Optimized oncolytic coxsackievirus for treatment of cancer

Abstract

The present invention relates to the adaptation and modification of Coxsackievirus B3 (CVB3) and their use or the use of their genomic RNA for the treatment of cancer, in particular for the treatment of gastrointestinal cancer, and furthermore particularly pancreatic and colorectal carcinomas.

Description

[0001] Amtl. Aktenzeichen: 17. Dez 2025

[0002] Unser Zeichen: P18625PC00

[0003] Optimized Oncolytic Coxsackievirus for T reatment of Cancer

[0004] Field of the Invention

[0005] The present invention relates to the adaptation and modification of Coxsackievirus B3 (CVB3) and their use or the use of their genomic RNA for the treatment of cancer, in particular for the treatment of gastrointestinal cancer, and furthermore particularly pancreatic and colorectal carcinomas.

[0006] Background of the Invention

[0007] Pancreatic cancer, specifically pancreatic ductal adenocarcinoma (PDAC), has the lowest survival rate of all cancers. This is mainly due to the limited effectiveness of conventional cancer treatments, such as radio- and chemotherapy.

[0008] Despite the availability of modern chemotherapies such as FOLFIRINOX, which is a combination of folinic acid, 5-fluorouracil, irinotecan and oxaliplatin, the average survival rate for patients with PDAC is about 11 months.

[0009] Recent advances in immunotherapy, particularly checkpoint inhibitors, have raised hopes for improved treatment outcomes. However, clinical trials using PD-1, PD-L1, and CTLA-4 antagonists as monotherapies have so far failed to show significant benefit in patients with PDAC.

[0010] PDAC develops in the exocrine pancreas. In the early stages of tumorigenesis, mutations in the KRAS gene, which occur in around 90% of PDACs, are oncogenic driver mutations and play a central role in initiating oncogenic signaling pathways promoting the formation of pancreatic intraepithelial neoplasia (PanIN), which is considered to be a precursor to PDAC.

[0011] A characteristic of PDACs is their highly immunosuppressive tumor microenvironment (TME), which results in these tumors being immunologically "cold" and poorly immunogenic. The pancreatic ductal adenocarcinoma TME is characterized by extensive infiltration of immunosuppressive cell populations that shield tumor cells from T-cell-mediated immune surveillance and hinder the development of effective anti-tumor immunity. This immunosuppression is mediated through the secretion of cytokines and chemokines, as well as direct inhibition of cytotoxic T lymphocytes (CTLs) and dendritic cells (DCs).

[0012] Further, PDACs are fibrotic tumors with an extremely dense stroma that surrounds and penetrates the tumor. This excess connective tissue contains high levels of collagen, fibronectin, periostin and hyaluronic acid, but few vascular structures, accounting for up to 80% of the tumor mass. This connective tissue structure promotes tumor cell proliferation and represents a significant physical barrier to conventional chemotherapies, radiotherapies and immunotherapies, including common oncolytic virus (OV) therapies.

[0013] Despite their potential, current OV therapies face major challenges due to the low sensitivity of tumor cells to OVs and the poor permeability of the TME to viruses. Their effectiveness of treatment varies Amtl. Aktenzeichen: 17. Dez 2025

[0014] Unser Zeichen: P18625PC00 significantly, with only a small proportion of patients benefiting from OV monotherapy. The underlying reasons for the resistance of tumor cells to OVs are diverse and poorly understood. They include physical barriers in the form of compact connective tissue structures, inefficient virus uptake due to a lack of or low expression of virus receptors on the surface of the target cells, lack of support for the viral replication machinery due to dysregulated cellular signal cascades, and insufficient release of the OV from the infected tumor cell due to inefficient induction of cell lysis.

[0015] It is thus, an object of the present invention to improve efficiency, timely generation and the administration of OVs for the use in treatment of cancer, in particular for the treatment of pancreatic and colorectal carcinomas.

[0016] Besides others, this object is solved by the present invention in providing a modified Coxsackievirus B3 (CVB3) deriving from strain PD-H according to claim 1. Further advantageous details, aspects and embodiments of the present invention are represented by the embodiments of the dependent claims.

[0017] The CVB3 strain PD-H is known and pre-published [A. Hazini et al., Hum Gene Then 2018, 29(11), 1301-1314], In the context of the present application, it is disclosed as cDNA sequence (SEQ ID No 5) beingthe translation of the viral genomic RNA (i RNA) sequence of CVB3 strain PD-H.

[0018] In the context of the present invention the term “oncolytic virus” (OV) refers to a virus capable of selectively and / or preferably infecting and lysing cancer cells over non-cancerous cells. Although many OVs are capable of infecting both cancer cells and non-cancerous cells, certain functional differences in cancer cells can promote viral uptake and replication as well as cellular lysis. These include the overexpression of viral receptor molecules on the surface of cancer cells, thereby enhancing viral uptake, as well as defects in the cellular antiviral defense mechanisms resulting from disruption of the type I interferon signaling pathway, the JAK / STAT signaling pathway, and the activity of protein kinase R eventually leading to the death of the cancerous cell.

[0019] According to the teaching of the present invention the mechanism of OVs is advantageously based on the destruction of tumor cells through viral replication and subsequent cell death e.g. by lysis, accompanied by the stimulation of both the innate and adaptive immune responses, resulting in an overall or systemic anti-tumor effect.

[0020] In other words, tumor cell death occurs through two interrelated mechanisms. First, direct lysis of tumor cells as a consequence of viral replication, and second, the subsequent release of immunologically active molecules, including pathogen-associated molecular patterns (PAMPs), danger-associated molecular patterns (DAMPs), cytokines, tumor-associated antigens (TAAs), and neoantigens, from the lysed cells. As such, the OVs of the invention are capable of influencing the TME, overcoming its immunosuppressive characteristics, and converting immunologically “cold” tumors into “hot” immune-responsive tumors.

[0021] Due to the efforts of the inventors a novel method for the adaptation of preselected or known OVs was used to generate additionally disease-adapted and further genetically modified CVB3 (deriving from the strain PD-H) with enhanced replication competence and improved anti-tumor efficacy.

[0022] The hereinafter described and applied adaptation method, which uses a volume-based passaging as a variant of the previously filed invention regarding a dose-based passaging method [WO 2024 / 088585A1], Amtl. Aktenzeichen: 17. Dez 2025

[0023] Unser Zeichen: P18625PC00 enables a substantially accelerated adaptation of the OV in comparison with traditional virus selection methods. The time required for development of an adapted virus according to the previous invention of the present inventors achieves a suitable and directed adaptation in less than one month.

[0024] In particular, the modified CVB3 of the invention exhibit enhanced oncolytic activity toward tumor cells, including but not limited to pancreatic and colorectal cancer cells, by overcoming the immunological barriers that hinder effective viral spread and immune activation within solid tumors.

[0025] Interestingly, the modified Coxsackievirus B3 of the invention showed particularly improved oncolytic activity compared to the parent virus (PD-H) in KPC cells not only in vitro but also in KPC cell tumors in vivo. Further surprisingly, this significantly increased oncolytic activity of the claimed viruses compared to their parent (PD-H) was also detected in several other pancreatic cancer cell lines as well as in colorectal tumor cell lines. Contrary to a general hypothesis, a virus as generated in this application and identified in the examples e.g. as PDKPC-375TS can thus effectively be used for the treatment of pancreatic carcinomas but also for colorectal carcinomas.

[0026] In one embodiment of the present invention a CVB3 of the strain PD-H, a non-enveloped, positive-sense, single-stranded RNA virus of the genus Enterovirus within the family Picornaviridae, was used as the starting point for the adaptation method and further for the genetic modification to generate the modified virus of the invention. The viral genome of CVB3 encodes a single polyprotein that is proteolytically cleaved into structural (VP1-VP4) and non-structural proteins necessary for viral replication and assembly.

[0027] In more detail, the open reading frame (ORF) of the CVB3 encodes a polyprotein which is processed into the 4 structural (VP1 - VP4) forming the viral shell and 7 non-structural proteins (2A - 2C, 3A - 3D), as well as 3 intermediate cleavage products (2BC, 3AB and 3CD), which are involved in virus replication.

[0028] Processing of the polyprotein is mediated by two key cysteine proteases 2Apro and 3Cpro. The 2Aproreleases itself from the polyprotein by cis-cleavage and initiates the separation of the Pl region which includes the structural protein from the P2 and P3 region which includes the nonstructural proteins. The 3Cprosubsequently cleaves the non-structural protein precursors into intermediate and mature products and is responsible for 8 of the 10 cleavages of the viral polyprotein.

[0029] To enhance the oncolytic activity the inventors applied the method of adaptation to the CVB3 of the strain PD-H having SEQ ID No.: 5 leading to the modified CVB3 of the invention having at least one or more nucleotide substitution within the 5’ untranslated region (5’UTR) and / or one or more nucleotide substitution within the coding sequence of the viral polyprotein.

[0030] As used herein, the term “untranslated region (UTR)” refers to a section of a nucleotide sequence that is not translated into an amino acid sequence. These regions may be located at the 5’end (5’UTR) and / or the 3’end (3’UTR) of a coding sequence. Further, UTRs may influence the regulation of transcription, RNA stability, and / or translation efficiency.

[0031] In the context of the present invention the term “coding sequence” refers to a section of a nucleotide sequence that encodes an amino acid sequence. The coding sequence typically comprises a series of codons, triplets of nucleotides, each of which corresponds to a particular amino acid or a translational stop signal in accordance with the genetic code. Amtl. Aktenzeichen: 17. Dez 2025

[0032] Unser Zeichen: P18625PC00

[0033] In the context of the present invention the term “nucleotide substitution” refers to the replacement of one nucleotide with another at a specific position within a nucleotide sequence. Such substitutions may occur within a coding sequence or an untranslated region. When occurring within a coding sequence, a substitution may lead to a change in the encoded amino acid, missense substitution, or it may be a synonymous substitution, leading to no change in the amino acid sequence. Nucleotide substitutions within UTRs may influence the regulation of transcription, RNA stability, and / or translation efficiency, without altering the encoded protein.

[0034] In the context of the present invention the term “amino acid substitution” refers the replacement of one amino acid by another within a polypeptide sequence. Such substitutions may result from one or more nucleotide substitutions within the corresponding coding sequence.

[0035] The one or more 5’UTR nucleotide substitution of the modified virus of the present invention are selected from the group comprising t249(nt)c and c736(nt)t. In the context of the present invention a nucleotide substitution is indicated using the notation xz(nt)y, where ‘x’ represents the original nucleotide, ‘y’ represents the substituted nucleotide and ‘z’ denotes the position of the substitution within the nucleotide sequence. The notation ‘(nt)’ specifies that the substitution occurs at the nucleotide level, rather than at the amino acid level. For example, the notation t249(nt)c indicates that the nucleotide thymine (t) at position 249 of the nucleotide sequence is substituted with cytosine (c).

[0036] The one or more nucleotide substitution within the coding sequence of the viral polyprotein of the modified virus of the invention results in at least one amino acid substitution being selected from the group comprising K112N, S348T, A512T, A661V, E768D, Y887C, and C1477T. In the context of the present invention, amino acid substitutions are indicated using the notation XZY, where ‘X’ represents the original amino acid, ‘Y’ represents the substituted amino acid, and ‘Z’ denotes the position of the substitution within the amino acid sequence.

[0037] Additional nucleotide substitutions within the coding sequence are to be considered as involved as long as such a single nucleotide substitution or multiple nucleotide substitutions leads to the codon required to encode the desired amino acid substitution.

[0038] These nucleotide substitutions as defined in claim 1 result in modifications to the viral genome that lead to enhanced cell toxicity in pancreatic and / or colon tumor cells compared to the parental virus. The term “parental or parent virus” defines in the context of this disclosure the starting material of the selected OV, which is then used for directed evolution. In any case the parent virus is a known and pre-described virus strain, which ideally was already used in humans and / or has a defined safety profile.

[0039] According to the invention, the term cell toxicity or cytotoxicity is understood as the ability of a virus, in particular an OV, to induce the destruction of infected cells, host cells, such as tumor cells, primarily through virus-mediated replication and subsequent cell lysis. In addition, the lysis of infected cells leads to the release of immunologically active factors, which can influence the tumor microenvironment by overcoming its immunosuppressive characteristics, thereby promoting an effective anti-tumor immune response. Amtl. Aktenzeichen: 17. Dez 2025

[0040] Unser Zeichen: P18625PC00

[0041] In one embodiment of the present invention the inventors found the most effective nucleotide substitutions which cause cell toxicity in pancreatic and / or colon tumor cells can be selected from the nucleotide substitution t249(nt)c within the 5’ untranslated region (5’UTR), the nucleotide substitution within the coding sequence of the viral capsid protein (VP3) of the viral polyprotein resulting in the amino acid substitution A512T, and / or the nucleotide substitution within the coding sequence of the viral capsid protein (VP1) of the viral polyprotein resulting in the amino acid substitution A661V or any combinations thereof. According to one exemplary embodiment of the invention the genome of the modified CVB3 corresponds to the cDNA sequence SEQ ID No: 1, herein after connected to or addressed as PDKPC and having the nucleotide substitution t249(nt)c within the 5’ untranslated region (5’UTR), the nucleotide substitution within the coding sequence of the viral capsid protein (VP3) of the viral polyprotein resulting in the amino acid substitution A512T, and the nucleotide substitution within the coding sequence of the viral capsid protein (VP1) of the viral polyprotein resulting in the amino acid substitution A661V, wherein SEQ ID No: 1 represents the cDNA translated from or translatable into the viral genomic RNA of the so-called PDKPC.

[0042] Genomic RNA of a CVB3 is a positive-sense (+) RNA. In the sense of the present invention the term "positive-sense (+) RNA" means that the genomic sequence is oriented forward relative to the translation start of the coding sequence. Thus, for the preparation of a cDNA construct this sequence was reverse transcribed and amplified by PCR to generate a DNA double strand.

[0043] In vivo studies commonly show that the pancreas and the heart are the organs most strongly affected by a Coxsackievirus B infection as off-target sites when different CVB3 variants are used. Therefore, there is a significant interest in, and need for, improving the selectivity, and consequently the safety, of such OVs for medical use in treating patients in need thereof.

[0044] In another embodiment of the invention the modified CVB3 further carries at least one of the microRNA target sequences for miR-375, miR-145, miR-143, miR-1, miR-124a and miR-122. Identified as miR-375TS, miR-145TS, miR-143TS, miR-lTS, miR-124aTS and miR-122TS, wherein TS stands for target sequence.

[0045] In the sense of the present invention " microRNA target sequences (miR-TS)” refers to a nucleotide sequence that is complementary, or at least substantially complementary, to endogenous microRNA sequences. These miR-TS allow - if the respective targeted tissue-specific microRNA is expressed in the infected off- target site host cell - that the respective complementary microRNA guide strand of the host cell can bind to the miR-TS and induce RNA interference (RNAi)-mediated RNA silencing, thus prohibiting virus replication.

[0046] Substantially complementary to microRNA sequences is to be understood as a respective nucleotide sequence that exhibits a degree of complementarity sufficient to permit specific binding. In particular, the sequence may be at least about 70% complementary, preferably at least about 80% complementary, more preferably at least about 90% complementary, to the target microRNA sequence in the respective cell.

[0047] According to one exemplary embodiment of the invention, the genome of the modified CVB3 corresponds to the cDNA sequence SEQ ID No: 3 wherein SEQ ID No: 3 represents the cDNA translated from or translatable into the viral genomic RNA carrying additionally the miR-TS complete complementary to human pancreas specific miR-375. This inventive OV, PDKpc-375TS, shows a Amtl. Aktenzeichen: 17. Dez 2025

[0048] Unser Zeichen: P18625PC00 surprisingly high and efficient replication as well as modifications of proteins involved in the antiviral IFN-pathway and also a stronger and earlier induction of apoptosis in comparison with the parental PD-H virus strain. It is particularly specific in its cell toxicity and thus in its efficiency to eliminate and kill cancerous cells, particularly pancreatic or colon cancer cells.

[0049] In another embodiment of the invention the modified CVB3 further carries additionally at least one transgene which codes for a polypeptide capable of enhancing and / or improving the oncolytic effect.

[0050] The term “at least one transgene” is understood as a single transgene or a plurality of transgenes. Accordingly, the term encompasses embodiments containing one, two, three, or more transgenes.

[0051] In the sense of the present invention the term “transgene” refers to a nucleotide sequence that is integrated into the viral genome and encodes a polypeptide that exerts an enhancing and / or supporting effect on the oncolytic activity. Preferably, the transgene according to the invention is selected from immunomodulatory transgenes.

[0052] Additionally, the term transgene does comprise any synthetic sequence or a sequence deriving from an other organism, thus in the context of the invention the term transgen also comprise miR-TS, as previously described. In other words, the integration of an immunomodulatory transgene does not preclude the integration of a miR-TS, and vice versa. Both can be present either independently or in combination. Furthermore, the transgene itself may be a microRNA.

[0053] According to the inventors, suitable and preferred immunomodulatory transgenes encode molecules selected from, but not limited to, cytokines, chemokines, immune checkpoint molecules, transcription factors and metabolic enzymes.

[0054] According to the invention one preferred immunomodulatory transgene is the Neo-2 / 15. Neo-2 / 15 is a synthetically designed, heat and denaturation-stable IL-2 analogon with amino acid sequence homology to human IL-2 of only 14%. The protein binds with high affinity to the I L-2R£y complex and avoids activation of the IL-2Ra subunit.

[0055] The IL-2Ra subunit poses a major challenge in cancer therapy because the IL-2Ra subunit is expressed in off-target cells such as endothelial cells and immunosuppressive regulatory T cells (Tregs). These cells respond to high-dose IL-2 much more strongly than the intended target cells (e.g., CD8+ naive T cells), resulting in a pleiotropic response with severe side effects and therefore limiting the clinical use of IL-2. In contrast, Neo-2 / 15 specifically stimulates CD8+ T cells and NK cells, while avoiding excessive activation of immunosuppressive Treg cell thereby allowing an anti-tumor immune response and less side effects.

[0056] According to the invention, the transgene may be integrated at various positions within the viral genome of the modified CVB3, with integration within the VP1-2A junction being preferred as it provides high tolerance and strongest expression of the inserted gene.

[0057] According to the teaching of the invention, the length of the integrated transgene is variable and allows sequences at least up to 1428 bp. Short sequences are, however, preferred, since the efficiency of virus generation and transgene stability may decrease as transgene length increases.

[0058] In one embodiment of the invention the inventors demonstrate that Neo-2 / 15 was successfully Amtl. Aktenzeichen: 17. Dez 2025

[0059] Unser Zeichen: P18625PC00 integrated and expressed as functional active protein from the PD-H variant, PD-Neo-2 / 15, and was capable of inducing IL-2 receptor signalling and proliferation of CD4+ and CD8+ T cells in vitro. In vivo, PD-Neo-2 / 15 inhibited Colon-26 tumor growth more effectively than PD-H and modulated the TME by enrichment with CD8+ T cells and NK cells.

[0060] In further embodiments the advantages of the modified CVB3, which are - beside others - an improved target specificity to tumor cells, are not only combined with the safty features of the miRNA-TS but also with the enhancing features of the immunomodulatory transgene, e.g. Neo-2 / 15.

[0061] The present invention further comprises the nucleic acid encoding the genomic coding sequences of the claimed modified CVB3. In particular this can be the isolated cDNA sequence translated from or translatable into the viral genomic RNA.

[0062] In another aspect of the invention the modified CVB3 is used for treatment of oncological conditions, wherein the term “oncological conditions” is understood as disease, disorder, or pathological state characterized by abnormal or dysregulated cell growth. Such oncological conditions in the context of the invention include, but are not limited to, gastrointestinal cancers including colorectal carcinoma, oesophageal cancer, pancreatic cancer, prostate cancer, gastric cancer, and liver cancer.

[0063] For the use in treatment the above-described modified CVB3 is further provided in form of a pharmaceutical composition comprising an effective amount of the modified CVB3 and / or a nucleic acid encoding the modified CVB3, be it pure, encapsulated or protected, and a suitable additive such as a pharmaceutically acceptable diluent, preservative, solubilizes, emulsifier, adjuvant, carrier and / or excipient.

[0064] In another embodiment of the invention a nucleic acid encoding the modified CVB3 is provided in from of a pharmaceutical composition further comprising at least one transport vesicle capable of infecting cancer cells.

[0065] It is also to be understood that the nucleic acid encoding the modified CVB3 may be packaged within the transport vesicle and can optionally be used in a pharmaceutical composition or in a pure form.

[0066] In the context of the present invention, the term “infecting cancer cells” or any linguistic variation thereof, refers to and includes any attachment, uptake, introduction or integration of genetic information, such as DNA, cDNA, mRNA and / or viral RNA, into a cell employing molecular standard technologies. This encompasses processes including but not limited to transfection, fusion and / or transduction.

[0067] For the infection of a cancer cell a nucleic acid encoding the OV, such as the modified CVB3 of the invention, is preferably provided in form of iRNA.

[0068] According to the inventors it is advantageous to use iRNA to generate OVs, virus replication in the target cell must be based on the administered iRNA. A small group of viruses, namely single-stranded (ss) positive-sense (+) RNA viruses, meet this requirement as their replication cycle can be initiated by ribosome-dependent translation of the iRNA. The preferred viruses include, in addition to members of the families Flaviviridae, Togaviridae, Coronaviridae, Caliciviridae, Astroviridae, and Hepeviridae, the Picornaviridae. Amtl. Aktenzeichen: 17. Dez 2025

[0069] Unser Zeichen: P18625PC00

[0070] The term “iRNA” refers to genomic RNA of a virus that is synthetically generated from a DNA precursor, usually viral copy DNA (cDNA). When iRNA is introduced into tumor cells, the iRNA serves as a template for the generation of OVs that induce cell lysis and spread further.

[0071] The advantage of administering OVs in the form of iRNA is the low immunogenicity, as otherwise OVs are quickly removed from the bloodstream due to binding to blood cells, sequestration by phagocytic cells in the liver and spleen, and / or neutralization by neutralizing antibodies (nAb), and are therefore unable or inefficient to reach the tumor.

[0072] According to the inventors, a further advantage is the ability to re-administer iRNA to patients who have been previously treated with OVs and have developed neutralizing antibodies against OVs. Additionally, the initial infection of a suitable host cells with the OVs is receptor-independent and can be significantly modulated and emphasized by the transport vesicle.

[0073] According to the teaching of the invention already the application of naked iRNA is sufficient to generate virions in tumor cells, as demonstrated in vitro in colorectal tumor cells or in vivo in colorectal tumors.

[0074] For the use in these selected treatments the only distinction might be the pharmaceutical composition and suitable carriers or transport vesicles, which can vary between enteral or intraperitoneal compared to intravenous or other pathways for administration.

[0075] In one further embodiment, the transport vesicles are selected from but not limited to, lipid nanoparticles (LNPs), such as targeted lipid nanoparticles, and extracellular vesicles, such as exosomes, for delivering functionally active iRNA of any oncolytic virus, preferably the modified CVB3, into tumors. The use of LNPs and extracellular vesicles containing proteins / peptides which bind selectively to tumor cells enables specific transfer of the iRNAs into the host cells.

[0076] According to the inventors the transfer of iRNAs into tumor cells can be further improved by inserting nucleotide modifications into the iRNA to increase the resistance to RNases.

[0077] Additionally, it did proof advantageously to package the modified coxsackievirus of the invention in exosomes to be administered e.g. intravenously or intraperitoneally for tumor therapy. This also reduced the problem of virus neutralization by the immune system or by prior preimmunization against CVB3. This approach seemed particularly promising in terms of a systemically applicable tumor therapy against pancreatic carcinoma with the modified CVB3 strains of the invention.

[0078] Consequently, the inventors produced and purified a modified CVB3 packaged in exosomes. Here it was found that CVB3 also adheres to the outside of the exosomes, so that it was not possible to produce a CVB3 exosome solution, without free virus particles.

[0079] According to the invention, in one embodiment, the complete viral RNA (iRNA) of the modified CVB3, e.g PDKPC, and thus, a virus particle free composition was used to be packaged, into the exosomes. Surprisingly, it was successfully demonstrated that packaging the viral RNA in exosomes results in effectively infectious units suitable for the use in the treatment of cancer. Amtl. Aktenzeichen: 17. Dez 2025

[0080] Unser Zeichen: P18625PC00

[0081] Description of the Figures

[0082] Figure 1 1 Volume-based passaging of PD-H on KPC cells.

[0083] (A) Scheme of volume-based passaging method of PD-H. One well each with 1,2 x 106KPC cells / 6-well (2ml cell culture medium) were infected according to the scheme

[0084] (B) Viral titers of adapted PD-H passage P1-P10. Virus was isolated at 48-72 h through three freeze / thaw cycles, and the virus titer was determined by plaque assay on HeLa cells. Data are shown as mean values ± SD from 1 experiment with two replicates.

[0085] Figure 2 | Adaption of PD-H in KPC cells and performance of PDKPC.

[0086] (A) Changes of cell viability during adaptation of PD-H. KPC cells were infected with 0.1 MOI of PD-H and the adapted virus from passage 1-10 (P1-P10). Cell viability was measured by XTT assay 48 h post-infection. Shown are mean values ± SD from 2 independent experiments.

[0087] (B) Detection of mutations in P5 and PIO. Upper panel with schematic of PD-H genomic RNA and location of the nucleotide substitutions within the genome; lower panels with chromatograms of the sanger sequencing of viral RNA isolated from P5 and PIO with position of nucleotide (nt) and resulting amino acid (aa) substitutions.

[0088] (C) Cell viability. KPC cells were infected with PD-H and PDKPC with 0.1 MOI or not infected (control) and cell viability was measured 48 h post-infection. Shown are mean values ± SD from 3 independent experiments set relative to control. The Student’s t test was used to analyze the significance of infected cells versus control or as indicated. Significance, * p<0.01, *** p<0.001.

[0089] (D) Calculation of ECSo shift of PDKPC compared to PD-H. KPC cells were infected with PD-H and PDKPC at indicated MOI and measured cell viability was set relative to control (not shown, not infected cells). ECSo shift was calculated by dividing the calculated MOI of both viruses (table).

[0090] (E) Virus growth kinetics. KPC cells were infected with PD-H and PDKPC at MOI of 0.01. Virus titer was determined by plaque assay at indicated times. Shown are mean values ± SD from 3 independent experiments.

[0091] (F) Determination of CVB3 VP1 protein. KPC cells were infected with PD-H and PDKPC at MOI 0.1 and 1 and VP1 and beta actin proteins were analyzed by western blotting 24 h post-infection.

[0092] (G) Effect of heparin on PDKPC infection in KPC cells: PDKPC at MOI 0.1 or 1 was incubated with DMEM containing heparin (5000 pg / ml) or without heparin for 1 h before being applied to the cells. Cell viability was measured 48 h post-infection. Data are shown as mean values ± SD from 3 independent experiments. Statistical significance as indicated: *** p < 0.001.

[0093] Figure 3| Comparison of oncolytic efficiency and replication of PD-H and PDKPC in pancreatic tumor cell lines.

[0094] (A) Cell viability. The pancreatic tumor cell lines were infected with PD-H or PDKPC (MIA Paca-2 MOI 10, BxPC-3 MOI 10, Capan-1 MOI 0.1, AsPC-1 MOI 0.1, Beta-TC-3 MOI 0.01, Capan-2 MOI 5) and cell viability was measured 48 h post-infection. Shown are mean values ± SD from 3 independent experiments. Amtl. Aktenzeichen: 17. Dez 2025

[0095] Unser Zeichen: P18625PC00

[0096] Significance compared to control (uninfected cells) or as indicated, * p<0.05, *** p<0.001; n.s., not significant.

[0097] (B) Virus titer. Cells were infected with PD-H or PDKPC (MIA Paca-2, BxPC-3, Capan-2 MOI 0,1, Capan-1, AsPC-1 MOI 0.01, Beta-TC-3 MOI 0.001) and virus titer was determined 0, 24 and 48 h after infection by plaque assay on HeLa cells. Shown are mean values ± SD from 3 independent experiments.

[0098] Figure 4 | Comparison of oncolytic efficiency and replication of PD-H and PDKPC in colorectal cancer cell lines.

[0099] Cell viability. The colorectal cancer cell lines were infected with PD-H or PDKPCand cell viability was measured 24 or 48 h post-infection (CaCo-2 and CT26-Luc MOI 1 for 24 h, DLD-1 and Colon-26 MOI 0,148 h, Colo-205 MOI 0,1 for 24h, Colo-320 and MC-38 MOI 1 48h). Shown are mean values ± SD from 3 independent experiments. Significance compared to control (uninfected cells) or as indicated, * p<0.05, ** p<0.01, *** p<0.001; n.s., not significant.

[0100] Figure 5 | Functional analysis of PDKPC in KPC cells.

[0101] (A) Attachment and uptake of PD-H and PDKPC to KPC cells. Virus attachment: KPC cells were infected with 0.1 MOI of PD-H and PDKPC on ice, and cells were washed two times with ice-cold PBS and viral RNA was isolated. Virus uptake: Cells were infected with 0.1 MOI of PD-H and PDKPC for lh at 37°C, and cells were washed two times with ice-cold PBS and viral RNA was isolated. Virus genome copy number was determined by qRT-PCR. Shown are mean values ± SD from 3 independent experiments. Significance as indicated, * p<0.05; n.s., not significant.

[0102] (B) Relative cleaved caspase 3 / 7 activity in KPC cells 24 and 48 h after infection with PD-H and PDKPC at indicated MOIs. Shown are mean values ± SD from 3 independent experiments. Statistical significance compared to PD-H as indicated, * p<0.05, ** p<0.01 and *** p<0.001; n.s., not significant.

[0103] (C) Determination of cellular STAT1 and PKR proteins involved in IFN pathway and apoptosis. Upper images, KPC cells were infected with 0.1 or 1 MOI of PD-H or PDKPC and analyzed 24 h later for expression of STAT1 and PKR by western blotting. The beta actin expression was used as internal loading control. Lower diagrams: Quantification of the expression of indicated proteins was carried out relative to the expression of beta actin by densitometric analysis using the ImageJ version 1.53a densitometry software and expression of STAT1 and PKR was set relative to the expression of non-infected cells (control) which was set as 100%. Shown are mean values ± SD. Statistical significance compared to control, * p<0.05 and *** p<0.001; n.s., not significant.

[0104] Figure 61 Role of individual amino acid substitutions for cytotoxicity and replication of PDKPC.

[0105] (A) Schematic representation of generated PDKPC variants. The following mutants were generated. PDUTR (T249(nt)C), PDVP3(A512T), PDVPi(A661V), PDUTR+VP3(T249(nt)C), A512T), PDUTR+VPI (T249(nt)C, A661V), PDVP3+VPI (A512T, A661V) and PDKPC (T249(nt)C, A512T, A661V). Shown are the respective changes of the nucleotide in the 5 'UTR or the aa substitutions compared to PD-H. Columns in the scheme represent the location of nucleotide substitutions compared to PD-H.

[0106] (B) Cell viability. KPC cells were infected with the indicated viruses at MOI 0.1 and 1. Cell viability was measured 48 h (upper panel) and 72 h (lower panel) post-infection. Shown are mean values ± SD from 3 Amtl. Aktenzeichen: 17. Dez 2025

[0107] Unser Zeichen: P18625PC00 independent experiments. Statistical significance compared to PD-H, * p<0.05, ** p<0.01 and *** p<0.001; n.s., not significant.

[0108] (C) Virus growth kinetics. KPC cells were infected with PD-H and the PDKPC variants from (A) at MOI 0.1 for 48 h and the virus titers were determined by plaque assay on HeLa cells. Shown are mean values ± SD from 3 independent experiments. Statistical significance compared to PD-H, ** p<0.01 and *** p<0.001.

[0109] Figure 7 | Oncolytic activity of PD-H and PDKPC in C57BL / 6J mice with subcutaneous KPC cell tumors.

[0110] KPC tumors were established on both flanks of C57BL / 6J mice. When one of the tumors reached a volume of ~50 mm3, the tumor was injected with 5><107PFU PD-H (n=8), PDKPC (n=8), or with PBS (n=7). Injection was repeated on the following two days. The contralateral tumor remained untreated. All animals were sacrificed 7 days after first injection.

[0111] (A) Left panel: Growth of the injected tumor. Arrows indicate injection times. Right panel, tumor weight. Seven days after first virus injection of the tumors with PBS, PDKPC or PD-H, both tumors of an animal were explanted and the weight of each tumor was measured. Data are shown as mean values ± SEM for each group. Statistical analysis was performed using a Mann-Whitney U-test compared to PBS-treated animals or as indicated, *, p<0.05, ** / ##, p<0.01, ***, p<0.001, n.s., not significant.

[0112] (B) Left panel: Growth of the non-injected tumor. Right panel, tumor weight. Data are presented as in A.

[0113] (C) Representative H&E and Sirus Red staining of tumors. Arrows indicate necrotic areas.

[0114] (D) Virus titer in explanted tumors determined by plaque assay on HeLa cells-.

[0115] Figure 8 | Safety of PD-H and PDKPC in C57BL / 6J mice with subcutaneous KPC cell tumors.

[0116] (A) Development of animal weight following treatment of animals described under Figure 7. Data are shown as mean values ± SEM for each group.

[0117] (B) Distribution of replicative virus of PD-H- and PDKpc-treated animals in indicated organs (heart, spleen, liver) and serum determined by plaque assay on HeLa cells and virus genome copy number in the pancreas determined by quantitative RT-PCR.

[0118] (C) HE Score of the pancreas of PD-H- and PDKPC -treated animals. An H&E score ranging from 0 to 4 was assigned, where 0 = no pathological changes, 1 = minimal pathological changes, 2 = mild pathological changes, 3 = moderate pathological damage, and 4 = severe pathological damage. Data are shown as mean values ± SEM for each group.

[0119] Figure 9 | Plasmid map of PDKPC-375TS CDNA clone.

[0120] The cDNA of PDKpc-375TS contains the complete genomic sequence of the virus. Downstream of the 3D Polymerase two target sites of the miR-375 were inserted into the 3’UTR.

[0121] Figure 10 | Oncolytic activity of PD-H, PD-H-375TS, PDKPC and PDKPC-375TS on pancreas tumor cell lines. Amtl. Aktenzeichen: 17. Dez 2025

[0122] Unser Zeichen: P18625PC00

[0123] (A) Cell viability. The pancreatic tumor cell lines were infected with either PD-H, PD-H-375TS, PDKPC or PDKpc-375TS at different MOIs (KPC:0.1; AsPC-l;0.1; Beta-TC-3:0.01; Capan-l:0.1; Capan-2:5; MIA PaCa-2:10; BxPC-3:10) and cytotoxicity was determined by XTT assay 48 h after infection. Infected cells were set in relation to untreated cells (100%, control). Shown are mean values ± SD from 3 independent experiments. Statistical significances between control and infected cells or as indicated; ***p<0.001, **p<0.01 and *p<0.05, n.s., not significant.

[0124] (B) Virus titer. KPC cells were infected with PD-H, PD-H-375TS, PDKPC or PDKpc-375TS with 0.01 MOI and virus titer was determined 0, 24 and 48 h post-infection by plaque assay on HeLa cells. Shown are mean values ± SD from 3 independent experiments.

[0125] Figure 11 1 Oncolytic activity of PDKPC-375TS in C57BL / 6J mice with subcutaneous KPC cell tumors.

[0126] KPC tumors were established on both flanks of C57BL / 6J mice. When one of the tumors reached a volume of ~50 mm3, the tumor was injected with lxio7PFU PDKpc-375TS (n=8) or with PBS (n=8). Injection was repeated on the following two days and on day 7 and 14 after first injection. The contralateral tumor remained untreated.

[0127] (A) Growth of the tumors. Upper diagram: Growth of the injected tumor. Arrows indicate injection times. Lower diagram: Growth of the non-injected tumor. Data are shown as mean values ± SEM for each group. Statistical significance compared to PBS, ** p<0.01.

[0128] (B) Development of animal weight. Data are shown as mean values ± SEM for each group.

[0129] Figure 12 | Remodeling of immune cell populations in the TME following treatment with PDKPC-375TS in C57BL / 6J mice bearing subcutaneous KPC cell tumors.

[0130] Tumors were established on both flanks of C57BL / 6J mice. One tumor was injected with PDKpc-375TS (lxio7PFU) (n=6) or with PBS (n=6) when one of the tumors reached a volume of ~50 mm3. Tumoral injections were repeated on the following two days. The contralateral tumor remained untreated.

[0131] (A) Growth of the injected tumor. Arrows indicate injection times of PDKpc-375TS.

[0132] (B) Weight of the injected tumor. Seven days after first intratumoral virus injection, tumor weight was measured. Data are shown as mean values ± SEM for each group.

[0133] (C) Distribution of immune cell subsets in injected KPC cell tumors 7 days after the first treatment. Tumor-infiltrating lymphocytes and myeloid cell subsets were analyzed by flow cytometry. Cell numbers were normalized to tumor weight and are shown as counts per mg tissue. Data are presented for CD4+T helper (Th) cells, CD8a+cytotoxic T lymphocytes (CTLs), CDllc+dendritic cells (DCs), CD49+natural killer (NK) cells, CD4+ / FoxP3+CD25+regulatory T cells (Tregs), Ly6ChighLy6G-(CDllb) = monocytic meyloid derived suppressor cells, Ly6ClowLy6G+ (Cdllb) = polymononuclear myeloid derived suppressor cells, and RELM+ / CD206+tumor-associated macrophages (TAMs). Statistical analysis was performed using a Mann-Whitney U-test. Statistical significance compared to PBS-treated animals, *, p<0.05, **, p<0.01, n.s., not significant.

[0134] Figure 13 | Adaptation of PD-H to MC38 cells. Amtl. Aktenzeichen: 17. Dez 2025

[0135] Unser Zeichen: P18625PC00

[0136] (A) Virus growth kinetics. MC38 cells were infected with PD-H at MOI 0.1. Virus titer was determined by plaque assay 24 h, 48 h and 72 h p.i.. Shown are mean values ± SEM (n = 3).

[0137] (B) Cell viability of MC38 cells after infection with PD-H. MC38 cells were infected at indicated MOI with PD-H. Cell viability was measured by XTT assay after 24 h, 48 h and 72 h. Cell viability was normalized to untreated cells (= 100%). Shown are mean values ± SEM (n = 3).

[0138] (C) Scheme of the serial passaging of PD-H on MC38 cells. For Pl cells were infected with PD-H at MOI 0.1 and incubated for 72 h. For further passaging to P10, the stated amount of a 1:10 dilution was added to fresh MC38 cells and incubated for the indicated time.

[0139] (D) Development of viral titers during serial passaging of PD-H on MC38 cells. The virus titers were determined by plaque assay on HeLa cells.

[0140] (E) Changes of the ability of PD-H to lyse MC38 cells during passaging. MC38 cells were infected with PD-H, and P-2, P-4, P-5, P-6, P-8 and P-10 at MOI 1. Cell viability was measured by XTT assay 48 h after infection. Shown are mean values ± SEM (n = 3). Significance, * p < 0.05; ** p < 0.01; **** p < 0.0001.

[0141] (F) Virus growth kinetics. MC38 cells were infected with PD-H and P-10 at MOI 0.1. Virus titer was determined by plaque assay. Shown are mean values ± SEM (n = 3). Significance compared to PD-H, * p < 0.05; **** p < 0.0001.

[0142] Figure 14 | Sequence analysis of P-10 and comparison of P-10 with other CVB3 isolates.

[0143] (A) Analysis of mutations occurred in P-10. Shown are eight electropherograms of the sanger sequencing of viral RNA isolated from PD-H and P-10. Nucleotide substitutions are highlighted in yellow boxes. For seven mutations a double signal in sanger sequencing was detected.

[0144] (B) Scheme of the genome of PD-H. The location of the mutations, the mutated nucleotides and the resulting amino acid substitutions detected in P-10 are indicated.

[0145] (C) Comparison of the nucleotide and amino acid substitutions found in PD-10 with other CVB3 strains. Only a partial cDNA is available for the RD strain, no comparison was carried out for the mutations in 2A and 3A protein.

[0146] Figure 15 | Replication and oncolytic activity of PD-MC38

[0147] (A) Virus growth kinetics. MC38 cells were infected with PD-H, P-10 and PD-MC38 at MOI 0.1. Virus titer was determined by plaque assay. Shown are mean values ± SEM (n = 3). There was no significant difference between P-10 and PD-MC38. Significance of PD-MC38 compared to PD-H, ** p < 0.01; *** p < 0.001.

[0148] (B) Cell viability of MC38 cells after infection. MC38 cells were infected at indicated MOI with PD-H, P-10 and PD-MC38. Cell viability was measured by XTT assay 48 h later. Cell viability was normalized to untreated cells (= 100%). Shown are mean values ± SEM (n = 3). Significance, * p < 0.05; ** p < 0.01; *** p < 0.001.

[0149] (C) Representative images of viral plaques (white dots) of PD-H, P-10 and PD-MC38 on HeLa cell monolayers. Amtl. Aktenzeichen: 17. Dez 2025

[0150] Unser Zeichen: P18625PC00

[0151] (D) Graphical representation of plaque size of PD-H, P-10 and PD-MC38 shown under C. Shown are mean values ± SEM for n = 50 plaques.

[0152] Figure 16 | Comparison of oncolytic efficiency of PD-MC38 and PD-H in different colorectal cancer cell lines.

[0153] The colorectal cancer cell lines DLD-1, Colo320, Colo205, CaCo-2, Colon-26 and CT-26Luc were infected with PD-H and PD-MC38 at indicated MOI; cell viability was measured 48 h after infection with XTT assay. Shown are mean values ± SEM (n = 3). Significance, * p < 0.05; ** p < 0.01; **** p < 0.0001.

[0154] Figure 17 | Schematic procedure and time schedule of the generation of tumor cell-specific adapted oncolytic CVB3 strain PD-H

[0155] Figure 18 | Schematic illustration of the mechanism of iRNA application for cancer therapy iRNA can be administered as “naked” iRNA or formulated in exosomes or lipid nanoparticles (LNP). Exosomes and LNP protect the iRNA from targeting by RNases and can simultaneously serve as iRNA transfer vesicles into tumor cells. Schematic illustration modified from E.M. Kennedy et al., Nat Commun. 13 (2022), 5907],

[0156] Figure 19 | Generation of PD-H after in vitro transfection of iPD-H

[0157] (A) Dose-dependent generation of PD-H by transfection of iPD-H in vitro. CHO-K1 cells were transfected with 0.1 or 1 pg of in vitro transcribed iPD-H using Lipofectamine. Virus titers were determined by plaque assay on HeLa cells at the indicated times.

[0158] (B) Production of PD-H after transfection of iPD-H in HEK293 cells and the colorectal carcinoma cell line Colon-26. Cells were transfected with 0.5 pg iPD-H using Lipofectamine; left: transfection efficiency determined by transfection of a GFP-expressing plasmid {top transmitted light microscopy, bottom: GFP expression), right: PD-H formation determined by plaque assay 72 hours after transfection.

[0159] Figure 20 | Generation of PD-H in colorectal tumors and generation of PD-KPC in KPC pancreatic carcinoma cells

[0160] (A) Virus titers in tumors of PDX mice after i.t. application of cDNA-PD-H, iPD-H, and PD-H on day 13 (cDNA-PD-H, PD-H) and day 20 (iPD-H) after application. The virus titer was determined using a plaque assay on HeLa cells.

[0161] (B) Tumor volume development in PDX mice after i.t. application of cDNA-PD-H, iRNA-PD-H, and PD-H. One mouse each was treated i.t. with 50 pg cDNA-PD-H, 30 pg iPD-H, or 3xl06pfu PD-H as soon as the subcutaneous tumors had reached a length of approximately 0.8 cm. The animals were sacrificed on day 13 (cDNA-PD-H, PD-H) and day 20 (iRNA-PD-H) after i.t. application.

[0162] (C) PD-H titers after i.t. administration of iPD-H in immunocompetent mice with subcutaneous Colon-26 tumors. When the tumors reached a size of approximately 0.5 cm, each was injected intratumorally with 30 pg iPD-H. Five days after the first iPD-H injection, the mice were sacrificed and the tumors were excised. The viral titer in the tumors of mice M1-M4 was determined by plaque assay on HeLa cells. Amtl. Aktenzeichen: 17. Dez 2025

[0163] Unser Zeichen: P18625PC00

[0164] (D) Transport of iPD-KPC via exosomes into KPC cells and production of PDKPC in vitro. 2.5 pg iPD-KPC and 60 pl exosomes, produced from a KPC cell culture via the Total Isolation Reagent (Thermo Fisher Inc.), were incubated using ExoFect (BioCat GmbH, Heidelberg, Germany) according to the manufacturer's instructions. The pellet was dissolved in 400 pl lxPBS. KPC cells were incubated with 100 pl of the loaded exosomes per well of a 96-well plate {column: exo-iPD-KPC). As positive controls, KPC cells were transfected with 250 ng / well iPD-KPC {column: iPD-KPC) or infected with 0.1 MOI PDKPC {column: PD-KPC). As a negative control, iPD-KPC was incubated only with ExoFect without exosomes {column: iPD-KPC w / o exo). After 72 hours, the cells were lysed by 3 freeze-thaw cycles and the PD-KPC titers were analyzed by plaque assay on HeLa cells.

[0165] Figure 21 1 Selection of transgene insertion sites

[0166] (A) Schematic overview of GFP transgene insertion sites in the CVB3 PD-H genome. The top left shows the genome of PD-H with red crosses marking regions unsuitable for transgene insertion due to constraints of the viral replication cycle. Below, all tested insertion sites are depicted, ranging from upstream of the VP4 protein to downstream of the 3D polymerase, each with the respective cleavage site.

[0167] (B) Nucleotide and amino acid sequences of wild-type (light grey) and artificial (dark grey) 3Cpro-CS with embedded GFP (green). Nucleotide substitutions within the sequence encoding for the artificial 3Cpro-CS are shown as red letters. Light blue, Amino acids from viral proteins. Note: The 3Cprocleavage motifs vary across the genome. Therefore, different artificial 3Cpro-CS were inserted in different constructs. Cleavage positions are indicated by brown arrows.

[0168] (C) Nucleotide and amino acid sequences of wild-type (light grey) and artificial (dark grey) 2Apro-CS with embedded GFP (green). Light blue, Amino acids from viral proteins. Nucleotide substitutions within the sequence encoding for the artificial 2Apro-CS are shown as red letters. Cleavage positions are indicated by brown arrows.

[0169] Figure 22 | GFP expression and virus production after transfection of PD-H-GFP constructs into HEK-293T cells

[0170] (A) GFP expression and cell lysis after transfection of various PD-GFP plasmid constructs into HEK-293T cells. The cells were seeded in 6-well plates and transfected with 2.5 pg of the viral cDNA.

[0171] (B) Viral titers 72 h post-transfection, determined by TCID50 assay on HeLa cells. Infectious virus was only detected for the GFP-VP4[3Cpro] and the VP1-GFP-2A construct; all other constructs failed to produce virus.

[0172] (C) GFP expression and virus-induced cell lysis of the GFP-VP4[3Cpro]-virus and the VPl-GFP-2A-virus (PD-GFP) . HEK293T cells were infected with MOI 0.1 and GFP expression and cell lysis was monitored 24 h and 48 h post infection (p.i.).

[0173] (D) Virus growth kinetics. HEK293T cells were infected with PD-H or PD-GFP at MOI 0.1. Viral titers were determined over time by TCID50 assay on HeLa cells. Data represent mean ± SEM (n = 3). Significance: **p < 0.01, ***p < 0.001. Amtl. Aktenzeichen: 17. Dez 2025

[0174] Unser Zeichen: P18625PC00

[0175] (E) Cell viability after infection. HEK293T cells were infected with PD-H or PD-GFP at the indicated MOI. Viability was assessed by XTT assay at 24 h (left) and 48 h (right) post-infection and normalized to untreated controls (100%). Data represent mean ± SEM (n = 3). Significance: *p < 0.1, ***p < 0.001.

[0176] Figure 23 | Transgene size correlates with generation of PD-H

[0177] (A) Schematic overview of PD-H constructs carrying transgenes of varying sizes. The GFP-cDNA (714 bp) served as a reference. At the 3’ end truncated GFP-cDNAs were used for shorter inserts of 90 bp, 180 bp 357 bp, and 534 bp, and 3’ truncated luciferase cDNAs were used to generate longer inserts of 894 bp, 1071 bp and 1428 bp. The total genome size and percentage increase compared to wild-type PD-H are indicated. Transgenes are flanked at its 5’ end with a 2Apro-CS and at its 3’end with a mutated 2Apro-CS.

[0178] (B) Assessment of virus-induced cell lysis 72 h post-transfection of HEK293T cells with 2.5 pg DNA in a six well plate. All eight constructs caused cell lysis.

[0179] (C) Viral titers measured 72 h post-transfection byTCID50 assay on HeLa cells.

[0180] Figure 24 | Stability of foreign sequences within the PD-H genome in HeLa, CaCo-2 and Colon-26 cells

[0181] (A) Stability of engineered viruses up to P10. Cells were infected with PD-90, PD-180, PD-357, PD-534, PD-GFP, or PD-1071 at MOI 0.1. After 48 h, virus titers were determined by TCID50 assay on HeLa cells. Cell supernatants were used to infect new cells at the same MOI. This process was repeated to P10. Viral RNA was extracted at each passage, reverse-transcribed, and PCR-amplified using primers flanking the foreign sequence. Table shows the last passage with intact transgene, passages in which a mixed virus population with intact and deleted transgene was detected, and the passage in which the transgene was lost.

[0182] (B) Reinfection of HEK293T cells with PD-GFP (P0-P3) from A. HeLa (left), CaCo-2 (middle), Colon-26 (right) cells were infected at MOI 0.0001 and analyzed for GFP expression {upper image) and cell viability {lower image) using fluorescence and light microscopy 48 h post-infection, respectively.

[0183] (C) Verification of transgene insertion. Viral RNA from PD-GFP (P0-P3) from B) was extracted, reverse-transcribed, and PCR-amplified using primers binding up- and downstream of the transgene encoding sequence within the viral RNA. Products were analyzed by 1% agarose gel electrophoresis. Larger band, amplificate contains the full-length transgene; smaller band, amplificate contains deletion of the transgene encoding sequence.

[0184] Figure 25 | Virus growth kinetics

[0185] (A) HeLa, CaCo-2 and Colon-26 cells were infected with PD-H, PD-90, PD-180, PD-357, PD-534, PD-GFP and PD-1071 at MOI 0.1, virus titer was determined by TCID50 method on HeLa cells. Shown are mean values ! SEM (n = 3).

[0186] (B) Cell viability. HeLa, CaCo-2 and Colon-26 cells were infected with indicated viruses and MOL Cell viability was measured by XTT assay 24 h and 48 h after infection. Cell viability was normalized to untreated cells (= 100%). Shown are mean values ± SEM (n = 3). Significance: PD-H (with transgene) vs. PD-H for each dose. Amtl. Aktenzeichen: 17. Dez 2025

[0187] Unser Zeichen: P18625PC00

[0188] Figure 26 | Characterization of PD-Neo-2 / 15 and PD-Neo-2 / 15-His

[0189] (A) Schematic representation of PD-Neo-2 / 15, PD-GFPtrunc and PD-Neo-2 / 15-His constructs.

[0190] (B) Virus growth kinetics in Colon-26 cells. Cells were infected with PD-H, PD-Neo-2 / 15, PD-Neo-2 / 15-His or PD-GFPtrunc at MOI 0.1. Virus titers were measured at indicated time points using the TCID50 method on HeLa cells. Data represent mean ± SEM (n = 3). Significance: PD-H vs. PD-Neo-2 / 15: *p<0.1, **p<0.01; PD-H vs. PD-Neo-2 / 15-His:#p<0.1, **p<0.01; PD-H vs. PD-GFPtrunc: ^<0.1.

[0191] (C) Cell viability of Colon-26 cells 24 h (upper diagram) and 48 h (lower diagram) after infection. Cells were infected with PD-H, PD-Neo-2 / 15, PD-Neo-2 / 15-His or PD-GFPtrunc at the indicated MOI. Cell viability was assessed via XTT assay at 24 h and 48 h post-infection and normalized to untreated cells (= 100%). Data are shown as mean ± SEM (n = 3). Significance vs. PD-H: *p<0.1, **p<0.01.

[0192] (D) Transgene stability in Colon-26 and HeLa Cells. Cells were infected with PD-Neo-2 / 15 or PD-Neo-2 / 15-His at MOI 0.1. Viruses were harvested 48 h post-infection and used for serial passaging on the respective cell line with MOI 0.1 for up to 10 passages. Viral RNA was extracted from each passage, reverse transcribed, and PCR was performed using primers flanking the Neo-2 / 15 insert. PCR products were analyzed via 1% agarose gel electrophoresis. The pJet-Neo-2 / 15, pJet-Neo-2 / 15-His and pJet-PD-H represent plasmids used for generation of the respective viruses. Transgenes were amplified from these plasmids and analyzed as described above. Upper arrow: PCR fragment contains the transgene. Lower arrow: PCR fragment without transgene.

[0193] Figure 27 | Induction of T-cell proliferation by Neo-2 / 15

[0194] (A) IL-2R3y bioassay confirming Neo-2 / 15 functionality. HEK293T cells were infected with PD-H or PD-Neo-2 / 15 at MOI 0.1 or 0.01. After 48 h, supernatants were collected, centrifuged, and analyzed in a I L-2R3y bioassay. Heat-inactivated samples (30 min at 60 °C) retained activity due to the heat stability of Neo-2 / 15. Data are presented as mean ± SEM (n = 3). Significance: ****p < 0.0001.

[0195] (B) Proliferation of unstimulated and stimulated CD4+and CD8+T cells in response to IL-2 or Neo-2 / 15. Cells were stimulated with anti-CD3 and anti-CD28 in the presence of 3 ng / ml IL-2 or let unstimulated for 48 h. Thereafter they were harvested and cultured for 5 days with no additive (control), 12 ng / ml recombinant IL-2 or indicated volumes of heat-inactivated viral supernatant containing Neo-2 / 15. The supernatant was taken from HEK293T cells infected at MOI 0.1 PD-Neo-2 / 15 for 48 h. Proliferation was assessed by reduction in CFSE signal and flow cytometry. Data show mean ± SEM (n = 3). Significance: *p <0.1, **p<0.01, ***p<0.001, ****p <0.0001 (untreated vs. treated); #p<0.1, ##p<0.01 (IL-2 vs. Neo-2 / 15).

[0196] (C) Proliferation of stimulated CD4+and CD8+T cells with Neo-2 / 15. Cells were stimulated with anti-CD3 and anti-CD28 in the presence 50 pl heat-inactivated viral supernatant containing Neo-2 / 15 or 3 ng / ml IL-2 (control) for 48 h. Cells were harvested and cultured for 5 days with of 50 pl Neo-2 / 15 supernatant or 3 ng / pl IL-2. Proliferation was assessed by reduction in CFSE signal and flow cytometry. A reduction in CFSE signal was used to assess proliferation via flow cytometry. Data are mean ± SEM (n = 3). Significance: **p<0.01, ***p<0.001. Amtl. Aktenzeichen: 17. Dez 2025

[0197] Unser Zeichen: P18625PC00

[0198] Figure 28 | In vivo oncolytic efficacy of PD-H, PD-Neo-2 / 15 and PD-GFPtrunc in the Colon-26 syngeneic mouse tumor model

[0199] 5x105Colon-26 cells were subcutaneously injected into the right flank of BALB / c mice. Five days after tumor cell injection, tumors were intratumorally treated with 5><106PFU virus; injections were repeated on days 6 and 7. PBS was used as control. Tumors and organs were harvested on day 10 after the first virus injection.

[0200] (A) Schematic representation of the experimental timeline including tumor cell inoculation and virus injections.

[0201] (B) Tumor growth curves. Tumor volume is shown as mean ± SEM for each treatment group. Dashed lines indicate the time points of virus injection. Significance: *p <0.1.

[0202] (C) Individual tumor volume data corresponding to (B), shown per animal.

[0203] (D) Tumor growth rate. Growth rates were determined by calculation of increase of tumor volume at day 15 compared to day 5 for each animal. Shown are means ± SEM.

[0204] (E) Tumor weights measured at endpoint (day 15). Data are shown as mean ± SEM. Significance: *p<0.1.

[0205] (F) Tumor-adjusted body weight on day 15. Tumor mass was subtracted from the total body weight on day 15; the resulting value was normalized to the initial body weight (day 0) and expressed as percentage. Significance: *p<0.1.

[0206] (G) Percent change in total body weight over the 15-day experimental period.

[0207] (H) Biodistribution of PD-H, PD-Neo-2 / 15, and PD-GFPtruncin tumor, heart and pancreas on day 15. Viral titers in tumor and pancreas were determined by TCID50 method; viral genome copy numbers in the pancreas were assessed by qRT-PCR. Data shown per animal.

[0208] (I) Histopathological analysis of heart and pancreas. Representative H&E-stained tissue sections on day 10 post-treatment are shown.

[0209] (J) Schematic representation of the experimental timeline for assessment of in vivo transgene stability of PD-Neo-2 / 15.

[0210] (K) Tumor weight on day 8 for each animal.

[0211] (L) Titer of PD-Neo-2 / 15 in the tumor on day 8 for each animal. Viral titers in tumor were determined by TCID50 method.

[0212] (M) Transgene stability of PD-Neo-2 / 15 3 days after i.t. injection in vivo. Viral RNA was extracted from tumor lysat, reverse transcribed, and PCR was performed using primers flanking the Neo-2 / 15 insert. PCR products were analyzed via 1% agarose gel electrophoresis. The pJet-Neo-2 / 15 and pJet-PD-H represent plasmids used for generation of the respective viruses. Transgenes were amplified from these plasmids and used as a control. Upper arrow: PCR fragment contains the transgene. Lower arrow: PCR fragment without transgene. Amtl. Aktenzeichen: 17. Dez 2025

[0213] Unser Zeichen: P18625PC00

[0214] Figure 29 | Expression of miR-216a and miR-39 from OV PDKpc-miR-216a and PDKpc-miR-39

[0215] KPC cells were infected with the indicated viruses or transfected with the miR-216a-expressing plasmid pCMV-miR-216a, and 24 hours later, microRNA expression was determined by qRT-PCR.

[0216] Sequences Amtl. Aktenzeichen: 17. Dez 2025

[0217] Unser Zeichen: P18625PC00

[0218] AAAAAGCACCATTAGAATCTACTTCAAACCGAAGCATGTCAAAGCGTGGATACCTAGACCACCTAGACTCTGCCAATACGAGAA

[0219] GGCAAAGAACGTGAACTTCCAACCCAGCGGAGTTACCACTACTAGGCAAAGCATCACTACAATGACAAATACGGGCGCATTTG

[0220] GACAACAATCAGGGGCAGTGTATGTGGGGAACTACAGGGTAGTAAATAGACATCTAGCTACCAGTGCTGACTGGCAAAACTGT

[0221] GTGTGGGAAAGTTACAACAGAGACCTCTTAGTGAGCACGACCACAGCACATGGATGTGATATTATAGCCAGATGTCAGTGCAC

[0222] AACGGGAGTGTACTTTTGTGCGTCCAAAAACAAGCACTACCCAATTTCGTTTGAAGGACCAGGTCTAGTAGAGGTCCAAGAGA

[0223] GTGAATACTACCCCAGGAGATACCAATCCCATGTGCTTTTAGCAGCTGGATTTTCCGAACCAGGTGACTGTGGCGGTATCCTA

[0224] AGGTGTGAGCATGGTGTCATTGGCATTGTGACCATGGGGGGTGAAGGCGTGGTCGGCTTTGCAGACATCCGTGATCTCCTGT

[0225] GGCTGGAAGATGATGCAATGGAACAGGGAGTGAAGGACTATGTGGAACAGCTTGGAAATGCATTCGGCTCCGGCTTTACTAAC

[0226] CAAATATGTGAGCAAGTCAACCTCCTGAAAGAATCACTAGTGGGTCAAGACTCCATCTTAGAGAAATCTCTAAAAGCCTTAGTT

[0227] AAGATAATATCAGCCTTAGTAATTGTGGTGAGGAACCACGATGACCTGATCACTGTGACTGCCACACTAGCCCTTATCGGTTG

[0228] TACCTCGTCCCCGTGGCGGTGGCTCAAACAGAAGGTGTCACAATATTACGGAATCCCTATGGCTGAACGCCAAAACAATAGCT

[0229] GGCTTAAGAAATTTACTGAAATGACGAATGCTTGCAAGGGTATGGAATGGATAGCTGTCAAAATTCAGAAATTCATTGAATGGC

[0230] TCAAAGTAAAAATTTTGCCAGAGGTCAGGGAAAAACACGAATTCCTGAACAGACTTAAACAACTCCCCTTATTAGAAAGTCAGA

[0231] TCGCCACAATCGAGCAGAGCGCGCCATCCCAAAGTGACCAGGAACAATTATTTTCCAATGTCCAATACTTTGCCCACTATTGCA

[0232] GAAAGTACGCTCCCCTCTATGCAGCTGAAGCAAAGAGGGTGTTCTCCCTTGAGAAGAAGATGAGCAATTACATACAGTTCAAG

[0233] TCCAAATGCCGTATTGAACCTGTATGTTTGCTCCTGCACGGGAGCCCTGGTGCCGGCAAGTCGGTGGCAACAAACTTAATTGG

[0234] AAGGTCGCTTGCTGAGAAACTCAACAGCTCAGTGTACTCACTACCGCCAGACCCAGATCACTTCGACGGATACAAACAGCAGG

[0235] CCGTGGTGATTATGGACGATCTATGCCAGAATCCTGATGGGAAAGACGTCTCCTTGTTCTGCCAAATGGTTTCCAGTGTAGAT

[0236] TTTGTACCACCCATGGCTGCCCTAGAAGAGAAAGGCATTCTGTTCACCTCACCGTTTGTCTTGGCATCGACCAATGCAGGATC

[0237] TATTAATGCTCCAACCGTGTCAGATAGCAGAGCCTTGGCAAGGAGATTTCACTTTGACATGAACATCGAGGTTATTTCCATGTA

[0238] CAGTCAGAATGGCAAGATAAACATGCCCATGTCAGTCAAGACTTGTGACGATGAGTGTTGCCCGGTCAATTTTAGAAAGTGCT

[0239] GCCCTCTTGTGTGTGGGAAGGCTATACAATTCATTGATAGAAGAACACAGGTCAGATACTCTCTAGACATGCTAGTCACCGAG

[0240] ATGTTTAGGGAGTACAATCATAGACATAGCGTGGGGACCACGCTTGAGGCACTGTTCCAGGGACCACCAGTATACAGAGAGAT

[0241] CAAAATTAGCGTTGCACCAGAGACACCACCACCGCCCGCCATTGCGGACCTGCTCAAATCGGTAGACAGTGAGGCTGTGAGGG

[0242] AGTACTGCAAAGAAAAAGGATGGTTGGTTCCTGAGATCAACTCCACCCTCCAAATTGAGAAACATGTCAGTCGGGCTTTCATTT

[0243] GCTTACAGGCATTGACCACATTTGTGTCAGTGGCTGGAATCATATATATAATATATAAGCTCTTTGCGGGTTTTCAAGGTGCTT

[0244] ATACAGGAGTGCCCAACCAGAAGCCCAGAGTGCCTACCCTGAGGCAAGCAAAAGTGCAAGGCCCTGCCTTTGAGTTCGCCGTC

[0245] GCAATGATGAAAAGGAACTCAAGCACGGTGAAAACTGAATATGGCGAGTTTACCATGCTGGGCATCTATGACAGGTGGGCCGT

[0246] TTTGCCACGCCACGCCAAACCTGGGCCAACCATCTTGATGAATGATCAAGAGGTTGGTGTGCTAGATGCCAAGGAGCTAGTAG

[0247] ACAAGGACGGCACCAACTTAGAACTGACACTACTCAAATTGAACCGGAATGAGAAGTTCAGAGACATCAGAGGCTTCCTAGCC

[0248] AAGGAGGAAGTGGAGGTTAATGAGGCAGTGCTAGCAATTAACACCAGCAAGTTTCCCAACATGTACATTCCAGTAGGACAGGT

[0249] CACAGAATACGGCTTCCTAAACCTAGGTGGCACACCCACCAAGAGAATGCTTATGTACAACTTCCCCACAAGAGCAGGCCAGT

[0250] GTGGTGGAGTGCTCATGTCCACCGGCAAGGTACTGGGTATCCATGTTGGTGGAAATGGCCATCAGGGCTTCTCAGCAGCACT

[0251] CCTCAAACACTACTTCAATGATGAGCAAGGTGAAATAGAATTTATTGAGAGCTCAAAGGACGCCGGGTTTCCAGTCATCAACAC

[0252] ACCAAGTAAAACAAAGTTGGAGCCTAGTGTTTTCCACCAGGTCTTTGAGGGGAACAAAGAACCAGCAGTACTCAGGAGTGGGG

[0253] ATCCACGTCTCAAGGCCAATTTTGAAGAGGCTATATTTTCCAAGTATATAGGAAATGTCAACACACACGTGGATGAGTACATGC

[0254] TGGAAGCAGTGGACCACTACGCAGGCCAACTAGCCACCCTAGATATCAGCACTGAACCAATGAAACTGGAGGACGCAGTGTAC

[0255] GGTACCGAGGGTCTTGAGGCGCTTGATCTAACAACGAGTGCTGGTTACCCATATGTTGCACTGGGTATCAAGAAGAGGGACAT

[0256] CCTCTCTAAGAAGACTAAGGACCTAACAAAGTTAAAGGAATGTATGGACAAGTACGGCCTGAACCTACCAATGGTGACTTATGT

[0257] AAAAGATGAGCTCAGGTCCATAGAGAAGGTAGCGAAAGGAAAGTCTAGGCTGATTGAGGCGTCCAGTTTGAATGATTCAGTGG

[0258] CGATGAGACAGACATTTGGTAATCTGTACAAAACTTTCCACCTAAACCCAGGGGTTGTGACTGGTAGTGCTGTTGGGTGTGAC

[0259] CCAGACCTCTTTTGGAGCAAGATACCAGTGATGTTAAATGGACATCTCATAGCATTTGATTACTCTGGGTACGATGCTAGCTTA

[0260] AGCCCTGTCTGGTTTGCTTGCCTAAAAATGTTACTTGAGAAGCTTGGATACACGCACAAAGAGACAAACTACATTGACTACTTG

[0261] TGTAACTCCCATCACCTGTACAGGGATAAACATTACTTTGTGAGGGGTGGCATGCCCTCGGGATGTTCTGGTACCAGTATTTT

[0262] CAACTCAATGATTAACAACATCATAATTAGGACACTAATGCTAAAAGTGTACAAAGGGATTGACTTGGACCAATTCAGGATGAT

[0263] CGCATATGGTGATGATGTGATCGCATCGTACCCATGGCCTATAGATGCATCTTTACTCGCTGAAGCTGGTAAGGGTTACGGGC

[0264] TGATCATGACACCAGCAGATAAGGGAGAGTGCTTTAACGAAGTTACCTGGACCAACGTCACTTTCCTAAAGAGGTATTTTAGA

[0265] GCAGATGAACAGTACCCCTTCCTGGTGCATCCTGTTATGCCCATGAAAGACATACACGAATCAATTAGATGGACCAAGGATCCA Amtl. Aktenzeichen: 17. Dez 2025

[0266] Unser Zeichen: P18625PC00 Amtl. Aktenzeichen: 17. Dez 2025

[0267] Unser Zeichen: P18625PC00

[0268] ATCATTCACTACACAAATATTAATTATTACAAGGATGCCGCATCCAACTCAGCCAATCGGCAGGATTTCGCTCAAGACCCGGGC

[0269] AAGTTCACAGAACCAGTAAAAGATATCATGATTAAATCACTACCAGCTCTCAACTCCCCCACAGTAGAGGAGTGCGGATACAGT

[0270] GACAGGGTGAGATCAATCACATTAGGTAACTCCACCATAACGACTCAGGAATGCGCCAACGTGGTGGTGGGCTATGGAGTATG

[0271] GCCAGATTATCTAAAGGATAGTGAGGCAACAGCAGAGGACCAACCGACCCAACCAGACGTTGCCACATGTAGGTTCTATACCC

[0272] TTGACTCTGTGCAATGGCAGAAAACCTCACCAGGATGGTGGTGGAAGCTGCCCGATGCTTTGTCGAACTTAGGACTGTTTGGG

[0273] CAGAACATGCAGTACCACTACTTAGGCCGAACTGGGTATACCGTACATGTGCAGTGCAATGCATCTAAGTTCCACCAAGGATG

[0274] CTTGCTAGTAGTGTGTGTACCGGAAGCTGAGATGGGTTGCGCAACGCTAGACAACACCCCATCCAGTGCAGAATTGCTGGGG

[0275] GGCGATAGCGCAAAAGAGTTTGCGGACAAACCGGTCGCATCCGGGTCCAACAAGTTGGTACAGAGGGTGGTGTATAATGCAG

[0276] GCATGGGGGTGGGTGTTGGAAACCTCACCATTTTCCCCCACCAATGGATCAACCTACGCACCAATAATAGTGCTACAATTGTG

[0277] ATGCCATACACCAACAGTGTACCTATGGATAACATGTTTAGGCATAACAACGTCACCCTAATGGTTATCCCATTTGTACCGCTA

[0278] GATTACTGCCCTGGGTCCACCACGTACGTCCCAATTACGGTCACGATAGCCCCAATGTGTGCCGAGTACAATGGGTTACGTTT

[0279] AGCAGGGCACCAGGGCTTACCAACCATGAATACTCCGGGGAGCTGTCAATTTCTGACATCAGACGACTTCCAATCGCCATCCG

[0280] CCATGCCGCAATATGACGTCACACCAGAGATGAGGATACCTGGTGAGGTGAAAAACTTGATGGAAATAGCTGAGGTTGACTCA

[0281] GTTGTCCCAGTCCAAAATGTTGGAGAGAAGGTCAACTCTATGGAAGCATACCAGATACCTGTGAGATCCAATGAAGGATCTGG

[0282] AACGCAAGTATTCGGCTTTCCACTGCAACCAGGGTACTCGAGTGTTTTTAGTCGGACGCTCCTAGGAGAGATCTTGAACTATT

[0283] ATACACATTGGTCAGGCAGCATAAAGCTTACGTTTATGTTCTGTGGTTCGGCCATGGCTACTGGAAAATTCCTTTTGGCATACT

[0284] CACCACCAGGTGCTGGAGCTCCTACAAAAAGGGTTGATGCCATGCTTGGTACTCATGTAGTTTGGGACGTGGGGCTACAATCA

[0285] AGTTGCGTGCTGTGTATACCCTGGATAAGCCAAACACACTACCGGTATGTT^CTTCAGATGAGTATACCGCAGGGGGTTTTAT

[0286] TACGTGCTGGTATCAAACAAACATAGTGGTCCCAGCGGATGCCCAAAGCTCCTGTTACATCATGTGTTTTGTGTCAGCATGCA

[0287] ATGACTTCTCTGTCAGGCTATTGAAGGATACTCCTTTCATTTCGCAGCAAAACTTTTACCAGGGCCCAGTGGAAGACGCGATAA

[0288] CAGCCGCTATAGGGAGAGTTGCGGATACCGTGGGTACAGGGCCAACCAACTCAGAAGCTATACCAGCACTCACTGCTGCTGA

[0289] GACAGGTCACACGTCACAAGTAGTGCCGGGTGACACCATGCAGACACGCCACGTTAAGAACTACCATTCAAGGTCCGAGTCAA

[0290] CCATAGAGAACTTCCTATGTAGGTCAGCATGCGTGTACTTTACGAAGTATGCAAACTCAGGTGCCAAGCGGTATGCTGAATGG

[0291] G@AATAACACCACGACAAGCAGCACAACTTAGGAGAAAGCTAGAATTCTTTACCTACGTCCGGTTCGACCTGGAGCTGACGTT

[0292] TGTCATAACAAGTACTCAACAGCCCTCAACCACACAGAACCAAGACGCACAGATCCTAACACACCAAATTATGTATGTACCACC

[0293] AGGTGGACCTGTACCAGAGAAAGTTGATTCATACGTGTGGCAAACATCTACGAATCCCAGTGTGTTTTGGACCGAGGGAAACG

[0294] CCCCGCCGCGCATGTCCATACCGTTTTTGAGCATTGGCAACGCCTATTCAAATTTCTATGACGGATGGTCTGAATTTTCCAGG

[0295] AACGGAGTTTACGGCATCAACACGCTAAACAACATGGGCACGCTATATGCAAGACATGTCAACTCTGGAAGCACGGGTCCAAT

[0296] AAAAAGCACCATTAGAATCTACTTCAAACCGAAGCATGTCAAAGCGTGGATACCTAGACCACCTAGACTCTGCCAATACGAGAA

[0297] GGCAAAGAACGTGAACTTCCAACCCAGCGGAGTTACCACTACTAGGCAAAGCATCACTACAATGACAAATACGGGCGCATTTG

[0298] GACAACAATCAGGGGCAGTGTATGTGGGGAACTACAGGGTAGTAAATAGACATCTAGCTACCAGTGCTGACTGGCAAAACTGT

[0299] GTGTGGGAAAGTTACAACAGAGACCTCTTAGTGAGCACGACCACAGCACATGGATGTGATATTATAGCCAGATGTCAGTGCAC

[0300] AACGGGAGTGTACTTTTGTGCGTCCAAAAACAAGCACTACCCAATTTCGTTTGAAGGACCAGGTCTAGTAGAGGTCCAAGAGA

[0301] GTGAATACTACCCCAGGAGATACCAATCCCATGTGCTTTTAGCAGCTGGATTTTCCGAACCAGGTGACTGTGGCGGTATCCTA

[0302] AGGTGTGAGCATGGTGTCATTGGCATTGTGACCATGGGGGGTGAAGGCGTGGTCGGCTTTGCAGACATCCGTGATCTCCTGT

[0303] GGCTGGAAGATGATGCAATGGAACAGGGAGTGAAGGACTATGTGGAACAGCTTGGAAATGCATTCGGCTCCGGCTTTACTAAC

[0304] CAAATATGTGAGCAAGTCAACCTCCTGAAAGAATCACTAGTGGGTCAAGACTCCATCTTAGAGAAATCTCTAAAAGCCTTAGTT

[0305] AAGATAATATCAGCCTTAGTAATTGTGGTGAGGAACCACGATGACCTGATCACTGTGACTGCCACACTAGCCCTTATCGGTTG

[0306] TACCTCGTCCCCGTGGCGGTGGCTCAAACAGAAGGTGTCACAATATTACGGAATCCCTATGGCTGAACGCCAAAACAATAGCT

[0307] GGCTTAAGAAATTTACTGAAATGACGAATGCTTGCAAGGGTATGGAATGGATAGCTGTCAAAATTCAGAAATTCATTGAATGGC

[0308] TCAAAGTAAAAATTTTGCCAGAGGTCAGGGAAAAACACGAATTCCTGAACAGACTTAAACAACTCCCCTTATTAGAAAGTCAGA

[0309] TCGCCACAATCGAGCAGAGCGCGCCATCCCAAAGTGACCAGGAACAATTATTTTCCAATGTCCAATACTTTGCCCACTATTGCA

[0310] GAAAGTACGCTCCCCTCTATGCAGCTGAAGCAAAGAGGGTGTTCTCCCTTGAGAAGAAGATGAGCAATTACATACAGTTCAAG

[0311] TCCAAATGCCGTATTGAACCTGTATGTTTGCTCCTGCACGGGAGCCCTGGTGCCGGCAAGTCGGTGGCAACAAACTTAATTGG

[0312] AAGGTCGCTTGCTGAGAAACTCAACAGCTCAGTGTACTCACTACCGCCAGACCCAGATCACTTCGACGGATACAAACAGCAGG

[0313] CCGTGGTGATTATGGACGATCTATGCCAGAATCCTGATGGGAAAGACGTCTCCTTGTTCTGCCAAATGGTTTCCAGTGTAGAT

[0314] TTTGTACCACCCATGGCTGCCCTAGAAGAGAAAGGCATTCTGTTCACCTCACCGTTTGTCTTGGCATCGACCAATGCAGGATC

[0315] TATTAATGCTCCAACCGTGTCAGATAGCAGAGCCTTGGCAAGGAGATTTCACTTTGACATGAACATCGAGGTTATTTCCATGTA Amtl. Aktenzeichen: 17. Dez 2025

[0316] Unser Zeichen: P18625PC00 Amtl. Aktenzeichen: 17. Dez 2025

[0317] Unser Zeichen: P18625PC00 Amtl. Aktenzeichen: 17. Dez 2025

[0318] Unser Zeichen: P18625PC00

[0319] GACAGGTCACACGTCACAAGTAGTGCCGGGTGACACCATGCAGACACGCCACGTTAAGAACTACCATTCAAGGTCCGAGTCAA

[0320] CCATAGAGAACTTCCTATGTAGGTCAGCATGCGTGTACTTTACGAAGTATGCAAACTCAGGTGCCAAGCGGTATGCTGAATGG

[0321] GCAATAACACCACGACAAGCAGCACAACTTAGGAGAAAGCTAGAATTCTTTACCTACGTCCGGTTCGACCTGGAGCTGACGTT

[0322] TGTCATAACAAGTACTCAACAGCCCTCAACCACACAGAACCAAGACGCACAGATCCTAACACACCAAATTATGTATGTACCACC

[0323] AGGTGGACCTGTACCAGAGAAAGTTGATTCATACGTGTGGCAAACATCTACGAATCCCAGTGTGTTTTGGACCGAGGGAAACG

[0324] CCCCGCCGCGCATGTCCATACCGTTTTTGAGCATTGGCAACGCCTATTCAAATTTCTATGACGGATGGTCTGAATTTTCCAGG

[0325] AACGGAGTTTACGGCATCAACACGCTAAACAACATGGGCACGCTATATGCAAGACATGTCAACTCTGGAAGCACGGGTCCAAT

[0326] AAAAAGCACCATTAGAATCTACTTCAAACCGAAGCATGTCAAAGCGTGGATACCTAGACCACCTAGACTCTGCCAATACGAGAA

[0327] GGCAAAGAACGTGAACTTCCAACCCAGCGGAGTTACCACTACTAGGCAAAGCATCACTACAATGACAAATACGGGCGCATTTG

[0328] GACAACAATCAGGGGCAGTGTATGTGGGGAACTACAGGGTAGTAAATAGACATCTAGCTACCAGTGCTGACTGGCAAAACTGT

[0329] GTGTGGGAAAGTTACAACAGAGACCTCTTAGTGAGCACGACCACAGCACATGGATGTGATATTATAGCCAGATGTCAGTGCAC

[0330] AACGGGAGTGTACTTTTGTGCGTCCAAAAACAAGCACTACCCAATTTCGTTTGAAGGACCAGGTCTAGTAGAGGTCCAAGAGA

[0331] GTGAATACTACCCCAGGAGATACCAATCCCATGTGCTTTTAGCAGCTGGATTTTCCGAACCAGGTGACTGTGGCGGTATCCTA

[0332] AGGTGTGAGCATGGTGTCATTGGCATTGTGACCATGGGGGGTGAAGGCGTGGTCGGCTTTGCAGACATCCGTGATCTCCTGT

[0333] GGCTGGAAGATGATGCAATGGAACAGGGAGTGAAGGACTATGTGGAACAGCTTGGAAATGCATTCGGCTCCGGCTTTACTAAC

[0334] CAAATATGTGAGCAAGTCAACCTCCTGAAAGAATCACTAGTGGGTCAAGACTCCATCTTAGAGAAATCTCTAAAAGCCTTAGTT

[0335] AAGATAATATCAGCCTTAGTAATTGTGGTGAGGAACCACGATGACCTGATCACTGTGACTGCCACACTAGCCCTTATCGGTTG

[0336] TACCTCGTCCCCGTGGCGGTGGCTCAAACAGAAGGTGTCACAATATTACGGAATCCCTATGGCTGAACGCCAAAACAATAGCT

[0337] GGCTTAAGAAATTTACTGAAATGACGAATGCTTGCAAGGGTATGGAATGGATAGCTGTCAAAATTCAGAAATTCATTGAATGGC

[0338] TCAAAGTAAAAATTTTGCCAGAGGTCAGGGAAAAACACGAATTCCTGAACAGACTTAAACAACTCCCCTTATTAGAAAGTCAGA

[0339] TCGCCACAATCGAGCAGAGCGCGCCATCCCAAAGTGACCAGGAACAATTATTTTCCAATGTCCAATACTTTGCCCACTATTGCA

[0340] GAAAGTACGCTCCCCTCTATGCAGCTGAAGCAAAGAGGGTGTTCTCCCTTGAGAAGAAGATGAGCAATTACATACAGTTCAAG

[0341] TCCAAATGCCGTATTGAACCTGTATGTTTGCTCCTGCACGGGAGCCCTGGTGCCGGCAAGTCGGTGGCAACAAACTTAATTGG

[0342] AAGGTCGCTTGCTGAGAAACTCAACAGCTCAGTGTACTCACTACCGCCAGACCCAGATCACTTCGACGGATACAAACAGCAGG

[0343] CCGTGGTGATTATGGACGATCTATGCCAGAATCCTGATGGGAAAGACGTCTCCTTGTTCTGCCAAATGGTTTCCAGTGTAGAT

[0344] TTTGTACCACCCATGGCTGCCCTAGAAGAGAAAGGCATTCTGTTCACCTCACCGTTTGTCTTGGCATCGACCAATGCAGGATC

[0345] TATTAATGCTCCAACCGTGTCAGATAGCAGAGCCTTGGCAAGGAGATTTCACTTTGACATGAACATCGAGGTTATTTCCATGTA

[0346] CAGTCAGAATGGCAAGATAAACATGCCCATGTCAGTCAAGACTTGTGACGATGAGTGTTGCCCGGTCAATTTTAGAAAGTGCT

[0347] GCCCTCTTGTGTGTGGGAAGGCTATACAATTCATTGATAGAAGAACACAGGTCAGATACTCTCTAGACATGCTAGTCACCGAG

[0348] ATGTTTAGGGAGTACAATCATAGACATAGCGTGGGGACCACGCTTGAGGCACTGTTCCAGGGACCACCAGTATACAGAGAGAT

[0349] CAAAATTAGCGTTGCACCAGAGACACCACCACCGCCCGCCATTGCGGACCTGCTCAAATCGGTAGACAGTGAGGCTGTGAGGG

[0350] AGTACTGCAAAGAAAAAGGATGGTTGGTTCCTGAGATCAACTCCACCCTCCAAATTGAGAAACATGTCAGTCGGGCTTTCATTT

[0351] GCTTACAGGCATTGACCACATTTGTGTCAGTGGCTGGAATCATATATATAATATATAAGCTCTTTGCGGGTTTTCAAGGTGCTT

[0352] ATACAGGAGTGCCCAACCAGAAGCCCAGAGTGCCTACCCTGAGGCAAGCAAAAGTGCAAGGCCCTGCCTTTGAGTTCGCCGTC

[0353] GCAATGATGAAAAGGAACTCAAGCACGGTGAAAACTGAATATGGCGAGTTTACCATGCTGGGCATCTATGACAGGTGGGCCGT

[0354] TTTGCCACGCCACGCCAAACCTGGGCCAACCATCTTGATGAATGATCAAGAGGTTGGTGTGCTAGATGCCAAGGAGCTAGTAG

[0355] ACAAGGACGGCACCAACTTAGAACTGACACTACTCAAATTGAACCGGAATGAGAAGTTCAGAGACATCAGAGGCTTCCTAGCC

[0356] AAGGAGGAAGTGGAGGTTAATGAGGCAGTGCTAGCAATTAACACCAGCAAGTTTCCCAACATGTACATTCCAGTAGGACAGGT

[0357] CACAGAATACGGCTTCCTAAACCTAGGTGGCACACCCACCAAGAGAATGCTTATGTACAACTTCCCCACAAGAGCAGGCCAGT

[0358] GTGGTGGAGTGCTCATGTCCACCGGCAAGGTACTGGGTATCCATGTTGGTGGAAATGGCCATCAGGGCTTCTCAGCAGCACT

[0359] CCTCAAACACTACTTCAATGATGAGCAAGGTGAAATAGAATTTATTGAGAGCTCAAAGGACGCCGGGTTTCCAGTCATCAACAC

[0360] ACCAAGTAAAACAAAGTTGGAGCCTAGTGTTTTCCACCAGGTCTTTGAGGGGAACAAAGAACCAGCAGTACTCAGGAGTGGGG

[0361] ATCCACGTCTCAAGGCCAATTTTGAAGAGGCTATATTTTCCAAGTATATAGGAAATGTCAACACACACGTGGATGAGTACATGC

[0362] TGGAAGCAGTGGACCACTACGCAGGCCAACTAGCCACCCTAGATATCAGCACTGAACCAATGAAACTGGAGGACGCAGTGTAC

[0363] GGTACCGAGGGTCTTGAGGCGCTTGATCTAACAACGAGTGCTGGTTACCCATATGTTGCACTGGGTATCAAGAAGAGGGACAT

[0364] CCTCTCTAAGAAGACTAAGGACCTAACAAAGTTAAAGGAATGTATGGACAAGTACGGCCTGAACCTACCAATGGTGACTTATGT

[0365] AAAAGATGAGCTCAGGTCCATAGAGAAGGTAGCGAAAGGAAAGTCTAGGCTGATTGAGGCGTCCAGTTTGAATGATTCAGTGG

[0366] CGATGAGACAGACATTTGGTAATCTGTACAAAACTTTCCACCTAAACCCAGGGGTTGTGACTGGTAGTGCTGTTGGGTGTGAC Amtl. Aktenzeichen: 17. Dez 2025

[0367] Unser Zeichen: P18625PC00 Amtl. Aktenzeichen: 17. Dez 2025

[0368] Unser Zeichen: P18625PC00

[0369] CCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTATTTCGAAAAACCTAGTA

[0370] ACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCG

[0371] ACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTA

[0372] TTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGT

[0373] GTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTG

[0374] ACAATTGAGAGATTGTTACCATATAGCTATTGGATTGGCCATCCGGTGACCAATAGAGCTATTATATATCTCTTTGTTGGGTTT

[0375] ATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAAATGGGAGCTCAAGTATCAACGC

[0376] AAAAGACTGGGGCACATGAGACCGGGCTGAATGCTAGCGGCAATTCCATCATTCACTACACAAATATTAATTATTACAAGGATG

[0377] CCGCATCCAACTCAGCCAATCGGCAGGATTTCGCTCAAGACCCGGGCAAGTTCACAGAACCAGTAAAAGATATCATGATTAAAT

[0378] CACTACCAGCTCTCAACTCCCCCACAGTAGAGGAGTGCGGATACAGTGACAGGGTGAGATCAATCACATTAGGTAACTCCACC

[0379] ATAACGACTCAGGAATGCGCCAACGTGGTGGTGGGCTATGGAGTATGGCCAGATTATCTAAAGGATAGTGAGGCAACAGCAGA

[0380] GGACCAACCGACCCAACCAGACGTTGCCACATGTAGGTTCTATACCCTTGACTCTGTGCAATGGCAGAAAACCTCACCAGGAT

[0381] GGTGGTGGAAGCTGCCCGATGCTTTGTCGAACTTAGGACTGTTTGGGCAGAACATGCAGTACCACTACTTAGGCCGAACTGG

[0382] GTATACCGTACATGTGCAGTGCAATGCATCTAAGTTCCACCAAGGATGCTTGCTAGTAGTGTGTGTACCGGAAGCTGAGATGG

[0383] GTTGCGCAACGCTAGACAACACCCCATCCAGTGCAGAATTGCTGGGGGGCGATAGCGCAAAAGAGTTTGCGGACAAACCGGT

[0384] CGCATCCGGGTCCAACAAGTTGGTACAGAGGGTGGTGTATAATGCAGGCATGGGGGTGGGTGTTGGAAACCTCACCATTTTC

[0385] CCCCACCAATGGATCAACCTACGCACCAATAATAGTGCTACAATTGTGATGCCATACACCAACAGTGTACCTATGGATAACATG

[0386] TTTAGGCATAACAACGTCACCCTAATGGTTATCCCATTTGTACCGCTAGATTACTGCCCTGGGTCCACCACGTACGTCCCAATT

[0387] ACGGTCACGATAGCCCCAATGTGTGCCGAGTACAATGGGTTACGTTTAGCAGGGCACCAGGGCTTACCAACCATGAATACTCC

[0388] GGGGAGCTGTCAATTTCTGACATCAGACGACTTCCAATCGCCATCCGCCATGCCGCAATATGACGTCACACCAGAGATGAGGA

[0389] TACCTGGTGAGGTGAAAAACTTGATGGAAATAGCTGAGGTTGACTCAGTTGTCCCAGTCCAAAATGTTGGAGAGAAGGTCAAC

[0390] TCTATGGAAGCATACCAGATACCTGTGAGATCCAATGAAGGATCTGGAACGCAAGTATTCGGCTTTCCACTGCAACCAGGGTA

[0391] CTCGAGTGTTTTTAGTCGGACGCTCCTAGGAGAGATCTTGAACTATTATACACATTGGTCAGGCAGCATAAAGCTTACGTTTAT

[0392] GTTCTGTGGTTCGGCCATGGCTACTGGAAAATTCCTTTTGGCATACTCACCACCAGGTGCTGGAGCTCCTACAAAAAGGGTTG

[0393] ATGCCATGCTTGGTACTCATGTAGTTTGGGACGTGGGGCTACAATCAAGTTGCGTGCTGTGTATACCCTGGATAAGCCAAACA

[0394] CACTACCGGTATGTTGCTTCAGATGAGTATACCGCAGGGGGTTTTATTACGTGCTGGTATCAAACAAACATAGTGGTCCCAGC

[0395] GGATGCCCAAAGCTCCTGTTACATCATGTGTTTTGTGTCAGCATGCAATGACTTCTCTGTCAGGCTATTGAAGGATACTCCTTT

[0396] CATTTCGCAGCAAAACTTTTACCAGGGCCCAGTGGAAGACGCGATAACAGCCGCTATAGGGAGAGTTGCGGATACCGTGGGTA

[0397] CAGGGCCAACCAACTCAGAAGCTATACCAGCACTCACTGCTGCTGAGACAGGTCACACGTCACAAGTAGTGCCGGGTGACACC

[0398] ATGCAGACACGCCACGTTAAGAACTACCATTCAAGGTCCGAGTCAACCATAGAGAACTTCCTATGTAGGTCAGCATGCGTGTA

[0399] CTTTACGAAGTATGCAAACTCAGGTGCCAAGCGGTATGCTGAATGGGCAATAACACCACGACAAGCAGCACAACTTAGGAGAA

[0400] AGCTAGAATTCTTTACCTACGTCCGGTTCGACCTGGAGCTGACGTTTGTCATAACAAGTACTCAACAGCCCTCAACCACACAGA

[0401] ACCAAGACGCACAGATCCTAACACACCAAATTATGTATGTACCACCAGGTGGACCTGTACCAGAGAAAGTTGATTCATACGTGT

[0402] GGCAAACATCTACGAATCCCAGTGTGTTTTGGACCGAGGGAAACGCCCCGCCGCGCATGTCCATACCGTTTTTGAGCATTGGC

[0403] AACGCCTATTCAAATTTCTATGACGGATGGTCTGAATTTTCCAGGAACGGAGTTTACGGCATCAACACGCTAAACAACATGGGC

[0404] ACGCTATATGCAAGACATGTCAACTCTGGAAGCACGGGTCCAATAAAAAGCACCATTAGAATCTACTTCAAACCGAAGCATGTC

[0405] AAAGCGTGGATACCTAGACCACCTAGACTCTGCCAATACGAGAAGGCAAAGAACGTGAACTTCCAACCCAGCGGAGTTACCAC

[0406] TACTAGGCAAAGCATCACTACAATGACAAATACGGGCGCATTTGGACAACAATCAGGGGCAGTGTATGTGGGGAACTACAGGG

[0407] TAGTAAATAGACATCTAGCTACCAGTGCTGACTGGCAAAACTGTGTGTGGGAAAGTTACAACAGAGACCTCTTAGTGAGCACG

[0408] ACCACAGCACATGGATGTGATATTATAGCCAGATGTCAGTGCACAACGGGAGTGTACTTTTGTGCGTCCAAAAACAAGCACTA

[0409] CCCAATTTCGTTTGAAGGACCAGGTCTAGTAGAGGTCCAAGAGAGTGAATACTACCCCAGGAGATACCAATCCCATGTGCTTT

[0410] TAGCAGCTGGATTTTCCGAACCAGGTGACTGTGGCGGTATCCTAAGGTGTGAGCATGGTGTCATTGGCATTGTGACCATGGG

[0411] GGGTGAAGGCGTGGTCGGCTTTGCAGACATCCGTGATCTCCTGTGGCTGGAAGATGATGCAATGGAACAGGGAGTGAAGGAC

[0412] TATGTGGAACAGCTTGGAAATGCATTCGGCTCCGGCTTTACTAACCAAATATGTGAGCAAGTCAACCTCCTGAAAGAATCACTA

[0413] GTGGGTCAAGACTCCATCTTAGAGAAATCTCTAAAAGCCTTAGTTAAGATAATATCAGCCTTAGTAATTGTGGTGAGGAACCAC

[0414] GATGACCTGATCACTGTGACTGCCACACTAGCCCTTATCGGTTGTACCTCGTCCCCGTGGCGGTGGCTCAAACAGAAGGTGTC

[0415] ACAATATTACGGAATCCCTATGGCTGAACGCCAAAACAATAGCTGGCTTAAGAAATTTACTGAAATGACGAATGCTTGCAAGGG

[0416] TATGGAATGGATAGCTGTCAAAATTCAGAAATTCATTGAATGGCTCAAAGTAAAAATTTTGCCAGAGGTCAGGGAAAAACACGA Amtl. Aktenzeichen: 17. Dez 2025

[0417] Unser Zeichen: P18625PC00 Amtl. Aktenzeichen: 17. Dez 2025

[0418] Unser Zeichen: P18625PC00

[0419] Examples

[0420] Example 1: Virus adaptation by volume-based passaging procedure

[0421] To adapt the PD-H virus to the pancreatic carcinoma cell line KPC, the established passaging procedure was optimized. Instead of the previous dose-based passaging, the use of a volume-based passaging protocol was implemented.

[0422] The main difference in the volume-based passaging procedure is that, after the virus was initially added to KPC tumor cells (in a 6-well plate) at a defined dose of 0.05 MOI, subsequent passaging was performed using a defined volume rather than a defined virus dose. The step of titrating the virus solution after each passage, as used in the dose-based method, was thus omitted, saving at least 3 days per passage.

[0423] After the virus had induced a lytic infection in the treated tumor cell line in passage 1, which was empirically estimated by observing the cell culture and was between 50-70% dead cells, 0.2 and 2 pl of the virus-containing cell culture supernatant were passaged onto fresh KPC cells according to the scheme in Fig. 1A. For internal control of the completed passaging procedure, plaque titrations were performed on each virus passage. This showed that the virus quantity in the passaged volumes was always < 0.2 MOI , thus remaining below the critical upper limit of 1 MOI, which should not be exceeded.

[0424] Example for volume based passaging procedure:

[0425] Pl: 0,05 MOI PD-H (E22070) for 48 h

[0426] P2: 0,2 pl from Pl for 72 h (back calculation: MOI 0,04)

[0427] P3: 2 pl from P2 for 48 h (back calculation: MOI 0,2) Amtl. Aktenzeichen: 17. Dez 2025

[0428] Unser Zeichen: P18625PC00

[0429] P4: 0,2 |il from P3 for 72 h (back calculation: MOI 0,01)

[0430] P5: 2 |il from P4 for48 h (back calculation: MOI 0,01)

[0431] P6: 0,2 |il from P5 for 72 h (back calculation: MOI 0,01)

[0432] P7: 2 |il from P6 for 48 h (back calculation: MOI 0,05)

[0433] P8: 0,2 |il from P7 for 48 h (back calculation: MOI 0,03)

[0434] P9: 2 |il from P8 for 72 h (back calculation: MOI 0,1)

[0435] P10: 0,2 |il from P9 for 48 h (back calculation: MOI 0,02)

[0436] The passaging was terminated after passage 10 because the primary goal of adaptation, the significant increase in the lytic activity of the virus against PD-H, had been achieved at this point (Fig. 2A). The generated virus was designated as P10.

[0437] To characterize P10, the virus genome was sequenced. Three relevant mutations, in the 5'UTR, VP1 and VP3, were detected (Fig. 2B). While the mutations in the 3'UTR and VP3 appeared as single signals in the sequencing, the mutation in VP1 was present as a double signal next to the original PD-H sequence. This means that P10 contained a mixture of viruses.

[0438] Based on the hypothesis that all detected mutations are positive for the virus, the three mutations were inserted into the cDNA genome of PD-H and used to generate the new oncolytic virus PDKPC.

[0439] PDKPC showed significantly stronger lytic infection than PD-H in KPC cells and demonstrated significantly better replication (Fig. 2C-E). Viral proteins, exemplified here by the VP1 protein detected by Western blotting (Fig. 2F), were expressed earlier and to a greater extent compared to PD-H. To verify whether the mutations in the viral proteins VP1 and VP3 alter the binding of the virus to heparan sulphates (HS), which act as the main receptors for virus uptake in PD-H strains, it was investigated whether virus infection can be inhibited by blocking HS. PDKPC was blocked by heparin to a similar extent as PD-H (Fig. 2G). This proves that the mutations have no influence on the interaction of the virus with HS.

[0440] The present results demonstrate that a novel passaging procedure enabled the generation of a virus adapted to specific tumor cell lines. Furthermore, this approach allowed for the identification of key mutations and the subsequent construction of modified viral variants.

[0441] Example 2: In vitro efficiency and replication of PDKPC

[0442] Lytic efficiency and replication of PDKPC in pancreatic and colorectal tumor cells

[0443] To analyze the replication and lytic efficiency of PDKPC in other pancreatic tumor cell lines, six different cell lines were infected with PDKPC and PD-H (control). Significantly better lytic activity and improved replication were observed in five of the six pancreatic tumor cell lines examined (BxPC-3, Capan-1, AsPC-1, Beta-TC-3, and Capan-2) compared to PD-H (Fig. 3A, B) and in the MIA Paca-2 cell line the effect of PDKPC was similar to that of PD-H.

[0444] These results are surprising as previous adaptations of PD-H to colorectal tumor cell lines by direct viral evolution (DVE) did not show increased lytic infection or replication in other tumor cell lines, apart from the cell line in which the virus adaptation was originally performed. Moreover, PD-H adapted to the Colo320 colorectal tumor cell line performed significantly worse than PD-H in almost all colorectal tumor cell lines examined. Amtl. Aktenzeichen: 17. Dez 2025

[0445] Unser Zeichen: P18625PC00

[0446] Next, the effect of PDKPC on colorectal tumor cell lines was investigated, which are distinct to the pancreatic tumor cell lines used for adaptation. Five of the seven colorectal tumor cell lines examined showed a significant increase in lytic activity compared to PD-H and in the other two cell lines, the lytic activities of PD-H and PDKPC were similar (Fig. 4). This demonstrates that PDKPC is generally superior to PD-H in terms of its oncolytic activity.

[0447] Various experiments were performed to elucidate the mechanisms underlying the increased efficacy of PDKPC compared to PD-H in KPC cells. The results showed that, (i) PDKPC is better taken up by tumor cell lines than PD-H (Fig. 5A), (ii) infection with PDKPC contributes to increased apoptosis induction (Fig. 5B), and (iii) proteins involved in the interferon pathway (Stat-1, PKR) are downregulated more strongly by PDKPC than by PD-H (Fig. 5C).

[0448] The effect of the individual mutations on the improved performance of PDKPC in KPC cells was also investigated. To this end, PD-H derivatives were generated by introducing the mutations identified in PDKPC. It was found that, when inserted into the PD-H genome, each mutation resulted in significantly improved oncolytic activity and replication compared to PD-H. The combination of two mutations led to a further enhancement of the effects, and in the presence of all three mutations (PDKPC), the strongest effects were observed (Fig. 6A-C).

[0449] These findings demonstrate that each mutation in the modified virus enhances lytic activity and improves replication within the cell line used for adaptation. Furthermore, the modified virus has been shown to be more effective than PD-H across a variety of tumor cell lines.

[0450] Example 3: In vivo verification of anti-tumor activity of PDKPC

[0451] To poof the anti-tumor activity of PDKPC in vivo, KPC cells were injected subcutaneously into both flanks of C57 / BL6 mice. Once the tumors had reached a size of ~50 mm3, one of the two tumors was injected with PDKPC (5><107PFU), PD-H (5><107PFU) or PBS on three consecutive days (injected tumor). The other tumor (non-injected tumor) remained untreated.

[0452] Tumor growth was observed over seven days (relative to the initial virus injection). The experiment showed that PD-H and PDKPC significantly reduced the growth of both the injected and non-injected KPC cell tumors (Fig. 7A, B). By analyzing the injected tumor, it also became clear that the treatment with PDKPC was more effective than the treatment with PD-H (Fig. 7A).

[0453] Histological examinations showed the typical picture of a pancreatic tumor. The tumor exhibits compact tumor cell tissue with extensive connective tissue structures (Sirius Red staining - red structures) running through the tumor..

[0454] In tumors injected with PDKPC, large necrotic areas were observed in two animals confirming .the excellent therapeutic effect of PDKPC (Fig. 7C).

[0455] Plaque titrations of tumor tissue showed that replicating viruses were detectable in the tumor tissue of both PD-H-injected tumors (5 out of 8 animals) and PDKpc-injected tumors (4 out of 8 animals), while no viruses could be detected in the non-injected tumor (Fig. 7D)

[0456] Weight loss as side effect was observed in the animals after treatment with PDKPC (Fig. 8A). Examination of the organs at the end of the experiment showed that in the majority of animals injected with PDKPC, Amtl. Aktenzeichen: 17. Dez 2025

[0457] Unser Zeichen: P18625PC00 the virus was detectable in the heart, pancreas and spleen, but not in the liver or serum. In contrast, PD-H was detected in the pancreas and spleen of all animals but at lower concentrations, sporadically in the heart and not at all in serum or liver (Fig. 8B). The pancreata of animals bearing PDKPc-injected tumors showed pronounced pancreatic tissue damage in three animals, with a median H&E score of 2.5-3. In contrast, PD-H-injected mice exhibited only mild pancreatic alterations, with an H&E score of approximately 1 (Fig. 8C).

[0458] In conclusion, PDKPC showed superior anti-tumor efficiency in vivo compared to PD-H. Despite the presence of side effects, a reduction in tumor growth was observed in both the injected and non-injected tumors. Moreover, histological analysis revealed necrotic tumor tissue within the PDKPC injected tumor.

[0459] Example 4: Further modification of the PDKPC genome to prevent side effects

[0460] In order to prevent PDKPC from causing side effects, the virus genome was modified with miR-375TS, using a microRNA-based approach to increase safety of the OV. The miR-375TS are recognized and cleaved in the genome of the newly generated PDKpc-375TS by miR-375, which is highly expressed in the pancreas, causingthe viral genome to be degraded in normal pancreatic cells.

[0461] Since the pancreas serves as the primary site of CVB3 replication in the murine host, facilitating viral dissemination to other organs, direct intratumoral injection of PDKPc-375TS inhibits pancreatic replication, thereby limiting systemic spread to other organs such as the heart. In this context, it is important to note that no degradation of viral RNA occurs in KPC as the expression of miR-375 is low in pancreatic tumor cells.

[0462] The miR-375TS were inserted as a tandem copy downstream of the 3D polymerase into the viral cDNA (Fig. 9). After transfecting KPC cells with the viral cDNA, the oncolytic activity and replication of the PDKPC-375TS virus was evaluated in vitro and compared to that of PDKPC across various carcinoma cell lines, including KPC cells. Both viruses showed comparable efficiency (Fig. 10A, B).

[0463] For the in vivo studies, the KPC tumor model as described in Example 3 was used in C57 / BL6 mice. KPC tumors were injected with PDKpc-375TS at a dose of lxlO7PFU on three consecutive days. The virus dose was thus significantly reduced compared to the experiment of Example 3. PDKPc-375TS was re-applied 7 and 14 days after the initial injection.

[0464] The results of the investigations showed that the injected tumor grew significantly less over the entire investigation period than the control tumor, which was injected with PBS. A significant, reduction in tumor growth was also observed in the non-injected tumor (Fig. 11). No weight reduction was observed as an indication of possible virus-induced side effects.

[0465] Example 5: Remodelling of immune cell populations in the TME following treatment with PDKPC-375TS

[0466] The KPC subcutaneous tumor model described in Example 4 was used in C57BL / 6 mice. KPC tumors were injected with PDKpc-375TS at a dose of lxio7PFU on three consecutive days, and animals were sacrificed 7 days after the first injection for analysis of the tumor microenvironment. In addition to inhibiting tumor growth and reducing tumor weight (Fig. 12A, B), PDKpc-375TS monotherapy increased Amtl. Aktenzeichen: 17. Dez 2025

[0467] Unser Zeichen: P18625PC00 intratumoral infiltration of effector immune cells, including CD8a+cytotoxic T lymphocytes, dendritic cells, and natural killer cells.

[0468] It significantly reduced monocytic MDSCs but increased granulocytic MDSCs and RELM+ / CD206+tumor-associated macrophages. Tregs remained unchanged compared with the PBS group, indicating a mixed and complex pattern of immune activation and immunosuppressive remodeling.

[0469] Example 6: Adaptation of PD-H to MC38 cells

[0470] PD-H replicated strongly in MC38 cells (Fig. 13A) but had low oncolytic activity (Fig. 13B). Even 72 h post-infection (p.i.) with a high MOI of 10, only a slight decrease in cell viability was observed. To improve the performance of PD-H in MC38 cells, the virus was adapted to the cells by volume-based passaging (Fig. 13C).

[0471] A defined volume of cell culture supernatant of infected MC38 cells was transferred to new MC38 cells, to eliminate the time-consuming repeated virus titration as already described in Example 1. The initial infection of the cells was conducted with an MOI of 0.1 for 72 h. For all further infections, a volume between 15 and 30 pL of a 1:10 dilution of the previous passage was used.

[0472] The virus-containing cell supernatant was collected early after cell lysis became visible, which typically occurred 48 or 72 h after the cells were infected (Fig. 13C). Serial passage of PD-H into MC38 cells led to a continuous increase in viral titer, reaching a level approximately 10-fold higher than that of the PD-H founder. The maximum increase in virus titer was observed after passage 5, with no further increase observed up to passage 10, at which point passaging was terminated (Fig. 13D).

[0473] To assess how passaging influenced the oncolytic potential of PD-H, an XTT assay was performed, revealing a significant enhancement in cytolytic activity. This led to the complete lysis of MC38 cells after infection with the P-10 using an MOI of 1 and a 48 h incubation period (Fig. 13E). The viral growth kinetics of the P-10 virus revealed a significant 10- to 100-fold increase in replication compared to the PD-H strain in MC38 cells (Fig. 13F).

[0474] Thus, the volume-based passaging approach facilitated the successful adaptation of PD-H to MC38 cells. The time required to generate tumor cell-adapted P-10 virus was reduced by more than 50%, from more than 60 days to less than 30 days.

[0475] Example 7: Sequence Analysis of P-10 and Comparison of P-10 with Other CVB3 Isolates

[0476] The genomic RNA of P-10 was isolated, reverse transcribed, and sequenced to determine which mutations lead to the adapted phenotype of P-10.

[0477] Eight nucleotide substitutions were detected (Fig. 14A, B). Two of them were found in the 5' UTR and a further six, leading to amino acid substitutions, were detected in the viral polyprotein. Four of them occurred in the viral capsid proteins VP1, VP2, and VP3 and two of them in the non-structural proteins 2A and 3A (Fig. 14B).

[0478] Sequencing revealed double signals in the electropherogram for seven out of the eight detected mutations, indicating that, in addition to the mutated PD-H variant, at least one other virus with a Amtl. Aktenzeichen: 17. Dez 2025

[0479] Unser Zeichen: P18625PC00 genome sequence closely resembling that of PD-H was present in P-10. Thus, P-10 consisted of a mixed virus population.

[0480] To further investigate the significance of the detected mutations, P-10 was compared with the corresponding nucleotide or amino acid sequences in known CVB3 isolates. The analysis revealed that the mutation t249c in the 5' UTR and the mutation A661V in the VP1 protein were present in the majority of other CVB3 isolates, whereas the remaining mutations were specific to P-10 (Fig. 14C). This indicates that the adaptation of PD-H to MC38 has produced a unique CVB3.

[0481] Example 8: Replication and oncolytic activity of PD-MC38

[0482] All mutations identified in P-10 were introduced into the genome of the PD-H strain. The virus PD-MC38, containing these mutations in its genome, was produced through transfection of the respective viral cDNA into HEK293T cells.

[0483] To access the oncolytic properties of PD-MC38, the replication and oncolytic activity was compared with the of PD-H and PD-10 in MC38 cells. Following infection at MOI 0.1, PD-MC38 showed similar replication to P-10, indicating that the insertion of the mutations was beneficial for viral replication (Fig. 15A).

[0484] To investigate the oncolytic activity of all three viruses, we infected MC38 cells with PD-MC38, PD-H, and P-10 at an MOI of 1, 0.1, and 0.01 and measured cell viability 48 h later by XTT assay. At a very low dose of 0.01 MOI, the three viruses did not show oncolytic activity. However, at higher doses of 0.1 and 1 MOI, treatment with PD-MC38 induced a pronounced decrease in MC38 cell viability, reducing it to 65% and 25%, respectively, whereas PD-H had no effect on cell viability.

[0485] Nevertheless, PD-MC38 did not achieve the same level of activity as P-10, which reduced cell viability to 40% at 0.1 MOI and to 12% at 1 MOI (Fig. 15B). A comparison plaque morphology and plaque size between PD-H, P-10, and PD-MC38 showed no significant differences (Fig. 15C, D), indicating that the acquired mutations did not affect these parameters.

[0486] Example 9: Oncolytic efficiency of PD-MC38 in different colorectal cancer cell lines

[0487] To verify whether the adaptation is specific only for MC38 cells, six additional colorectal carcinoma cell lines were infected with PD-M38 and PD-H at 0.01, 0.1, and 1 MOI and the cell viability was determined 48 h later by XTT assay (Fig. 16). In four of the cell lines (Colo320, CT-26Luc, Colon-26, and CaCo-2), PD-MC38 showed similar cytotoxicity to PD-H, whereas in DLD-1 and Colo205 cells, the cytotoxicity of PD-MC38 was significantly lower than that of PD-H. These data demonstrate that the enhanced oncolytic activity of PD-MC38 is effective in MC38 cells.

[0488] Example 10: PD-H virion generation after transfection of cells with iPD-H in vitro

[0489] To determine whether PD-H is generated from iPD-H in tumor cells via T7 polymerase-mediated transcription, the plasmid pJET-CVB3-PD-H was transfected into the packaging cell lines CHO-K1 and HEK293, as well as the colorectal tumor cell line Colon-26. The plasmid contained the cDNA of the oncolytic CVB3 PD-H under the regulatory control of a T7 promoter. Amtl. Aktenzeichen: 17. Dez 2025

[0490] Unser Zeichen: P18625PC00

[0491] PD-H was generated in all three cell lines (Fig. 19A), demonstrating the functionality of iPD-H. However, the PD-H titers varied. Low titers were observed in Colon-26 cells (Fig. 19B, right), while very high titers were detected in CHO-K1 and HEK293 cells (Fig. 19A and Fig. 19B, right). The reason for the low titers in Colon-26 cells was the comparatively low transfection efficiency of iPD-H in Colo-26 cells (Fig. 19B, left).

[0492] Example 11: PD-H generation after intratumoral (i.t.) application of naked iPD-H in colorectal tumors in vivo

[0493] To proof that PD-H is generated after the application of naked iPD-H in tumors, established in immunocompetent mice, the patient-derived xenograft (PDX) of a colorectal tumor (side length approx. 0.8 cm) from an immunodeficient mouse was injected with 30 pg iPD-H i.t..

[0494] 50 pg cDNA (plasmid DNA: pJet-CVB3-PD-H) (one mouse) and 3xl06pfu PD-H (one mouse) were injected directly into the PDX tumor as controls. Animals were sacrificed according to the termination criteria on day 13 (cDNA-PD-H and PD-H) and day 20 (iPD-H), respectively. PD-H was successfully detected in the tumor infected with iPD-H and in the tumor infected with PD-H.

[0495] However, the titer in the tumor injected with iPD-H was significantly lower than the PD-H titer. In contrast, PD-H could not be detected in the cDNA-PD-H control (Fig. 20A). Examination of the tumor volume showed that it was significantly smaller in the iPD-H mouse than in the mouse treated with PD-H and the mouse treated with cDNA-PD-H (Fig. 20B).

[0496] In a further experiment, it was investigated whether PD-H was generated in the tumor after injection of iPD-H into tumors of immunocompetent mice. For this purpose, subcutaneous tumors were established in 4 Balb / C mice by applying the murine colorectal tumor cell line Colon-26. Once the tumors reached a size of approximately 0.5 cm in length, they were injected twice at intervals of one day with 30 pg iRNA-PD-H. Five days after the first iPD-H injection, the PD-H titers in the tumors were determined. PD-H was detectable in the tumors of all 4 treated animals, with high to very high virus titers found in three animals (Fig. 20C).

[0497] These results show that direct i.t. application of naked iPD-H in immunodeficient and immunocompetent mice leads to the formation of PD-H in the tumors. Furthermore, the studies show that PD-H is generated in vivo in both human tumor cells (PDX) and murine tumor cells (Colon-26).

[0498] Example 12: Generation of PDKPC in KPC pancreatic carcinoma cells after application of iPD-KPC-loaded exosomes

[0499] The number of viruses generated from iRNAs in tumor cells and tumors depends on the amount of iRNA taken up into the tumor cell (Fig. 19A) and the number of viruses generated is significant for anti-tumor efficiency. It is therefore to be expected that improving iRNA transfer into the tumor cell / tumor will achieve a better therapeutic effect.

[0500] Furthermore, iRNA transfer should be as specific as possible to tumor cells in order to reduce side effects. Naked iRNAs are susceptible to RNases and cannot be specifically transferred to tumor cells, which are significant disadvantages. This problem could be solved by using transfer vesicles. In addition to LNPs, exosomes are another type of transfer vesicle that could be used. Amtl. Aktenzeichen: 17. Dez 2025

[0501] Unser Zeichen: P18625PC00

[0502] Exosomes are formed by cells in a multi-stage process and released from cells. They serve as transport vehicles and for the release of cell components. They also facilitate cellular communication. Viruses, such as the HI virus, use exosomes for transport and disguise.

[0503] Exosomes are formed by cells in a multi-stage process, after which they are released. They serve as transport vehicles for cell components, protect iRNAs from degradation by RNases and can be specifically loaded with specific proteins or peptides that act as binding molecules to mediate the docking and uptake of exosomes to tumor cells. Thus, exosomes have the potential to increase both the efficiency and specificity of iRNA transfer into tumor cells.

[0504] To demonstrate this, exosomes were prepared from the pancreatic tumor cell line KPC and transfected with iPD-KPC. KPC cells were then treated with these vesicles. As a control, the cells were infected with the PDKPC virus or transfected with iPD-KPC using Lipofectamine.

[0505] The iPD-KPC-loaded exosomes were produced using the Total Exosome Isolation Reagent (Invitrogen™) and the Exo-Fect Exosome Transfection Kit (SBI System Biosciences).The results showed that iPD-KPC was successfully transferred into KPC cells via exosomes, as demonstrated by the detection of PD-KPC in the cells (Fig. 20D, exo-iPD-KPC).

[0506] When iPD-KPC was incubated without KPC exosomes, precipitated, and added to the cells, no viruses were produced (Fig. 20D, iPD-KPC w / o exo), demonstrating that exosomes were indeed responsible for the transfer of iPD-KPC.

[0507] Example 13: Selection of transgene insertion sites and protease 2A and 3C cleavage sites within the genome of PD-H

[0508] Given the critical role of the sequential processing of the CVB3 polyprotein by the viral proteases 2Aproand 3Cpro, as well as the presence of naturally occurring 2Aproand 3Cprocleavage sites (CS) within the viral genome, eight possible sites were identified, where a transgene within the polyprotein can be inserted (Fig. 21A).

[0509] As transgene for these initial investigations the green fluorescent protein (GFP) reporter was chosen, as it can easily be detected and its cDNA has a size of 714 bp. At three of these sites - N-terminal ofVP4, the VP1-2A junction and the C-terminal of 3D - the transgene fused to a new 2Apro-CS was inserted. At seven of these sites - at the N-terminus of the VP4-protein, VP2-VP3, VP3-VP1, 2A-2B, 2C-3A and 3B-3C junction, and at the C-terminus of 3D the transgene was inserted fused to a new 3Cpro-CS).

[0510] To prevent the loss of the transgene by homologous recombination, the nucleotide sequences encoding for the artificial 2Apro-CS and 3Cpro-CS were mutated (Mutated 2Apro-CS, mutated 3Cpro-CS) by nucleotide substitutions, which, however, did not affect their amino acid (aa) sequences (Fig. 21B, C).

[0511] Example 14: Toleration of the GFP reporter within the viral genome

[0512] To elucidate whether the transgene-containing PD-H cDNA constructs are suitable to generate viruses that express GFP HEK293T cells with the nine cDNAs constructs were transfected. The expression of GFP by fluorescence microscopy and virus generation by determination of the TCID50 was analyzed. Amtl. Aktenzeichen: 17. Dez 2025

[0513] Unser Zeichen: P18625PC00

[0514] GFP was detected in cells transfected with the constructs GFP-VP4 [3Cpro], VP1-GFP-2A, 2C-GFP-3A, and 3D-GFP [3Cpro] 48 h and 72 h after transfection. The strength of expression was much higher in cells transfected with VP1-GFP-2A compared to those transfected with GFP-VP4 [3Cpro], 2C-GFP-3A and 3D-GFP [3Cpro]. First signs of cytolysis became evident 48 h after transfection but exclusively in cells transfected with GFP-VP4 [3Cpro], and VP1-GFP-2A. A pronounced cytolysis was detected in these cells 72 hours after transfection, while none of the cells transfected with the other cDNA constructs exhibited cytolysis at this time point (Fig. 22A).

[0515] The virus was generated only after transfection with GFP-VP4 [3Cpro] and VP1-GFP-2A and the virus detection failed in cell transfected with the other constructs (Fig. 22B).

[0516] To assess the replication and cytotoxicity of the GFP-VP4 [3Cpro] and the VP1-GFP-2A virus in more detail, HEK293T cells were infected with the virus and its GFP expression, replication and cytotoxicity was investigated. Infection with a very low MOI of 0. 1 led to GFP expression as early as 24 h post-infection, which further increased after 48 h (Fig. 21C).

[0517] It became clear, that the GFP is tolerated best in the VP1-GFP-2A construct, subsequently referred to as PD-GFP. A one-step growth curve using an MOI of 0.1 revealed replication of PD-GFP, to titers of 107TCID50 / ml at 48 and 72 hours post-infection. However, compared to PD-H, the replication of PD-GFP was approximately 2 log10lower (Fig. 22D). A similar trend was observed for the cytotoxicity which was determined by XTT-assay. Although PD-GFP induced strong cytolysis it remained below that of PD-H (Fig. 22E).

[0518] These data demonstrate that PD-H tolerates a transgene well when it is inserted into VP1-2A junction.

[0519] Example 15: Correlation between transgene length to generation of PD-H following cDNA transfection

[0520] Foreign sequences ranging in their size from 90 bp to 1428 bp were inserted into the VP1-2A junction of PD-H genome. The transgenes from 90 to 534 bp encode for C-terminal truncated versions of GFP, whereas transgenes with a length of 894 to 1428 bp encode for C-terminal truncated versions of luciferase (Fig. 23A).

[0521] Following transfection of respective PD-H cDNAs all eight constructs induced cell lysis in HEK293T cells (Fig. 23B) and led to generation of virus (Fig. 23C) 72 h after transfection.

[0522] A virus titer of 3.95xl08TCID50 / ml was determined for the virus PD-90 containing the smallest foreign gene sequence and a virus titer with up to 9.37xl04TCID50 / ml was found for the virus PD-1428 which contained the largest foreign sequence.

[0523] The data demonstrate that PD-H with foreign sequences up to 1428 bp in length can be produced by transfecting viral cDNAs into HEK293T cells.

[0524] Example 16: Correlation between transgene length to stability of engineered PD-H viruses

[0525] The stability of the transgene within the viral genome is crucial, as it determines both the strength and duration of its expression and is therefore a key factor in the oncolytic activity of an armed OV. Amtl. Aktenzeichen: 17. Dez 2025

[0526] Unser Zeichen: P18625PC00

[0527] To assess the stability of the viruses PD-90 to PD-1071, CaCo-2, and Colon-26 cells were serially passaged in HeLa for a total of 10 passages. After each passage, genomic viral RNA was isolated, and the foreign sequence was amplified using primers targeting the viral genome regions flanking the inserted foreign sequence.

[0528] The resulting PCR fragments were then analyzed by agarose gel electrophoresis and additionally GFP expression of PD-GFP for P0-P3 by fluorescence microscopy was determined. Analysis of viruses passaged in HeLa cells showed that PD-90, PD-180, and PD-357 remained stable up to passage 10 (P10) (Fig. 24A-C).

[0529] These data demonstrate that the stability of the virus strongly depends on the size of the transgene. They also show that there are transitional states in which mixed populations of viruses with and without the transgenes coexist and that virus stability in addition to the length of the transgene is also influenced by the cell line used.

[0530] Example 17: Correlation between transgene length to replication and cytotoxicity of the engineered PD-H

[0531] To investigate whether the differing lengths of the foreign sequences were influencing viral replication and lysis of the PD-H virus in cancer cell lines, the colorectal cancer cell lines CaCo-2 and Colon-26, as well as HeLa cells as a highly PD-H sensitive control, were infected with the respective PD-H constructs.

[0532] In all three cell lines, the virus growth curves showed that replication gradually decreased as the size of the inserted foreign sequence increased. However, the strength of the effect depended on the cell lines studied. Thus, the virus PD-1071 replicated worst in all three cell lines, with HeLa cells showing a 1000-fold poorer replication than PD-H, while in CaCo-2 and Colon-26 cells replication was only about 100-fold lower than that of PD-H.

[0533] Simultaneously, viruses with foreign sequences up to a length of 180 bp replicated in HeLa cells only about 10-fold worse than PD-H, whereas in CaCo-2 and Colon-26 cells a similar reduction in viral replication was observed for viruses containing foreign sequences of up to 357 bp and 534 bp, respectively (Fig. 25A).

[0534] The cytotoxicity of the viruses also decreased with increasing size of the foreign sequence and already insertion of 90 bp of foreign sequences let to significant reduction of cytotoxicity in all cell lines. However, HeLa cells were overall markedly more sensitive to the viruses than CaCo-2 and Colon-26 cells (Fig. 25B).

[0535] In summary, these data demonstrate that the insertion of a foreign sequence into PD-H inhibits viral replication and cytotoxicity. The magnitude of the reduction is inversely proportional to the size of the foreign sequences and is influenced by the host cell line.

[0536] Example 18: Generation and characterization of PD-Neo-2 / 15 and PD-Neo-2 / 15-His

[0537] To analyze whether arming of PD-H with an immunomodulatory transgene can improved its oncolytic activity in colorectal cancer, the cDNA of the IL-2 analogon Neo-2 / 15 (length 351 bp) or a cDNA of a His-tag extended Neo-2 / 15 (length 379 bp) was inserted into the VP1-2A junction of PD-H and generated Amtl. Aktenzeichen: 17. Dez 2025

[0538] Unser Zeichen: P18625PC00 the virus PD-Neo-2 / 15 and PD-Neo / 15-His. The control virus PD-GFPtrunc was also generated, containing a truncated GFP cDNA with has the same length as the cDNA of Neo-2 / 15 (Fig. 26A).

[0539] Growth kinetics of the viruses PD-Neo-2 / 15, PD-Neo-2 / 15-His, and PD-GFPtrunc were determined in Colon-26 cells following infection with 0.1 MOI. The three viruses reached similar titers ranging between 5 to 8 x 107TCID50 / mL (Fig. 26B). The viruses also exhibited similar and strong cytotoxicity after infection of Colon-26 cells 0.01 to 1 MOI (Fig. 26C).

[0540] To determine the genetic stability of PD-Neo-2 / 15 and PD-Neo-2 / 15-His both viruses were serially passaged in Colon-26 and HeLa cells up to P10. The coding sequence of Neo-2 / 15 within the PD-H genome was detected in Colon-26 cells up to P10, and a mixt population consisting of low amounts of virus which has lost the transgene and high amounts of virus still containing the transgene was detected at P8 to P10.

[0541] These results show that PD-H can be equipped with Neo-2 / 15 and Neo-2 / 15-His and the stability of PD-Neo-2 / 15 was superior to PD-Neo-2 / 15-His. Consequently, only PD-Neo-2 / 15 was pursued in subsequent investigations.

[0542] Example 19: Neo-2 / 15 expressed from PD-H enables activation of IL-2 receptor and induces proliferation of human T cells in vitro

[0543] The functionality of PD-H-expressed Neo-2 / 15 was confirmed by investigating whether the protein induces IL-2R signaling.

[0544] HEK293T cells were infected with MOI 0.1 and 0.01 MOI of PD-H and PD-Neo-2 / 15. The cell culture supernatant was collected 48 h later, centrifuged and used natively or after virus inactivation by heating in an I L-2R(3y bioassay. Both, native and heat-treated supernatants from PD-Neo-2 / 15, but not those from PD-H infected cells led to strong induction, of luciferase expression in this assay, demonstrating that Neo-2 / 15 was expressed as functional active protein which was able to induced IL-2R£Y signalling (Fig. 27A).

[0545] To assess whether I L-2RPy induction led to induction of human T cell proliferation, stimulated primary human T cells were treated with 3 ng / pl recombinant IL-2 or let unstimulated for 48 h. Thereafter the cells were cultured for further 5 days in the presence of 12 ng / ml recombinant IL-2 or increasing volumes (1 to 50 pl) of heat-inactivated supernatant harvested from HEK293T cells after infection with 0.1 MOI PD-Neo-2 / 15 for 48 h.

[0546] Cell proliferation was assessed by reduction in CFSE signal and flow cytometry. In both, unstimulated and stimulated primary T cells treatment with IL-2 and Neo-2 / 15 resulted in induction of CD4+ and CD8+ T-cell proliferation. In unstimulated T cells induction was distinctly lower than in stimulated cells and increased as more Neo-2 / 15 containing supernatant was used, whereas in the stimulated T cells increase of volume of Neo-2 / 15 containing cell culture supernatant did not further lead to increase of CD4+ and CD8+ T-cell proliferation (Fig. 27B).

[0547] Interestingly already 1 to 2 pl of Neo-2 / 15 containing supernatant were sufficient to achieve cell proliferation similar as to induced by 12 ng / ml IL-2. Amtl. Aktenzeichen: 17. Dez 2025

[0548] Unser Zeichen: P18625PC00

[0549] To elucidate, whether Neo-2 / 15 is as IL-2 also able to stimulate CD4+ and CD8+ cells in the early step of stimulation, the experiment was repeated but replaced recombinant IL-2 by Neo-2 / 15 containing supernatants. As shown in (Fig. 27C) Neo-2 / 15 was able to fully replace the function of IL-2.

[0550] These data demonstrate that Neo-2 / 15 is expressed as functional protein form PD-Neo-2 / 15, which is able to induces I L-2RPy signaling and CD4+ CD8+ proliferation.

[0551] Example 20: PD-Neo-2 / 15 reduces growth of subcutaneous Colon-26 tumors and lead to changes in the tumor microenvironment in Balb / C mice in vivo

[0552] To assess whether arming PD-H with Neo-2 / 15 enhances its oncolytic activity, subcutaneous Colon-26 tumors in BALB / c mice were established.

[0553] On day 5 after Colon-26 injection animals were randomly divided into four groups and intratumorally injected 5><106PFU of PD-Neo-2 / 15, PD-H, or PD-GFPtrunc or PBS on three consecutive days. Tumor growth was monitored until day 15 after Colon-26 cell inoculation. At this point the experiment was terminated, because the skin over various tumors showed the first signs of ulceration and the animals therefore had to be sacrificed for animal welfare reasons (Fig. 28A).

[0554] Tumors in the PBS group grew rapidly and the average tumor volume reached 518.9 mm3at the end of the experiment. All three virotherapy treatments delayed tumor growth compared with the untreated control group.

[0555] The average tumor growth of the PD-Neo-2 / 15 group was reduced by 68.4 % (163.68 mm3), of the PD-H group by 55.3 % (231.66 mm3) and of the PD-GFPtrunc group by 44.2 % (289.52 mm3) at day 15 (Fig. 28B, C).

[0556] As a further parameter characterizing the efficiency of virus treatment, the increase of tumor volume between day 5 and day 15 was determined. In the PBS group, tumor volume increased by 26.1-fold, in the PD-GFPtrunc group by 19.3-fold, in the PD-H group by 10.2-fold, and in the PD-Neo-2 / 15 group only by 6.8-fold (Fig. 28D). In two animals tumor shrinkage was observed, in one animal from the PD-H group and in one from the PD-Neo-2 / 15 group (Fig. 28C).

[0557] The tumor weight after explantation at day 15 was measured. Highest weight showed the tumors of animals from the PBS control group, reaching an avaerage tumor weigth of 0.325 g, whereas in the PD-GFPtrunc group the average tumor weight was 0.243 g, in the PD-H group 0.182 g and in the PD-Neo-2 / 15 group 0.127 g (Fig. 28E). Body weight monitoring showed no weight loss for any of the groups (Fig. 28G).

[0558] Infectious virus particles were not recovered from tumor tissues, with the exception of a single animal treated with PD-H, suggesting that the viruses were cleared by the host immune system at this time point. No virus was detected in the pancreas or heart representing organs particularly susceptible to CVB3 infection in mice and no histological signs of inflammation or tissue damage were observed in these organs across all treatment groups (Fig. 28H, I), confirming the safety profile of PD-Neo-2 / 15 and the other PD variants.

[0559] To assess transgene stability in vivo, Colon-26 tumors were injected and extracted 3 days after single injection of 5xl06PFU PD-Neo-2 / 15 (Fig. 28 J). Tumor weight was monitored (Fig. 28 K) and virus titer Amtl. Aktenzeichen: 17. Dez 2025

[0560] Unser Zeichen: P18625PC00 in the tumor was determined using TCID-50 method (Fig. 28 L). The foreign transgene Neo-2 / 15 was ampflified after viral RNA was extracted from the tumor lysat. All four tumors showed virus with intact transgene (Fig. 28M).

[0561] Example 21: CVB3 PDKpc-mediated expression of the microRNAs miR-216a and miR-39 To investigate whether microRNAs can also be expressed by PD-H, miR-216a and miR-39 were inserted into the viral genome of PD-H variant PDKPC , between the coding regions of VP1 and 2A in the genome of the virus. The OVs were then generated and the pancreatic carcinoma cell line KPC was infected with the generated viruses PDKpc-miR-216a and PDKPc-miR-39 at a dosage of 0.1 and 1 MOI. As a control, the cells were transfected with the plasmid pCMV-GFP-miR-216a, which expresses miR-216a, using Lipofectamine 3000. Twenty-four hours after transfection / infection, genomic RNA was extracted from the cells and miR-216a, miR-39, and U6 RNA were quantified.

[0562] As a result of these investigations, virus dose-dependent expression of miR-216a and miR-39 were found, which shows that the microRNAs can be expressed by PDKPC. However, the expression levels were significantly lower than those determined after transfection of the miR-216a-expressing plasmid (Fig. 29).

Claims

Amtl. Aktenzeichen:

17. Dez 2025Unser Zeichen: P18625PC00Claims1. A modified Coxsackievirus B3 deriving from the strain PD-H having additionally one or more nucleotide substitution within the 5’ untranslated region (5’UTR) and / or one or more nucleotide substitution within the coding sequence of the viral polyprotein, wherein the one or more 5’UTR nucleotide substitution is selected from the group comprising t249(nt)c and c736(nt)t, and / or wherein the one or more nucleotide substitution within the coding sequence of the viral polyprotein results in at least one of the amino acid substitutions being selected from the group comprising K112N, S348T, A512T, A661V, E768D, Y887C, C1477T and combinations thereof, and wherein the modified Coxsackievirus B3 is cell toxic for infected pancreatic and / or colon tumor cells.

2. The modified Coxsackievirus B3 according to claim 1, wherein the virus comprises one or more of the following substitutions which cause the cell toxicity in infected pancreatic and / or colon tumor cells, selected from- the nucleotide substitution t249(nt)c within the 5’ untranslated region (5’UTR),- the nucleotide substitution within the coding sequence of the viral capsid protein (VP3) of the viral polyprotein resulting in the amino acid substitution A512T,- the nucleotide substitution within the coding sequence of the viral capsid protein (VP1) of the viral polyprotein resulting in the amino acid substitution A661V, and any combinations thereof.

3. The modified Coxsackievirus B3 according to claims 2, wherein the virus being defined by the nucleic acid sequence of SEQ ID No: 1, being the cDNA translation of the genomic viral RNA comprising the mutations of claim 2.

4. The modified Coxsackievirus B3 according to claims 1 to 3, wherein the viral genome additionally carries at least one microRNA target sequences selected from the group comprising miR-375TS, miR-145TS, miR-143TS, miR-lTS, miR-124aTS and miR-122TS suitable for reducing cell toxicity in healthy cells.

5. The modified Coxsackievirus B3 according to claim 4, wherein the virus has the nucleic acid sequence of SEQ ID No: 3 being the cDNA translation of the genomic viral RNA including the miR-375TS sequence.

6. The modified Coxsackievirus B3 according to claims 1 to 5, wherein the viral genome additionally carries at least one transgene.

7. The modified Coxsackievirus B3 according to claim 6, wherein at least one transgene is an immunomodulatory transgene.

8. The modified Coxsackievirus B3 according to claims 6 to 7, wherein at least one transgene codes for Neo-2 / 15.Amtl. Aktenzeichen:

17. Dez 2025Unser Zeichen: P18625PC009. The modified Coxsackievirus B3 according to claims 6 to 8, wherein at least one transgene is integrated within the VP1-2A junction of the viral genome.

10. Nucleic acid encoding the modified Coxsackievirus B3 according to claims 1-9.

11. The modified Coxsackievirus B3 according to claims 1-9 and / or the nucleic acid encoding the modified Coxsackievirus B3 according to claim 10 for use in treatment of oncological conditions and / or cancer selected from the group of colorectal carcinoma, oesophageal cancer, breast cancer, lung cancer, melanoma, pancreatic cancer, prostate cancer, gastric cancer, and liver cancer.

12. A pharmaceutical composition comprising the modified Coxsackievirus B3 according to claims 1-9 and / or the nucleic acid encoding the modified Coxsackievirus B3 according to claim 10 and a pharmaceutical acceptable carrier, diluent or excipient.

13. The pharmaceutical composition according to claim 12, wherein the nucleic acid encoding the modified Coxsackievirus B3 is the genomic information of a single-stranded (ss) positive-sense (+) RNA virus, i.e. iRNA.

14. The pharmaceutical composition accordingto claim 13, wherein the genomic information is anRNA sequence, denominated iRNA, synthetically generated from a DNA precursor such as cDNA.

15. The pharmaceutical composition accordingto claim 14 comprising the nucleic acid encoding the modified Coxsackievirus B3 packaged in transport vesicle selected from the group comprising LNPs, targeted LNPs, extracellular vesicles and exosomes, and capable of infecting cancer cells.43

Images