited antimicrobial resistance genes. Variants of the above genes are included within the scope of the present invention.

[0145] In alternative, or complementary aspects of this invention, the nucleic acid sequence to be detected in the biological sample may be a virulence gene or nucleic acid transcript thereof. A non-limited list of virulence genes (with exemplary Genbank accession no.) that may be detected in aspects of this invention include the mucoviscosity-associated gene A (mag A) (NC_012731.1), the regulator of mucoid phenotype A (rmpA) gene (NC_012731.1), the Klebsiella ferric iron uptake (kfu) gene (ON921323.1), the type 1 fimbrial adhesin fimH) gene (NC_012731.1), the type 3 fimbrial adhesin genes (mrkDVl) (EU682505.2), and mrkDV2-4 (AY225463.1, AY225464.1, and AY225465.1), the haemolysin (khe) gene (NC_012731.1), the aerobactin (iucC) gene (NC_005249.1), the ferric aerobactin receptor lutA (iutA) gene (AB010890.1), the Panton-Valentine leukocidine (PVL) genes lukS-PV and lukF-PV (EU518770.1), encoding the toxins with protein id# ACB12455.1 and ACB12456.1, and the enterobactin synthase component B (entB) gene (Gene ID: 93310910).

[0146] In preferred embodiments of aspects of this invention, the panel of nucleic acid molecules that is to be detected in a sample may comprise at least 2, 3, 4, 5, 6, 7, 8, or more of the above-recited virulence gene. Variants of the above genes are included within the scope of the present invention.

[0147] In alternati ve, or complementary aspects of this invention, the nucleic acid sequence to be detected may be a viral gene or nucleic acid transcript thereof, such as a viral structural or nonstructural protein gene. The viruses to be detected may include adenoviruses, cytomegaloviruses, enteroviruses, herpes simplex viruses, influenza viruses, parainfluenza viruses, rhinoviruses, respiratory syncytial viruses, varicella herpesviruses, and paramyxoviruses (including human parainfluenza virus). Preferably, the nucleic acid target is a gene for a structural or non- structural protein of one of the following viruses: Respiratory Viruses, including but not limited to SARS-CoV-2 (COVID- 19), MERS-CoV, Influenza A and B, Respiratory Syncytial Virus (RSV), Human Metapneumovirus (hMPV), Parainfluenza viruses 1-4, Adenoviruses (various types), Human Rhinoviruses (HRV), Enteroviruses, Coxsackie Virus, Human Coronavirus (229E, NL63, OC43, HKU1), Hantavirus; Gastrointestinal Viruses including but not limited to Norovirus (GI and GII), Rotavirus, Astrovirus, Sapovirus, Adenoviruses (types 40 and 41 for gastrointestinal infections), Picobirna Virus, Hepatitis A virus; Herpesviruses including but not limited to Herpes Simplex Virus (HSV-1 and HSV-2), Herpes B Virus, Varicella Zoster Virus (VZV), Cytomegalovirus (CMV), Epstein-Barr Virus (EBV), Human Herpesviruses 6, 7 and 8 (HHV-6, HHV-7 and HHV-8); Blood-Borne Viruses including but not limited to Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Hepatitis Delta Virus, Hepatitis E Virus, Human Immunodeficiency Virus (HIV-1 and HIV-2), Human T-lymphotropic Virus (HTLV-1 and HTLV-2); Arboviruses including but not limited to Dengue Virus (serotypes 1-4), Zika Virus, Chikungunya Virus, West Nile Virus, Yellow Fever Virus; Viral Hemorrhagic Fevers including but not limited to Ebola Virus, Marburg Virus, Lassa Virus, Bunya Virus, Crimean-Congo Hemorrhagic Fever Virus, Rift Valley fever virus, Alkhurma Hemorrhagic Fever Virus; Central Nervous System (CNS) Viruses including but not limited to Rabies Virus, Nipah Virus, Hendra Virus, Eastern Equine Encephalitis Virus (EEE), Japanese Encephalitis Virus, Tick-Borne Encephalitis Virus, Mumps Virus (can cause meningitis and encephalitis), Usutu encephalitis Virus, St. Louis Encephalitis Virus, Kyasanur Forest Disease Virus, Colorado Tick Fever Virus; Human Papillomaviruses (HPV) including but not limited to HPV high-risk types (e.g., HPV-16, HPV-18, and others associated with cancer); Other Notable Viruses including but not limited to Measles Virus, Mumps Virus, Rubella Virus, Human Boca virus, BK Virus, JC Virus, Parecho Virus, Polyomaviruses (additional types), Monkeypox Virus, Molluscum contagiosum, and Yatapox virus.

[0148] In preferred embodiments of aspects of this invention, the panel of nucleic acid molecules that is to be detected in a sample may comprise a viral gene of at least 2, 3, 4, 5, 6, 7, 8, or more of the above-recited viruses. Variants of these genes are included within the scope of the present invention. In alternative, or complementary aspects of this invention, the nucleic acid sequence to be detected may be a conserved microbial gene preferably, a conserved microbial gene comprising variable and / or hypervariable regions for species identification of the microorganism or nucleic acid transcript thereof. A preferred conserved microbial gene in aspects of this invention comprises a ribosomal RNA gene optionally in combination with a region between ribosomal RNA genes, or an rDNA internal transcribed spacer (ITS) region, preferably at least a part of the 16S-23S rDNA-ITS, more preferably the complete 16S-23S rDNA-ITS region. In preferred embodiments of aspects of this invention, the panel of nucleic acid molecules that is to be detected in a sample may comprise a ribosomal RNA gene or an rDNA internal transcribed spacer (ITS) region thereof from at least 2, 3, 4, 5, 6, 7, 8, or more bacteria or fungi.

[0149] In alternative, or complementary aspects of this invention, the nucleic acid sequence to be detected may be a gene comprising a mutation associated with cancer or nucleic acid transcript thereof. A non-limiting list of genes in which mutations may be detected for cancer diagnosis include ALK, APC, ATM, BAP1, BARD1, BMPR1A, BRAF, BRCA1, BRCA2, BRIP1, CHEK2, CDH1, CDK4, CDKN2A, EGFR, ERBB2, EPCAM, FLT3, G6PD, HOXB13, IFNL3, IGH, KIT, KRAS, MET, MLH1, MSH2, MSH6, MUTYH, NF1, NRAS, PALB2, PDGFRA, PDGFRB, PGR, PIK3CA, PMS2, POLE, PTEN, RAD51C, RAD51D, RARS, RET, ROS, SERPINA1, SMAD4, STK11, and TP53. In preferred embodiments of aspects of this invention, the panel of nucleic acid molecules that is to be detected in a sample may comprise at least 2, 3, 4, 5, 6, 7, 8, or more of the above-recited cancer genes. Variants of these genes are included within the scope of the present invention.

[0150] In alternative, or complementary aspects of this invention, the nucleic acid sequence to be detected may be a gene comprising a mutation associated with a prenatal disorder or nucleic acid transcript thereof. A nonlimiting list of genes in which mutations may be detected for prenatal disorders include CFTR, UBE3A, PTPN11, SOS1, RAF1, BRAF, MAP2K1, MAP2K2, HRAS, GJB2, and STRC. In preferred embodiments of aspects of this invention, the panel of nucleic acid molecules that is to be detected in a sample may comprise at least 2, 3, 4, 5, 6, 7, 8, or more of the above-recited prenatal disorder genes. Variants of these genes are included within the scope of the present invention.

[0151] Nucleic acid target sequence detection

[0152] In aspects of the present invention, the initial detection of a nucleic acid target sequence in a biological sample is performed using a padlock probe (Nilsson et al., 1994, Science 265, 2085-88). Padlock probes are 5’ phosphorylated single stranded DNA fragments (oligonucleotides) consisting of two target-complementary regions, connected by a linker sequence. The padlock probe oligonucleotide thus comprises 3’ and 5’ target-complementary annealing regions, which regions, when end-to-end positioned on a target strand, in combination recognize the padlock probe’s complementary target region on the nucleic acid target of interest. Upon hybridization of these complementary annealing regions to said target region, and when these 5’ and 3’ annealing regions of the linear padlock probe are in complete juxtaposition, they can be covalently joined by the action of a DNA ligase. A suitable amount of ligase is, for instance 0.4 U / pl of Ampligase (Lucigen) or Taq DNA Ligase (New England Biolabs). The ligation of the padlock probe results in a circular DNA fragment, which, due to the helical nature of DNA, is wound around the target strand.

[0153] Optionally, this ligation reaction may be improved by the addition of polymers, such as polyethylene glycol (PEG), preferably PEG-6000 (e.g., in an amount of about 10%). Polymers exert their effect through the excluded volume model, increasing the local concentration of other components. Under such optimized conditions, an assay in accordance with the present invention is able to detect targets in copy numbers as low as 50- 500 copies per reaction or lower. The concentration of the padlock probe can be as low as 1 pM, or even 10 fM. This low concentration allows for the simultaneous addition of many padlock probes (3-1000 or more), each having a distinct target recognition sequence formed by its 5’ and 3’ ends.

[0154] Optionally, in case the nucleic acid target is an RNA target, such as in detection of an RNA virus, the reaction mixture for performing the ligation reaction can be supplemented with a Reverse Transcriptase enzyme, in order to generate cDNA from said RNA target. One of skill will understand that such reactions require the usual reactants, including dNTPs and an initiation primer for the reverse transcription reaction for each target.

[0155] In case that original concentration of the nucleic acid molecule that is to be detected in a sample very low, it is possible to perform an initial nucleic acid amplification step prior to padlock probe annealing. Optionally, therefore, the reaction mixture for performing the ligation reaction can thus be supplemented with target- specific amplification primers for the nucleic acid molecule that is to be detected, in combination with a polymerase and dNTPs. This can be used to boost the sensitivity of targets where the padlock probe alone lacks sufficient sensitivity. In order to circumvent primer dimer issues and physical interference with the ligation reaction, such initial amplification primers are preferably added in limiting concentrations, in the range from 0.1 to 50nM. This can increase the sensitivity of the assay for certain padlock probes from -1000 nucleic acid molecules per assay to -20 nucleic acid molecules per assay that can be detected.

[0156] Mutation detection

[0157] A mutation-specific padlock probe may be designed with nearly -identical target sequences as that used for the non-mutated variant of the nucleic acid target, wherein preferably the last nucleotide(s) at the 3'-end of the padlock probes differ(s) depending on the genotype of the mutation to be detected. Mismatches at this position are not accepted by the DNA ligase used (no circularization occurs), and single nucleotide differences, such as point mutations, can thus be efficiently discriminated from wild-type, nonmutated, sequence, and may thus be detected.

[0158] Specific amplification

[0159] The newly formed circular ligated padlock probes are amplified in order to ease their detection. This may be accomplished by a nucleic acid amplification reaction using the circularized padlock probes as circular DNA template. A preferred such reaction is a PCR reaction. Even though the expected PCR amplicon is only produced from circularized ligated padlock probes, due to the fact that non-circularized padlock probes result in aberrant amplicons in the form of short unspecific amplicons as they still contain primer binding sites, the presence of unligated padlock probes that have found no target or are not ligated may result in background noise. Therefore, the PCR reaction is preferably supplemented with exonuclease proteins (Exonuclease I and Exonuclease III), in order to digest linear nontemplate DNA (e.g. unligated padlock probes), while leaving the circular padlock probes untouched. It was found that the concentration at which these exonucleases are to be used may differ depending on the type of exonuclease. The exonuclease is used in an amount sufficient to digest linear non-template DNA that remains in the reaction mixture following the ligation reaction. Exonuclease I is preferably added at a relatively high concentration (>0.4 U / pL), whereas Exonuclease III is preferably added at a low concentration (<0.1 U / pL) as this enzyme shows some non-specific activity at increased concentrations. In order to protect the primers and detection probes from the exonucleases in the reaction mixture, the amplification primers and detection probes are preferably protected by the introduction of phosphorothioate bonds and / or locked nucleic acid (LNA) bases. It was found that very suitably, and thus preferably, phosphorothioate bonds, such as for instance 1-10 or more, are introduced into the primers and / or probes to reduce the activity of the exonuclease on these oligonucleotides. In the case of use of Exonuclease I or III, and preferably for primers, such phosphorothioate bonds or LNAs are preferably provided at the 3’ terminus of the primers and / or probes. Alternatively, in the case of probes and Exonuclease I, molecular beacons may be used as these are more resistant to Exonuclease I degradation in their unbound hairpin state. LNA may also be introduced into molecular beacons. It was found that very suitably, and thus preferably, a combination of phosphorothioate bonds and one or more, preferably three, consecutive LNA bases are introduced in the detection probes at the 3’ terminus. One of skill will understand that it is essential that the exonuclease is only added to the reaction mixture after padlock probe ligation. It is preferred that probes and primers present in the reaction mixture upon addition of exonucleases are protected from degradation as described above.

[0160] It was found that the optional use of exonucleases directly in the PCR reaction mixture, in contrast to an exonuclease treatment as a separate third step in the protocol, to digest linear DNA (after padlock probe ligation) provides for an assay that is very easy to perform, that the optional use of exonucleases further increases the reproducibility and sensitivity of the assay, and that the optional use of exonucleases reduces the chance of crosscontamination as reaction tubes have to be opened less frequently for the addition of further reaction components. Furthermore, this approach avoids diluting the sample each time a new assay step is initiated, as this normally comes with addition of buffer as well as enzymes.

[0161] To further improve the amplification of the circular DNA template, an initial short rolling circle amplification (RCA) reaction may optionally be performed on the circular DNA template in the reaction mixture in advance of the PCR amplification step. During this optional reaction step, a strand-displacing polymerase amplifies the circular DNA template, which yields linear concatemers from the circular DNA template. Preferably the RCA reaction results in a linear concatemer that contains numerous repeats that are complementary to the circular template. The RCA reaction may be allowed to proceed for between 5 seconds - 5 minutes, preferably about 45 seconds. Apart from multiplying the initial template concentration for PCR, this optional short rolling circle amplification (RCA) reaction generates linear DNA which is a preferred target for PCR amplification. Regular DNA polymerase used in PCR reactions exhibits 5’ exonuclease activity, which could digest the newly synthesized DNA upon reaching the 5’ end of the primer from which the DNA replication was initiated. In addition, an initial RCA step to produce a linear DNA template comprising the padlock probe sequence precludes or alleviates the problem of physical interference between actual target DNA and padlock probes annealed thereto, as the padlock probe is wound around the target, giving steric hindrance and less efficient amplification. However, it is to be understood that the above pre- amplification of the circular template by RCA is optional in methods of this invention. Suitable strand-displacing polymerases for use in RCA include phi29 DNA Polymerase, Bsu DNA polymerase (Bacillus subtilis), Bst DNA polymerase (Bacillus stearothermophilus) and or Bst DNA polymerase derivatives, such as Bst2.0 or Bst3.0, Klenow fragment (exonuclease deficient) of DNA polymerase I, Deep Vent (exo-) DNA polymerase, and Vent (exo-) DNA Polymerase, preferably BST DNA polymerase.

[0162] In a highly preferred embodiment of a method of the present invention, the method comprises (i) exonuclease digestion of linear DNA upon generation of circularized padlock probes, (ii) rolling circle amplification of circularized padlock probes to generate rolling circle product and (iii) PCR amplification of said linear rolling circle product. The three different reactions (exonuclease, RCA, PCR) are preferably separated through the use of different temperatures. The strand-displacing polymerase used in RCA may be inactivated at lower temperatures (<45 °C) by a reversibly-bound aptamer. Such aptamers are conventionally used in the so-called “hot start” and “warmstart” DNA polymerase mixtures (e.g. as available from New Engeland Biolabs). The DNA polymerase used for PCR may, for instance, contain a chemical hot-start modification, which is activated at 95 °C. The qPCR program may suitably consist of three major phases. First, an incubation comprising an exonuclease treatment may be performed (e.g. 0.4 U / pL Exonuclease I, 10 min, 37-45 °C). Next, an incubation comprising a rolling circle amplification (RCA) reaction may be performed (e.g. Bst2.0 WS polymerase, 0.5-5 min, 60-70 °C) during which concatemers of the padlock amplicon sequence are formed. Thereafter, PCR is performed using a DNA polymerase. Suitable DNA polymerases may be selected from the group comprising E. coli DNA polymerase, Klenow fragment of E. coli DNA polymerase I, T7 DNA polymerase, T4 DNA polymerase, Taq polymerase, Pfu DNA polymerase, Vent DNA polymerase and sequenase. When using a heat-activated DNA polymerase, an incubation comprising a hot-start activation step (e.g. 1-10 min, 95 °C) may be performed to activate the DNA polymerase used for PCR amplification, while simultaneously inactivating the enzymes of the previous two phases (Exonuclease I, Exonuclease III and Bst polymerase), followed by a standard (q)PCR cycling program for PCR amplification. After completion of the PCR amplification, the PCR amplicon may then be analysed. Analysis of the amplicon may include determination of the hrMC, and determination of amplicon-specific detection probe signals. Amplicon analysis may also comprise length determination of the amplicon, preferably using capillary gel electrophoresis.

[0163] Identification of detected target In principle, and primarily, the successful amplification of a padlock probe sequence by PCR following the recognition of the target by the padlock probe, and the detection of padlock probe PCR amplicon, may be monitored by the use of detection probes as described herein. These detection probes may be the same or different for different padlock probe PCR amplicons.

[0164] In aspects of this invention, a detection probe may target a single amplicon, which single amplicon is defined by a unique nucleotide sequence, a unique sequence length, and / or a unique melting curve profile, preferably by all of the above. In alternative embodiments of this invention, a detection probe may target multiple (distinct) padlock probe amplicons, each comprising the same detection probe’s target sequence, wherein said multiple (distinct) padlock probe amplicons have distinct melting curve profiles due to having distinct nucleotide sequences and / or a distinct sequence length, but have a common probe.

[0165] In further alternative embodiments of this invention, at multiple (distinct) detection probes may be used that target multiple (distinct) padlock probe amplicons, each comprising the detection probe’s target sequence, wherein said multiple (distinct) padlock probe amplicons have distinct melting curve profiles due to having distinct nucleotide sequences or a distinct sequence length, and wherein said multiple amplicons are generated through amplification of different padlock probe sequences using one or more sets, preferably one set, of bidirectional amplification primers. The multiple detection probes in aspects of this invention may detect the amplicons of the same or distinct padlock probes, preferably the amplicons of distinct padlock probes.

[0166] In addition to the feature that different amplicons resulting from different padlock probes may be distinguished based on a different profile of their amplicon melting curve, different amplicons resulting from different padlock probes may also be distinguished based on a different detection probe signal. Thus, in embodiments of methods of this invention, use may be made of different detection probes, each detecting a different sequence in a padlock probe amplicon. The padlock probes in aspects of this invention may thus be designed so as to have different detection probe recognition sequences. This allows for a further possibility of distinguishing different padlock probe PCR amplicons, and thus to the possibility of detecting different target sequences in the original sample. The use of different detection probes for padlock probe amplicons with different melting curve profiles may also serve to verify the assay result. Thus, the signal of a specific detection probe (for detecting specific padlock probe amplicons) may be confirmed by the amplicon having the expected melting curve.

[0167] Different detection probes, will generally have different (fluorescent) labels. However, different detection probes may also have the same (fluorescent) label. For instance, a detection probe label providing a signal in the blue channel may indicate the presence of all padlock probe amplicons generated from beta-lactam antibiotic resistance gene sequences as targets in the sample, while a detection probe label providing a signal in the red channel could indicated the presence of all padlock probe amplicons generated from (fluoro) quinolone resistance gene sequences.

[0168] It is a feature of the present invention that the above detection probe-based assay results may be confirmed by amplicon melting curve analysis, which melting curve should correspond to the expected melting curve for the amplicon. Therefore, the presence of the target sequence in the sample is preferably based on both the detection probe signal and the amplicon melting curve profile. The melting curve analysis is suitably performed as part of the PCR program.

[0169] Although aspects of the method of the invention could be performed separately, such as detection of specific padlock probe amplicons solely on the basis of their melting curve, whereby the production of amplicons is verified by use of an intercalating dye, the combined use of melting curve and detection probe signal provides for an increased potential for differentiation between original nucleic acid targets in the sample, and provides an assay with higher specificity.

[0170] Since the PCR does not amplify the original nucleic acid targets, but rather the synthetic padlock probes, the melting curve of these probes can be designed as needed. The melting temperature of DNA is highly influenced by the GC-content of the DNA as well as the local DNA sequence. Melting curves of the original nucleic acid targets could lead to amplicons with messy melt profiles comprising many peaks, or to distinct amplicons having similar melt profiles, as the amplicon sequence and its GC-content can only be changed by designing alternative primers for a different (less-ideal) target site. This can be avoided by using fully designed amplicon sequences as is the case for padlock probes in aspects of the present invention. Since the design of the padlock probes, and thereby also the padlock probe amplicon sequences, can be fully controlled by the design of the spacer sequence, it is possible to obtain sharp single peak melting curves by designing sequences with a homogeneous GC-content, wherein the negative first derivative of the temperature-dependent DNA dissociation curve provides a curve with clearly visible peaks. Additionally, it is possible to distribute the melting curves over a broad temperature range. Another advantage of the use of melting curves of padlock probe amplicons is the lack of biological variation in the amplicons, as a result of which the melting curves are very reproducible, and small distinctions between melting curves may indicate clearly distinct targets. The above advantages provide a virtually infinite number of possibilities to distinguish targets in a sample and to successfully amplify padlock probes for a very large number of targets, each having a distinguishable melting curve.

[0171] The number of detection probes that can be used in methods of this invention for recognizing specific padlock probe amplicons is, in principle, also limitless. The number will only be limited by practical considerations, such as number of detection channels of the instrumentation used. The number of different fluorescent labels that can be used to distinguish such detection probes, may, for instance, be limited by the number of fluorescent detection channels of a PCR instrument.

[0172] However, the number of distinguishable detection signals may be increased by using more than one color channel -specific label per detection probe, or by using at least two detection probes with different detectable label for recognizing a single amplicon. For that purpose, the padlock probe amplicon sequence may be provided with a second annealing site for a second detection probe. Preferably, in embodiments wherein a padlock probe is provided with a second annealing site for a second detection probe, said second detection probe is preferably provided with a second detectable label that is different from that of the first detection probe.

[0173] Combinatorial dense probes

[0174] When using only single target or amplicon-specific detection probes (i.e., probes that detect only one padlock probe amplicon as target), a high number of distinct detection probes in the reaction mixture may be required in order to detect all nucleic acid targets of interest in the biological sample, and all padlock probe amplicons subsequently generated, on the basis of detection probe signals only (i.e., assuming the situation that melting curves of the padlock probe amplicons are indistinguishable). One of skill in the art may design the padlock probes in such a manner that many amplicons generated therefrom will be distinguishable based on their melting curve. However, in the event that certain padlock probe amplicons are indistinguishable, the use of amplicon-specific detection probes may be desirable. Similar to the effect that a high number of distinct primer sets in a PCR reaction may negatively impact the amplification reaction, a high number of distinct detection probes may negatively impact the detection reaction, due to probe interferences, increased background noise, unspecific reactions, etc., hampering accurate identification and detection.

[0175] In order to overcome this problem, and as an alternative to (i) a single target - single probe design, or (ii) a single target - multiple probe design as described above for multiple detection probes detecting a single padlock probe amplicon, use can be made of a probe design concept that is referred to herein as a combinatorial dense probes design. In a combinatorial dense probes design strategy, a panel of multiple detection probes is designed, wherein at least two of said multiple detection probes detect distinct subset selections of (padlock probe amplicon) targets from a defined group of targets that is to be detected, wherein the combination of signals from said probes partitions the defined group of targets into subsets each comprising at least one but preferably multiple targets whereby each target is in one and only one subset, and wherein the target is detected as a member of the subset. This concept is described in detail in co-pending application EP24189592.9 filed on 18 July 2024, the content of which is incorporated herein by reference in its entirety.

[0176] In aspects of this invention, this concept of combinatorial dense probes design is applicable to the padlock probes in the detection of a defined group of nucleic acid target molecules that is to be detected in the sample, as well as to the detection probes in the detection of a defined group of padlock probe amplicon targets that is to be detected among the reaction products.

[0177] Thus, rather than or in addition to using target-specific padlock probes or amplicon-specific detection probes, a combination of multiple probes can thus be designed in such a way that each of the probes detect a subset selection of known sample nucleic acid targets (in the case of padlock probes as described herein) or of amplicon targets (in the case of detection probes as described herein), from a pre-defined group of targets that is to be detected, wherein the detection signals of the padlock probes or amplicon- specific detection probes (whichever is applicable) together form a combinatorial partition of distinct subsets selected from the group of targets of interest and wherein each target from the so defined group is present in one and only one of the subsets.

[0178] In practice, and as an example, 3 distinct detection probes, each labeled with a distinct detectable label (e.g. blue, green, and red fluorescent labels), may be used to detect the presence or absence of 8 distinct (subsets of) target amplicons generated from amplification of circularized padlock probes that are specific to nucleic acid targets in a biological sample, wherein 3 distinct (subsets of) target amplicons are detectable by a single color (blue, green, or red), 3 further distinct (subsets of) target amplicons are detectable by a dual color (blue / green, blue / red, red / green), one further distinct (subset of) target amplicon is detectable by a triple color, and one further distinct (subset of) target amplicon is detectable as not being detected in any of the three color channels. In general, 2ndifferent amplicon targets are detectable by the use of n detection probes.

[0179] Especially in the case that one or more of the selected subsets of target amplicons comprise more than one target amplicon, the combinatorial dense probe design facilitates the detection of a very large number of distinct targets within a biological sample, using only a limited number of detection probes.

[0180] In general, the combinatorial dense probe design in the case of detection probes, comprises the use of at least two detection probes, wherein each of said detection probes detects the amplicon of a distinct selection of at least two padlock probe amplicons generated from a group of at least three target nucleic acids the presence of at least one of which is to be determined in a biological sample, wherein said at least two detection probes comprise a detectable label for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the detection probe target sequence in the amplicon, wherein said combination of said at least two different detection signals partitions said group of at least three target nucleic acids into distinct subsets wherein each target nucleic acid of said group of at least three target nucleic acids is in one and only one of these distinct subsets, and wherein the total number of detection probes is smaller than the number of distinct subsets.

[0181] In exemplary embodiments of aspects of this invention, 3 detection probes may be used for detecting the presence or absence of 8, preferably 7, distinct (subsets of) padlock probe amplicons, each indicating the presence of distinct (subsets of) target nucleic acid sequences in said biological sample. The presence or absence of 7 distinct (subsets of) amplicons is preferred for reasons that the one distinct (subset of) target amplicon that is not labeled by any of the detection probes, although detectable by other means, is not detected in the detection probe panel.

[0182] In further exemplary embodiments of aspects of this invention, 4 detection probes may be used for detecting the presence or absence of 16, preferably 15, distinct (subsets of) padlock probe amplicons, each indicating the presence of distinct (subsets of) target nucleic acid sequences in said biological sample.

[0183] In general, multiple detection probes for detecting the presence or absence of 2xdistinct (subsets of) padlock probe amplicons, each indicating the presence of distinct (subsets of) target nucleic acid sequences in said biological sample may be used, wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals.

[0184] In alternative embodiments of aspects of this invention, the total number of detection probes needed for detecting each padlock probe amplicon from a group of N padlock probe amplicons is divided over multiple separate reaction containers, that may be analysed in parallel, such that in each separate reaction container the number of distinct detection signals obtained from the detectable labels of the detection probes is no more than x, preferably x-1, wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals.

[0185] The use of combinatorial dense probes allows for the detection and identification of a high number of different target nucleic acids in a biological sample or of a high number of different padlock probe amplicons in a PCR reaction mixture as described herein, either as an individual target or amplicon, or in groups, by the use of a single nucleic acid amplification reaction and the use of a relatively low number of distinct probes. The combinatorial dense probes design is most suitably applied to detection probes as defined herein for the detection of distinct padlock probe amplicons.

[0186] Distinguishable melting curves of padlock probe amplicons

[0187] Now that the melting curves of the padlock probe amplicons can be fully designed, it is possible to create sets of padlock probes of which the melting curves of their amplicons are individually clearly distinguishable. For instance, the melting curve of the amplicons may have a unique profile, or may have one or more unique peaks in the negative first derivative of the dissociation curve. The linking regions of the padlock probe sequence may be designed to have distinct lengths or distinct sequences. It is also possible to produce an in silico melting curve of a particular padlock probe amplicon sequence, and to design other padlock probe sequences around that amplicon that have distinguishable amplicons thereto. It is an advantage of the present invention that it allows for the classification of numerous uniquely distinguishable melting curves. The full number of separate classifications (sample nucleic acid targets to be detected) is thus determined by i) the number of distinguishable designed melting curves (which may be distinguishable on peak location, but which can also be designed to have different complex curves that are distinguishable), times (ii) the number of detection probes used, as these detection probes allow for the classification of amplicons that are indistinguishable based on melting curve. It should be noted that a first PCR channel may be dedicated towards the use of an intercalating dye used to perform the melting curve analysis. Modern qPCR instruments contain up to six or more separate channels for fluorescence detection, leaving 5 or more channels available for detection probe-based detections. Taking into account that a) padlock probes can be designed with relative ease that give amplicons with well- distinguishable peaks in their melting curves (see Figure 2), b) that padlock probes can be designed with relative ease that give amplicons with more complex melting curves, and c) that the use of detection probes for amplicons with indistinguishable melting curves allows for even further expansion of the multiplex analysis, it is clear that the method of the present invention opens new perspectives in multiplex detection. The use of a coding scheme in combination with the use of multiple detection probes per padlock probe amplicon allows the detection of 2ndifferent amplicons using only n detection probes. Including the above-described combinatorial dense probe design makes that the number of simultaneously detectable targets is very large.

[0188] Another advantage of a method of the invention is that it increases the total number of sequences that can be detected by mapping different target sequences to the identical detection probe I melting curve outcome. This is possible because both the annealing site for the detection probe, and thus the detection probe itself, as well as the melting curve of the amplicon, can be designed. The number of color channels needed, for instance, may be reduced considerably when detecting similar phenotypes that are based on distinct genotypes at a single color channel. For instance, in the case of antimicrobial resistance, it is of less interest which genotype results in resistance to beta-lactams. A single detection signal, or a single melting curve profile may be used to detect all phenotypically identical betalactam resistance genotypes. This can, for instance, be used to detect different variations of an antimicrobial resistance gene, producing the same phenotype (CTX-M-11 CTX-M-2), but even for two completely different genes, which could lead to the same phenotype by a different genotype (blaVIM / blaIMP).

[0189] Combination with fragment analysis.

[0190] To further improve the detection of target sequences present in a sample, the length of each of the padlock probe amplicons generated in the PCR reaction may be determined, for instance by using capillary gel electrophoresis. Each padlock probe amplicon, in addition to being recognizable by a detection probe and melting curve in combination, may thus be designed to have a unique length, ranging from about 50-500 base pairs (double stranded) or nucleotides (single stranded), preferably about 130 to 200 bp or nucleotides. For length determination by capillary gel electrophoresis, one of the amplification primers, preferably the forward primer, and preferably only a portion of the forward primer used in the reaction, may be provided with a fluorescent label. The increase in fluorescence in the label-specific PCR channel was found to be negligible. Hence, the use of at least one labelled primer wherein only a portion of that primer used in the reaction is labeled, allows for the determination of the length of the amplicon using capillary electrophoresis. This provides yet further information on the presence of targets in the sample, for example when multiple targets are present and interfere in melting curve and detection probe analysis.

[0191] One of skill will understand that the methods described herein are applicable for the detection of antibiotic resistance genes in bacteria, and for a wide variety of other applications. Wherever there is a need to detect specific nucleic acid sequences, the methods of the present invention could potentially be used, in particular for applications that do not allow for an approach using conserved primer regions. The design of specific panels of padlock probes could be used for different applications. For instance the design of a virus recognition padlock probe panel, or a panel for specific (human) biomarkers, etc..

[0192] It is also conceivable that padlock probes of a large number of different applications are added to the ligation reaction, and that separate PCR amplification are run with unique primer sets for amplifying different padlock probe panels, in order to obtain the identity of the targets present in the sample.

[0193] One of skill will further understand that the methods described herein may be performed using digital PCR (dPCR). This is especially beneficial in the case of complex samples with multiple targets present, as the dPCR reaction is able to separate the PCR bulk reaction into many individual reactions that contain at most a single target molecule, this way multiple targets present will be individually analyzed.

[0194] EXAMPLES

[0195] Example 1 - preferred embodiment for urine samples

[0196] A sample (2.5 pL) or negative control (delta) is mixed with ligation mix (2.5 pL). The final ligation reaction consists of 20 mM TRIS / HC1, pH 8.5, 25 mM KC1, 11 mM MgCl2, 1 mM NAD+, 0. 1% Triton-X, 0.2 ng / pL sheared Salmon sperm DNA, 10% PEG-6000, 1 mM TCEP, 5 ng / pL ET SBB, 0.4 U / pL Taq Ligase and 0.1 pM of each PLP. The reaction mixture is mixed by pipetting up-and-down 5-10 times to fully mix sample and ligation mix. Thereafter the tubes / plate is briefly span down, in order to collect the full mixture at the bottom of the well and positioned in a thermal cycler machine. The following program is run on the thermal cycler: 1 min at 95°C, 20 cycles of 20 sec 95°C, 1 min 55°C, 4 min 50°C, 1 min 65°C and finally a 4°C hold.

[0197] After the ligation reaction is finished, the PCR mixture (20 pL) is added to the reaction. The final concentration of the added ingredients is 10 mM TRIS / HC1, 25 mM Ammonium Sulphate, 650 mM Betaine, 0,5x EvaGreen, 200nM of each dNTP, 500nM of each primer, 200nM of each qPCR detection probe, 0.07 U / pL DNA polymerase, 0.005 U / pL Bst2.0WS polymerase, 0.025 U / pL Exonuclease III, 0.4 U / pL Exonuclease I. The ligation reaction and PCR mix are mixed by pipetting up-and-down 3-5 times to ensure proper mixing, afterwhich the tubes / plate is briefly span down and is placed inside the thermal cycler for qPCR. The following program is run: 10 min 45°C, 45 sec 63°C, 10 min 95°C, 10 cycles of 20 sec 95°C, 30 sec 70°C (1°C decrement each cycle), 30 sec 72°C, 30 cycles of 20 sec 95°C, 5 sec 60°C (with fluorescence recording), 30 sec 72°C, Melt curve recording from 70°C to 95°C with a deltaT of 0.2°C.

[0198] The resulting amplification curves indicate that a target harbouring the detection probe 2 sequence is present in the sample (Figure 4). Furthermore, the melting with a Tm of ~80.5°C indicate that the target present in the sample is either blaTEM or blaSHV, which are mapped to the same output as they both result in resistance against the antibiotics Amoxicillin, Ampicillin, Cephalothin, Piperacillin, Ticarcillin as indicated in the ResFinder database. This result is concordant with the phenotypic standard-of-care results for this clinical sample. This proofs that genotypic results can be obtained much faster with similar results as slow (gold-standard) phenotypic tests.

[0199] Example 2 - preferred embodiment for high sensitivity

[0200] A 0.2 mL bacterial cell suspension of 0.5 McFarland is made, which corresponds to 3x107bacterial cells. This suspension is mixed with 250 pL bacterial shock buffer 1 (inbiome, Amsterdam) and incubated at 95°C, before 25 pL bacterial shock buffer 2 (inbiome, Amsterdam) was added.

[0201] Subsequently DNA was isolated using the EasyMag (Biomerieux) using the instructions of the manufacturer.

[0202] The sample or negative control (2.5 pL) is mixed with ligation mix (2.5 pL). The final ligation reaction consists of 20 mM TRIS / HC1, pH 8.5, 25 mM KC1, 11 mM MgCl2, 1 mM NAD+, 0.1% Triton-X, 0.2 ng / pL sheared Salmon sperm DNA, 10% PEG-6000, 1 mM TCEP, 5 ng / pL ET SBB, 0.4 U / pL Taq Ligase, 0.1 pM of each PLP, 50 pM of each dNTP, 32 nM primer mix and 0.02 U / pL polymerase (if indicated). The reaction mixture is mixed by pipetting up-and-down 5-10 times to fully mix sample and ligation mix. Thereafter the tubes / plate is briefly span down, in order to collect the full mixture at the bottom of the well and positioned in a thermal cycler machine. The following program is run on the thermal cycler: 1 min at 95°C, 15 cycles of 20 sec 95°C, 1 min 60°C, 1 min 72°C, 5 cycles of 20 sec 95°C, 1 min 55°C, 4 min 50°C, 1 min 65°C and finally a 4°C hold.

[0203] After the ligation reaction is finished, the PCR mixture (20 pL) is added to the reaction. The final concentration of the added ingredients is 10 mM TRIS / HC1, 25 mM Ammonium Sulphate, 650 mM Betaine, 0,5x EvaGreen, 200nM of each dNTP, 500nM of each primer, 0.07 U / pL DNA polymerase, 0.005 U / pL Bst2.0WS polymerase, 0.025 U / pL Exonuclease III, 0.4 U / pL Exonuclease I. The ligation reaction and PCR mix are mixed by pipetting up-and-down 3-5 times to ensure proper mixing, after which the tubes / plate is briefly span down and is placed inside the thermal cycler for qPCR. The following program is run: 10 min 45°C, 45 sec 63°C, 10 min 95°C, 10 cycles of 20 sec 95°C, 30 sec 70°C (1°C decrement each cycle), 30 sec 72°C, 30 cycles of 20 sec 95°C, 5 sec 60°C (with fluorescence recording), 30 sec 72°C, Melt curve recording from 70°C to 95°C with a deltaT of 0.2°C.

[0204] The resulting amplification curves indicate that the addition of the pre-amplification protocol (addition of specific primers, dNTPs and polymerase) results in higher sensitivity. The 200 CFU input is barely detectable in the control reaction, where the polymerase is omitted. While in the presence of the polymerase (and specific primers and dNTP’s) even the 25 CFU input is clearly observed. Remarkably, the addition of these preamplification ingredients allows a faster thermocycling program to run.

[0205] Instead of 20 long cycles for optimal sensitivity, 15 short cycles are run, followed by 5 long cycles. During the 15 fast cycles the target gets amplified, while the last 5 slow cycles allow for padlock probe ligation on the pre¬ amplified targets.

[0206] Table 1: Overview of antimicrobial resistance gene targets for a UTI test.

[0207] The PLP sequences of every target are shown, along with its designated detection probe number and intended melting temperature of the resulting amplicon. Each padlock probe (PLP) is synthesized with 5’ phosphate group. For primer and probe sequences, see Table 2,

[0208] | target PLP sequence 5' - 3’ probe | Amplicon Tm TCTTTTTGCCAACCTTTACCATCGAGACTATATGTCCGCAAAA AGACATCGGGCGCTACGCAACAACTAACTTGGGCAAAGCGT CGTTCTGGTAGAAATAAGTGGCGCCACGCACGGTGTGGAAA

[0209] mecA TCCTATTAATATACCCAAACAGATGTAACCACCCCAAGATTTA 1 78,5

[0210] TTCAGCATCGCACGACTAAAATTGCAATGCAACGCGGATGCT GAACTCGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT GGTAGGGTGGCTCGTGAAGATATGTTGCCGCTACAGAATCG

[0211] qnrBl AATGTAGATTGTAATTCGCCAGCTTTTAAAAATGGCATCT 1 79

[0212] AAACTCCCCACAAGAAAGATCGGAGATGTTAAAGACGGGGA GTTTCAGAGGCTACGCAACAACTAACTTGGGCAAAGCGTCG TTCTGGTAGTGCGTGAAAATCGTATTACACTTGCCGCTACAG AATCGTAAAGAAACGAAAGGACTCCAAAAGACCAATCAAAC

[0213] qnrDl GATGA 1 79

[0214] ACCAAAAATTATCGACCTGTGTTCCGACAAGTACGCGCAATT TGGTCATCTTGGCCTACGCAACAACTAACTTGGGCAAAGCGT CGTTCTGGTAGGCCCATCCGCATCGGCATTATACGGTGTGGA OXA- AATCCTATACTTGATACAACTTCCCGCGTAATTTTAAGGGGG

[0215] 24_P2 CCAACTA 1 79

[0216] GGCGGGCAAATTCTTGATAAACAGGATACTTAACATGAGCC GCCCTTCGCGCGCTACGCAACAACTAACTTGGGTTACAAAGC GTCGTTCTGGTAGTGTGCGCTGTTGACAATGTAATTTGTCGC

[0217] blaOXA- ACGGTGTGGAAATCCTAGACCGTTTTAGCAAGTTGAATATAA

[0218]

[0219] 48 GTGCCTCGCCAATTT 1 79,5 GCTTGGTTTGCCCGTTTAAGATTGTATTAACGGCACCCAAGC CTACCCCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCTG

[0220] blaOXA- GTAGCGGCTCGTCAGAGAAAAGTTTACGGTGTGGAAATCCT

[0221] 54 ACTCTTAGACACATGGTTATAGTCGATGCGGGTAAAAAT 1 80

[0222] CCTTGATCAGGCAGCCACCAAAAGTCAAATGTAAAACGCGAT CAAGGCTGAGCGCTACGCAACAACTAACTTGGGCAAAGCGT CGTTCTGGTAGTTGCCCGCCCGTAGATTGATCAAGATACGCA

[0223] blaNDM CGGTGTGGAAATCCTCATTGTAGAGCACTAAACGGACTATTT

[0224] -1 GACTTGGCCTTGCTGT 1 81

[0225] AGAATTAAGCCACTCTATTCCGCCCTCTGTAGTGCCACTGAA CCTTAATTCTGGTGCGGCGCCTACGCAACAACTAACTTGGGC AAAGCGTCGTTCTGGTAGGACCGGCCGCCCGAGATCCAATA

[0226] blalMP- CGCACGGTGTGGAAATCCTAAAGTTGTTATATGTGTTCGCGG

[0227] 1 CATACGTGGGGATAGATTG 1 81

[0228] CAAACACCATCGGCAATCTGGTAAAGCTTGATAACTCCCTCT GCGGTGTTTGACAGGCCCGCCCCTACGCAACAACTAACTTGG GCAAAGCGTCGTTCTGGTAGCTGGCGGATGTCTCGCGCTCAT

[0229] blaVIM- ATAAACGCACGGTGTGGAAATCCTCAAAGGACATCCAAACT

[0230] 1 GAGGTACTTTCGTTGCGATATGCGAC 1 81

[0231] ATGTCCTTGAACAATCTGACTCGGGCCATCGCCGACGCTGCG GACATCTTGGTTGGCTACGCAACAACTAACTTGGGCAAAGC GTCGTTCTGGTAGCGCTGGCTGACCCTACGCCGTACCTACGG

[0232] blaOXA- TGTGGAAATCCTGAGTATTCGTAGGGAAGTGCCTGGCAGTA

[0233] 23 TTGATGAATCACCTGATT 1 82

[0234] GGACTCTATGTGCTTTGTAGGCCAGTATGCTCGCCAGGCGCT ACGCAACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGCCC GCAACCACGCGAGAGAACGGTGTGGAAATCCTGTGCGTAAG

[0235] ant2-l GTACCAAGTTGCATGCGAGCCTGTA 1 82

[0236] CAACCCACATGCTCAAAGAAGCCTCTACGGTTCGCGCTACGC AACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGCCTGCTGC GCGAGAATCACGGTGTGGAAATCCTGTGTACAGCAGAAGAC

[0237] aac6-lf TAGCTGACTTCGAAGCC 1 83

[0238] CCACCACTCGACGATATGAGATCGAACGGCGCCCACGCGGC

[0239] aac6- TACGCAACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGCGC

[0240] 30- AGCCGCATGCCCCTCTAAACGGTGTGGAAATCCTCCCGCATT

[0241] aac6-lb CCGGAAGTGCAGATGCTTCTTCTCCGCC 1 83

[0242] GCGGCGTTATCACTGTATTGCACAGAATAGGCGCGCGCCTAC GCAACAACTAACTTGGGTTACAAAGCGTCGTTCTGGTAGCCG

[0243] blaKPC- GGCACCCGGAATTTACATCGCACGGTGTGGAAATCCTTGTCT

[0244] 2 CCAACACACTCGACTATCAGCAACAAATTGGCG 1 83

[0245] CTCGCATTTTTCCAGAACCACCTTCGTCGATGGAGCGCGCTA CGCAACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGGCGA TGCCCATCCCACTTACTTGCCGCTACAGAATCGCAACCTGTAC

[0246] qnrEl ACAAACGATAAGCGGTTTTCCCACAG 1 83

[0247] TCACCCTGTTCAATGAACTTGCAGTTCGCAGTCTCGCACGTG GGAACGCCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT GGTAGCCGGTTGCGGATGGTACTCTCCAATTGCCGCTACAGA

[0248] qnrSl ATCG G CTCTCC A AC AGTACG AAGTG G C AG CCTTCG ATA 1 83 AAGTTATCCACAACCTGGCCGATTTAAACCGATACCGATGGA TAACTTGGACGCTACGCAACAACTAACTTGGGCAAAGCGTCG TTCTGGTAGGCAGGTCACTCGCATAATGGTTAACGGTGTGG

[0249] blaOXA- AAATCCTACTGACGTTTACGAGAAGAATTTGGTCCCACCAAC

[0250] 50 CAG 1 83

[0251] TCAAATCCTGGCGTGAGAAATCCTCAAGCAAGGGCGCCGCT ACGCAACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGCCC GGGCCCATCCTGAGATATTGCCGCTACAGAATCGGTAGGAG

[0252] qnrAl TCTCATCGGAACTCGAAAACGGCTGTCAC 1 83

[0253] GCCGTTTGAATCGTATTCTGATGCCAAATGTACACCCAAACG GCCTAGCGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTC TGGTAGCGGACCGATACGTCAATTGTGACGGTGTGGAAATC CTCTAATGGATGGTGCTTAACGCATAGCAAAGCAATCGAGA

[0254] aac3-ll AT 1 84

[0255] GTTGATTCCAGATGGCGCTCAATGATCGCGGTTCCCCGCTAC GCAACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGCGCTG

[0256] ant3-li- GCCTTCGCGATTGTAACGGTGTGGAAATCCTCCCGTTTGGAG

[0257] aac6-ll GCAAGTAAAGCACGGCCAGCAAC 1 84

[0258] CAGGGGCAATGGATCAGAGATGATCCAGTGCAGGCGGTGC GCGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCTGGTA GGCGGAGCCTCGCGGATCCAACAGACGGTGTGGAAATCCTG

[0259] aac3-IV AGCGGTGTTGCGAGGAATTCAAGGCGAGTGAGGTGG 1 85

[0260] CGCCAGTTTTAATGGTTGCAGGACAGTGACGCCGGCCGGCG CTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTGGTA

[0261] blaCMY- GGCCGCGCCCACTTGTCACGAATCGCACGGTGTGGAAATCCT

[0262] 2 CCCTGGTAGTGAGTCGCAACGGAACCGTAATCCAGGTATG 1 85

[0263] GATCAGCGCATCGACAAGTGTCTGTATGTGTGCCGCCACACG AGCGCCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCTG GTAGCGGAGCGCGGACCGGCCAGACATTTGGCAGACGGTG TGGAAATCCTAGGCCAACCCCTGCTGCAGAGTCCACACATGC

[0264] aac3-VI CGACGGCCTC 1 86

[0265] TTGCATCCACGTCTTTGGTGTATGAACTTGGTTCGATGGATG CAACAACGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTC

[0266] blaOXA- TGGTAGACACGGCAGCCAATACATGATTTGCCGCTACAGAAT

[0267] 1 CGAAAACTTTGAACTCTCAAGCAACCCAAACAACAGAAAA 2 79

[0268] AATTCGGCGTTCAAGTTGTTCAAGCATTAGTTGCACCGACGA ATTCTGGGGCTACGCAACAACTAACTTGGGCAAAGCGTCGTT CTGGTAGTCCACGGTCCACCTTAAGATATTGCCGCTACAGAA

[0269] blaLAP- TCGTTAAGTTAGCATACTTGACAGCAGGTCATGCTTATTATA

[0270] 1 GGT 2 79

[0271] GCTGTTTGCATACAGACGCATATCGTTATGTATTAATTGCGC AAACAGCATCGCATGCTACGCAACAACTAACTTGGGCAAAG CGTCGTTCTGGTAGCCAGGCGAAACCATTTGTCGTAAATTAT

[0272] blaDHA- TGCCGCTACAGAATCGAGATTGGCTTTCCTTAACCATTGGTA

[0273] 1 TCCAAACAGGCCGATACT 2 79

[0274] TCTGGCGATTTGTTGAAATACGGGATTATATTTTGCCTGCGC

[0275] blaOXA- CGCCAGAACTCTACGCAACAACTAACTTGGGTTACAAAGCGT

[0276] 7 CGTTCTGGTAGCTGCAGCGCCTAAATTAATAGGTTTGCCGCT 2 79 ACAGAATCGCTAAATTGGAATCAACCGAACATTCTTACTTCG CCAACTTC ACCAAAAATTATCGACTTGTGTTCCGAGATTATCGGCAGGCC ACATTTTTGGTCATGCGCTCGCTACGCAACAACTAACTTGGG CAAAGCGTCGTTCTGGTAGCGGCCCTCCGGCTTATCTGAAAT

[0277] blaOXA- TGCCGCTACAGAATCGCAAATTAATAAACGTACTGCCGTAAT

[0278] 279 TTTTAATGGGCCAACTA 2 79

[0279] GGTGAGCAAAAACAGGAAGGCAAAAATTATATGGGTGGGT GCCGCTCACCGGTCTACGCAACAACTAACTTGGGTTACAAAG CGTCGTTCTGGTAGCGTCGACGCTCCAGAAAACTATTCTTTG

[0280] blaTEM- CCGCTACAGAATCGCCATTGCCTACTTGGGAACAATTACATT

[0281] 1A TCACCAGCGTTTCTG 2 80,5

[0282] ATCCTGCTGGCGATAGTGGATCTTTCTGTCTAGAAATTGGTG TCGCAGGATGGAGTCTCCCGCTACGCAACAACTAACTTGGGC AAAGCGTCGTTCTGGTAGCCGCGAGCAAGCGTTAGTATAAT

[0283] blaSHV- ATATTGCCGCTACAGAATCGCCAACCTTTTGAGCCGTTAGAT

[0284] 1 TGATTGCGAGTAGTCCACCAG 2 80,5 gyrA_T8

[0285] 3IACC- TGTCGCCGTGCGGGTGGTACTTACCGAGACTAGTGCAGTGA

[0286] ATC_Ps CTACCGTGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTC

[0287] eudomo TGGTAGCCAGCGCAGGGTAGATCTCAATTGCCGCTACAGAA

[0288] nas TCGAAGTCTCGTCTAGCTACGAGAGGTGTCGTAGACCGTGA 2 81

[0289] AGTCACCATGGGGATGGTATTTACCG

[0290] gyrA_S8 AGACTAGTGCAGTGACTACCGTGCTACGCAACAACTAACTTG

[0291] 3L- GGCAAAGCGTCGTTCTGGTAGCCAGCGCAGGGTAGATCTCA

[0292] D87N_e A TTGCCGCTACAGAATCG AAGTCTCGTCTAGCTACGAGA

[0293] coli CGTGTTATAGACCGTCA 2 81 gyrA_S8

[0294] 3TCC- TTC- AGTCGCCGTGCGGGTGGTATTTACCG

[0295] D87GAC AGACTAGTGCAGTGACTACCGTGCTACGCAACAACTAACTTG GGCAAAGCGTCGTTCTGGTAGCCAGCGCAGGGTAGATCTCA AAC_Kle A TTGCCGCTACAGAATCG AAGTCTCGTCTAGCTACGAGA

[0296] bsiella GGTGTTGTATACCGTGA 2 81

[0297] TATCACCATGAGGGTGGTATTTACCGAGACTAGTGCAGTGAC TACCGTGCTACGCAACAACTAACTTGGG

[0298] gyrA_cit CAAAGCGTCGTTCTGGTAGCCAGCGCAGGGTAGATCTCAA

[0299] robacte TTGCCGCTACAGAATCG

[0300] r AAGTCTCGTCTAGCTACGAGAGGTGTCGTAAACGGTGA 2 81 gyrA_A TATCACCATGAGGGTGGTATTTACCGAGACTAGTGCAGTGAC

[0301] CT- TACCGTGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT

[0302] ATT_Ko GGTAGCCAGCGCAGGGTAGATCTCAATTGCCGCTACAGAAT

[0303] xytoca CGAAGTCTCGTCTAGCTACGAGAGGTGTCGTATACGGTAA 2 81 gyrA_S8 TGTCCCCATGGGGGTGATATTTACCCAGACTAGTGCAGTGAC

[0304] 3I_AGT- TACCGTGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT

[0305] ATT_Efa GGTAGCCAGCGCAGGGTAGATCTCAATTGCCGCTACAGAAT

[0306] ecalis CG AAGTCTCGTCTAG CTACG AG ATG ATTCGTAAATCGTAA 2 81 gyrA_S8 TGTCACCGTGCGGGTGATATTTACCGAGACTAGTGCAGTGAC 3IAGT- TACCGTGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT

[0307] ATT_Pro GGTAGCCAGCGCAGGGTAGATCTCAATTGCCGCTACAGAAT

[0308] teus CGAAGTCTCGTCTAGCTACGAGACGTTTCATAGACAGTAA 2 81 gyrA_S8 AGTCACCATGAGGGTGATATTTACCCAGACTAGTGCAGTGAC

[0309] 4LTCA- TACCGTGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT

[0310] TTA_Sa GGTAGCCAGCGCAGGGTAGATCTCAATTGCCGCTACAGAAT

[0311] ureusSs CGAAGTCTCGTCTAGCTACGAGACCATTGCTTCATAAATAGG

[0312] ap TA 2 81

[0313] CGAGAAAATAGTACGACGCCCCTTCTTAGTGCCCACGCCGCT ACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTGGTAGC GCCCGGCCGCTCCCTAATAACGTGGTGTTTGATGGGCTCTCC

[0314] fosA3 TGTCGAGTCCAGTTCGAATATGGCCGTCAGGGT 2 82

[0315] ACCATAGCTTTGTTGAGTTTGGCCTGGTTCTTGCCTCGTTGTC ACTATGGTCTTGGCGGCGGCTACGCAACAACTAACTTGGGC AAAGCGTCGTTCTGGTAGGCGGCGCACGGCGTAGCTTTATTT

[0316] blaOXA- GCCGCTACAGAATCGCATAATCTCTACACTGGACCACAGCAC

[0317] 51 GAGCAAGATCATT 2 82

[0318] CGCAAAACGTTCATCAGCACGATAACTGGACTTCGCGGTTTT CCGCTACGGCTACGCAACAACTAACTTGGGTTACAAAGCGTC

[0319] blaRAH GTTCTGGTAGCCCGCCGTCGTTCGAGATTCTTTTGCCGCTACA

[0320] N-l GAATCGCTAAATGGAACCGATCTGCTTACTGGTGCTGCACAT 2 82

[0321] TACTGCACATGGGGAAAGGTTCATCGTGTATAGCACGCGGC GCCGCGCCCTACGCAACAACTAACTTGGGCAAAGCGTCGTTC TGGTAGGCCGGCCGCACACGGTTCTATTACTTGCCGCTACAG

[0322] blaCTX- AATCGCACAGGAGGTGAGTAAGCTAGCTACGCCATCACTTTA

[0323] M-151 CTGG 2 83,5

[0324] AAGGTTACCACTTGTATACGTCGCGTGCACGCCCGGCTACGC AACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGCGGCCCT

[0325] blaADC- GCGCTAGTATTTGCCGCTACAGAATCGCAAGTGCAACTCGTT

[0326] 25 GGTCTGGAAATTGCAAGGC 2 83,5

[0327] GCGATATCGTTGGTGGTGCCATAGATATGCGCGCCGCTACG CAACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGGCGCCG

[0328] blaCTX- CGGCCTTAATGTTTGCCGCTACAGAATCGCATTCATGCTCCA

[0329] M-l AGGGTGCTTTTGGCCAGATCACC 2 83,5

[0330] CCGCCTGTTTCAGCTTATACGAGAATTAGTGCCCACGCCGCT ACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTGGTAGC GCCCGGCCGCTCCCTAATAACGTGGTGTTTGATGGGCTCTCC

[0331] fosA7 TGTCGAGTCCAGTTCGAATTTCCAGACCGTCACTC 2 84

[0332] CCGCTACTGAGGCAATCCCTGCAAACATTTCCGCGTAGCGGG GCCGGGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT GGTAGGCCGCATGGCCGCGAGCTAGGAATTTTGCCGCTACA

[0333] Candida GAATCGGCGCGTCGTGTTCCTACTTGACTGTCTTTTGCCGCTT

[0334] sp. CACTCG 2 85

[0335] CGCCAGTTTTAATGGTTGCAGGACAGTGACGCCGGCCGGCG CTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTGGTA

[0336] blaCMY- GGCCGCGCCCACTTGTCACGAATCGCACGGTGTGGAAATCCT

[0337] 2 CCCTGGTAGTGAGTCGCAACGGAACCGTAATCCAGGTATG 2 85 TGCTTGACCACTTTTATCAGCAACCACTTGGTTCGATGGATGC AACAACGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT GGTAGACACGGCAGCCAATACATGATTTGCCGCTACAGAATC GAAAACTTTGAACTCTCAACATCATTTCTAGAAGCATATGTTA

[0338] blaZ T 2 87

[0339] ACGAATATTTAATTTCGCTTCTAGGAGGCTTCTAAACTAATAT TCGTCTATCGGCGGCCCCACTACGCAACAACTAACTTGGGTT ACAAAGCGTCGTTCTGGTAGGGCAACGTCAATCTTATTACGT GGTGTTTGATGGGCTCATAAGTTTGCGGAAATTGTAAATGCT

[0340] fosB3 ATATGAGTAT 3 77

[0341] TTTAAGTATCCAAGAGAAACCGAGCGTGCGGCGGCACACAT ACTTAAACAGGTCAACTACGCAACAACTAACTTGGGTTACAA AGCGTCGTTCTGGTAGGCCGAATTGTCAGCAACTATGTAACG TGGTGTTTGATGGGCTCAATTACCTGGTATGATCTGCTTGGA

[0342] tet(M) CTGCATTTTGAAATGATTGA 3 78,5

[0343] GCGATTTGGAAGAACACCCATAGAGCGGGATACTTGCTGGT CGACAGGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGT TCTGGTAGCCCTGGCCACATGTTCATCGTGGTGTTTGATGGG

[0344] dfrA17 CTCATTAGTACAACCAGTTGATCTTTGACACTACTGCATATTT 3 80

[0345] TCTGGCTCGGAATCTATTGTCGAGACGGGATACTTGCTGGTC GACAGGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTT CTGGTAGCCCTGGCCACATGTTCATCGTGGTGTTTGATGGGC

[0346] dfrA27 TCATTAGTACAACCAGTTGAGGAAAGAAAACATTGCCC 3 80

[0347] ACATTTTCTCAACATATGGTAGAAACAACGGGATACTTGCTG GTCGACAGGCTACGCAACAACTAACTTGGGTTACAAAGCGTC GTTCTGGTAGCCCTGGCCACATGTTCATCGTGGTGTTTGATG GGCTCATTAGTACAACCAGTTGAAATTCGTAATGAATTTTTGT

[0348] dfrK AATGT 3 80

[0349] GCCTTTCCCGAATCCCAACTTAGAACGGGATACTTGCTGGTC GACAGGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTT CTGGTAGCCCTGGCCACATGTTCATCGTGGTGTTTGATGGGC

[0350] dfrA19 TCATTAGTACAACCAGTTGAATTTCCATGGAATCTTGCC 3 80

[0351] CCATTCCCGATAACTCCATTCTTCGGGATATTTGCTGGCCGGA CGGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTG GTAGCCCTGGCCACATTTTCATCGTGGTGTTTGATGGGCTCA

[0352] dfrAl TTAGTACAACCAGTTGACACTCCATGGAATATCAGGG 3 80

[0353] GTACCTCAGATAGAAAGACGCCGTCTATATAATCCTGGTGAG GTACCTACGGGACCTACGCAACAACTAACTTGGGCAAAGCG TCGTTCTGGTAGCGGTGGTGGATAATGTTGTTTCGTGGTGTT TGATGGGCTCTAAACAAGGTAGAAGGTTAAACCCTCGAAGG

[0354] dfrAl 3 TTTGAT 3 80

[0355] TTTTCTTCCGACAAGAAGCCACTGAAGAAACCGGGGAAGAA AACTGCGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGT TCTGGTAGCCCGCGCTGGTTATATACGTGGTGTTTGATGGGC

[0356] dfrA29 TCTATAACAAACCAGACACAATACCCATTGACTCAAATGT 3 80

[0357] CAACCAATCACTCCGTTTTTCGCTTATTAATTGAGTACTTGGT TGGGCGTGCGCTACGCAACAACTAACTTGGGCAAAGCGTCG

[0358] dfrA14 TTCTGGTAGTGTCGGCCGGAGGTATATATAGTTTCGTGGTGT 3 80 TTGATGGGCTCTTTCAGTGAGCAGATGATGTTTCATGGGTAT GTGTGGACCG TCACAACCATTAAAGGTGAACCCCTATAGAGTTACCGACGGC ACGCGGTTGTGACTTCTACGCAACAACTAACTTGGGTTACAA AGCGTCGTTCTGGTAGCCCGCCCGCTGATTTTATTGCGTGGT GTTTGATGGGCTCATAAGAGACAGAGATCTTCTATTGAATGG

[0359] dfrG ACGATT 3 80

[0360] TCACCCTGTTCAATGAACTTGCAGTCCTCAGTTCTAATGGAG GGTGACATGCGCCGCGCTACGCAACAACTAACTTGGGCAAA GCGTCGTTCTGGTAGCCGTGCGCGAAACTTAAAACGTGGTG TTTGATGGGCTCAGATCTGACTCGTCTATGTGGCAGCCTTCG

[0361] qnrSl ATA 3 81,5

[0362] TCAAATCCTGGCGTGAGAAATCCTCTAATTGGCCACACGTGC GCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTGGT AGGCGGTGGCCTAATAAGTCGTGGTGTTTGATGGGCTCTAT

[0363] qnrAl GTATGGTCTCCCTTCGAAAACGGCTGTCAC 3 81,5

[0364] TATTCATAAAGCTTGCGCCGCGAAACGATCGTATGTAGCACG ATTATGAATACACGCGCCCGCTACGCAACAACTAACTTGGGC AAAGCGTCGTTCTGGTAGGCCCCAGACGTTGTGTATACATCC GTGGTGTTTGATGGGCTCTGGACTATTGAGGTGGCAGACAT

[0365] qnrBll GCGCGTGGTGATCA 3 81,5

[0366] TGTAGATAGACACCGTTCTCACCCAAATCAACGCGGCCGGCC GGACGTGACACGACTACGCAACAACTAACTTGGGCAAAGCG TCGTTCTGGTAGGGGCGCGCGGAGATGCTTCGGCTGTTTCAT CGTGGTGTTTGATGGGCTCACTTTCTCCGTTTAGCTAAGTCGT

[0367] mcr-1,1 CCAGAGAGGCATTTGGCATACCA 3 83

[0368] CTGCTGATAAAACGCCACGCTCTTAGTGCCCACGCCGCTACG CAACAACTAACTTGGGTTACAAAGCGTCGTTCTGGTAGCGCC CGGCCGCTCCCTAATAACGTGGTGTTTGATGGCCTCTCCTGT

[0369] fosA5 CGAGTCCAGTTCGAACGTCATGCCCAGCAG 3 84,5

[0370] CCGTCCGGGTCGAGAAAATAGAATCATGGCGGCGGCGCGCT ACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTGGTAGG CGCGCCCTCGATAGGACAGACTCGTGGTGTTTGATGGGCTCT

[0371] fosA2 GCCACAGTCACTGCATGATGAAGCTCCAGCTTGTGC 3 84,5

[0372] CTTGGATATCGTTCAGGTAGCCCACATCGTGAGTCCGCGGCC GACGGCCGGCCTACGCAACAACTAACTTGGGTTACAAAGCG TCGTTCTGGTAGCCCCGAGCCGGCGGACCTGGAACAGATCG TGGTGTTTGATGGGCTCGTTGGACACCCCTAAGTGGCGCGC

[0373] sull AGGGTCAGGAAATC 3 85,5

[0374] GAAACAGACAGAAGCACCGGCAAATGCCTAGGAAGGTTGCC CCGCGGCGGGCTACGCAACAACTAACTTGGGCAAAGCGTCG TTCTGGTAGGCGGCGGGCGGGCCATTGAGCAGATACGTGGT GTTTGATGGGCTCGTGGTCTCCCAGATCCCACAGCTGGCAGA

[0375] sul2 AAGGATTTGCGC 3 85,5

[0376] TCGTCAATTCCTGCATGTTTTAAGGAGTTTTGTGGCGGCCAA GCCGGCGCTACGCAACAACTAACTTGGGCAAAGCGTCGTTCT GGTAGCTGACAGCGAACATTAATATCGGGGTTCGGCGCTTA

[0377] erm(C) CTTTATGGGTAGTTTTCGTTGTTCAAAGCTAATATTGTTTAAA 4 78 GAGCAACCCTAGTGTTCGGTGAATATTAATGTTCACAATAAG TTGCTCCAAACGCGCCCTACGCAACAACTAACTTGGGTTACA AAGCGTCGTTCTGGTAGACTGGCTACGATATAGCCAAGATAT CTATACGGGGTTCGGCGCTATACAAATCTTCAAGACGAAAAG

[0378] erm(B) TTCTAATGAGACTTGAGTGTGCAA 4 78

[0379] TTCAAAG CCTGTCG G AATTGGTTTTTAG GGTCATATGAAGCTTTGAAGGGTCGTGCCTACGCAACAACTA ACTTGGGCAAAGCGTCGTTCTGGTAGTATAAAACAGGTGGC CGGGGTTCGGCGCTTTATATTAATACTTCGTTACG

[0380] erm(A) ATATTAGTGACATTTGCATGC 4 78

[0381] CTGAGATAGCTTTCTCCTGCTGAGCTGAAAAGGCAAAAGTCA TAATCACTATCTCAGACCCACCCGGCCGCTACGCAACAACTA ACTTGGGCAAAGCGTCGTTCTGGTAGGCCCGGCTTTTCCTAT TAACTCATTTTCGGGGTTCGGCGCTATGTTATACTTGCACAGT

[0382] ere(A) TATGCACAAGCTTCAATCTGGTTACCC 4 79,5

[0383] CAGGTCCGCCAATTTCTCTCAGTAACACGATACTTGCTAGTTG ACAGGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTC TGGTAGCCATGTCCACATGTTCATAGGGTTCGGCGCTCATTA GES GTACAACCAGTTGAAATACTGCGTCATTGCAG 4 80

[0384] GTGGTTTCGACCATCCACTTCCATACACAGTACTTGTCAGTTG ACAGGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTC TGGTAGCCGTGTCTACATGTTTATAGGGTTCGGCGCTACTTA PER GTACACACAGTTAACGCTCTGGTCCTGTG 4 80

[0385] GCAAATCTTGGTCTTGATTGTGGCCAAATGTCTTAGCGGAAG ATTTGCACTGACGCTACGCAACAACTAACTTGGGCAAAGCGT CGTTCTGGTAGCAGCTCCTCGTGGATCTAACTATAGTAGGGT TCGGCGCTATTTACGACAATCGGAAGAATGTTTTCCGCATTG OXA-2 CTGATC 4 80

[0386] CCACTTCGCCGACAATCAAATCATCACATCCCCAATTCCTCGG AAGTGGCTACGGCTGCCGCTACGCAACAACTAACTTGGGCA AAGCGTCGTTCTGGTAGCCAGCGCTATGTAGACTTCTTACGG GGTTCGGCGCTATTGATTGGATCGCAACTATTGCTCAGCCGG

[0387] VanHBX ATTTGAT 4 81

[0388] AAACATATCAACACGGGCAAGACCTGGCATGAAAACGAACA GATATGTTTCAAACGTGGCCGCACGGCCCTACGCAACAACTA ACTTGGGTTACAAAGCGTCGTTCTGGTAGCGCCTCACCGTAT CCAGGAATATCCTTCGGGGTTCGGCGCTTCATTAATAAGTGA

[0389] VanHAX GTGCCGGCCGTTATCTTGTAA 4 81

[0390] AAACATATCAACACGGGCAAGACCTACAAGATAGGGTCGTA TCCGCAGATATGTTTCAAGCGCGCCCGCCTACGCAACAACTA ACTTGGGCAAAGCGTCGTTCTGGTAGGTGCCGCCACCGACA AAATATATAAAGCTCGGGGTTCGGCGCTCATATTTGCAAACA

[0391] VanA CTCTGGAGGTATGACGGCCGTTATCTTGTAA 4 81

[0392] CGGTTCGGTAGCCATCTAATAAGCAAATTATGGCCGTCGCCG GGAACCGCTTCTACGCAACAACTAACTTGGGTTACAAAGCGT CGTTCTGGTAGTTCGTGCCGCGCAATGAGAATTAATCGGGGT TCGGCGCTTATTGAACACCAACGCTTAGATAATACCGTTGCT

[0393] VanXY GCTTTT 4 81 GCGATATCGTTGGTGGTGCCATAGCTGTGTGCATCGCCTACG CAACAACTAACTTGGGCAAAGCGTCGTTCTGGTAGGCACGCT GTCTGTAGGTAGGGTTCGGCGCTCAGTCATGCTCCAAGTGTG CTX-M1 CTTTTGGCCAGATCACC 4 83

[0394] TACTGCACATGGGGAAAGGTTCATCGTGTATAGCATGCGGT GCCGAGCCCTACGCAACAACTAACTTGGGCAAAGCGTCGTTC TGGTAGGCAGGCCGCACACGGTTCTATTACAGGGTTCGGCG CTX-M- CTCACAGGAGGTGAGTAAGCTAGCTACGCCATCACTTTACTG

[0395] 151 G 4 83

[0396] CGCAAAACGTTCATCAGCACGATAACTGGACTTCGCGGTTTT CCGCTACGGCTACGCAACAACTAACTTGGGTTACAAAGCGTC

[0397] bla_RA GTTCTGGTAGCCCGCCGTCGTTCGAGATTCTTAGGGTTCGGC

[0398] HN GCTCTAAATGGAACCGATCTGCTTACTGGTGCTGCACAT 4 83

[0399] CTTCCGTATCTTTTACGCAGCGGTAAATCTTCCACGTGCGCGC CCGCACCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTT

[0400] aph(3')- CTGGTAGCGCCCGGGTGTACATTATTCTCGGGGTTCGGCGCT

[0401] III TATAGACGGATCGGAACCTTAGCAGGAGACATTC 4 83

[0402] ATCCGGTGAGAATGGCAAAAGCTTAGTATACCCTGCGGCCC GTGCGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTC TGGTAGTGGGCACCGTGAACGGTACTTTGTAATCGGGGTTC

[0403] aph(3’)- GGCGCTAGCATTTCTCATGCCTGGGACGTACCTCCATGAGTG

[0404] la ACGACTGA 4 83

[0405] CAGACAGATCAGCCGCCGGTACTCTTATATTACGGCGCCGG GCCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTGG TAGCCCGGTCGTGGAGGCACATACTATACGGGGTTCGGCGC

[0406] aph(3")- TATACGTTGAAGGTCTGTGGGTAGTCTTTGAGCAAATCCGCT

[0407] lb C 4 84,5

[0408] TCAGCCGGATCGTAGAACATATTGGTAAACGGGCGCCGCCC GCGCTACGCAACAACTAACTTGGGTTACAAAGCGTCGTTCTG GTAGGGCCGCCGCCTCAACTATCCTAAGACGGGGTTCGGCG

[0409] aph(6)- CTTGTGACATGCTGAAGTCAGAACCGAGACAAAGGTCGTCT

[0410] Id CTG 4 84,5

[0411] CCGCTACTGAGGCAATCCCTG TGTATGTGGTGCTGCGCTACGCAACAACTAACTTGGGCAAA GCGTCGTTCTGGTAGGAGGCGTTGCGGTACGGCTCATAGGG

[0412] Candida TTCGGCGCTATCAAACGTACACTTCGTTTGA

[0413] sp. CTTTTGCCGCTTCACTCG 4 85

[0414] GATCTTGGTGACCTCGGGATCATTGTTTCCGCTAGCCTGCCG

[0415] aac(6')- CGCGCGCACTACGCAACAACTAACTTGGGTTACAAAGCGTCG

[0416] 30- TTCTGGTAGGGGCCGCGTTATCGGCGCGAGCTCAGAAAATC

[0417] aac(6')- GGGGTTCGGCGCTAAGTGAAGGCGTCTGACAGCGGATAAG

[0418] lb' CAGGCGACGGGTCCGTTTG 4 85,5

[0419] Table 2: primer and detection probe sequences. *: PTO bond between the bases. +: succeeding base is LNA base. primer / 5' 3' sequence

[0420] probe modification modification qPCRJwd CAAAGCGTCGTTCTGG*T*A*G

[0421] qPCR ev CCCAAGTTAGTTGTTGCG*T*A*G

[0422] probel ACGG+TGTGG+AAA+TC+CT*+T*+A*+A HEX BHQ1 probe2 TTGCCG+CTA+CAGAA+TCG*+T*+A*+A TexasRed BHQ2 probe3 CGTGGTG+TT+TGATGGG+CT*+T*+A*+A Cy5 BHQ3 probe4 AGGG+TT+CGG+CGC+T*+T*+A*+A Cy5.5 BHQ3

[0423] Example 3

[0424] Exonuclease resistant qPCR probes

[0425] In order to combine the Exonuclease treatment and the amplification reaction in a single tube, the detection probes (e.g. Taqman probes or Molecular Beacons) need to be modified to make them resistant against Exonuclease digestion. Canonically, Exonuclease III is described as a dsDNA specific exonuclease, but recent studies have shown that it is also active against ssDNA. Moreover, Exonuclease III has also been reported to have RNase H, 3 '-phosphatase and AP-endonuclease activities, indicating the versatile nature of this enzyme. A literature search shows that Exonuclease resistance can be achieved by multiple 3’ modifications: a series of PT bonds, large 3’-hydrophobic moieties (e.g. cholesterol), LNA bases. To test which modifications are most effective, multiple probes with a 5’ fluorophore and 3’ quencher were tested for resistance against Exonuclease I and Exo-nuclease III. The results show that none of the modifications alone can completely prevent Exonuclease III digestion. However, a combination of 3’ PT-bonds and LNA bases makes the oligos highly resistant against Exonuclease III as well as the combination of Exonuclease I and Exonuclease III digestion. Results of the experiment are displayed in Figure 6. Table 3: detection probes tested for Exonuclease resistance. S: Sensitive to exonuclease digestion. R: Resistant to exonuclease digestion

[0426]

[0427] Example 4

[0428] Melting curve by design

[0429] In order to differentiate targets, specific amplicon melting curves are designed. This is accomplished by modification of several variable regions in between the fixed elements of the padlock probe. The goal is to have an overall amplicon sequence that melts homogeneously at the desired melting temperature to produce a distinct sharp melting curve. Hereto the length and the GC-content of the variable regions is iteratively changed and the resulting amplicon melting curve is checked in silico, for instance using an implementation of the Poland-Scheraga algorithm (e.g. MELTSIM). This results in target specific meltcurve that are easily differentiated by >>0.5°C.

[0430] In order to further improve the multiplex capabilities, the melting curve space was expanded by implementing detection probes. This results in the possibility of having melting curves at the same location, of within 1°C. Results of the experiment for the detection of 49 antibiotic resistance genes is displayed in Figures 7 and 8,

Claims

Claims1. A method for detecting at least one nucleic acid molecule in a sample, the method comprising the steps of:a) contacting a sample comprising or suspected of comprising at least one nucleic acid molecule with at least one padlock probe wherein said padlock probe comprises:- 3’ and 5’ terminal regions complementary to a target nucleic acid sequence comprised in said at least one nucleic acid molecule,- a linker region connecting said terminal regions,- at least one primer binding region for binding of at least one amplification primer,- at least one probe binding region for binding of at least one detection probe, and wherein said at least one padlock probe comprises a set of at least two padlock probes, preferably a plurality of padlock probes, each targeting a different target nucleic acid sequence in the same or different sample nucleic acid molecule(s), wherein each padlock probe amplicon generated from said set of at least two padlock probes is individually distinguishable on the basis of its melting curve profile and / or on the basis of padlock probe amplicon-specific detection probe signal(s);b) hybridizing the complementary terminal regions of said at least one padlock probe to said target nucleic acid sequence;c) circularising said at least one padlock probe by ligating the termini of said at least one padlock probe to provide a circularized padlock probe sequence;d) hybridizing at least one amplification primer to said primer binding region in said circularized padlock probe, and amplifying at least a part of said circularized padlock probe sequence comprising said probe binding region, to thereby generate an amplicon from said circularized padlock probe;e) i) recording the high-resolution melting curve of said amplicon and / or ii) hybridizing at least one detection probe to said probe binding region in said amplicon and recording the detection signal of said at least one detection probe, andf) determining the presence or absence of said at least one nucleic acid molecule in said sample on the basis of i) the recorded melting curve of said padlock probe amplicon and / or ii) the recorded detection signal from said detection probe.

2. Method according to claim 1, wherein said at least one detection probe comprises a set of at least two detection probes, preferably a plurality of detection probes, and wherein each detection probe carries a fluorescent label detectable in a defined fluorescence channel of a qPCR instrument and wherein said fluorescent label of each of said detection probes is distinct for amplicons of which the position of the primary peak of the first derivative (- dF / dT) of the melting curve differs from that of other amplicons by less than 0.5 °C, and / or wherein each detection probe each carries a fluorescent label detectable in the same fluorescence channel of a qPCR instrument as the fluorescent label of any probe for detecting amplicons of which the position of the primary peak of the first derivative (—dF / dT) of the melting curve differs from that of other amplicons by at least 0.5–2 °C.

3. Method according to any one of the preceding claims, wherein said set of at least two padlock probes consists of a plurality of padlock probes, each targeting a different target nucleic acid sequence, wherein said set comprises a) padlock probes whose amplicons have melting curves with first derivative (-dF / dT) primary peak positions that differ by at least 0.5 °C and have identical probe binding regions, and b) padlock probes whose amplicons have melting curves with first derivative (-dF / dT) primary peak positions that differ by less than 0.5 °C and have different probe binding regions.

4. Method according to any one of the preceding claims, wherein said padlock probe comprises at least two primer binding regions for binding of at least one set of bidirectional amplification primers, and wherein step d) comprises PCR amplifying at least a part of said circularized padlock probe sequence comprising said probe binding region.

5. Method according to any one of the preceding claims, wherein following the circularization in step c) and prior to the amplification in step d), a step dl) is included wherein any non-circularized padlock probe is digested by exonuclease digestion, and preferably wherein said at least one amplification primer and / or said at least one detection probe are rendered resistant to said exonuclease digestion, preferably by the presence of consecutive phosphorothioate bonds and / or consecutive LNA bases at the 3’ end.

6. Method according to any one of the preceding claims, wherein said steps d) and e) of amplification and detection are performed in a single closed reaction container.

7. Method according to any one of the preceding claims, wherein said sample comprises at least one nucleic acid molecule of a single strain or single species of a micro-organism.

8. Method according to any one of the preceding claims, comprising classifying said at least one nucleic acid molecule on the basis of i) the recorded melting curves of said set of at least two padlock probe amplicons and / or ii) the recorded detection signals from said set of at least two detection probes, preferably classifying said at least one nucleic acid molecule on the basis of i) the recorded melting curve of a first padlock probe amplicon of said set of at least two padlock probes, if the recorded detection signal from said first detection probe is the same as the recordeddetection signal from a second detection probe of said set of at least two padlock probes and / or on the basis of ii) the recorded detection signals from said set of at least two detection probes if the position of the primary peak of the first derivative (-dF / dT) of the recorded melting curve of said amplicon of said first padlock probe of said set of at least two detection probes differs from that of said amplicon of said second padlock probe by less than 0.5 °C.

9. Method according to any one of the preceding claims, wherein following the circularization in step c) and the optional exonuclease digestion of non-circularized padlock probe of step dl), and prior to the PCR amplification step of step e), a step d2) is included wherein concatenated sequence copies of said circularized padlock probe sequence are generated by rolling circle amplification (RCA).

10. Method according to any of the preceding claims, wherein the padlock probe amplicon is between 40-400 nucleotides, preferably 80-300 nucleotides, more preferably 150-250 nucleotides in length.

11. Method according to any of the preceding claims, wherein said at least one nucleic acid molecule in a sample is selected from an antimicrobial resistance gene, a virulence gene, a viral nucleic acid, a fungal nucleic acid, a bacterial nucleic acid, a ribosomal RNA gene or an rDNA internal transcribed spacer (ITS) region, a gene comprising a mutation that is associated with cancer, a gene comprising a mutation associated with a prenatal disorder, and nucleic acid transcripts of those genes.

12. Method according to any of the preceding claims, wherein steps a) through c) are performed in a first reaction mixture and wherein steps d) through e), optionally including dl) and / or d2), are performed in a second reaction mixture.

13. Method according to any one of the preceding claims, wherein each padlock probe amplicon is detectable by multiple detection probes.

14. Method according to claim 13, wherein each padlock probe amplicon in said set of at least two padlock probe amplicons is detectable by at least two detection probes, wherein each of said at least two detection probes detects the amplicon of a subset selection of amplicons selected from said set, wherein said combination of detection signals from said at least two different detection probes partitions said set into distinct subsets wherein each amplicon of said set of amplicons is in one and only one of these distinct subsets.

15. A kit of parts comprising:a) at least one padlock probe wherein said padlock probe comprises:- 3’ and 5’ terminal regions complementary to a target nucleic acid sequence comprised in said at least one nucleic acid molecule,- a linker region connecting said terminal regions,- at least one primer binding region for binding of at least one amplification primer,- at least one probe binding region for binding of at least one detection probe, and wherein said at least one padlock probe comprises a set of at least two padlock probes each targeting a different target nucleic acid sequence in the same or different sample nucleic acid molecule(s), wherein each padlock probe amplicon generated from said set of at least two padlock probes is individually distin uishable on the basis of its melting curve profile and / or on the basis of padlock probe amplicon-specific detection probe signal(s);said kit of parts further comprising at least one of:b) a ligase for ligating the termini of said at least one padlock probe when said at least one padlock probe is hybridized at its complementary terminalregions to said target nucleic acid sequence to generate a circularized padlock probe sequence;c) an exonuclease for degrading non-circularized padlock probe sequences; d) at least one amplification primer for amplifying at least a part of a circularized padlock probe sequence and for generating a padlock probe amplicon comprising said at least one probe binding region;e) a DNA polymerase for generating a padlock probe amplicon through a nucleic acid amplification reaction;f) at least one detection probe comprising a targeting sequence for targeting a complementary nucleotide target sequence in said padlock probe amplicon, and comprising a detectable label.

16. A kit of parts according to claim 15, wherein said kit comprises a set of padlock probes as defined in any one of claims 1-14, optionally in combination with a set of detection probes as defined in any one of claims 1- 14.

17. Kit of parts according to claim 15 or 16, wherein said kit comprises as separate mixtures:i) a ligation mixture comprising components a) and b), andii) an amplification mixture comprising at least one of components c) through f).

18. Kit of parts according to any one of claims 15-17, further comprising at least one set of bidirectional amplification primers for amplifying at least a part of a circularized padlock probe sequence and for generating a padlock probe amplicon comprising said at least one probe binding region.

19. Kit of parts according to any one of claims 15-18, wherein said at least one detection probe comprises a set of at least two detection probes,preferably a plurality of detection probes, and wherein each detection probe carries a fluorescent label detectable in a defined fluorescence channel of a qPCR instrument and wherein said fluorescent label of each of said detection probes is distinct for amplicons of which the position of the primary peak of the first derivative (–dF / dT) of their melting curve differs from that of other amplicons by less than 0.5 °C, and / or wherein each detection probe each carries a fluorescent label detectable in the same fluorescence channel of a qPCR instrument as the fluorescent label of any probe for detecting amplicons of which the position of the primary peak of the first derivative (–dF / dT) of their melting curve differs from that of other amplicons by at least 0.5-2 °C.

20. Kit of parts according to any one of claims 15-19, wherein said at least one amplification primer and / or said at least one detection probe are rendered resistant to said exonuclease digestion, preferably by the presence of consecutive phosphorothioate bonds and / or consecutive LNA bases at the 3’ end.

21. A system comprisinga) a kit of parts as defined in any one of claims 15-20, andb) a device for recording a high-resolution melting curve of said padlock probe amplicon, said device preferably further comprising multiple color channels for detecting a signal from a detectable label of said at least one detection probe.