Double‑stranded RNA composition for modulating DGAT2 expression, conjugate thereof, pharmaceutical composition comprising same, and use thereof
By designing a double-stranded RNA composition with a specific sequence to target the liver and regulate DGAT2 expression, the liver toxicity and side effects of existing NASH treatments are resolved, achieving a safe and effective improvement in fatty liver.
Patent Information
- Application Number
- PCT/CN2025/143056
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-17
- Filing Date
- 2025-12-17
- Publication Date
- 2026-06-25
AI Technical Summary
Existing drug treatments for non-alcoholic steatohepatitis (NASH) have hepatotoxicity and side effects, and there is a lack of safe and effective treatments. DGAT2 is significantly expressed in the liver and adipose tissue, and inhibiting its expression is expected to improve the fatty liver phenotype.
Designed double-stranded RNA compositions with specific sequences are targeted to the liver via small nucleic acid delivery technology to regulate DGAT2 expression. These compositions include both sense and antisense strands. The nucleotide sequences are modified to improve stability and efficiency, forming partially or completely complementary structures, and conjugated groups are added to enhance delivery.
It significantly inhibits DGAT2 expression, reduces liver fat accumulation, improves the NASH phenotype, provides a safe and effective treatment option, reduces liver fat levels and the risk of liver fibrosis, and reduces side effects.
Smart Images

Figure CN2025143056_25062026_PF_FP_ABST
Abstract
Description
A double-stranded RNA composition for regulating DGAT2 expression, its conjugates and pharmaceutical compositions and their uses Technical Field This invention belongs to the field of biomedical technology, specifically relating to a double-stranded RNA composition for regulating DGAT2 expression, its conjugates and pharmaceutical compositions, and their uses. Background Technology MASH is a liver disease associated with metabolic disorders, characterized by abnormal fat accumulation in the liver, accompanied by inflammation and hepatocellular damage. It was previously often referred to as nonalcoholic steatohepatitis (NASH). This condition is a severe form of metabolic-associated fatty liver disease (MAFLD) and is closely related to factors such as type 2 diabetes, hypertension, hyperlipidemia, and obesity. MASH patients have excessive fat accumulation in their livers, accompanied by inflammation and hepatocellular damage. This inflammation and damage can lead to liver fibrosis, cirrhosis, liver failure, and even liver death. Drug treatment options for MASH are very limited, making drug development for MASH a global focus in metabolic disease research. In 2024, the FDA approved Rezdiffra, the first oral small molecule drug for treating MASH patients with moderate to advanced fibrosis. Rezdiffra is an orally selective thyroid hormone receptor (THR-β) agonist for treating MASH with liver fibrosis. It is the world's first drug for MASH treatment, exhibiting high selectivity. It works by activating β-receptors in hepatocytes, playing a central role in the liver by regulating lipid metabolism and reducing LDL cholesterol, triglycerides, and atherogenic lipoproteins, thereby reducing liver fat. After 52 weeks of treatment with 100 mg of Rezdiffra, patients experienced an average reduction of 51% in liver fat levels. Liver fibrosis, liver volume, and spleen volume also decreased significantly. However, it may have some liver toxicity, and gallstones, acute cholecystitis, and obstructive pancreatitis (gallstones) are more likely to be observed, along with side effects such as diarrhea, vomiting, constipation, abdominal pain, and dizziness. Therefore, it remains important to develop safe and effective drugs for the treatment of NASH. The main component of fats is triglycerides (TAGs), which are the primary energy storage substances in living organisms. Their synthesis mainly occurs via two pathways: the glycerol-3-phosphate pathway and the monoacylglycerol pathway. [1] Mammals primarily synthesize triglycerides via the glycerol-3-phosphate pathway. The final step in both pathways involves diacylglycerol acyltransferases (DGATs) catalyzing the production of TAG from diacylglycerol (DAG). [2]DGATs have two known isomers: DGAT1 and DGAT2. Although both DGAT1 and DGAT2 can esterify diglycerides to triglycerides, these two enzymes are not homologous at the protein level and differ in their tissue expression patterns. DGAT2 is significantly expressed primarily in the liver and adipose tissue, while the DGAT1 isomer is mainly expressed in the intestine and less so in other tissues. Studies have shown... [3] In a NASH (ob / ob-gan) mouse model, administration of small nucleic acid drugs inhibited and reversed triglyceride accumulation (>85%, p<0.0001), thereby significantly improving the fatty liver phenotype. Therefore, as a liver- and fat-specific negative regulator, developing RNAi drugs using a GalNAc-specific liver delivery platform to inhibit DGAT2 expression holds promise as a potentially advantageous strategy for treating NASH-related metabolic diseases.
[0001] Coleman, RA & Mashek, DG, et al. (2018) Mammalian Triacylglycerol Metabolism: Synthesis, Lipolysis, and Signaling. Chem. Rev. 111, 6359-6386 (2011).
[0002] Terytty Yang Li, Lintao Song, Yu Sun, et al. (2018) Tip60-mediated lipin 1 acetylation and ER translocation determine triacylglycerol synthesis rate, Nature Communications, 9(1):1916.
[0003] Batuhan Yenilmez, Nicole Wetoska, Mark Kelly, et al. (2021) An RNAi therapeutic targeting hepatic DGAT2 in a genetically obese mouse model of nonalcoholic steatohepatitis, Molecular Therapy, 30(3), 1329-1342. Summary of the Invention The purpose of this invention is to provide a double-stranded RNA composition for regulating DGAT2 (diaacylglycerol acyltransferase 2) expression, its conjugates and pharmaceutical compositions, and their uses. To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of the present invention provides a double-stranded RNA comprising a sense strand and an antisense strand, wherein each nucleotide in the double-stranded RNA is independently modified or unmodified; the sense strand comprises a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO. 1 to 86 or a nucleotide sequence differing from the above sequences by no more than 3 nucleotides, and the antisense strand comprises a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO. 87 to 172 or a nucleotide sequence differing from the above sequences by no more than 5 nucleotides. According to some embodiments, the positive chain includes a nucleotide sequence that differs from any one of the nucleotide sequences shown in SEQ ID NO. 1 to 86 by no more than 2 nucleotides and a nucleotide sequence that differs from any one of the nucleotide sequences shown in SEQ ID NO. 1 to 86 by no more than 1 nucleotide. According to some implementations, the nucleotide differences of the positive strand in the 5' to 3' direction can be any one, two, or three of the following positions in the nucleotide sequence: first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, and nineteenth positions. According to some embodiments, the antisense strand includes a nucleotide sequence that differs from any one of the nucleotide sequences shown in SEQ ID NO. 87 to 172 by no more than 5 nucleotides, a nucleotide sequence that differs from any one of the nucleotide sequences shown in SEQ ID NO. 87 to 172 by no more than 4 nucleotides, a nucleotide sequence that differs from any one of the nucleotide sequences ... According to some implementations, the nucleotide difference of the antisense strand can be at any position in the nucleotide sequence, such as the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twentieth, and twenty-first positions, including any one, two, three, four, or five positions. According to certain embodiments, the 3' end base of the positive strand can be arbitrarily replaced with A, U, C, or G. That is, the 3' end base of any nucleotide sequence shown in SEQ ID NO. 1 to 86 can differ from that specific sequence, and can be replaced with three bases other than itself. While not all sequences with 3' end base variations are listed here, their 3' end base substitution sequences should be considered explicitly stated. According to certain embodiments, the 5' end base of the antisense strand can be arbitrarily replaced with A, U, C, or G. That is, the 5' end base of any one of the nucleotide sequences shown in SEQ ID NO. 87 to 172 can differ from that specific sequence, and can be replaced with three bases other than itself. While not all sequences with 5' end base variations are listed here, their 5' end base substitution sequences should be considered explicitly stated. According to some embodiments, the antisense strand comprises 18 to 23 nucleotides, such as 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, or 23 nucleotides. According to some implementations, the positive chain comprises 16 to 21 nucleotides, such as 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, and 21 nucleotides. According to some embodiments, the sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded structure. Further, the double-stranded structure has no more than 3 base mismatches, no more than 2 base mismatches, and no more than 1 base mismatch. Further, the sense strand and the antisense strand are completely anticomplementary. The partial anticomplementary or complete reactive complementarity does not take into account the prominent bases of the antisense strand. According to some embodiments, the 3' of the antisense strand has one, two, or three base protrusions. According to certain specific embodiments, the double-stranded RNA is selected from the sequences shown in Table 1. According to certain specific embodiments, the double-stranded RNA is selected from: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.9 or a nucleotide sequence with no more than 2 nucleotide mutations thereof, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.95 or a nucleotide sequence with no more than 2 nucleotide mutations thereof; (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.31 or a nucleotide sequence with no more than 2 nucleotide mutations thereof, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.117 or a nucleotide sequence with no more than 2 nucleotide mutations thereof; (3) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 43 or a nucleotide sequence with no more than two nucleotide mutations thereof, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 129 or a nucleotide sequence with no more than two nucleotide mutations thereof; or (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.81 or a nucleotide sequence with no more than 2 nucleotide mutations thereof, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.167 or a nucleotide sequence with no more than 2 nucleotide mutations thereof. Furthermore, the double-stranded RNA is selected from: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.9 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.95 or a nucleotide sequence with no more than one nucleotide mutation therein; (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.31 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.117 or a nucleotide sequence with no more than one nucleotide mutation therein; (3) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 43 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 129 or a nucleotide sequence with no more than one nucleotide mutation therein; or (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.81 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.167 or a nucleotide sequence with no more than one nucleotide mutation therein. Furthermore, the double-stranded RNA is selected from: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.9, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.95; (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.31, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.117; (3) The sense strand contains the nucleotide sequence shown in SEQ ID NO. 43, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 129; or (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.81, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.167. According to certain specific implementations, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen nucleotides in the sense strand or the antisense strand are all modified nucleotides. According to certain specific embodiments, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphate ester groups in the sense chain or the antisense chain are phosphate ester groups with modifying groups. Preferably, the phosphate ester groups with modifying groups are thiophosphate ester groups. According to certain specific embodiments, the nucleotide at the 5' end of the positive strand and / or the nucleotide at the 3' end of the positive strand is linked to a reverse debased deoxyribose residue containing a phosphate ester group or a thiophosphate ester group. In this application, the positions of bases in the sense strand and / or antisense strand are calculated based on the bases in the sequence, without including reverse desaturated deoxyribose residues. According to certain specific embodiments, the modified nucleotide is selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof; and / or, the phosphate ester group having the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom. According to certain specific embodiments, the modified nucleotide is a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-O-CH2-CH2-O-CH3 modified nucleotide, a 2'-O-CH2-CH=CH2 modified nucleotide, a 2'-CH2-CH2-CH=CH2 modified nucleotide, a 2'-deoxy nucleotide, a 2'-methoxyethyl modified nucleotide, a phosphate thioester bond modified nucleotide, a VP modified nucleotide, LNA, ENA, cET BNA, UNA, GNA, and One or more combinations thereof, wherein R1 is H, OH or CH3, and Base is a natural nucleobase, a modified nucleobase, a universal base or a H atom. According to certain specific embodiments, the positive chain simultaneously contains a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, and a thiophosphate group. According to certain specific embodiments, the antisense strand simultaneously contains a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, and a thiophosphate group. According to some specific embodiments, the 2'-methoxy modified nucleotide in the positive strand is located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fifteen, or sixteenth position from the first to the sixth, eighth, tenth, twelfth to the last position, in the 5' to 3' direction. According to some other specific embodiments, the 2'-methoxy modified nucleotide in the positive strand is located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or sixteenth position from the first to the eighth position and from the tenth to the last position, in the 5' to 3' direction. According to some specific embodiments, the 2'-fluorinated nucleotide in the positive strand is located at any one, two, or three positions among the seventh, ninth, and eleventh positions, in the 5' to 3' direction. According to some other specific embodiments, the 2'-fluorinated nucleotide in the positive strand is located at any one, two, or three positions in the seventh, eighth, and ninth positions, in the 5' to 3' direction. According to some more specific embodiments, in the direction from 5' to 3', the 2'-methoxy modified nucleotides in the positive strand are located at the first to sixth, eighth, tenth, twelfth to last positions, and the 2'-fluorinated modified nucleotides in the positive strand are located at the seventh, ninth and eleventh positions. According to some other, more specific embodiments, in the direction of 5' to 3', the 2'-methoxy modified nucleotides in the positive strand are located at the first to sixth positions and the tenth to last position, and the 2'-fluorinated modified nucleotides in the positive strand are located at the seventh, eighth, and ninth positions. According to certain specific embodiments, in the direction from 5' to 3', at least one, at least two, at least three, or at least four of the following nucleotides in the positive strand are linked by thiophosphate groups: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides. According to certain specific embodiments, in the 5' to 3' direction, the following nucleotides of the positive strand are linked by thiophosphate groups: the first and second nucleotides, and the second and third nucleotides. In other embodiments, when the nucleotides at the 5' end of the positive strand and / or the nucleotides at the 3' end of the positive strand are connected to a reverse debased deoxyribose residue containing a thiophosphate group, the bases of the positive strand are linked by a phosphate group. According to some specific embodiments, in the direction from 5' to 3', any one, two, three or four nucleotides at the second, sixth, fourteenth or sixteenth position of the antisense strand are 2'-fluorinated nucleotides. According to some other specific embodiments, in the direction from 5' to 3', any one, two, or three nucleotides at the second, fourteenth, and sixteenth positions of the antisense strand are 2'-fluorinated nucleotides. According to certain specific embodiments, in the direction from 5' to 3', any one, two, three, four, five, six, or seven nucleotides at positions 2, 3, 4, 5, 6, 7, and 8 of the antisense strand are... (These four structural formulas are anti-off-target modified nucleotides). According to some further embodiments, in the direction from 5' to 3', any one, two, or three nucleotides at positions 6, 7, and 8 of the antisense strand are the aforementioned off-target modified nucleotides. According to certain specific embodiments, in the direction from 5' to 3', any one or more nucleotides at positions other than those mentioned above in the antisense strand are nucleotides modified with 2'-methoxy groups. According to some further embodiments, the 2'-methoxy modified nucleotide in the antisense strand is located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fifteen, seventeen to the last position, in the 5' to 3' direction. According to some further embodiments, the 2'-methoxy modified nucleotide in the antisense strand is located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, or eighteenth position in the first, third to thirteenth, fifteenth, seventeenth to last position, in the 5' to 3' direction. According to some further embodiments, in the direction of 5' to 3', the 2'-methoxy modified nucleotides in the antisense strand are located at the first, third to fifth, seventh to thirteenth, fifteenth, seventeenth to last positions, and the 2'-fluorinated modification is located at the second, sixth, fourteenth, and sixteenth positions of the antisense strand. According to some further embodiments, in the 5' to 3' direction, the first, third to fifth, ninth to thirteenth, fifteenth, seventeenth to last nucleotides of the antisense strand are 2'-methoxy modified nucleotides, and the second, fourteenth, and sixteenth positions of the antisense strand are 2'-fluorinated modified nucleotides; any one of the sixth to eighth positions of the antisense strand is the aforementioned off-target modified nucleotide, and the remaining two positions are 2'-methoxy modified nucleotides. According to some further embodiments, in the direction of 5' to 3', the 2'-methoxy modified nucleotides in the antisense strand are located at the first, third to thirteenth, fifteenth, seventeenth to last positions, and the 2'-fluorinated modification is located at the second, fourteenth, and sixteenth positions of the antisense strand. According to certain specific embodiments, in the direction from 5' to 3', at least one, at least two, at least three, or at least four of the following nucleotides in the antisense strand are linked by phosphate thioester groups: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides. Furthermore, in the 5' to 3' direction, the following nucleotides of the antisense strand are linked by thiophosphate groups: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides. According to certain specific embodiments, the first nucleotide of the antisense strand contains a VP modification. According to certain specific embodiments, the double-stranded RNA is selected from the sequences shown in Table 2. According to certain specific embodiments, the double-stranded RNA is selected from: (a) The justice chain contains IB-s-GmCmUmGmUmGmCfUmCfUmAfCmUmUmCmAmCmUmUm-s-IB, and the antisense chain contains AmsAfsGmUmGmAmAmGmUmAmGmAmGmCfAmCfAmAmGmCmsGmsAm; (b) The justice chain contains IB-s-GmAmAmCmUmAmUfAmUfCmUfUmUmGmGmAmUmAmAmAm-s-IB, and the antisense chain contains UmsUfsAmUmCmCmAmAmAmGmAmUmAmUfAmGfUmUmCmsCmsUm; (c) The justice chain contains IB-s-CmAmUmAmGmAmCfUmAfUmUfUmGmCmUmUmUmCmAm-s-IB, and the antisense chain contains UmsGfsAmAmAmGmCmAmAmAmUmAmGmUfCmUfAmUmGmsGmsUm; (d) The justice chain contains IB-s-GmUmCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm-s-IB, and the antisense chain contains UmsUfsUmUmAmAmAmUmAmAmCmCmCmCmAfCmAfGmAmCmsAmsCm; or (e) The justice chain contains IB-s-GmUmCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm-s-IB, and the antisense chain contains VPUmsUfsUmUmAmAmAmUmAmAmCmCmCmCmAfCmAfGmAmCmsAmsCm. According to certain specific embodiments, the double-stranded RNA can regulate DGAT2 expression, and further, the double-stranded RNA can inhibit DGAT2 expression. A second aspect of the present invention provides a double-stranded RNA conjugate comprising the above-described double-stranded RNA and a conjugating group conjugated to any position of the double-stranded RNA. Furthermore, one, two, three, or four consecutively connected conjugate groups are attached to any position of the double-stranded RNA. In some embodiments, the conjugation group is attached to the 3' end and / or 5' end of the positive chain. In some embodiments, the siRNA conjugate has any of the following structures: in, Indicates double-stranded RNA; R represents any one of the following conjugation groups having the following structures: Where Y is either O or S. According to certain specific embodiments, the double-stranded RNA conjugates are shown in Table 4 or Table 5. According to certain specific embodiments, the double-stranded RNA conjugate is selected from: (a) The justice chain contains SA51SA51SA51-s-IB-s-GmCmUmGmUmGmCfUmCfUmAfCmUmUmCmAmCmUmUm-s-IB, and the antisense chain contains AmsAfsGmUmGmAmAmGmUmAmGmAmGmCfAmCfAmAmGmCmsGmsAm; (b) The justice chain contains SA51SA51SA51-s-IB-s-GmAmAmCmUmAmUfAmUfCmUfUmUmGmGmAmUmAmAmAm-s-IB, and the antisense chain contains UmsUfsAmUmCmCmAmAmAmGmAmUmAmUfAmGfUmUmCmsCmsUm; (c) The justice chain contains SA51SA51SA51-s-IB-s-CmAmUmAmGmAmCfUmAfUmUfUmGmCmUmUmUmCmAm-s-IB, and the antisense chain contains UmsGfsAmAmAmGmCmAmAmAmUmAmGmUfCmUfAmUmGmsGmsUm; (d) The justice chain contains SA51SA51SA51-s-IB-s-GmUmCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm-s-IB; the antisense chain contains UmsUfsUmUmAmAmAmUmAmAmCmCmCmAfCmAfGmAmCmsAmsCm; or (e) The justice chain contains SA51SA51SA51-s-IB-s-GmUmCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm-s-IB, and the antisense chain contains VPUmsUfsUmUmAmAmAmUmAmAmCmCmCmAfCmAfGmAmCmsAmsCm. A third aspect of the present invention provides a pharmaceutical composition comprising the above-described double-stranded RNA or the above-described double-stranded RNA conjugate, and a pharmaceutically acceptable carrier or excipient. According to certain specific embodiments, the pharmaceutical composition is used to regulate DGAT2 expression. The present invention also provides the use of the above-mentioned double-stranded RNA, the above-mentioned double-stranded RNA conjugate, and the above-mentioned pharmaceutical composition in the preparation of medicaments for treating and / or preventing diseases and / or symptoms related to DGAT2 expression. The diseases and / or conditions associated with DGAT2 expression are lipid metabolism disorders; more specifically, the diseases and / or conditions associated with DGAT2 expression are non-alcoholic fatty liver disease and non-alcoholic steatohepatitis. The present invention also provides the use of the above-mentioned double-stranded RNA, the above-mentioned double-stranded RNA conjugate, and the above-mentioned pharmaceutical composition in the preparation of medicaments for treating and / or preventing non-alcoholic fatty liver disease and non-alcoholic steatohepatitis. The present invention also provides a method for treating and / or preventing DGAT2 expression-related diseases and / or conditions in a subject, comprising administering to the subject an effective amount of the double-stranded RNA as described above, the double-stranded RNA conjugate as described above, and / or the pharmaceutical composition as described above. Furthermore, the diseases and / or conditions associated with DGAT2 expression are lipid metabolism disorders. Furthermore, the diseases and / or conditions associated with DGAT2 expression are non-alcoholic fatty liver disease and non-alcoholic steatohepatitis. Furthermore, the subject is a mammal, furthermore, the subject is a primate, and furthermore, the subject is a human. Due to the application of the above-mentioned technical solution, the present invention has the following advantages compared with the prior art: The double-stranded RNA that regulates DGAT2 expression, its conjugates, and pharmaceutical compositions disclosed in this invention can be delivered to the liver using small nucleic acid delivery technology, which is expected to provide a safer and more effective treatment option for patients with MASH-related metabolic diseases. Attached Figure Description Figure 1 shows the in vivo activity test results in mice in Example 5; Figure 2 shows the in vivo activity test results in mice in Example 6; Figure 3 shows the residual expression level of DGAT2 mRNA in mouse liver in Example 8; Figure 4 shows the liver / body weight ratio of mice in Example 8; Figure 5 shows the HE staining results of mouse liver in Example 8; Figure 6 shows the in vivo activity test results in mice in Example 9. Detailed Implementation It should be noted that, unless otherwise defined, the technical or scientific terms used in this application shall have the ordinary meaning as understood by one of ordinary skill in the art. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the raw materials, reagents, and other materials used in the following embodiments are commercially available products. The sense and antisense strand sequences in this application are in the order from the 5' end to the 3' end. definition In the foregoing and hereinafter, "2'-fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribosyl group is replaced by fluorine. Similarly, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides all refer to nucleotides in which the hydroxyl group at the 2' position of the ribosyl group is replaced by the corresponding substituent group. VP-modified nucleotides refer to nucleotides in which the phosphate group of the nucleotide is replaced by a vinyl phosphate group. In some embodiments, the 5' terminal phosphate group of the antisense strand is replaced by VP. "Alkyl" includes straight-chain, branched, or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl, and similar groups. For instance, "C1-6" in "C1-6 alkyl" refers to a group containing 1, 2, 3, 4, 5, or 6 carbon atoms arranged in a straight-chain, branched, or cyclic form. "Alkoxy" herein refers to an alkyl group that is attached to the remainder of a molecule by an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, etc. "Nucleotide analogues" refer to groups that can replace nucleotides in nucleic acids, but whose structure differs from that of adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine deoxyribonucleotides. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides. BNA refers to a restricted or inaccessible nucleotide. BNA can contain a five-membered, six-membered, or seven-membered ring with a "fixed" C3'-endoglycan condensation bridging structure. This bridge is typically incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide, such as LNA, ENA, cET BNA, etc., where LNA is shown in formula (1), ENA in formula (2), and cET BNA in formula (3). Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of a nucleotide, such as unopened nucleic acids (UNA) or glycerol nucleic acids (GNA or SAFE-01). UNA is shown in formula (4), GNA in formula (5), and SAFE-01 in formula (6). In formulas (4), (5) and (6) above, R is selected from H, OH or alkoxy (O-alkyl). Heteronucleotides are compounds formed by changing the position of the bases in the ribose ring of a nucleotide. For example, compounds formed by moving the bases from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in formula (7) or (8): In the compounds of formulas (7)-(8) above, Base represents a nucleic acid base, such as A (adenine), U (uracil), G (guanine), C (cytosine) or T (thymine); R is selected from H, OH, F or non-fluorine groups as described above. In some embodiments, the nucleotide analog is selected from one of the following: isonucleotides, LNA, ENA, cET BNA, UNA, GNA, and SAFE-01. In some embodiments, the siRNA of the present invention contains deoxynucleotides, which may be dA, dT, dC, or dG. In the preceding and following text, "thiophosphate group" refers to a thiophosphate group in which an oxygen atom in the phosphodiester bond is replaced by a sulfur atom. "5'-phosphonucleotide" refers to the structure of the following formula: In the foregoing and hereinafter, the terms "complementary" and "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired with bases of the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, "mismatch" in the art means, in the case of a double-stranded nucleic acid, that the bases at corresponding positions are not paired in a complementary manner. In the preceding and following text, a "nucleotide difference" between two nucleotide sequences refers to a change in the type of bases at the same position of the nucleotides compared to the latter. For example, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, then a nucleotide difference is considered to exist between the two nucleotide sequences at that position. In some embodiments, replacing the nucleotide at the original position with a baseless nucleotide or its equivalent can also be considered a nucleotide difference at that position. A baseless nucleotide is a monomeric compound formed when a nucleic acid base in a nucleotide is replaced by other groups or hydrogen atoms. These other groups include, but are not limited to, substituted or unsubstituted aromatic or heteroaryl groups. In the preceding and following text, double-stranded RNA is also referred to as siRNA. A "protruding end" refers to one or more unpaired nucleotides that protrude from the double-stranded structure of the siRNA when one 3' end of one strand extends beyond the 5' end of the other, or vice versa. A "flat-ended" or "knock-end" siRNA means that there are no unpaired nucleotides at that end of the siRNA, i.e., no nucleotide protrusions. A "flat-ended" siRNA is a double-stranded siRNA that is double-stranded throughout its entire length, meaning there are no nucleotide protrusions at either end of the molecule. In the foregoing and hereinafter, particularly in the description of methods for preparing siRNA, pharmaceutical compositions, or siRNA conjugates of this disclosure, unless otherwise specified, the nucleoside monomer refers to a modified or unmodified nucleoside phosphorus amide monomer used in solid-phase phosphorus amide synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Solid-phase phosphorus amide synthesis is a method used in RNA synthesis that is well known to those skilled in the art. All nucleoside monomers used in this disclosure are commercially available. In the context of this disclosure, unless otherwise stated, "conjugation" refers to the covalent connection between two or more chemical parts, each having a specific function; correspondingly, "conjugated compound" refers to a compound formed by the covalent connection of these chemical parts. Further, "siRNA conjugated compound" refers to a compound formed by the covalent attachment of one or more chemical parts having a specific function to siRNA. siRNA conjugated compounds should be understood, depending on the context, as a collective term for multiple siRNA conjugated compounds or a siRNA conjugated compound represented by a specific chemical formula. In the context of this disclosure, "conjugated molecule" should be understood as a specific compound that can be reactively conjugated to siRNA to ultimately form the siRNA conjugated compounds of this disclosure. Various hydroxyl protecting groups may be used in this disclosure. Generally, protecting groups insensitize chemical functional groups to specific reaction conditions and can be added to and removed from the functional group in a molecule without substantially impairing the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed., John Wiley & Sons, New York, 1991, all of which are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. Non-exclusive examples of hydroxyl protecting groups that may be used herein include dimethoxytriphenylmethyl (DMT), monomethoxytriphenylmethyl, 9-phenylxanthine-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein include Tr (triphenylmethyl), MMTr (4-methoxytriphenylmethyl), DMTr (4,4'-dimethoxytriphenylmethyl), and TMTr (4,4',4”-trimethoxytriphenylmethyl). As used in this specification, "optional" or "optionally" means that the event or condition described thereafter may or may not occur, and the description includes both the occurrence and non-occurrence of the event or condition. The term “subject” as used herein refers to any animal, such as a mammal or marsupial. Subjects of this disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, rabbits, sheep, rats, and any kind of poultry. As used herein, “treatment” refers to a method of achieving a beneficial or desired outcome, including but not limited to treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a treatment benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, even though the subject may still be suffering from the underlying disorder. As used herein, “prevention” refers to methods for obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a “preventive benefit,” siRNA, siRNA conjugates, or pharmaceutical compositions may be given to subjects at risk of developing a specific disease, or to subjects who report one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made. The pharmaceutically acceptable carriers described in this disclosure can be carriers conventionally used in the field of siRNA delivery, such as, but not limited to, magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethyl ethylene) phosphate. The excipients may be one or more of phosphate, PPEEA, and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and their derivatives. The excipients may be one or more of a variety of formulations or compounds conventionally used in the art. For example, other pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic regulators. In this application, uppercase letters A, C, G, and U represent adenosine-3'-phosphate, cytidine-3'-phosphate, guanosine-3'-phosphate, and uridine-3'-phosphate, respectively; lowercase letter m indicates that the nucleotide adjacent to the left of m is a 2'-methoxy modified nucleotide; lowercase letter f indicates that the nucleotide adjacent to the left of f is a 2'-fluoro modified nucleotide; Tgn represents (S)-ethylene glycol-5'-methyluridine. Lowercase letter s in the middle of uppercase letters indicates that the two nucleotides adjacent to s are linked by a thiophosphate group; when s is the first 3' terminus, it indicates that the nucleotide adjacent to the left of s has a thiophosphate group at its end. IB: reverse debasing deoxyribose residue, wherein the phosphate ester bond in IB can be replaced by a thiophosphate bond. As used in this article, a hyphen ("-") that is not between two letters or two symbols or It is used to indicate the location of the substituent connection point. This refers to a single-stranded oligonucleotide, such as the positive strand of siRNA. The technical solution provided by the present invention will be further described below with reference to specific embodiments. The following embodiments are for illustrative purposes only and do not limit the scope of protection of the present invention. Unless otherwise specified, such reagents can be obtained from any molecular biology reagent supplier and possess the quality / purity standards required for molecular biology applications. Example 1: Design and Synthesis of siRNA If the actual source of the reagents is not specified in the text, such reagents can be obtained from any molecular biology reagent supplier and must meet the quality / purity standards required for molecular biology applications. 1) siRNA design: Human DGAT2 (NM_001253891.2) was used as the target gene to design a 19 / 21nt siRNA that meets the general rules for active siRNAs. A detailed list of unmodified sense and antisense strand sequences is shown in Table 1 below, and a detailed list of modified sense and antisense strand sequences is shown in Table 2 below. 2) siRNA synthesis: DGAT2 siRNA sequences were synthesized at a density of 200 nanomolars (nmol) using solid-support-mediated phosphoramide chemistry on a Dr. Oligo48 synthesizer (Biolytic). The solid support used was a universal solid support (Shenzhen DouDian Biotechnology). Nucleoside monomers, such as 2'-FRNA and 2'-O-methylRNA, were purchased from Shanghai Zhaowei or Suzhou Jima. The coupling time for all phosphoramides (50 mM acetonitrile solution) was 6 min. 5-Ethylthio-1H-tetrazole (ETT) was used as the activator (0.6 M acetonitrile solution). 0.22 M PADS dissolved in a 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Kelama) was used as the sulfidation reagent, with a sulfidation reaction time of 3 min. Iodopyridine / aqueous solution (Kelama) was used as the oxidant, with an oxidation reaction time of 2 min. After solid-phase synthesis, the oligonucleotides were cleaved from the solid support and soaked in a 3:1 solution of 28% ammonia and ethanol at 50°C for 16 hours. The mixture was then centrifuged at high speed, and the supernatant was transferred to another centrifuge tube. After concentration and evaporation to dryness, purification was performed using C18 reversed-phase chromatography with a mobile phase of 0.1M TEAA and acetonitrile. DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotides were collected, lyophilized, identified as the target product by LC-MS, and then quantified by UV (260 nm). The obtained single-stranded oligonucleotides were annealed in equimolar ratios according to the complementary pairing of two sequences. The resulting double-stranded siRNA was then dissolved in 1X PBS and adjusted to the required concentration for the experiment. These monomers are interconnected into oligonucleotides via 5'-3'-phosphodiester bonds or phosphothiodiester bonds. Table 1 Table 2 Example 2: Synthesis of siRNA conjugates I. GalNAc Target Preparation The synthesis methods of compounds SA51 (I-1-7) and SA102 are described in Example 2 of WO2024234831A1. The structural formula of compound SA51(I-1-7) is as follows: The structural formula of compound SA102 is as follows: II. Preparation of siRNA conjugates Nucleoside monomers were sequentially linked along the 3'-5' direction in nucleotide arrangement using a solid-phase phosphorous amide method on a universal synthetic column. Each linkage involved four steps: deprotection, coupling, capping, and oxidation or sulfidation. The sense and antisense chains were synthesized under the same conditions. The reactants included either compound SA51 or compound SA102. Instruments used: Biolytic Dr. Oligo 48 solid-phase synthesizer, DS0200 Embed CPG Frits universal synthesis column from DouDian Biotechnology, and DC189650 (80mg) 96-well desalting column from DouDian Biotechnology. Reagents used for the synthesis of siRNA conjugates are shown in Table 3. Table 3 The synthesis conditions are as follows: Nucleoside monomers were provided in 0.05 M acetonitrile solution. The deprotection reaction conditions were the same for each step: 25 °C, 3 min reaction time, DCA as the deprotection reagent, and 180 μL injection volume. The coupling reaction conditions were identical for each step, including a temperature of 25°C and a reaction time of 3 minutes. The injection volume of the nucleoside monomer was 90 μL, and the injection volume of the ACT catalyst was 110 μL. Each capping step was performed under identical conditions, including a temperature of 25°C and a reaction time of 2 minutes. The capping reagent solution was a 1:1 molar ratio mixture of CapA and CapB. The injection volume of the capping reagent was 180 μL. The oxidation reaction conditions were the same for each step, including a temperature of 25°C, a reaction time of 3 minutes, and an injection volume of 180 μL for the oxidizing reagent OXD. The vulcanization reaction conditions were identical for each step, including a temperature of 25°C, a reaction time of 4 minutes, and a 0.05 M PADS pyridine acetonitrile solution as the vulcanizing agent. The injection volume of the vulcanizing agent was 180 μL. After the last nucleoside monomer was ligated, the nucleic acid sequence ligated on the solid-phase support was sequentially cut, deprotected, purified, and desalted, and then freeze-dried to obtain the sense and antisense strands, wherein: The cleavage and deprotection conditions were as follows: The synthesized nucleotide sequence linked to the vector was added to a mixture of ammonia and ethanol in a 3:1 ratio to a volume of 0.8 mL. The reaction was carried out at 50 °C for 15 h. The remaining vector was removed by filtration, and the supernatant was concentrated to dryness under vacuum. The purification and desalting conditions are as follows: Desalting is performed using a C18 reversed-phase column. Specific conditions include: (1) Sample preparation Add 0.1M TEAA (triethylamine acetate) to the oligonucleotide sample to a volume of 0.8mL. (2) Activation of 96-well plate Activation: 0.8 mL of acetonitrile was passed through each well of a 96-well plate for activation; Equilibration: Equilibrate the 96-well plate with 0.8 mL of TEAA (pH 7.0) solution. (3) The purification process shall be carried out in the following order: Pass 0.8 mL of a solution containing oligonucleotides through a desalting column; Wash the 96-well plate twice with 0.8 mL of 6.5% ammonia to remove failed sequences; Rinse the 96-well plate twice with 0.8 mL of deionized water to remove salts; The 96-well plate was washed three times with 0.8 mL of 3% trifluoroacetic acid to remove DMT, and the adsorbed layer was observed to turn orange-red. Rinse the 96-well plate with 0.8 mL of 0.1 M TEAA; Rinse the 96-well plate twice with 0.8 mL of deionized water to remove trifluoroacetic acid and residual salts; Elute with 0.6 mL of 20% acetonitrile and collect and freeze-dry. The detection method is as follows: The purity of the sense and antisense strands was detected and the molecular weight was analyzed using Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18). The measured values are consistent with the theoretical values, indicating that the synthesized compound is the target compound. The annealing procedure was as follows: The synthesized sense and antisense strands were dissolved separately in water for injection to prepare solutions ranging from 0.1 mg / mL to 40 mg / mL. The solutions were then calibrated to an equimolar ratio using a concentration meter, heated at 90°C for 5 minutes, and then slowly cooled naturally to allow them to form a double-stranded structure through hydrogen bonding. Samples were taken and sent for SEC purity testing of the product. The double-stranded samples were then lyophilized. The sequences of the siRNA conjugates are shown in Tables 4 and 5. Table 4 Table 5 The structural formulas of the positive chain containing the conjugated group in Tables 4 and 5 are as follows: Example 3: Inhibition of human DGAT2 by siRNA in Huh7 cells, screening for single-concentration site-specific inhibitory activity. The effect of DGAT2-targeting siRNA on DGAT2 mRNA expression levels was tested in vitro. Huh7 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. At transfection, Huh7 cells were seeded in 96-well plates at a density of 20,000 cells per well with 100 μL of medium per well. Following the product instructions, siRNA was transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778150) at a final siRNA concentration of 10 nM. Twenty-four hours after treatment, RNA was isolated from cells using a cell RNA extraction kit (Zhiang Biotechnology, MNTR / FX96). Reverse transcription was performed using a reverse transcription kit (HiScript III All-in-one RT SuperMix Perfect for qPCR, R333-01), and quantitative real-time PCR was performed using a qPCR kit (Vazyme, Q711) to determine the DGAT2 mRNA level. The DGAT2 mRNA level was corrected based on the β-actin internal reference gene level. Target gene DGAT2 primers: Forward primer: GTTTCGCCCCATGCATCTTC (SEQ ID NO:173); Reverse primer: ATGGGCTCTCCCACAACAGT (SEQ ID NO:174). Primers for the internal reference gene β-actin: Forward primer: CATTGCCGACAGGATGCA (SEQ ID NO:175); Reverse primer: GCTCAGGAGGAGCAATGATCTT (SEQ ID NO:176). The results are expressed as the remaining percentage of DGAT2 mRNA expression relative to cells that have not been treated with siRNA (which is 100%). The smaller the remaining percentage, the higher the inhibitory activity of the siRNA. The results are shown in Table 6. Table 6 Example 4: Inhibition of human DGAT2 in Huh7 cells by siRNA, with dual concentration site activity. In Huh7 cells, siRNAs showing 74% or higher in vitro inhibitory effects were screened at two concentrations (10 nM and 1 nM). Huh7 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. 24 h before transfection, Huh7 cells were seeded into 96-well plates at a density of 10,000 cells per well with 100 μL of medium per well. Following the product instructions, siRNA was transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778150) at final transfection concentrations of 10 nM and 1 nM. Twenty-four hours after transfection, RNA was isolated from cells using a cell extraction kit (Zhiang Biotechnology, MNTR / FX96). Reverse transcription was performed using a reverse transcription kit (HiScript III All-in-one RT SuperMix Perfect for qPCR, R333-01), and quantitative real-time PCR was performed using a qPCR kit (Vazyme, Q711) to determine the mRNA level of DGAT2. The DGAT2 mRNA level was corrected based on the β-actin internal reference gene level. The results are expressed as the remaining percentage of DGAT2 mRNA expression (which is 100%) in cells that have not been treated with siRNA. The smaller the remaining percentage, the higher the inhibitory activity of the siRNA. The results are shown in Table 7. Table 7 Example 5: Activity of siRNA conjugates in HDI mice In this embodiment, siRNA was selected for conjugation synthesis, and its in vivo activity was evaluated in an HDI mouse model. The siRNA conjugate was obtained by solid-phase synthesis as described in Example 2, and the specific sequence and modification information are shown in Table 4. At least 14 days prior to administration of the conjugate, humanized DGAT2-expressing mice were constructed from six- to eight-week-old female Balb / C mice via high-pressure tail vein injection. As previously described, a plasmid containing the DGAT2 mRNA sequence was injected into the mice via the tail vein over 5–7 seconds to generate the DGAT2-SEAP mouse model (Zhang G et al., “High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol. 10, pp. 1735–1737.). Inhibition of DGAT2 expression by the DGAT2 siRNA conjugate resulted in inhibition of SEAP expression. One day prior to administration, serum was collected via orbital blood sampling and administered via Phospha-Light according to the product instructions. TM The SEAP reporter gene analysis system (Invitrogen) was used to measure serum SEAP expression levels, and mice were grouped according to their mean SEAP levels. The experimental group mice were given the conjugate, while the solvent group mice were given phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 1 mg / kg per mouse. Blood samples were collected again at 7, 14, 21, and 28 days post-administration, and serum was analyzed using Phospha-Light according to the product instructions. TM The SEAP reporter gene analysis system (Invitrogen) was used to measure SEAP expression levels in serum. The SEAP level in each animal after treatment was divided by the SEAP level before treatment to determine the expression ratio "normalized to pre-treatment". The results are expressed as the residual expression level of serum SEAP before and after administration in each group (100% for the solvent group). The results are shown in Figure 1, which shows that several compounds exhibited good inhibitory activity in vivo. Example 6: In vivo testing of the activity of the conjugate in mice SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 3 mg / kg per mouse. Seven days after administration, the animals were euthanized, and their livers were harvested. The expression level of DGAT2 mRNA was detected using qPCR. Target gene mouse DGAT2 primers: Forward primer: TGGGTCCTATCCTTCCTGGT (SEQ ID NO:177); Reverse primer: CGATCTCCTGCCACCTTTCT (SEQ ID NO:178); Internal reference gene GAPDH primers: Forward primer: TGCACCACCAACTGCTTAG (SEQ ID NO:179); Reverse primer: GATGCAGGGATGATGTTC (SEQ ID NO:180). Results are expressed as the residual expression level of the siRNA-treated group compared to the solvent group (the solvent group was 100%). The sequences of the conjugates used for injection are shown in Table 4, and they were prepared according to the method in Example 2. The residual expression levels of DGAT2 mRNA in mouse liver after using the test conjugates are shown in Figure 2 and Table 8. The results showed that SD007306 had the best activity and was used for efficacy testing in NASH mice. Table 8 Example 7: IC50 activity of the conjugate against human DGAT2 inhibition in Huh7 cells. The IC50 activity of the siRNAs that showed good in vivo inhibitory effects in Huh7 cells was evaluated using 11 concentrations (90 nM, 30 nM, 10 nM, 3.3 nM, 1.1 nM, 0.37 nM, 0.12 nM, 0.04 nM, 0.01 nM, 0.0046 nM, and 0.0015 nM). Huh7 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. 24 h before transfection, Huh7 cells were seeded into 96-well plates at a density of 10,000 cells per well with 100 μL of medium per well. Following the product instructions, siRNA was transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778150) at a final concentration of 90 nM to 0.0015 nM. Twenty-four hours after transfection, RNA was isolated from cells using a cell extraction kit (Zhiang Biotechnology, MNTR / FX96). Reverse transcription was performed using a reverse transcription kit (HiScript III All-in-one RT SuperMix Perfect for qPCR, R333-01), and quantitative real-time PCR was performed using a qPCR kit (Vazyme, Q711) to determine the mRNA level of DGAT2. The DGAT2 mRNA level was corrected based on the β-actin internal reference gene level. The results are expressed as the remaining percentage of DGAT2 mRNA expression (represented as 100%) in cells not treated with siRNA. The IC50 value was calculated as a percentage; the smaller the IC50 value, the higher the inhibitory activity of the siRNA. The results are shown in Table 9. Table 9 Example 8: Pharmacological evaluation of the conjugate in a GAN-induced NASH mouse model SPF-grade male C57 mice induced by GAN (Gubra-Amylin NASH) feeding were randomly divided into groups of 6 mice each after acclimatization. The solvent group was given phosphate-buffered saline (PBS) for drug efficacy, while the experimental group was given a subcutaneous dose of 10 mg / kg of the conjugate. Drug administration was performed every two weeks for 8 weeks, after which the drug was discontinued. At the experimental endpoint, the animals were euthanized, their livers were harvested, weighed, and the expression level of DGAT2 mRNA was measured. Liver sections were prepared and stained with hematoxylin and eosin (HE). Serum was collected for blood biochemical analysis. Figure 3 shows the residual expression level of DGAT2 mRNA in mouse liver compared to the PBS group after using the test conjugate. Figure 4 shows the liver / body weight ratio. Figure 5 shows the liver HE staining results. Table 10 shows the blood biochemistry data. The results showed that the SD007306 administration group significantly reduced the expression level of DGAT2 mRNA in liver tissue. The SD007306 administration group also improved hepatic steatosis. Liver function was improved in the SD007306 administration group, with ALT and AST showing a decreasing trend compared to the PBS group. Table 10 Example 9: Activity test of the conjugate in mice SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 3 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 3 mg / kg per mouse. At 7, 14, and 21 days post-administration, the animals were euthanized, and their livers were harvested. The expression level of DGAT2 mRNA was detected using qPCR. Results are expressed as the residual expression level of the siRNA-treated group compared to the solvent group (the solvent group was 100%). The sequences of the conjugates used for injection are shown in Tables 4 and 5, and were prepared according to the method in Example 2. The residual expression level of DGAT2 mRNA in mouse liver after using the test conjugates is shown in Figure 6 and Table 11. The results showed that SD007742 had the best activity and was used in the cynomolgus monkey efficacy test. Table 11 Example 10: Evaluation of siRNA conjugate activity in non-human primates (NHP) In this embodiment, the in vivo activity of the siRNA conjugate SD007742 was evaluated in non-human primate (NHP) cynomolgus monkeys. Healthy male cynomolgus macaques aged 3-5 years were selected, with 3 macaques per group. Grouping and liver biopsy were performed 7 days before drug administration for subsequent DGAT2 mRNA detection. SD007742 was administered subcutaneously on day 0 at a dose of 3 mpk. Animal experiments, as well as corresponding animal husbandry and quarantine, were conducted by WuXi AppTec. Liver biopsies were performed on day 14 after drug administration, and liver tissue was collected. DGAT2 mRNA expression levels were detected using qPCR. Target gene DGAT2 primers: Forward primer: GTTTCGCCCCATGCATCTTC (SEQ ID NO:173); Reverse primer: ATGGGCTCTCCCACAACAGT (SEQ ID NO: 174); Internal reference gene GAPDH primers: Forward primer: TGCACCACCAACTGCTTAGC (SEQ ID NO:181); Reverse primer: ACTGTGGTCATGAGTCCTTCCA (SEQ ID NO:182). Table 12 shows the residual expression level of DGAT2 mRNA after administration to the subcutaneous liver of cynomolgus monkeys compared to before administration. The maximum KD (knockdown) activity was 85.9%, demonstrating good efficacy. Table 12
Claims
1. A double-stranded RNA comprising a sense strand and an antisense strand, characterized in that: Each nucleotide in the double-stranded RNA is independently modified or unmodified; the sense strand comprises a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO. 1 to 86 or a nucleotide sequence differing from the above sequences by no more than 3 nucleotides, and the antisense strand comprises a nucleotide sequence selected from the nucleotide sequences shown in SEQ ID NO. 87 to 172 or a nucleotide sequence differing from the above sequences by no more than 5 nucleotides.
2. The double-stranded RNA according to claim 1, characterized in that: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.9 or a nucleotide sequence with no more than 2 nucleotide mutations thereof, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.95 or a nucleotide sequence with no more than 2 nucleotide mutations thereof; (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.31 or a nucleotide sequence with no more than 2 nucleotide mutations thereof, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.117 or a nucleotide sequence with no more than 2 nucleotide mutations thereof; (3) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 43 or a nucleotide sequence with no more than two nucleotide mutations thereof, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 129 or a nucleotide sequence with no more than two nucleotide mutations thereof; or (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.81 or a nucleotide sequence with no more than 2 nucleotide mutations thereof, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.167 or a nucleotide sequence with no more than 2 nucleotide mutations thereof.
3. The double-stranded RNA according to claim 2, characterized in that: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.9 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.95 or a nucleotide sequence with no more than one nucleotide mutation therein; (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.31 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.117 or a nucleotide sequence with no more than one nucleotide mutation therein; (3) The sense strand comprises the nucleotide sequence shown in SEQ ID NO. 43 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO. 129 or a nucleotide sequence with no more than one nucleotide mutation therein; or (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.81 or a nucleotide sequence with no more than one nucleotide mutation therein, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.167 or a nucleotide sequence with no more than one nucleotide mutation therein.
4. The double-stranded RNA according to claim 3, characterized in that: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.9, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.95; (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.31, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.117; (3) The sense strand contains the nucleotide sequence shown in SEQ ID NO. 43, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 129; or (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.81, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.
167.
5. The double-stranded RNA according to any one of claims 1 to 4, characterized in that: The sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded structure; and / or, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide; and / or, at least one phosphate group is a phosphate group with a modifying group; and / or, the 5' terminal nucleotide of the sense strand and / or the 3' terminal nucleotide of the sense strand are linked to an anti-base deoxyribose residue containing a phosphate group or a thiophosphate group.
6. The double-stranded RNA according to claim 5, characterized in that: The modified nucleotide is selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof; and / or, the phosphate ester group having the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom.
7. The double-stranded RNA according to any one of claims 1 to 4, characterized in that: The modified nucleotides are 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl modified nucleotides, phosphate thioester bond modified nucleotides, VP modified nucleotides, LNA, ENA, cET, BNA, UNA, GNA, and One or more combinations thereof, wherein R1 is H, OH or CH3, and Base is a natural nucleobase, a modified nucleobase, a universal base or a H atom.
8. The double-stranded RNA according to any one of claims 1 to 4, characterized in that: The sense strand contains a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, and a thiophosphate group; and / or, the antisense strand contains a 2'-methoxy modified nucleotide, a 2'-fluoro modified nucleotide, and a thiophosphate group.
9. The double-stranded RNA according to any one of claims 1 to 4, characterized in that: In the 5' to 3' direction, any one or more nucleotides at positions 7, 9, and 11 of the positive strand are 2'-fluorinated nucleotides; or, any one or more nucleotides at positions 7, 8, and 9 of the positive strand are 2'-fluorinated nucleotides; and / or, In the 5' to 3' direction, any one or more nucleotides at positions 1 to 6, 8, 10, 12 to the last position of the positive strand are 2'-methoxy modified nucleotides; or, any one or more nucleotides at positions 1 to 6, 10 to the last position of the positive strand are 2'-methoxy modified nucleotides; and / or, In the 5' to 3' direction, at least one of the following nucleotide linkages in the positive strand is a phosphate thioester linkage: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides; or, The nucleotide at the 5' end of the positive strand and / or the nucleotide at the 3' end of the positive strand are respectively linked to a reverse-deoxyribose residue containing a phosphate ester group or a thiophosphate ester group; or, In the 5' to 3' direction, any one or more nucleotides at the second, sixth, fourteenth, and sixteenth positions of the antisense strand are 2'-fluorinated nucleotides; or, any one or more nucleotides at the second, fourteenth, and sixteenth positions of the antisense strand are 2'-fluorinated nucleotides; and / or, In the 5' to 3' direction, at least one of the following nucleotide linkages in the antisense strand is a phosphate thioester linkage: the first and second nucleotides, the second and third nucleotides, the last and last second nucleotides, and the last second and last third nucleotides; and / or, Following the 5' to 3' direction, any one or more nucleotides at positions 2 to 8 of the antisense strand are... And / or, In the antisense strand, one or more nucleotides at positions other than those described above are 2'-methoxy modified nucleotides; and / or, The first nucleotide of the antisense strand, in the 5' to 3' direction, contains a VP modification.
10. The double-stranded RNA according to claim 1, characterized in that: The double-stranded RNA is selected from the sequences shown in Table 1 or Table 2.
11. The double-stranded RNA according to claim 1, characterized in that: (a) The justice chain contains GmsCmsUmGmUmGmCfUmCfUmAfCmUmUmCmAmCmUmUm, and the antisense chain contains AmsAfsGmUmGmAmAmGmUmAmGmAmGmCfAmCfAmAmGmCmsGmsAm; (b) The justice chain contains GmsAmsAmCmUmAmUfAmUfCmUfUmUmGmGmAmUmAmAm, and the antisense chain contains UmsUfsAmUmCmCmAmAmAmGmAmUmAmUfAmGfUmUmCmsCmsUm; (c) The justice chain contains CmsAmsUmAmGmAmCfUmAfUmUfUmGmCmUmUmUmCmAm, and the antisense chain contains UmsGfsAmAmAmGmCmAmAmAmUmAmGmUfCmUfAmUmGmsGmsUm; or (d) The justice chain contains GmsUmsCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm, and the antisense chain contains UmsUfsUmUmAmAmAmUmAmAmCmCmCmCmAfCmAfGmAmCmsAmsCm.
12. The double-stranded RNA according to claim 1, characterized in that: (a) The justice chain contains IB-s-GmCmUmGmUmGmCfUmCfUmAfCmUmUmCmAmCmUmUm-s-IB, and the antisense chain contains AmsAfsGmUmGmAmAmGmUmAmGmAmGmCfAmCfAmAmGmCmsGmsAm; (b) The justice chain contains IB-s-GmAmAmCmUmAmUfAmUfCmUfUmUmGmGmAmUmAmAmAm-s-IB, and the antisense chain contains UmsUfsAmUmCmCmAmAmAmGmAmUmAmUfAmGfUmUmCmsCmsUm; (c) The justice chain contains IB-s-CmAmUmAmGmAmCfUmAfUmUfUmGmCmUmUmUmCmAm-s-IB, and the antisense chain contains UmsGfsAmAmAmGmCmAmAmAmUmAmGmUfCmUfAmUmGmsGmsUm; (d) The justice chain contains IB-s-GmUmCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm-s-IB, and the antisense chain contains UmsUfsUmUmAmAmAmUmAmAmCmCmCmCmAfCmAfGmAmCmsAmsCm; or (e) The justice chain contains IB-s-GmUmCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm-s-IB, and the antisense chain contains VPUmsUfsUmUmAmAmAmUmAmAmCmCmCmCmAfCmAfGmAmCmsAmsCm.
13. The double-stranded RNA according to claim 1, characterized in that: The antisense strand comprises 18 to 23 nucleotides, more specifically 20 to 22 nucleotides, and further, the nucleotide length of the antisense strand is 21 nt; or, the double-stranded RNA is capable of inhibiting DGAT2 expression.
14. A double-stranded RNA conjugate, characterized in that: It includes the double-stranded RNA as described in any one of claims 1 to 13, and a conjugating group conjugated to any position of the double-stranded RNA.
15. The double-stranded RNA conjugate according to claim 14, characterized in that: The double-stranded RNA may be linked to one, two, three, or four consecutively connected conjugate groups at any position; or, The conjugation group is attached to the 5' end and / or 3' end of the positive chain.
16. The double-stranded RNA conjugate according to claim 15, characterized in that: The double-stranded RNA conjugate has any of the following structures: in, Indicates double-stranded RNA; R represents any one of the following conjugation groups having the following structures: Where Y is either O or S.
17. The double-stranded RNA conjugate according to claim 14, characterized in that: The double-stranded RNA conjugates are shown in Table 4 or Table 5.
18. The double-stranded RNA conjugate according to claim 14, characterized in that: (a) The justice chain contains SA51SA51SA51-s-IB-s-GmCmUmGmUmGmCfUmCfUmAfCmUmUmCmAmCmUmUm-s-IB, and the antisense chain contains AmsAfsGmUmGmAmAmGmUmAmGmAmGmCfAmCfAmAmGmCmsGmsAm; (b) The justice chain contains SA51SA51SA51-s-IB-s-GmAmAmCmUmAmUfAmUfCmUfUmUmGmGmAmUmAmAmAm-s-IB, and the antisense chain contains UmsUfsAmUmCmCmAmAmAmGmAmUmAmUfAmGfUmUmCmsCmsUm; (c) The justice chain contains SA51SA51SA51-s-IB-s-CmAmUmAmGmAmCfUmAfUmUfUmGmCmUmUmUmCmAm-s-IB, and the antisense chain contains UmsGfsAmAmAmGmCmAmAmAmUmAmGmUfCmUfAmUmGmsGmsUm; (d) The justice chain contains SA51SA51SA51-s-IB-s-GmUmCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm-s-IB; the antisense chain contains UmsUfsUmUmAmAmAmUmAmAmCmCmCmAfCmAfGmAmCmsAmsCm; or (e) The justice chain contains SA51SA51SA51-s-IB-s-GmUmCmUmGmUmGfGmGfUmUfAmUmUmUmAmAmAmAm-s-IB, and the antisense chain contains VPUmsUfsUmUmAmAmAmUmAmAmCmCmCmAfCmAfGmAmCmsAmsCm.
19. A pharmaceutical composition, characterized in that: It includes double-stranded RNA as described in any one of claims 1 to 13 or double-stranded RNA conjugates as described in any one of claims 14 to 18, and pharmaceutically acceptable carriers or excipients.
20. Use of the double-stranded RNA of any one of claims 1 to 13, or the double-stranded RNA conjugate of any one of claims 14 to 18, or the pharmaceutical composition of claim 19 in the preparation of a medicament for treating and / or preventing diseases and / or conditions associated with DGAT2 expression; further, the diseases and / or conditions associated with DGAT2 expression are lipid metabolism disorders; even further, the diseases and / or conditions associated with DGAT2 expression are non-alcoholic fatty liver disease and non-alcoholic steatohepatitis.