Benzimidazole derivatives modulating a nuclease

Benzimidazole derivatives are developed to inhibit TREX1, addressing the need for effective modulators in treating TREX1-associated diseases and cancers by reducing autoimmunity and chromosomal instability.

WO2026132018A1PCT designated stage Publication Date: 2026-06-25MERCK PATENT GMBH +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/087683
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-20
Filing Date
2025-12-17
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Current treatments for diseases associated with TREX1 gene mutations, such as Aicardi-Goutieres syndrome, familial chilblain lupus, systemic lupus erythematosus, and retinal vasculopathy with cerebral leukodystrophy, as well as chromosomally unstable cancers like breast, small cell lung, and colorectal cancer, lack effective modulators of TREX1 to manage autoimmunity and chromosomal instability.

Method used

Development of benzimidazole derivatives that act as modulators, particularly inhibitors, of TREX1 to regulate its activity and reduce immunogenicity in cancer cells and autoimmune diseases.

Benefits of technology

The benzimidazole derivatives effectively inhibit TREX1, reducing autoinflammatory processes and promoting tumor cell death, thereby treating TREX1-mediated autoimmune diseases and cancers with chromosomal instability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000004_0001
    Figure IMGF000004_0001
  • Figure IMGF000006_0001
    Figure IMGF000006_0001
  • Figure IMGF000007_0001
    Figure IMGF000007_0001
Patent Text Reader

Abstract

The present invention relates to compounds of formula (I), and stereoisomers, tautomers, N- oxides, and pharmaceutically acceptable salts thereof that are useful for modulating, preferably inhibiting three-prime repair exonuclease (TREX1). The present invention further relates to compounds of formula (I) for use as a medicament and to pharmaceutical compositions comprising said compounds. Further, the present invention relates to compounds of formula (I) and pharmaceutical compositions comprising said compounds for use in the treatment of cancer, such as breast, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1-mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutières syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Foreignfiling_text P24-163

[0002] 1

[0003] Benzimidazole derivatives modulating a nuclease

[0004] Field of the Invention

[0005] The present invention relates to compounds of formula (I), and stereoisomers, tautomers, N- oxides, and pharmaceutically acceptable salts thereof that are useful for modulating, preferably inhibiting three-prime repair exonuclease (TREX1). The present invention further relates to compounds of formula (I) for use as a medicament and to pharmaceutical compositions comprising said compounds. Further, the present invention relates to compounds of formula (I) and pharmaceutical compositions comprising said compounds for use in the treatment of cancer, such as breast, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0006] Background of the Invention

[0007] The DNA exonuclease three-prime repair exonuclease 1 (TREX1) is involved in the metabolism of DNA. TREX1 has been shown to play a critical role in preventing autoimmunity in mice and humans by degrading endogenous cytosolic DNA that otherwise triggers activation of the innate cGAS / STING signaling pathway, leading to the production of type I interferons (IFN). [Hemphill, W. O., Simpson, S. R., Liu, M., Salsbury Jr, F. R., Hollis, T., Grayson, J. M., & Perrino, F. W. (2021). TREX1 as a novel immunotherapeutic target. Frontiers in Immunology, 12, 660184.]

[0008] Mutations in the TREX1 gene can lead to an accumulation of non-degraded DNA fragments in the cell, which triggers autoinflammatory processes via activation of the immune system. The common pathomechanism of the diseases associated with changes in the TREX1 gene is a systemic autoimmune process. This can lead to the development of the associated clinical conditions, particularly through damage to the blood vessels, but also to other tissues. These highly diverse diseases include severe early childhood diseases such as Aircardi-Goutieres syndrome (AGS), but also diseases that manifest in adulthood, such as Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL), chilblain lupus erythematosus (CHBL1) and retinal small vessel vasculopathy with cerebral leukodystrophy (RVCL).

[0009] The progression of cancer is known to be i.a. promoted by chromosomal instability (CIN) through numerous genomic, epigenetic and transcriptional changes that are both cancer cell intrinsic and cell non-autonomous. TREX1 induction has been shown to protect chromosomally unstable tumors from immune surveillance by attenuating type I IFN production. [Toufektchan, E., Dananberg, A., Striepen, J., Hickling, J. H., Shim, A., Chen, Y., ... & Maciejowski, J. (2024). Intratumoral TREX1 induction promotes immune evasion by limiting type I IFN. Cancer Immunology Research, 12(3), 673-686.]

[0010] Overexpression of TREX1 has further been shown to reduce the immunogenicity of chromosomally unstable cells, which promotes their transformation into cancer cells. [ Fang, L., Ying, S., Xu, X., & Wu, D. (2023). TREX1 cytosolic DNA degradation correlates with autoimmune disease and cancer immunity. Clinical and Experimental Immunology, 211(3), 193- 207.] The expression of TREX1 was also found to be highly pronounced in chemoresistant small-cell lung cancers (SCLCs) [Murayama, T., Mahadevan, N. R., Meador, C. B., Ivanova, E. Foreignfiling_text P24-163

[0011] 2

[0012] V., Pan, Y., Knelson, E. H., ... & Canadas, I. (2024). Targeting TREX1 Induces Innate Immune Response in Drug-Resistant Small-Cell Lung Cancer. Cancer Research Communications, 4(9), 2399-2414.]. By adaptively regulating the expression of TREX1 in cancer immunity to promote tumor proliferation, TREX1 represents a promising therapeutic target.

[0013] Therefore, TREX1 is considered to be an important therapeutic target for cancer treatment. In other words, compounds modulating TREX1 may be useful for treating cancer, preferably a cancer selected from breast cancer, small cell lung cancer and colorectal cancer. In particular, compounds modulating TREX1 may be useful for treating cancers exhibiting chromosomal instability. Further, compounds modulating TREX1 may be useful for treating TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0014] Objects and Summary of the Invention

[0015] It is therefore an object of the present invention to provide compounds, which act as modulators of TREX1, in particular compounds acting as inhibitors of TREX1. In particular, it is an object to provide compounds that inhibit TREX1 with high activity.

[0016] It is another object of the present invention to provide compounds, which are suitable for use as a medicament. It is another object of the present invention to provide compounds, which are suitable for use in the treatment of one or more diseases, in which the modulation of TREX1, in particular the inhibition, of TREX1 is beneficial. It is yet another object to provide compounds, which are suitable for use in the treatment of cancer, preferably a cancer selected from breast cancer, small cell lung cancer and colorectal cancer. It is yet another object to provide compounds, which are suitable for use in the treatment of TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0017] The above objects can be achieved by the compounds of formula (I), including stereoisomers, tautomers, N-oxides, or pharmaceutically acceptable salts thereof, as defined herein as well as pharmaceutical compositions comprising the same, and by the medical uses thereof. The inventors of the present invention inter alia surprisingly found that the compounds of formula (I) as defined herein act as modulators, in particular as inhibitors, of TREX1. Accordingly, the compounds of formula (I) can be used as a medicament, in particular for the treatment of cancer.

[0018] The invention provides compounds, i.e. compounds of formula (I), including stereoisomers, tautomers, N-oxides, or pharmaceutically acceptable salts thereof, along with their pharmaceutically acceptable salts, pharmaceutical compositions, and combinations, all of which act as modulators of TREX1, in particular as inhibitors of TREX1. Furthermore, the invention relates to the compound of formula (I) for use in the treatment, prevention, or improvement of a disease or condition, involving the administration of the compound of formula (I) as a modulator of TREX1, in particular as an inhibitor of TREX1 in an effective amount to individuals in need of such treatment. Additionally, the invention relates to compounds of formula (I) or their pharmaceutically acceptable salts, and pharmaceutical compositions comprising the same, specifically designed for the treatment of cancer, in particular breast cancer, small cell lung Foreignfiling_text P24-163

[0019] 3 cancer and colorectal cancer. Further, the invention relates to compounds of formula (I) or their pharmaceutically acceptable salts, and pharmaceutical compositions comprising the same, specifically designed for the treatment of cancer, in particular cancer with chromosomal instability. Furthermore, the invention relates to compounds of formula (I) or their pharmaceutically acceptable salts, and pharmaceutical compositions comprising the same, specifically designed for the treatment of TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) or retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0020] Various aspects of the invention are detailed in this document, including compounds represented by formula (I) or stereoisomers, tautomers, N-oxides, pharmaceutically acceptable salts, or hydrates thereof.

[0021] In a first aspect, the present invention therefore relates to a compound of formula (I) or a stereoisomer, tautomer, N-oxide, or pharmaceutically acceptable salt thereof; wherein

[0022] R1is C(=O)R11, wherein

[0023] R11is NRARB, ORC, Ci-C4-alkyl, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RD; or

[0024] R1is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE;

[0025] R2is H;

[0026] R3is -CH2-R33, wherein

[0027] R33is 3- to 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable Foreignfiling_text P24-163

[0028] 4 atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RG; or

[0029] R3is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered saturated, partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RH;

[0030] R4is H, or halogen;

[0031] R5is H, or halogen;

[0032] R6is H, or halogen; and

[0033] R7is H, or halogen; and wherein

[0034] RAis H, or Ci-C4-alkyl;

[0035] RBis H, or Ci-C4-alkyl;

[0036] Rcis H, or Ci-C4-alkyl;

[0037] RDis halogen, Ci-C2-alkyl, or Ci-C2-alkoxy;

[0038] REis halogen, OH, NH2, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl, or Ci-C4-alkoxy; or two REtogether form =0;

[0039] RGis halogen, CN, NH2, OH, C(=O)NR'RJ, Ci-C4-alkyl, Ci-C4-haloalkyl, Ci-C4-alkyl-NR'RJ, C1- C4-alkyl-C(=O)NR'RJ, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy, Ci-C4-hydroxyalkoxy, or C1-C4- alkoxy-Ci-C4-alkyl;

[0040] RHis halogen, CN, NR'RJ, ORK, C(=O)RL, S(=O)RM, S(=O)2RM, S-RM, Ci-C4-alkyl, C1-C4- haloalkyl, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl-ORK, Ci-C4-alkyl-C(=O)RL, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl,or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RN; or two RHtogether form =0;

[0041] R1is H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp;

[0042] RJis H, or Ci-C4-alkyl;

[0043] RKis H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp, Ci-C4-alkyl-C(=O)NR°Rp, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl, or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RR;

[0044] RLis NR'RJ, or ORK;

[0045] RMis Ci-C2-alkyl;

[0046] RNis Ci-C4-alkyl, or Ci-C4-alkyl-NR°Rp;

[0047] R° is H, Ci-C4-alkyl, or C(=O)RQ;

[0048] Rpis H, or Ci-C4-alkyl; Foreignfiling_text P24-163

[0049] 5

[0050] RQis Ci-C4-alkyl, Ci-C4-aminoalkyl, -CH2-(O-CH2CH2)n-O-CH3, -CH2CH2-(O-CH2CH2)n-O- CH3, -CH2-(O-CH2CH2)n-NH2, -CH2CH2-(O-CH2CH2)n-NH2, wherein in each case independently n is 0, 1 , 2, 3, or 4;

[0051] RRis 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents Rs; and

[0052] Rsis NR°RP.

[0053] In a preferred embodiment,

[0054] R1is C(=O)R11, wherein

[0055] R11is NRARB, ORC, Ci-C4-alkyl, or phenyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RD; or

[0056] R1is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE.

[0057] In a more preferred embodiment, Foreignfiling_text P24-163

[0058] 6

[0059] In another preferred embodiment,

[0060] R3is -CH2-R33, wherein

[0061] R33is 4- to 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RG; or

[0062] R3is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered saturated, partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RH; wherein

[0063] RGis OH, C(=O)NR'RJ, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl-C(=O)NR'RJ, Ci-C4-hydroxyalkyl, C1- C4-alkoxy, Ci-C4-hydroxyalkoxy, or Ci-C4-alkoxy-Ci-C4-alkyl;

[0064] RHis halogen, CN, NR'RJ, ORK, C(=O)RL, S(=O)RM, S(=O)2RM, S-RM, Ci-C4-alkyl, Ci-C4- haloalkyl, Ci-C4-alkyl-NR'RJ, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or 5- or e- membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl,or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RN; or two RHtogether form =0.

[0065] In another preferred embodiment, Foreignfiling_text P24-163 Foreignfiling_text P24-163 Foreignfiling_text P24-163

[0066] 9

[0067] In another preferred embodiment, R4is H.

[0068] In another preferred embodiment, R5is H, Cl, or F.

[0069] In another preferred embodiment, R6is H, Cl, or F.

[0070] In another preferred embodiment, R7is H, Cl, or F.

[0071] In another preferred embodiment, the compound is selected from the group consisting of N-[1-(3-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2-carboxamide;

[0072] N-[6-fluoro-1-(2-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0073] N-[6-chloro-1-(2-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0074] N-[1-(3-hydroxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0075] N-[1-(2-cyanophenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0076] 6-methoxy-N-[1-(3-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0077] N-[1-(3-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrazine-2-carboxamide;

[0078] 6-methoxy-N-{1-[(2-methoxyphenyl)methyl]-1 H-1 ,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;

[0079] 6-methoxy-N-{1-[(3-methoxyphenyl)methyl]-1 H-1 ,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;

[0080] N-[1-(3-cyanophenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0081] N-{1-[2-(2-hydroxyethyl)phenyl]-1 H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4-carboxamide;

[0082] N-{1-[2-(2-hydroxyethoxy)phenyl]-1 H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;

[0083] 6-methoxy-N-{1-[2-(trifluoromethyl)phenyl]-1 H-1 ,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;

[0084] N-[7-fluoro-1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0085] 5-methoxy-N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2-carboxamide;

[0086] N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-5-methylpyridine-2-carboxamide;

[0087] N-[1-(4-cyanophenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0088] N-{1-[4-(dimethylamino)phenyl]-1H-1,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide; Foreignfiling_text P24-163

[0089] 10

[0090] N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-5-methylpyrazine-2-carboxamide;

[0091] N-[1-(4-hydroxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0092] N-[1-(4-carbamoylphenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0093] N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;

[0094] N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2-carboxamide;

[0095] N-(1-benzyl-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0096] N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0097] N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0098] N-[1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0099] N-(1-{[3-(carbamoylmethyl)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0100] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2-carboxamide;

[0101] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0102] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;

[0103] N-[1-(3,4-dimethoxyphenyl)-4,6-difluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0104] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0105] N-[1 -( 1 -ethyl- 1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0106] N-{1-[4-(1-methyl-1H-pyrazol-4-yl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;

[0107] N-[1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0108] N-(1-{4-[(pyridazin-3-yl)methoxy]phenyl}-1 H-1, 3-benzodiazol-2-yl)pyrimidine-4- carboxamide;

[0109] N-(1-{[3-(2-hydroxyethoxy)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0110] N-(1-{[2-(hydroxymethyl)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0111] N-(1-{[3-(2-hydroxyethyl)phenyl]methyl}-1 H-1, 3-benzodiazol-2-yl)pyrimidine-4- carboxamide;

[0112] N-[1-(2-oxo-2,3-dihydro-1 H-1 ,3-benzodiazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0113] N-[1 -( 1 ,3-dihydro-2-benzofuran-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0114] N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-1-methyl-6-oxo-1 ,6-dihydropyrimidine-4- carboxamide;

[0115] N-[1-(1-methyl-1 H-indazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0116] 6-methoxy-N-[1-(1 -methyl- 1 H-indazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0117] N-[1-(1-methylpiperidin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-2-carboxamide;

[0118] N-[1-(3,4-dimethoxyphenyl)-4,6-difluoro-1 H-1 ,3-benzodiazol-2-yl]-5-fluoropyridine-2- carboxamide;

[0119] N-[1-(pyridin-4-yl)-1 H-1 , 3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0120] N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0121] N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0122] N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2- carboxamide;

[0123] 5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0124] 5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-2- carboxamide;

[0125] N-[1-(phthalazin-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0126] N-{1-[4-(methylcarbamoyl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;

[0127] N-(1-{4-[(2-hydroxyethyl)carbamoyl]phenyl}-1H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0128] N-[1-(4-{[2-(dimethylamino)ethyl]carbamoyl}phenyl)-1H-1,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0129] N-{1-[3-(methylcarbamoyl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;

[0130] N-[1-(4-methanesulfinylphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide; Foreignfiling_text P24-163

[0131] 11

[0132] N-[1-(4-methanesulfonylphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0133] N-(1-{3-[(2-hydroxyethyl)carbamoyl]phenyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0134] N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-

[0135] 4-carboxamide;

[0136] N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0137] 5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0138] N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2- carboxamide;

[0139] N-[1-(isoquinolin-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0140] N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine- 2-carboxamide;

[0141] N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2- carboxamide;

[0142] N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide;

[0143] N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0144] 6-methoxy-N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0145] N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0146] N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0147] N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-fluoropyridine-2- carboxamide;

[0148] N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2- carboxamide;

[0149] N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine- 2-carboxamide;

[0150] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-2-oxopropanamide;

[0151] N-{1-[3-({5-[4-(dimethylamino)piperidin-1-yl]pyridazin-3-yl}oxy)phenyl]-1H-1,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;

[0152] N-{1-[2-(2-hydroxypropyl)phenyl]-1 H-1 ,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;

[0153] N-{1-[4-({5-[4-(dimethylamino)piperidin-1-yl]pyridazin-3-yl}oxy)phenyl]-1H-1,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;

[0154] N'-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-N-methylethanediamide;

[0155] N'-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0156] N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)-5- methoxypyrazine-2-carboxamide;

[0157] 5-methoxy-N-[1-(1 -methyl- 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrazine-2-carboxamide;

[0158] N-[1-(4-cyanophenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0159] N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4- carboxamide;

[0160] N-{1-[4-(2-acetamidoethoxy)phenyl]-1 H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;

[0161] N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0162] N-[1 -( 1 ,3-dimethyl-2-oxo-2,3-dihydro-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide; Foreignfiling_text P24-163

[0163] 12

[0164] N-(1-{4-[2-(4-aminobutanamido)ethoxy]phenyl}-1 H-1 ,3-benzodiazol-2-yl)-6-hydroxypyrimidine-4- carboxamide;

[0165] N-{1-[1-(2-aminoethyl)-1 H-indazol-5-yl]-6-fluoro-1 H-1 ,3-benzodiazol-2-yl}-5-methoxypyrazine-2- carboxamide;

[0166] N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0167] N-{1-[4-(dimethylca rbamoyl)phenyl]-6-fluoro-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;

[0168] N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;

[0169] 6-methoxy-N-[1-(1 ,3,3-trimethyl-2-oxo-2,3-dihydro-1 H-indol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0170] N-[1-(3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide;

[0171] N-[1-(1-methyl-2,2-dioxo-1 ,3-dihydro-2A6,1-benzothiazol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0172] 5-fluoro-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0173] 6-methoxy-N-[1-(1-methyl-2,2-dioxo-1 ,3-dihydro-2A6, 1-benzothiazol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0174] 5-methyl-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrazine-2- carboxamide;

[0175] N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2-carboxamide;

[0176] 5-methoxy-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0177] 3-amino-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0178] N-{1-[4-(dimethylcarbamoyl)phenyl]-6-fluoro-1 H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;

[0179] N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0180] N-[1 -( 1 ,3,3-trimethyl-2-oxo-2,3-dihydro-1 H-indol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0181] N-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0182] N-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0183] N'-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0184] 6-methoxy-N-[1-(2,3,3-trimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0185] N-(1-{1-methyl-1 H-pyrrolo[3,2-b]pyridin-7-yl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4- carboxamide;

[0186] N-[1-(2,3,3-trirnethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0187] 6-methoxy-N-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0188] N'-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0189] N-methyl-N'-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]ethanediamide;

[0190] N'-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0191] N-{1-[2-(2-hydroxyethyl)-3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl]-1 H-1 ,3-benzodiazol-2- yl}pyrimidine-4-carboxamide; Foreignfiling_text P24-163

[0192] 13

[0193] N-[1-(3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0194] N'-[6-fluoro-1-(1-methyl-1H-1,3-benzodiazol-5-yl)-1 H-1,3-benzodiazol-2-yl]-N- methylethanediamide;

[0195] N'-[4,6-difluoro-1-(1-methyl-1H-indazol-5-yl)-1H-1 ,3-benzodiazol-2-yl]-N-methylethanediamide;

[0196] N-{1-[2-(2-aminoethyl)-3,3-dimethyl-1-oxo-2,3-dihydro-1H-isoindol-5-yl]-1 H-1,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;

[0197] N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0198] N-(6-fluoro-1-{1-[2-(1-methylpiperidin-4-yl)ethyl]-1H-indazol-5-yl}-1 H-1,3-benzodiazol-2-yl)-5- methoxypyrazine-2-carboxamide;

[0199] N-(1-{2-[2-(dimethylamino)ethyl]-3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl}-1 H-1,3- benzodiazol-2-yl)-6-methoxypyrimidine-4-carboxamide;

[0200] N'-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0201] N'-[6-fluoro-1-(1-methyl-1H-indazol-5-yl)-1 H-1,3-benzodiazol-2-yl]-N-methylethanediamide;

[0202] N-[6-fluoro-1-(pyridin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0203] N-[6-fluoro-1-(2-methoxypyridin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0204] N-[6-fluoro-1-(6-methylpyridin-3-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0205] N-[6-fluoro-1-(2-methyl-2H-indazol-6-yl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0206] N-[6-fluoro-1-(2-methylpyridin-4-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0207] N-[6-fluoro-1-(1-methyl-1 H-pyrazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0208] N-[6-fluoro-1-(2-fluoropyridin-4-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0209] N-[6-fluoro-1-(7-fluoro-1-methyl-1 H-indazol-5-yl)-1 H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-

[0210] 4-carboxamide;

[0211] N-[6-fluoro-1-(7-fluoro-1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0212] 5-chloro-N-[1-(4-cyanophenyl)-6-fluoro-1 H-1,3-benzodiazol-2-yl]-3-fluoropyridine-2- carboxamide;

[0213] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1,3-benzodiazol-2-yl]-5-fluoro-6-methoxypyrimidine-4- carboxamide;

[0214] N-[1 -( 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0215] N'-[1 -( 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0216] Pyrazine-2-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;

[0217] 6-Methyl-pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;

[0218] Pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;

[0219] 6-Ethyl-pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;

[0220] N-(1-(2-(2-hydroxyethyl)-3,3-dimethyl-1-oxoisoindolin-5-yl)-1H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0221] N-(6-fluoro-1-(2-methyl-2H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0222] N-(1-(2-(2-(dimethylamino)ethyl)-3,3-dimethyl-1-oxoisoindolin-5-yl)-1H-benzo[d]imidazol-2- yl)pyrimidine-4-carboxamide; Foreignfiling_text P24-163

[0223] 14

[0224] N-(6-fluoro-1-(6-methoxypyridin-3-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0225] N-(6-fluoro-1-(2-methyl-2H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)pyrimidine-4-carboxamide;

[0226] N-(6-fluoro-1-(1-(2-(1-methylpiperidin-4-yl)ethyl)-1H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0227] N-(6-fluoro-1-(1-methyl-1 H-indazol-6-yl)-1 H-benzo[d]imidazol-2-yl)pyrimidine-4-carboxamide;

[0228] N-(6-fluoro-1-(1-methyl-1 H-indazol-6-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0229] N-(6-fluoro-3'-methyl-3'H-[1 ,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4-carboxamide;

[0230] N-(6-fluoro-3'-methyl-3'H-[1 ,5'-bibenzo[d]imidazol]-2-yl)-6-methoxypyrimidine-4-carboxamide;

[0231] N-(1-(6-chloropyridin-3-yl)-6-fluoro-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0232] N-(1-(6-(dimethylamino)pyridin-3-yl)-6-fluoro-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0233] N-(6-fluoro-1-(1-methyl-1 H-pyrazolo[3,4-c]pyridin-5-yl)-1 H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0234] N-(1-(1-(2-aminoethyl)-1 H-indazol-5-yl)-6-fluoro-1 H-benzo[d]imidazol-2-yl)pyrimidine-4- carboxamide;

[0235] N-(1-(1-(2-aminoethyl)-1 H-indazol-5-yl)-6-fluoro-1 H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0236] N-(6-fluoro-1'-(2-hydroxyethyl)-2'-methyl-TH-[1 ,5'-bibenzo[d]imidazol]-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0237] N-(1-(1 ,4-dimethyl-1 H-indazol-6-yl)-6-fluoro-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0238] N-(6-fluoro-3'-(2-hydroxyethyl)-2'-methyl-3'H-[1 ,5'-bibenzo[d]imidazol]-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0239] N-(6-fluoro-3'-(2-hydroxyethyl)-2'-methyl-3'H-[1 ,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4- carboxamide;

[0240] N-(6-fluoro-1-(2-(methylthio)pyridin-4-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0241] N-(6-fluoro-T,2'-dimethyl-TH-[1 ,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4-carboxamide;

[0242] N-(6-fluoro-T-(2-hydroxyethyl)-2'-methyl-1'H-[1 ,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4- carboxamide;

[0243] N-(6-fluoro-1-(5-fluoropyridin-3-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide; and

[0244] N-(6-fluoro-2',3'-dimethyl-3'H-[1 ,5'-bibenzo[d]imidazol]-2-yl)-6-methoxypyrimidine-4- carboxamide.

[0245] In a further aspect, the present invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound of formula (I) as defined herein and optionally a pharmaceutically acceptable carrier, diluent or excipient.

[0246] In yet another aspect, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition comprising the same as defined herein for use in medicine.

[0247] In yet another aspect, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition comprising the same as defined herein for use in treating or preventing a disease selected from the group consisting of cancer, such as breast, Foreignfiling_text P24-163

[0248] 15 small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0249] Moreover, the present invention relates to the compound of formula (I) or a pharmaceutical salt thereof, or a pharmaceutical composition comprising the same for use in the following contexts: therapy; the manufacture of a medicament; the manufacture of a medicament specifically for the treatment of cancer, such as breast, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0250] In another embodiment, the present invention relates to the compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the same, for use in the treatment of cancers exhibiting chromosomal instability.

[0251] In another embodiment, the present invention relates to the compound of formula (I) or its pharmaceutically acceptable salt, or a pharmaceutical composition comprising the same, for use in the treatment of a disorder or disease that can be addressed by the modulation of TREX1 , in particular the inhibition of TREX1, in a subject by administering a therapeutically effective amount of the compound of formula (I) or its pharmaceutically acceptable salt. In another embodiment, the present invention relates to the compound of formula (I) or its pharmaceutically acceptable salt, or a pharmaceutical composition comprising the same, for use in the treatment of cancer in a subject by administering a therapeutically effective amount of the compound of formula (I) or its pharmaceutically acceptable salt. In another embodiment, the present invention relates to the compound of formula (I) or its pharmaceutically acceptable salt, or a pharmaceutical composition comprising the same, for use in the treatment of a disease in a subject by administering a therapeutically effective amount of the compound described by formula (I) or its pharmaceutically acceptable salt, wherein the disease is selected from the group consisting of TREX1-mediated autoimmune diseases, inflammatory myocarditis, Aicardi- Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0252] Detailed Description of the Invention

[0253] In the following disclosure, preferred embodiments of the substituents in the above formula (I) are described in further detail. It is to be understood that each preferred embodiment is relevant on its own as well as in combination with other preferred embodiments. Furthermore, it is to be understood that the preferences in each case also apply to the stereoisomers, tautomers, N- oxides, or pharmaceutically acceptable salts of the compounds of the invention.

[0254] As indicated above, the present invention relates to a compound of formula (I) Foreignfiling_text P24-163

[0255] 16 or a stereoisomer, tautomer, N-oxide, or pharmaceutically acceptable salt thereof; wherein

[0256] R1is C(=O)R11, wherein

[0257] R11is NRARB, ORC, Ci-C4-alkyl, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RD; or

[0258] R1is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE;

[0259] R2is H;

[0260] R3is -CH2-R33, wherein

[0261] R33is 3- to 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RG; or

[0262] R3is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered saturated, partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RH;

[0263] R4is H, or halogen;

[0264] R5is H, or halogen;

[0265] R6is H, or halogen; and

[0266] R7is H, or halogen; and wherein

[0267] RAis H, or Ci-C4-alkyl; Foreignfiling_text P24-163

[0268] 17

[0269] RBis H, or Ci-C4-alkyl;

[0270] Rcis H, or Ci-C4-alkyl;

[0271] RDis halogen, Ci-C2-alkyl, or Ci-C2-alkoxy;

[0272] REis halogen, OH, NH2, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl, or Ci-C4-alkoxy; or two REtogether form =0;

[0273] RGis halogen, CN, NH2, OH, C(=O)NR'RJ, Ci-C4-alkyl, Ci-C4-haloalkyl, Ci-C4-alkyl-NR'RJ, C1- C4-alkyl-C(=O)NR'RJ, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy, Ci-C4-hydroxyalkoxy, or C1-C4- alkoxy-Ci-C4-alkyl;

[0274] RHis halogen, CN, NR'RJ, ORK, C(=O)RL, S(=O)RM, S(=O)2RM, S-RM, Ci-C4-alkyl, C1-C4- haloalkyl, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl-ORK, Ci-C4-alkyl-C(=O)RL, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl,or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RN; or two RHtogether form =0;

[0275] R1is H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp;

[0276] RJis H, or Ci-C4-alkyl;

[0277] RKis H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp, Ci-C4-alkyl-C(=O)NR°Rp, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl, or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RR;

[0278] RLis NR'RJ, or ORK;

[0279] RMis Ci-C2-alkyl;

[0280] RNis Ci-C4-alkyl, or Ci-C4-alkyl-NR°Rp;

[0281] R° is H, Ci-C4-alkyl, or C(=O)RQ;

[0282] Rpis H, or Ci-C4-alkyl;

[0283] RQis Ci-C4-alkyl, Ci-C4-aminoalkyl, -CH2-(O-CH2CH2)n-O-CH3, -CH2CH2-(O-CH2CH2)n-O- CH3, -CH2-(O-CH2CH2)n-NH2, -CH2CH2-(O-CH2CH2)n-NH2, wherein in each case independently n is 0, 1 , 2, 3, or 4;

[0284] RRis 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents Rs; and

[0285] Rsis NR°RP.

[0286] In one embodiment, in the compound of formula (I) R2is H.

[0287] Thus, the compound of formula (I) is preferably a compound of formula (I*) as depicted below. Foreignfiling_text P24-163

[0288] 18

[0289] In connection with the compound of formula (I), in particular in connection with the compound of formula (I*) it is to be understood that the substituents R1, R3, R4, R5, R6and R7are as defined above or further below.

[0290] Thus, in connection with the compounds of formula (I), and in particular in connection with the compounds of formula (I*), the substituents R4, R5, R6and R7are as defined in the following:

[0291] In one embodiment,

[0292] R4is H, or halogen.

[0293] In a preferred embodiment,

[0294] R4is H, F, Cl or Br.

[0295] In a more preferred embodiment, R4is H, Cl or F.

[0296] In an even more preferred embodiment, R4is H or F.

[0297] In a particularly preferred embodiment, R4is H.

[0298] In another embodiment,

[0299] R5is H, or halogen.

[0300] In a preferred embodiment,

[0301] R5is H, F, Cl, or Br.

[0302] In a more preferred embodiment,

[0303] R5is H, Cl or F.

[0304] In another embodiment, R6is H, or halogen.

[0305] In a preferred embodiment, R6is H, F, Cl or Br.

[0306] In a more preferred embodiment, R6is H, Cl or F.

[0307] In a particularly preferred embodiment, R6is H. Foreignfiling_text P24-163

[0308] 19

[0309] In another embodiment,

[0310] R7is H, or halogen.

[0311] In a preferred embodiment,

[0312] R7is H, F, Cl, or Br.

[0313] In a more preferred embodiment, R7is H, Cl or F.

[0314] In a particularly preferred embodiment, R7is H or F.

[0315] Thus, the compound of formula (I), and preferably the compound of formula (I*) is particularly preferably a compound of formula (l*A), (l*B), (l*C), (l*D) or (l*E) as depicted below.

[0316] In a particularly preferred embodiment, the compound of formula (I) is a compound of formula (I*), preferably a compound of formula (l*A) or (l*B).

[0317] In connection with the above embodiments, it is to be understood that R1and R3are as defined above or further below.

[0318] Thus, in connection with the compounds of formula (I), in particular in connection with the compounds of formula (I*), and even more particularly in connection with the compounds of formulae (l*A), (l*B), (l*C), (l*D) and (l*E), the substituent R1, R11and REare as defined in the following:

[0319] In one embodiment,

[0320] R1is C(=O)R11, wherein

[0321] R11is NRARB, ORC, Ci-C4-alkyl, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RD; or Foreignfiling_text P24-163

[0322] 20

[0323] R1is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE; wherein

[0324] RAis H, or Ci-C4-alkyl;

[0325] RBis H, or Ci-C4-alkyl;

[0326] Rcis H, or Ci-C4-alkyl; and

[0327] REis halogen, OH, NH2, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl, or Ci-C4-alkoxy; or two REtogether form =0.

[0328] In a preferred embodiment,

[0329] R1is C(=O)R11, wherein

[0330] R11is NRARB, ORC, Ci-C4-alkyl, or phenyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RD; or

[0331] R1is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE.

[0332] In connection with the above preferred embodiment, it is to be understood that RA, RB, Rcand REare as defined as follows:

[0333] RAis H, or Ci-C4-alkyl;

[0334] RBis H, or Ci-C4-alkyl;

[0335] Rcis H, or Ci-C4-alkyl; and

[0336] REis halogen, OH, NH2, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl, or Ci-C4-alkoxy; or two REtogether form =0.

[0337] Thus, in one embodiment, Foreignfiling_text P24-163

[0338] 21 wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0339] In a preferred embodiment,

[0340] R1is C(=O)R11, wherein

[0341] R11is NRARB, ORC, or Ci-C4-alkyl; and wherein

[0342] RAis H, or Ci-C4-alkyl;

[0343] RBis H, or Ci-C4-alkyl;

[0344] Rcis H, or Ci-C4-alkyl.

[0345] In a more preferred embodiment,

[0346] R1is C(=O)R11, wherein

[0347] R11is NRARB, ORC, or Ci-C2-alkyl; and wherein

[0348] RAis H, or Ci-alkyl;

[0349] RBis H, or Ci-alkyl;

[0350] Rcis H, or Ci-alkyl.

[0351] In an even more preferred embodiment,

[0352] R1is C(=O)R11, wherein

[0353] R11is NRARB, ORC, or Ci-alkyl; and wherein

[0354] RAis H, or Ci-alkyl;

[0355] RBis H, or Ci-alkyl;

[0356] Rcis Ci-alkyl.

[0357] Thus, in a preferred embodiment, wherein the wavy line in each case marks the connection to the remainder of the molecule. Foreignfiling_text P24-163

[0358] 22

[0359] In another embodiment,

[0360] R1is C(=O)R11, wherein

[0361] R11is a 6-membered aromatic carbocyclyl, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RD.

[0362] In a preferred embodiment,

[0363] R1is C(=O)R11, wherein

[0364] R11is a 6-membered aromatic carbocyclyl, preferably

[0365] R11is phenyl.

[0366] Thus, in a preferred embodiment, wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0367] In another embodiment,

[0368] R1is a 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE; wherein

[0369] REis halogen, OH, NH2, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl, or Ci-C4-alkoxy; or two REtogether form =0.

[0370] In a preferred embodiment,

[0371] R1is a 5- or 6-membered saturated, partially or fully unsaturated, or aromatic heterocyclyl, or 9- membered partially or fully unsaturated, or aromatic heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE; wherein

[0372] REis F, Cl, OH, NH2, Ci-C2-alkyl, or Ci-C2-alkoxy; or two REtogether form =0.

[0373] Thus, in a preferred embodiment,

[0374] R1is Foreignfiling_text P24-163

[0375] 23 wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0376] In a particularly preferred embodiment, in connection with the compounds of formula (I), in particular in connection with the compounds of formula (I*), and even more particularly in connection with the compounds of formulae (l*A), (l*B), (l*C), (l*D) and (l*E) wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0377] Further, in connection with the compounds of formula (I), in particular in connection with the compounds of formula (I*), and even more particularly in connection with the compounds of formulae (l*A), (l*B), (l*C), (l*D) and (l*E), the substituent R3, R33, RGand RHare as defined in the following:

[0378] In one embodiment,

[0379] R3is -CH2-R33, wherein

[0380] R33is 3- to 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S- Foreignfiling_text P24-163

[0381] 24 atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RG; or

[0382] R3is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered saturated, partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RH;

[0383] RGis halogen, CN, NH2, OH, C(=O)NR'RJ, Ci-C4-alkyl, Ci-C4-haloalkyl, Ci-C4-alkyl-NR'RJ, C C4-alkyl-C(=O)NR'RJ, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy, Ci-C4-hydroxyalkoxy, or Ci-C4- alkoxy-Ci-C4-alkyl;

[0384] RHis halogen, CN, NR'RJ, ORK, C(=O)RL, S(=O)RM, S(=O)2RM, S-RM, Ci-C4-alkyl, Ci-C4- haloalkyl, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl-ORK, Ci-C4-alkyl-C(=O)RL, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl,or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RN; or two RHtogether form =0.

[0385] In connection with the above embodiment, it is to be understood that the substituents R1, RJ, RK, RL, RMand RNare as defined above or further below.

[0386] Thus, in one embodiment of the present invention, the substituents R1, RJ, RK, RL, RMand RNare as defined as follows:

[0387] R1is H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp;

[0388] RJis H, or Ci-C4-alkyl;

[0389] RKis H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp, Ci-C4-alkyl-C(=O)NR°Rp, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl, or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RR;

[0390] RLis NR'RJ, or ORK;

[0391] RMis Ci-C2-alkyl;

[0392] RNis Ci-C4-alkyl, or Ci-C4-alkyl-NR°Rp; wherein

[0393] R° is H, Ci-C4-alkyl, or C(=O)RQ;

[0394] Rpis H, or Ci-C4-alkyl;

[0395] RRis 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the Foreignfiling_text P24-163

[0396] 25 aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents Rs; and wherein

[0397] RQis Ci-C4-alkyl, Ci-C4-aminoalkyl, -CH2-(O-CH2CH2)n-O-CH3, -CH2CH2-(O-CH2CH2)n-O- CH3, -CH2-(O-CH2CH2)n-NH2, -CH2CH2-(O-CH2CH2)n-NH2, wherein in each case independently n is 0, 1 , 2, 3, or 4;

[0398] Rsis NR°RP.

[0399] In a preferred embodiment,

[0400] R3is -CH2-R33, wherein

[0401] R33is 4- to 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RG; or

[0402] R3is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered saturated, partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RH; wherein

[0403] RGis OH, C(=O)NR'RJ, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl-C(=O)NR'RJ, Ci-C4-hydroxyalkyl, C C4-alkoxy, Ci-C4-hydroxyalkoxy, or Ci-C4-alkoxy-Ci-C4-alkyl;

[0404] RHis halogen, CN, NR'RJ, ORK, C(=O)RL, S(=O)RM, S(=O)2RM, S-RM, Ci-C4-alkyl, Ci-C4- haloalkyl, Ci-C4-alkyl-NR'RJ, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or 5- or e- membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl,or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RN; or two RHtogether form =0.

[0405] In connection with the above embodiment, it is to be understood that the substituents R1, RJ, RK, RL, RMand RNare as defined as follows:

[0406] R1is H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp;

[0407] RJis H, or Ci-C4-alkyl;

[0408] RKis H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp, Ci-C4-alkyl-C(=O)NR°Rp, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl, or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RR; Foreignfiling_text P24-163

[0409] 26

[0410] RLis NR'RJ, or ORK;

[0411] RMis Ci-C2-alkyl;

[0412] RNis Ci-C4-alkyl, or Ci-C4-alkyl-NR°Rp; wherein

[0413] R° is H, Ci-C4-alkyl, or C(=O)RQ;

[0414] Rpis H, or Ci-C4-alkyl;

[0415] RRis 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents Rs; and wherein

[0416] RQis Ci-C4-alkyl, Ci-C4-aminoalkyl, -CH2-(O-CH2CH2)n-O-CH3, -CH2CH2-(O-CH2CH2)n-O- CH3, -CH2-(O-CH2CH2)n-NH2, -CH2CH2-(O-CH2CH2)n-NH2, wherein in each case independently n is 0, 1 , 2, 3, or 4;

[0417] Rsis NR°RP.

[0418] Thus, in a preferred embodiment, Foreignfiling_text P24-163 Foreignfiling_text P24-163 Foreignfiling_text P24-163

[0419] 29 wherein the wavy line in each case marks the connection to the remainder of the molecule. Foreignfiling_text P24-163 Foreignfiling_text P24-163

[0420] 31 wherein the wavy line in each case marks the connection to the remainder of the molecule.

[0421] In one embodiment, the compound according to formula (I) is selected from the group consisting of

[0422] N-[1-(3-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]pyridine-2-carboxamide;

[0423] N-[6-fluoro-1-(2-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0424] N-[6-chloro-1-(2-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0425] N-[1-(3-hydroxyphenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0426] N-[1-(2-cyanophenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0427] 6-methoxy-N-[1-(3-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0428] N-[1-(3-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]pyrazine-2-carboxamide;

[0429] 6-methoxy-N-{1-[(2-methoxyphenyl)methyl]-1H-1,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;

[0430] 6-methoxy-N-{1-[(3-methoxyphenyl)methyl]-1H-1,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;

[0431] N-[1-(3-cyanophenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0432] N-{1-[2-(2-hydroxyethyl)phenyl]-1 H-1,3-benzodiazol-2-yl}-6-methoxypyrimidine-4-carboxamide;

[0433] N-{1-[2-(2-hydroxyethoxy)phenyl]-1H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;

[0434] 6-methoxy-N-{1-[2-(trifluoromethyl)phenyl]-1 H-1,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;

[0435] N-[7-fluoro-1-(4-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0436] 5-methoxy-N-[1-(4-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]pyridine-2-carboxamide;

[0437] N-[1-(4-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]-5-methylpyridine-2-carboxamide;

[0438] N-[1-(4-cyanophenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0439] N-{1-[4-(dimethylamino)phenyl]-1H-1,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;

[0440] N-[1-(4-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]-5-methylpyrazine-2-carboxamide;

[0441] N-[1-(4-hydroxyphenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0442] N-[1-(4-carbamoylphenyl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0443] N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;

[0444] N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]-5-methoxypyridine-2-carboxamide;

[0445] N-(1-benzyl-1H-1,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0446] N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0447] N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0448] N-[1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0449] N-(1-{[3-(carbamoylmethyl)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide; Foreignfiling_text P24-163

[0450] 32

[0451] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2-carboxamide;

[0452] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0453] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;

[0454] N-[1-(3,4-dimethoxyphenyl)-4,6-difluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0455] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0456] N-[1 -( 1 -ethyl- 1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0457] N-{1-[4-(1-methyl-1H-pyrazol-4-yl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;

[0458] N-[1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0459] N-(1-{4-[(pyridazin-3-yl)methoxy]phenyl}-1 H-1, 3-benzodiazol-2-yl)pyrimidine-4- carboxamide;

[0460] N-(1-{[3-(2-hydroxyethoxy)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0461] N-(1-{[2-(hydroxymethyl)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0462] N-(1-{[3-(2-hydroxyethyl)phenyl]methyl}-1 H-1, 3-benzodiazol-2-yl)pyrimidine-4- carboxamide;

[0463] N-[1-(2-oxo-2,3-dihydro-1 H-1 ,3-benzodiazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0464] N-[1 -( 1 ,3-dihydro-2-benzofuran-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0465] N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-1-methyl-6-oxo-1 ,6-dihydropyrimidine-4- carboxamide;

[0466] N-[1-(1-methyl-1 H-indazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0467] 6-methoxy-N-[1-(1 -methyl- 1 H-indazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0468] N-[1-(1-methylpiperidin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-2-carboxamide;

[0469] N-[1-(3,4-dimethoxyphenyl)-4,6-difluoro-1 H-1 ,3-benzodiazol-2-yl]-5-fluoropyridine-2- carboxamide;

[0470] N-[1-(pyridin-4-yl)-1 H-1 , 3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0471] N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0472] N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0473] N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2- carboxamide;

[0474] 5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0475] 5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-2- carboxamide;

[0476] N-[1-(phthalazin-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0477] N-{1-[4-(methylcarbamoyl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;

[0478] N-(1-{4-[(2-hydroxyethyl)carbamoyl]phenyl}-1H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0479] N-[1-(4-{[2-(dimethylamino)ethyl]carbamoyl}phenyl)-1H-1,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0480] N-{1-[3-(methylcarbamoyl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;

[0481] N-[1-(4-methanesulfinylphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0482] N-[1-(4-methanesulfonylphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0483] N-(1-{3-[(2-hydroxyethyl)carbamoyl]phenyl}-1H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;

[0484] N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-

[0485] 4-carboxamide;

[0486] N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0487] 5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0488] N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2- carboxamide; Foreignfiling_text P24-163

[0489] 33

[0490] N-[1-(isoquinolin-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0491] N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine- 2-carboxamide;

[0492] N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2- carboxamide;

[0493] N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide;

[0494] N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0495] 6-methoxy-N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0496] N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0497] N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0498] N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-fluoropyridine-2- carboxamide;

[0499] N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2- carboxamide;

[0500] N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine- 2-carboxamide;

[0501] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-2-oxopropanamide;

[0502] N-{1-[3-({5-[4-(dimethylamino)piperidin-1-yl]pyridazin-3-yl}oxy)phenyl]-1H-1,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;

[0503] N-{1-[2-(2-hydroxypropyl)phenyl]-1 H-1 ,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;

[0504] N-{1-[4-({5-[4-(dimethylamino)piperidin-1-yl]pyridazin-3-yl}oxy)phenyl]-1H-1,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;

[0505] N'-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-N-methylethanediamide;

[0506] N'-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0507] N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)-5- methoxypyrazine-2-carboxamide;

[0508] 5-methoxy-N-[1-(1 -methyl- 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrazine-2-carboxamide;

[0509] N-[1-(4-cyanophenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0510] N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4- carboxamide;

[0511] N-{1-[4-(2-acetamidoethoxy)phenyl]-1 H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;

[0512] N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0513] N-[1 -( 1 ,3-dimethyl-2-oxo-2,3-dihydro-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide;

[0514] N-(1-{4-[2-(4-aminobutanamido)ethoxy]phenyl}-1 H-1 ,3-benzodiazol-2-yl)-6-hydroxypyrimidine-4- carboxamide;

[0515] N-{1-[1-(2-aminoethyl)-1 H-indazol-5-yl]-6-fluoro-1 H-1 ,3-benzodiazol-2-yl}-5-methoxypyrazine-2- carboxamide;

[0516] N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0517] N-{1-[4-(dimethylca rbamoyl)phenyl]-6-fluoro-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;

[0518] N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;

[0519] 6-methoxy-N-[1-(1 ,3,3-trimethyl-2-oxo-2,3-dihydro-1 H-indol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0520] N-[1-(3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide; Foreignfiling_text P24-163

[0521] 34

[0522] N-[1-(1-methyl-2,2-dioxo-1 ,3-dihydro-2A6,1-benzothiazol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0523] 5-fluoro-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0524] 6-methoxy-N-[1-(1-methyl-2,2-dioxo-1 ,3-dihydro-2A6, 1-benzothiazol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0525] 5-methyl-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrazine-2- carboxamide;

[0526] N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2-carboxamide;

[0527] 5-methoxy-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0528] 3-amino-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;

[0529] N-{1-[4-(dimethylcarbamoyl)phenyl]-6-fluoro-1 H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;

[0530] N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0531] N-[1 -( 1 ,3,3-trimethyl-2-oxo-2,3-dihydro-1 H-indol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0532] N-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;

[0533] N-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0534] N'-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0535] 6-methoxy-N-[1-(2,3,3-trimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0536] N-(1-{1-methyl-1 H-pyrrolo[3,2-b]pyridin-7-yl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4- carboxamide;

[0537] N-[1-(2,3,3-trimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0538] 6-methoxy-N-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;

[0539] N'-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0540] N-methyl-N'-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]ethanediamide;

[0541] N'-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0542] N-{1-[2-(2-hydroxyethyl)-3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl]-1 H-1 ,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;

[0543] N-[1-(3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0544] N'-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-N- methylethanediamide;

[0545] N'-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-N-methylethanediamide;

[0546] N-{1-[2-(2-aminoethyl)-3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl]-1 H-1 ,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;

[0547] N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0548] N-(6-fluoro-1-{1-[2-(1-methylpiperidin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)-5- methoxypyrazine-2-carboxamide; Foreignfiling_text P24-163

[0549] 35

[0550] N-(1-{2-[2-(dimethylamino)ethyl]-3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl}-1 H-1,3- benzodiazol-2-yl)-6-methoxypyrimidine-4-carboxamide;

[0551] N'-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0552] N'-[6-fluoro-1-(1-methyl-1H-indazol-5-yl)-1 H-1,3-benzodiazol-2-yl]-N-methylethanediamide;

[0553] N-[6-fluoro-1-(pyridin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0554] N-[6-fluoro-1-(2-methoxypyridin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0555] N-[6-fluoro-1-(6-methylpyridin-3-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0556] N-[6-fluoro-1-(2-methyl-2H-indazol-6-yl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0557] N-[6-fluoro-1-(2-methylpyridin-4-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0558] N-[6-fluoro-1-(1-methyl-1 H-pyrazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0559] N-[6-fluoro-1-(2-fluoropyridin-4-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;

[0560] N-[6-fluoro-1-(7-fluoro-1-methyl-1 H-indazol-5-yl)-1 H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-

[0561] 4-carboxamide;

[0562] N-[6-fluoro-1-(7-fluoro-1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;

[0563] 5-chloro-N-[1-(4-cyanophenyl)-6-fluoro-1 H-1,3-benzodiazol-2-yl]-3-fluoropyridine-2- carboxamide;

[0564] N-[1-(4-cyanophenyl)-6-fluoro-1 H-1,3-benzodiazol-2-yl]-5-fluoro-6-methoxypyrimidine-4- carboxamide;

[0565] N-[1 -( 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;

[0566] N'-[1 -( 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;

[0567] Pyrazine-2-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;

[0568] 6-Methyl-pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;

[0569] Pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;

[0570] 6-Ethyl-pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;

[0571] N-(1-(2-(2-hydroxyethyl)-3,3-dimethyl-1-oxoisoindolin-5-yl)-1H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0572] N-(6-fluoro-1-(2-methyl-2H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0573] N-(1-(2-(2-(dimethylamino)ethyl)-3,3-dimethyl-1-oxoisoindolin-5-yl)-1H-benzo[d]imidazol-2- yl)pyrimidine-4-carboxamide;

[0574] N-(6-fluoro-1-(6-methoxypyridin-3-yl)-1H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0575] N-(6-fluoro-1-(2-methyl-2H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)pyrimidine-4-carboxamide;

[0576] N-(6-fluoro-1-(1-(2-(1-methylpiperidin-4-yl)ethyl)-1H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0577] N-(6-fluoro-1-(1-methyl-1H-indazol-6-yl)-1 H-benzo[d]imidazol-2-yl)pyrimidine-4-carboxamide;

[0578] N-(6-fluoro-1-(1-methyl-1H-indazol-6-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0579] N-(6-fluoro-3'-methyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4-carboxamide;

[0580] N-(6-fluoro-3'-methyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)-6-methoxypyrimidine-4-carboxamide;

[0581] N-(1-(6-chloropyridin-3-yl)-6-fluoro-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide; Foreignfiling_text P24-163

[0582] 36

[0583] N-(1-(6-(dimethylamino)pyridin-3-yl)-6-fluoro-1H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0584] N-(6-fluoro-1-(1-methyl-1H-pyrazolo[3,4-c]pyridin-5-yl)-1H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0585] N-(1-(1-(2-aminoethyl)-1H-indazol-5-yl)-6-fluoro-1H-benzo[d]imidazol-2-yl)pyrimidine-4- carboxamide;

[0586] N-(1-(1-(2-aminoethyl)-1H-indazol-5-yl)-6-fluoro-1H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0587] N-(6-fluoro-1'-(2-hydroxyethyl)-2'-methyl-TH-[1,5'-bibenzo[d]imidazol]-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0588] N-(1-(1 ,4-dimethyl-1 H-indazol-6-yl)-6-fluoro-1H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0589] N-(6-fluoro-3'-(2-hydroxyethyl)-2'-methyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)-6- methoxypyrimidine-4-carboxamide;

[0590] N-(6-fluoro-3'-(2-hydroxyethyl)-2'-methyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4- carboxamide;

[0591] N-(6-fluoro-1-(2-(methylthio)pyridin-4-yl)-1H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;

[0592] N-(6-fluoro-T,2'-dimethyl-TH-[1,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4-carboxamide; N-(6-fluoro-T-(2-hydroxyethyl)-2'-methyl-1'H-[1,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4- carboxamide;

[0593] N-(6-fluoro-1-(5-fluoropyridin-3-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide; and N-(6-fluoro-2',3'-dimethyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)-6-methoxypyrimidine-4- carboxamide.

[0594] Definitions

[0595] The term “compound(s) of the present invention” is to be understood as equivalent to the term "compound(s) according to the invention" and relates to the compounds of formula (I), preferably to compounds of formula (I*), (l*A), (l*B), (l*C), (l*D) or (l*E), and also covers a stereoisomer, tautomer, N-oxide, or pharmaceutically acceptable salt thereof.

[0596] The compounds according to the invention may be amorphous or may exist in one or more different crystalline states (polymorphs), which may have different macroscopic properties such as stability or show different biological properties such as activities. The present invention relates to amorphous and crystalline forms of compounds of formula (I), mixtures of different crystalline states of the compounds of formula (I), as well as amorphous or crystalline salts thereof.

[0597] The compounds according to the invention also include solvates, preferably hydrates of the compounds of formula (I). The term “hydrate” in connection with the compounds of formula (I) refers to a compound of formula (I), which contains water or its constituent elements (i.e., H and OH). A hydrate of the compounds of formula (I) may be a compound of formula (I), which incorporates water molecules in the crystalline structure but does not alter the chemical structure of formula (I). It is to be understood that such hydrates of the compounds provided herein, also include hydrates of pharmaceutically acceptable salts of the corresponding compounds. Foreignfiling_text P24-163

[0598] 37

[0599] Salts of the compounds according to the invention are preferably pharmaceutically acceptable salts, such as those containing counterions present in drug products listed in the US FDA Orange Book database. They can be formed in a customary manner, e.g., by reacting the compound with an acid of the anion in question, if the compounds according to the invention have a basic functionality, or by reacting acidic compounds according to the invention with a suitable base.

[0600] Suitable cationic counterions are in particular the ions of the alkali metals, preferably lithium, sodium and potassium, of the alkaline earth metals, preferably calcium, magnesium and barium, and of the transition metals, preferably manganese, copper, silver, zinc and iron, and also ammonium (NH4+) and substituted ammonium in which one to four of the hydrogen atoms are replaced by Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy, Ci-C4-alkoxy-Ci-C4-alkyl, hydroxy-Ci- C4-alkoxy-Ci-C4-alkyl, phenyl or benzyl. Examples of substituted ammonium ions comprise methylammonium, isopropylammonium, dimethylammonium, diisopropylammonium, trimethylammonium, tetramethylammonium, tetraethylammonium, tetrabutylammonium, 2- hydroxyethylammonium, 2-(2-hydroxyethoxy)ethyl-ammonium, bis(2-hydroxyethyl)ammonium, benzyltrimethylammonium and benzyltriethylammonium, furthermore the cations of 1 ,4- piperazine, meglumine, benzathine and lysine.

[0601] Suitable anionic counterions are in particular chloride, bromide, hydrogensulfate, sulfate, dihydrogenphosphate, hydrogenphosphate, phosphate, nitrate, bicarbonate, carbonate, hexafluorosilicate, hexafluorophosphate, benzoate, and the anions of Ci-C4-alkanoic acids, preferably formate, acetate, propionate and butyrate, furthermore lactate, gluconate, and the anions of poly acids such as succinate, oxalate, maleate, fumarate, malate, tartrate and citrate, furthermore sulfonate anions such as besylate (benzenesulfonate), tosylate (p- toluenesulfonate), napsylate (naphthalene-2-sulfonate), mesylate (methanesulfonate), esylate (ethanesulfonate), and ethanedisulfonate. They can be formed by reacting compounds according to the invention that have a basic functionality with an acid of the corresponding anion.

[0602] Tautomers may be formed, if a substituent is present at the compound of formula (I), which allows for the formation of tautomers such as keto-enol tautomers, imine-enamine tautomers, amide-imidic acid tautomers or the like.

[0603] The term " / V-oxide" includes any compound of the present invention which has at least one tertiary nitrogen atom that is oxidized to an / V-oxide moiety.

[0604] Depending on the substitution pattern, the compounds according to the invention may have one or more centres of chirality. The invention provides both, pure enantiomers or pure diastereomers, of the compounds according to the invention, and their mixtures, including racemic mixtures. Suitable compounds according to the invention also include all possible geometrical stereoisomers (cis / trans isomers or E / Z isomers) and mixtures thereof. E / Z- isomers may be present with respect to, e.g., an alkene, carbon-nitrogen double-bond or amide group.

[0605] Any formula or structure given herein, including compounds of formula (I), is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. I sotopically labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Foreignfiling_text P24-163

[0606] 38

[0607] Examples of isotopes that can be incorporated into compounds of the disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as, but not limited to2H (deuterium, D),3H (tritium),11C,13C,14C,15N,18F,31P,32P,35S,36CI and125l. For example, radioactive isotopes such as3H,13C and14C provide isotopically labelled compounds useful in metabolic studies, reaction kinetic studies, detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays or in radioactive treatment of patients. Further, the disclosure includes compounds of formula (I) in which from 1 to n hydrogens attached to a carbon atom is / are replaced by deuterium, in which n is the number of hydrogens in the molecule. Deuterium labeled or substituted therapeutic compounds of the disclosure may have improved DMPK (drug metabolism and pharmacokinetics) properties, relating to distribution, metabolism and excretion (ADME). Substitution with heavier isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life, reduced dosage requirements and / or an improvement in therapeutic index. See, for example, Poster, "Deuterium Isotope Effects in Studies of Drug Metabolism", Trends Pharmacol. Sei. 5(12):524- 527 (1984). Such compounds are synthesized by means well known in the art, for example by employing starting materials in which one or more hydrogens have been replaced by deuterium. The concentration of such a heavier isotope, specifically deuterium, may be defined by an isotopic enrichment factor. Unless otherwise stated, when a position is designated specifically as "H" or "hydrogen", the position is understood to have hydrogen at its natural abundance isotopic composition. Accordingly, in the compounds of this disclosure any atom specifically designated as a deuterium (D) is meant to represent deuterium.

[0608] The term "substituted", as used herein, means that a hydrogen atom bonded to a designated atom is replaced with a specified substituent, provided that the substitution results in a stable or chemically feasible compound. Unless otherwise indicated, a substituted atom may have one or more substituents, and each substituent is independently selected. The term "substitutable atom" means that attached to the atom is a hydrogen, which can be replaced with a suitable substituent. The term "substitutable", when used in reference to a designated atom, means that attached to the atom is a hydrogen, which can be replaced with a suitable substituent. When it is referred to certain atoms or moieties being substituted with “one or more” substituents, the term “one or more” is intended to cover at least one substituent, e.g., 1 to 10 substituents, preferably 1 , 2, 3, 4, or 5 substituents, more preferably 1 , 2, or 3 substituents, most preferably 1 , or 2 substituents. When neither the term “unsubstituted” nor “substituted” is explicitly mentioned concerning a moiety, said moiety is to be considered as unsubstituted.

[0609] The organic moieties mentioned in the above definitions of the variables are - like the term halogen - collective terms for individual listings of the individual group members. The prefix Cn- Cmindicates in each case the possible number of carbon atoms in the group.

[0610] The term “halo” refers to fluoro, chloro, or bromo, particularly fluoro or chloro. The term “halogen” denotes in each case fluorine, bromine, chlorine or iodine, in particular fluorine or chlorine.

[0611] The term "alkyl" as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 6 carbon atoms, preferably 1 to 5 or 1 to 4 carbon atoms, more preferably 1 to 3 or 1 or 2 carbon atoms. Examples of an alkyl group are methyl, ethyl, n-propyl, / so-propyl, n-butyl, 2-butyl, / so-butyl, tert-butyl, n-pentyl, 1-methylbutyl, 2- methylbutyl, 3- Foreignfiling_text P24-163

[0612] 39 methylbutyl, 2,2-dimethylpropyl, 1-ethylpropyl, n-hexyl, 1,1 -dimethylpropyl, 1,2-dimethylpropyl, 1- methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1 , 1-dimethylbutyl, 1,2- dimethylbutyl, 1 ,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1- ethylbutyl, 2-ethylbutyl, 1 , 1 ,2-trimethylpropyl, 1 ,2,2- trimethylpropyl, 1-ethyl-1-methylpropyl, and 1-ethyl-2-methylpropyl.

[0613] The term "haloalkyl" as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 4 carbon atoms, preferably 1 to 3 or 1 or 2 carbon atoms, wherein the hydrogen atoms of this group are partially or totally replaced with halogen atoms. Preferred haloalkyl moieties are selected from Ci-C4-haloalkyl, more preferably from C1-C3- haloalkyl or Ci-C2-haloalkyl, in particular from Ci-C2-fluoroalkyl such as fluoromethyl, difluoromethyl, trifluoromethyl, 1-fluoroethyl, 2-fluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, and the like.

[0614] The term "alkoxy" as used herein denotes in each case a straight-chain or branched alkyl group which is bonded via an oxygen atom to the remainder of the molecule and has usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom. Examples of an alkoxy group are methoxy, ethoxy, n-propoxy, / so-propoxy, n-butyloxy, 2-butyloxy, / so- butyloxy, terf-butyloxy, and the like.

[0615] An alkoxy group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, which is bonded via an alkyl group as defined herein having usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom, to the remainder of the molecule, is referred to as an “alkoxyalkyl”. Thus, it refers to an alkyl group, which is bonded via oxygen to a further alkyl group, which is then bonded to the remainder of the molecule. Examples of alkoxyalkyl groups are methoxymethyl, methoxyethyl, ethoxymethyl, ethoxyethyl, and the like. Alkyl and alkoxy groups can be unbranched or branched, and examples of alkyl include but are not limited to methyl, ethyl, n- propyl, iso -propyl, n-butyl, iso -butyl, sec-butyl, and tert-butyl. Examples of alkoxy include methoxy, ethoxy, n-propoxy, iso -propoxy, n-butoxy, iso -butoxy, sec-butoxy, and tert- butoxy.

[0616] The term “hydroxyalkoxy” as used herein denotes in each case a straight-chain or branched alkyl group as defined herein which is bonded via an oxygen atom to the remainder of the molecule and has usually from 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms, more preferably 1 carbon atom and being further substituted with 1 to 5, preferably with 1 to 2 hydroxy groups, in particular with 1 hydroxy group, wherein a hydroxy group is a OH group. Preferably, the one hydroxy group is terminating the straight-chain or branched alkoxy group so that the hydroxy group is bonded to an alkoxy bridge, which is bonded to the remainder of the molecule.

[0617] The term “hydroxyalkyl” as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 6 carbon atoms, preferably from 1 to 4 carbon atoms, more preferably 1 to 2 carbon atoms, and being further substituted with 1 to 5, preferably with 1 to 2 hydroxy groups, in particular with 1 hydroxy group, wherein a hydroxy group is a OH group. Preferably, the one hydroxy group is terminating the straight-chain or branched alkyl group so that the hydroxy group is bonded to an alkyl bridge, which is bonded to the remainder of the molecule. Examples of an hydroxyalkyl group are hydroxymethyl, hydroxyethyl, n- hydroxypropyl, 2-hydroxypropyl, n-hydroxybutyl, 2-hydroxybutyl, 2-hydroxy-2-methylpropyl, and Foreignfiling_text P24-163

[0618] 40 n-hydroxypentyl. Hydroxymethyl, hydroxyethyl, hydroxypropyl, and hydroxybutyl, are preferred, in particular hydroxymethyl and hydroxyethyl.

[0619] The term “aminoalkyl” as used herein denotes in each case a straight-chain or branched alkyl group having usually from 1 to 6 carbon atoms, preferably from 1 to 4 carbon atoms, more preferably 1 to 2 carbon atoms, and being further substituted with 1 to 5, preferably with 1 to 2 amino groups, in particular with 1 amino group, wherein an amino group is a NH2 group. Preferably, the one amino group is terminating the straight-chain or branched alkyl group so that the amino group is bonded to an alkyl bridge, which is bonded to the remainder of the molecule.

[0620] The term “Cn-Cm-alkyl-NRxRY” or “Cn-Cm-alkyl-C(=O)NRxRY” refers to e.g. a NRXRYgroup, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms. Preferably, terms such as “Cn-Cm-alkyl-NRxRY” or “Cn-Cm-alkyl-C(=O)NRxRY”, refer to the corresponding groups e.g. NRXRYor C(=O)NRXRYbeing bonded to the remainder of the molecule via an alkyl group. With regard to the above terms it is to be understood that the groups NRXRYor C(=O)NRXRYcan be also replaced by other / different groups which are bonded to the remainder of the molecule via an alkyl group.

[0621] “=O” represents an oxo substituent.

[0622] The term “carbocyclic”, “carbocyclyl”, or “carbocycle” includes, unless otherwise indicated, in general a 3- to 10- membered monocyclic ring, preferably a 4- to 8-membered or a 3- to 6- membered or a 5- to 7-membered monocyclic, more preferably a 3-, 4-, 5- or 6-membered monocyclic ring, comprising 3 to 10, preferably 4 to 8 or 3 to 6 or 5 to 7, more preferably 3, 4, 5 or 6 carbon atoms. The carbocycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. Also “aryls” are covered by the term “carbocycles”. The term “aromatic carbocyclyl “, “aryl” or “aromatic carbocycle” refers to aromatic carbocyclic rings based on carbon atoms as ring members, preferably 6-membered aromatic carbocyclic rings based on carbon atoms as ring members. A preferred example is phenyl. Unless otherwise indicated, the term “aryl” further covers “aromatic carbobicycles” as defined herein. The term “carbocyclic” or “carbocyclyl”, unless otherwise indicated, may therefore cover inter alia cycloalkyl, cycloalkenyl, as well as phenyl. Preferably, the term “carbocyclic” or “carbocyclyl” covers phenyl and cycloalkyl, for example phenyl, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl. The term “cycloalkyl” as used herein denotes in each case a monocyclic cycloaliphatic radical having usually from 3 to 10 or from 3 to 6 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl and cyclodecyl or cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl. Cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl are preferred.

[0623] The term "carbobicyclic" or “carbobicyclyl” includes in general 6 to 14-membered, preferably 7- to 12-membered or 8- to 10-membered, more preferably 9- or 10-membered bicyclic rings comprising 6 to 14, preferably 7 to 12 or 8 to 10, more preferably 9 or 10 carbon atoms. The carbobicycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. For being “aromatic”, it is sufficient if one of the two rings of the bicyclic moieties is aromatic, while the Foreignfiling_text P24-163

[0624] 41 other is non-aromatic. Preferably, the term “aromatic” in connection with the carbobicyclic ring means that both rings of the bicylic moiety are aromatic, so that, e.g., 8 TT electrons are present in case of a 10-membered aromatic carbobicyclic ring. The term “carbobicylce” or “carbobicyclyl”, unless otherwise indicated, may therefore cover inter alia bicycloalkyl, bicycloalkenyl, as well as bicyclic aromatic groups, for example bicyclohexane (decalin), bicycloheptane (such as norbornane), bicyclooctane (such as bicyclo[2.2.2]octane, bicyclo[3.2.1]octane or bicyclo[4.2.0]octane), bicyclononane (such as bicyclo[3.3.1]nonane or bicyclo[4.3.0]nonane ), bicyclodecane (such as bicyclo[4.4.0]decane), bicycloundecane (such as bicyclo[3.3.3]undecane), norbornene, naphthalene and the like. Preferably, the carbobicycle is a fused carbobicycle, which is preferably aromatic, for example naphthalene.

[0625] The term “carbocyclylalkyl” as used herein, refers to carbocyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom. Preferably, the term “carbocyclylalkyl” refers to phenylalkyl or cycloalkylalkyl, which refers to the corresponding groups being bonded to the remainder of the molecule via an alkyl group. Preferred examples of carbocyclylalkyl include benzyl (i.e. , phenylmethyl), phenylethyl, cyclopropylmethyl, cyclopropylethyl, cyclobutylmethyl, cyclobutylethyl, cyclopentylmethyl, cyclopentylethyl, cyclohexylmethyl, cyclohexylethyl.

[0626] The term “heterocyclic” or “heterocyclyl” includes, unless otherwise indicated, in general a 3- to 10-membered, preferably a 4- to 8-membered or 5- to 7-membered, more preferably 5- or 6- membered, in particular 6-membered monocyclic ring. The heterocycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. The heterocycle typically comprises one or more, e.g. 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The remaining ring members are carbon atoms. In a preferred embodiment, the heterocycle is an aromatic heterocycle, preferably a 5- or 6-membered aromatic heterocycle comprising one or more, e.g. 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. Examples of aromatic heterocycles are provided below in connection with the definition of “hetaryl”. “Hetaryls” or “heteroaryls” are covered by the term “heterocycles”. The saturated or partially or fully unsaturated heterocycles usually comprise 1 , 2, 3, 4 or 5, preferably 1 , 2 or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2.

[0627] The skilled person is aware that S, SO or SO2 is to be understood as follows:

[0628] ■S,

[0629] Further, a skilled person is aware that resonance structures of the oxidized forms may be possible. Saturated heterocycles include, unless otherwise indicated, in general 3- to 10- membered, preferably 4- to 8-membered or 5- to 7-membered, more preferably 5- or 6- membered monocyclic rings comprising 3 to 10, preferably 4 to 8 or 5 to 7, more preferably 5 or 6 atoms comprising at least one heteroatom, such as pyrrolidine, tetrahydrothiophene, tetrahydrofuran, piperidine, tetrahydropyran, dioxane, morpholine or piperazine.

[0630] The term “heterobicyclic” or “heterobicyclyl” includes, unless otherwise indicated, in general 6 to 14-membered, preferably 7- to 12-membered or 8- to 10-membered, more preferably 8- or 9- Foreignfiling_text P24-163

[0631] 42 membered bicyclic rings. The heterobicycle may be saturated, partially or fully unsaturated, or aromatic, wherein saturated means that only single bonds are present, and partially or fully unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled, whereas aromatic means that the Huckel (4n + 2) rule is fulfilled. For being “aromatic”, it is sufficient if one of the two rings of the bicyclic moieties is aromatic, while the other is non-aromatic. The heterobicycle typically comprises one or more, e.g., 1 , 2, 3, or 4, preferably 1 , 2, or 3 heteroatoms selected from N, O and S as ring members, where S-atoms as ring members may be present as S, SO or SO2. The remaining ring members are carbon atoms. Examples of heterobicycles include but are not limited to: benzofuranyl, benzothienyl, indolyl, indazolyl, benzimidazolyl, benzoxathiazolyl, benzoxadiazolyl, benzothiadiazolyl, benzoxazinyl, quinolinyl, isoquinolinyl, purinyl, 1 ,8-naphthyridyl, pteridyl, pyrido[3,2-d]pyrim idyl, pyridoimidazolyl, triethylenediamine or quinuclidine and the like.

[0632] The term “heteroaryl” or “aromatic heterocycle” or “aromatic heterocyclic ring” or "hetaryl" or “heterocyclyl” includes monocyclic 5- or 6-membered aromatic heterocycles comprising as ring members 1 , 2, 3 or 4 heteroatoms selected from N, O and S, where S-atoms as ring members may be present as S, SO or SO2. Examples of 5- or 6-membered aromatic heterocycles include pyridyl (also referred to as pyridinyl), i.e. 2-, 3-, or 4-pyridyl, pyrimidinyl, i.e. 2-, 4- or 5- pyrimidinyl, pyrazinyl, pyridazinyl, i.e. 3- or 4-pyridazinyl, thienyl, i.e. 2- or 3-thienyl, furyl, i.e. 2- or 3-furyl, pyrrolyl, i.e. 2- or 3-pyrrolyl, oxazolyl, i.e. 2-, 3- or 5-oxazolyl, isoxazolyl, i.e. 3-, 4- or 5-isoxazolyl, thiazolyl, i.e. 2-, 3- or 5- thiazolyl, isothiazolyl, i.e. 3-, 4- or 5-isothiazolyl, pyrazolyl, i.e. 1-, 3-, 4- or 5-pyrazolyl, i.e. 1-, 2-, 4- or 5-imidazolyl, oxadiazolyl, e.g. 2- or 5- [1 ,3,4]oxadiazolyl, 4- or 5-(1 ,2,3-oxadiazol)yl, 3- or 5-(1 ,2,4-oxadiazol)yl, 2- or 5-(1 ,3,4- thiadiazol)yl, thiadiazolyl, e.g. 2- or 5-(1 ,3,4-thiadiazol)yl, 4- or 5-(1 ,2,3-thiadiazol)yl, 3- or 5- (1 ,2,4-thiadiazol)yl, triazolyl, e.g. 1 H-, 2H- or 3H-1 ,2,3-triazol-4-yl, 2H-triazol-3-yl, 1 H-, 2H-, or 4H-1 ,2,4-triazolyl and tetrazolyl, i.e. 1 H- or 2H-tetrazolyl. Unless otherwise indicated, the term “hetaryl” further covers “aromatic heterobicycles” as defined above.

[0633] The term “heterocyclylalkyl” as used herein, refers to heterocyclyl as defined herein, which is bonded to the remainder of the molecule via an alkyl group having usually from 1 to 2 carbon atoms, preferably 1 carbon atom.

[0634] The term "cancer" pertains to a disease characterized by the rapid and uncontrolled growth of abnormal cells that can spread locally or through the bloodstream and lymphatic system. Various cancers, including colorectal, gastric, endometrial, prostate, adrenocortical, uterine, cervical, oesophageal, breast, kidney, and ovarian cancer, among others, are described herein. The terms "tumour", “tumor” and "cancer" are used interchangeably and encompass both solid and liquid tumours, including diffuse or circulating tumours. As used herein, the terms "tumour" and "cancer" include premalignant, as well as malignant cancers and tumours.

[0635] A “TREX1 modulator” or " TREX1 inhibitor" refers to a compound that modulates or inhibits TREX1 .

[0636] The term "medicine" as used herein is intended to be a generic term inclusive of prescription and non-prescription medications. The compound for use in medicine should be understood as being useful in maintaining health or promoting recovery from a disease, preferably cancer. Further, the term "medicine" includes medicine in any form, including, without limitation, e.g., pills, salves, creams, powders, ointments, capsules, injectable medications, drops, vitamins and Foreignfiling_text P24-163

[0637] 43 suppositories. The scope of this invention is not limited by the type, form or dosage of the medicine.

[0638] A "pharmaceutical composition" is a compound of the invention or a pharmaceutically acceptable salt thereof, along with at least one pharmaceutically acceptable carrier, prepared for oral or parenteral administration. A "pharmaceutically acceptable carrier" includes substances used in the preparation of pharmaceutical compositions, such as diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffering agents, emulsifiers, and more. The term “pharmaceutically acceptable excipient” as used herein refers to compounds commonly comprised in pharmaceutical compositions, which are known to the skilled person. Typically, a pharmaceutically acceptable excipient can be defined as being pharmaceutically inactive.

[0639] A "therapeutically effective amount" of a compound refers to an amount that, when administered to a subject, achieves a biological or medical response, such as the reduction of enzyme or protein activity or the alleviation, mitigation, or prevention of symptoms, disease progression, or the disease itself.

[0640] A "subject" can be a human, primate, dog, rabbit, guinea pig, pig, rat, or mouse, depending on the context.

[0641] "Treat," "treating," or "treatment" refers to alleviating or mitigating a disease or disorder or reducing symptoms. The term “treatment” is to be understood as also including the option of “prophylaxis”. Thus, whenever reference is made herein to a “treatment” or “treating”, this is to be understood as “treatment and / or prophylaxis” or “treating and / or preventing”. "Prevent," "preventing," or "prevention" involves prophylactic treatment or delaying the onset or progression of a disease. A subject is "in need of" treatment if they would benefit from it biologically, medically, or in terms of quality of life.

[0642] It needs to be understood that the term “comprising” is not limiting. For the purposes of the present invention, the term “consisting of” is considered to be a preferred embodiment of the term “comprising of”. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also meant to encompass a group which preferably consists of these embodiments only.

[0643] The terms “about” and “approximately” in the context of the present invention denotes an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates a deviation from the indicated numerical value of ±10% and preferably ±5%.

[0644] Finally, terms such as “a”, “an”, “the”, and similar terms encompass both singular and plural forms unless otherwise indicated or contradicted by the context. The use of examples or exemplary language serves to clarify the invention but does not limit the scope of the claimed invention.

[0645] Routes of Administration and Formulations

[0646] A pharmaceutical composition according to the present invention may be formulated for oral, buccal, nasal, rectal, topical, transdermal or parenteral application. Preferred non-parenteral Foreignfiling_text P24-163

[0647] 44 routes include mucosal (e.g., oral, vaginal, nasal, cervical, etc.) routes, of which the oral application may be preferred. Preferred parenteral routes include but are not limited to, one or more of subcutaneous, intravenous, intra-muscular, intraarterial, intradermal, intrathecal and epidural administrations. Preferably, administration is by non-parenteral routes. Particularly preferred is oral administration. The compound according to formula (I) should be applied in pharmaceutically effective amounts, for example in the amounts as set out herein below.

[0648] A pharmaceutical composition of the present invention may also be designated as formulation or dosage form. A compound of formula (I) may also be designated in the following as (pharmaceutically) active agent or active compound.

[0649] Pharmaceutical compositions may be solid or liquid dosage forms or may have an intermediate, e.g. gel-like character depending inter alia on the route of administration.

[0650] In general, the inventive dosage forms can comprise various pharmaceutically acceptable excipients which will be selected depending on which functionality is to be achieved for the dosage form. A “pharmaceutically acceptable excipient” in the meaning of the present invention can be any substance used for the preparation of pharmaceutical dosage forms, including coating materials, film-forming materials, fillers, disintegrating agents, release-modifying materials, carrier materials, diluents, binding agents and other adjuvants. Typical pharmaceutically acceptable excipients include substances like sucrose, mannitol, sorbitol, starch and starch derivatives, lactose, and lubricating agents such as magnesium stearate, disintegrants and buffering agents.

[0651] The term “carrier” denotes pharmaceutically acceptable organic or inorganic carrier substances with which the active ingredient is combined to facilitate the application. Suitable pharmaceutically acceptable carriers include, for instance, water, aqueous salt solutions, alcohols, oils, preferably vegetable oils, propylene glycol, polyoxyethelene sorbitans, polyethylene-polypropylene block co-polymers such as poloxamer 188 or poloxamer 407, polyethylene glycols such as polyethylene glycol 200, 300, 400, 600, etc., gelatin, lactose, amylose, magnesium stearate, surfactants, perfume oil, fatty acid monoglycerides, diglycerides and triglycerides, polyoxyethylated medium or long chain fatty acids such as ricinoleic acid, and polyoxyethylated fatty acid mono-, di, and triglycerides such as capric or caprilic acids, petroethral fatty acid esters, hydroxymethyl celluloses such as hydroxymethyl, hydroxyethyl, hydroxypropyl, hydroxypropyl acetate succinate, polyvinylpyrrolidone, crosspovidone and the like. Preferably, the compounds of the present invention are administered in a pharmaceutical composition comprising of lipids, interbilayer crosslinked multilamellar vesicles, biodegradeable poly(D,L-lactic-co-glycolic acid) [PLGA]-based or poly anhydride-based nanoparticles or microparticles, nanoporous particle-supported lipid bilayers and as a conjugate with an antibody.

[0652] The pharmaceutical compositions can be sterile and, if desired, mixed with auxiliary agents, like lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavoring and / or aromatic substances and the like which do not deleteriously react with the active compound. It is to be understood that the term “carrier” also covers an antibody that delivers the compound of formula (I).

[0653] If liquid dosage forms are considered for the present invention, these can include pharmaceutically acceptable emulsions, solutions, suspensions and syrups containing inert Foreignfiling_text P24-163

[0654] 45 diluents commonly used in the art such as water. These dosage forms may contain e.g. microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer and sweeteners / flavoring agents.

[0655] For parenteral application, particularly suitable vehicles consist of solutions, preferably oily or aqueous solutions, as well as suspensions, emulsions, or implants. Pharmaceutical formulations for parenteral administration are particularly preferred and include aqueous solutions of the compounds of formula (I) in water-soluble form. Additionally, suspensions of the compounds of formula (I) may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.

[0656] Particularly preferred dosage forms are injectable preparations of a compound of formula (I). Thus, sterile injectable aqueous or oleaginous suspensions can for example be formulated according to the known art using suitable dispersing agents, wetting agents and / or suspending agents. A sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Among the acceptable vehicles and solvents that can be used are water and isotonic sodium chloride solution. Sterile oils are also conventionally used as solvent or suspending medium. Preferred applications for injectable preparations comprising the compounds of the present invention are intravenous, intratumoral and peritumoral administration.

[0657] Suppositories for rectal administration of a compound of formula (I) can be prepared by e.g. mixing the compound with a suitable non-irritating excipient such as cocoa butter, synthetic triglycerides and polyethylene glycols which are solid at room temperature but liquid at rectal temperature such that they will melt in the rectum and release the compound according to formula (I) from said suppositories.

[0658] For administration by inhalation, the compounds according to the present invention may be conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0659] Oral dosage forms may be liquid or solid and include e.g. tablets, troches, pills, capsules, powders, effervescent formulations, dragees and granules. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. The oral dosage forms may be formulated Foreignfiling_text P24-163

[0660] 46 to ensure an immediate release of the compound of formula (I) or a sustained release of the compound of formula (I).

[0661] A solid dosage form may comprise a film coating. For example, the inventive dosage form may be in the form of a so-called film tablet. A capsule of the invention may be a two-piece hard gelatin capsule, a two-piece hydroxypropylmethylcellulose capsule, a two-piece capsule made of vegetable or plant-based cellulose, or a two-piece capsule made of polysaccharide. The dosage form according to the invention may be formulated for topical application. Suitable pharmaceutical application forms for such an application may be a topical nasal spray, sublingual administration forms and controlled and / or sustained release skin patches. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0662] The compositions may conveniently be presented in unit dosage forms and may be prepared by any of the methods well known in the art of pharmacy. The methods can include the step of bringing the compounds into association with a carrier, which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.

[0663] As regards human patients, the compound of formula (I) may be administered to a patient in an amount of about 0.001 mg to about 5000 mg per day, preferably of about 0.01 mg to about 1000 mg per day, more preferably of about 0.05 mg to about 250 mg per day, which is the effective amount. The phrase “effective amount” means an amount of compound that, when administered to a mammal in need of such treatment, is sufficient to treat or prevent a particular disease or condition.

[0664] Medical Indications

[0665] The compounds according to the present invention are suitable for use in medicine. The compounds of the present invention are useful for modulating TREX1 , in particular in inhibiting TREX1. Thus, the compounds according to the present invention are particularly suitable for use in the treatment of a disease associated with modulating, in particular inhibiting, TREX1 , in particular a proliferative disorder such as cancer or pre- cancerous syndromes.

[0666] Thus, in one embodiment, the present invention relates to a compound of formula (I) as defined herein or a pharmaceutical composition as defined herein for use in medicine. In particular, the compound of the present invention or a pharmaceutical composition comprising the same is for use in the treatment of a disease selected from the group consisting of cancer, such as breast cancer, small cell lung cancer, and colorectal cancer, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).

[0667] In further aspects, the present invention relates to methods of treatment comprising the administration of a compound of formula (I) as defined herein or a pharmaceutical composition comprising the same as defined herein to a human or animal body. In particular, the present invention relates to methods of treating diseases that can be addressed by TREX1 modulation, Foreignfiling_text P24-163

[0668] 47 preferably that can be addressed by TREX1 inhibition, with a particular emphasis on cancers, such as breast cancer, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability.

[0669] Moreover, the invention further relates to the manufacture of a medicament for the treatment of diseases that can be addressed by TREX1 modulation, preferably TREX1 inhibition, with a particular emphasis on cancers, such as breast cancer, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability.

[0670] It is to be understood that in connection with the medical uses of the invention it can be preferred that the compounds according to the present invention are administered in combination with antibodies, radiotherapy, surgical therapy, immunotherapy, chemotherapy, toxin therapy, gene therapy, or any other therapy known to those of ordinary skill in the art for treatment of a particular disease. This is particularly relevant in connection with the treatment of cancer.

[0671] The present invention is further illustrated by the following examples.

[0672] Examples

[0673] The compounds described herein may be prepared using the following methods and schemes. The sequence of reactions is an illustrative example. Swapping steps is possible and reaction conditions can be easily modified. Unless specified otherwise, all starting materials used are commercially available or can be synthesized analogously to the described intermediates or literature described routes.

[0674] The following abbreviations refer respectively to the definitions below:

[0675] THF: tetrahydrofurane

[0676] DMF: dimethylformamide

[0677] ACN: acetonitrile

[0678] DCM: dichloromethane

[0679] RT: room temperature

[0680] TBTU: 2-(1 H-Benzotriazole-1-yl)-1 ,1 ,3,3-tetramethylaminium tetrafluoroborate

[0681] HATU: 1-[Bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate

[0682] XPhos Pd G3: (2-Dicyclohexylphosphino-2',4',6'-triisopropyl-1 ,T-biphenyl)[2-(2'-amino-1,T- biphenyl)]palladium(ll) methanesulfonate

[0683] Instrument specifications and measurement conditions are provided in Table 1 below.

[0684] Table 1 Foreignfiling_text P24-163

[0685] 48 Foreignfiling_text P24-163

[0686] 49

[0687] 1H NMR was recorded on Bruker DPX-300, DRX-400 or AVII-400 spectrometer, using residual signal of deuterated solvent as internal reference. Chemical shifts (6) are reported in ppm relative to the residual solvent signal (6 = 2.49 ppm for 1 H NMR in DMSO-d6). 1H NHMR data are reported as follows: chemical shift (multiplicity, coupling constants, and number of Foreignfiling_text P24-163

[0688] 50 hydrogens). Multiplicity is abbreviated as follows: s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), br (broad).

[0689] 1. Synthesis of N-[6-fluoro-1-(2-methoxypyridin-4-yl)-1H-1,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide (Example No. 109) a. Synthesis of N-(5-fluoro-2-nitrophenyl)-2-methoxypyridin-4-amine

[0690] To 2-methoxypyridin-4-amine (1.00 g, 7.89 mmol, 1.0 eq) in THF (20 mL) was cooled to -78°C for 10 minutes, and lithiobis(trimethylsilyl)amine, 1M in THF (15.8 mL, 15.8 mmol, 2.0 eq) was added slowly at the same temperature. After stirring for 30 minutes, in the same temperature 2, 4-difluoro-1 -nitrobenzene (1.65 g, 10.3 mmol, 1.3 eq) was added. The reaction was stirred at RT for 12h. The reaction mixture was quenched with water and extracted three times with ethyl acetate. The combined organic layer was washed with brine twice, dried over sodium sulfate and evaporated to dryness. The crude was purified by flash chromatography (ethyl acetate / petroleum ether, gradient) to yield in the desired compound (1.20 g, 3.94 mmol, 50 %) as a yellow solid. Rt LC / MS (Method L) = 0.68 min, (M+H) 287. b. Synthesis of 5-fluoro-N1-(2-methoxypyridin-4-yl)benzene-1,2-diamine

[0691] To N-(5-fluoro-2-nitrophenyl)-2-methoxypyridin-4-amine (1.00 g, 3.28 mmol, 1.0 eq), Fe (926 mg, 16.4 mmol, 5.0 eq), ammonium chloride (1.77 g, 32.8 mmol, 10.0 eq) in ethanol (15 mL), water (5.00 mL) was heated to 70°C for 3h. The reaction was filtered through celite and extracted with ethyl acetate three times. Combined organic layer were washed with brine twice. Then organic layer was dried over sodium sulfate and distilled to yield in the desired product (1.00 g, 3.91 mmol, >100%) a colorless liquid as a crude product, which was used in the next step without further purification. Rt LC / MS (Method L) = 0.41 min, (M+H) 234. c. Synthesis of 6-fluoro-1-(2-methoxypyridin-4-yl)-1H-1,3-benzodiazol-2-amine

[0692] To 5-fluoro-N1-(2-methoxypyridin-4-yl)benzene-1,2-diamine (1.00 g, 3.91 mmol, 1.0 eq), in MeOH (15 mL) and water (5 mL) was added cyanogen bromide (465 mg, 4.30 mmol, 1.1 eq) and the mixture was stirred at RT for 12h. The mixture was concentrated to dryness to obtain the desired crude product (1.00 g, 3.11 mmol, 79%) as a brown solid, which was used in the next step without further purification. Rt LC / MS (Method L) = 0.59 min, (M+H) 259. Foreignfiling_text P24-163

[0693] 51 d. Synthesis of N-[6-fluoro-1-(2-methoxypyridin-4-yl)-1H-1,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide

[0694] To 6-fluoro-1-(2-methoxypyridin-4-yl)-1 H-1 ,3-benzodiazol-2-amine (0.30 g, 0.93 mmol, 1.0 eq) and 6-methoxypyrimidine-4-carboxylic acid (176 mg, 1.12 mmol, 1.2 eq) in DMF (9.00 mL) was added HATU (542 mg, 1.40 mmol, 1.5 eq) and N,N-diisopropylethylamine (0.49 mL, 2.79 mmol, 3.0 eq) and the mixture was stirred at RT for 12h. The reaction mixture was stopped with cold water (5 mL) and extracted three times with ethyl acetate. The combined organic layer and gave washes of brine twice. The organic layer was dried over sodium sulfate and evaporated to dryness. The crude material was purified by reverse phase HPLC (0.1% Ammonium bicarbonate / ACN, gradient) to yield in the desired compound (67.6 mg, 0.17 mmol, 18%) of a pale brown solid. See Table 2 below for analytical data.

[0695] 2. Synthesis of N-[6-fluoro-1-(1-methyl-1H-indazol-5-yl)-1H-1,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide (Examples No. 67) e. Synthesis of N-(5-fluoro-2-nitrophenyl)-1-methyl-1H-indazol-5-amine

[0696] 5-Fluoro-2-nitro-phenylamine (550 mg, 3.52 mmol, 1.0 eq), 5-Bromo- 1 -methyl- 1H-indazole, 98% (797 mg, 3.70 mmol, 1.05 eq), XPhos Pd G3 (298 mg, 0.35 mmol, 0.1 eq) and cesium carbonate (3.44 g, 10.6 mmol, 3.0 eq) were suspended in 1,4-Dioxane (15 mL). The mixture was stirred 20 h at 100°C. The mixture was filtered and the solid washed with dioxane. The filtrate was evaporated to dryness. The residue was dissolved in DCM and washed with water and with brine. The organic layer was dried with sodium sulfate and adsorbed on silica gel and then separated by flash chromatography on silica, (cyclohexane / ethyl acetate, gradient) to yield in 912 mg (3.60 mmol, 87%) of a red solid with purity of 96%. Rt LC / MS (Method A) = 1.73 min, (M+H) 287. f. Synthesis of 5-fluoro-N1-(1-methyl-1H-indazol-5-yl)benzene-1,2-diamine N-(5-fluoro-2-nitrophenyl)-1-methyl-1H-indazol-5-amine (912 mg, 3.06 mmol, 1.0 eq) was dissolved in THF (20 mL), Sponge Nickel metalyst MC813 (0.9 g) was added and the mixture was stirred for 16 h at RT under hydrogen atmosphere. The mixture was evaporated t dryness. The residue was dissolved in DCM and washed with water and with brine. The organic layer Foreignfiling_text P24-163

[0697] 52 was dried with sodium sulfate, filtered and evaporated to dryness to yield in 800mg (2.90 mmol, 95%) of the desired yellow product with purity of 93%. Rt LC / MS (Method A) = 1.30 min, (M+H) 257. The crude product was used without further purification. g. Synthesis of 6-fluoro-1-(1-methyl-1H-indazol-5-yl)-1H-1,3-benzodiazol-2-amine To a solution of 5-fluoro-N1-(1-methyl-1H-indazol-5-yl)benzene-1,2-diamine (800 mg, 2.90 mmol, 1.0 eq) in ethanol (20 mL) was added cyanogen bromide (300 mg, 2.75 mmol, 0.95 eq). The mixture stirred for 2h at rt. The mixture was evaporated to dryness and the residue was treated with water and sat. NaHCO3-solution and extracted with DCM. The organic layer was dried and evaporated to dryness and purified by flash chromatography (DCM / methanol, gradient) to yield in 705 mg (2.50, 86%) of a yellow solid with a purity of 100%. Rt LC / MS (Method A) = 1.14 min, (M+H) 287. h. Synthesis of N-[6-fluoro-1-(1-methyl-1H-indazol-5-yl)-1H-1,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide

[0698] 6-methoxypyrimidine-4-carboxylic acid (38.3 mg, 0.25 mmol, 1.4 eq), TBTLI (85.5 mg, 0.27 mmol, 1.5 eq) and N-ethyldiisopropylamine (90.6 pl, 0.53 mmol, 3.0 eq) were dissolved in N,N- diethylformamide (4 mL). The mixture stirred for 5 min at RT. To the mixture 6-fluoro-1-(1- methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-amine (50.0 mg, 0.18 mmol, 1.0 eq) was added and stirring continued for 1h at RT. Further 6-methoxypyrimidine-4-carboxylic acid (383 mg, 0.25 mmol, 1.4 eq), TBTU (85,5 mg, 0,27 mmol, 1.5 eq) and N-ethyldiisopropylamine for synthesis (0.09 mL, 0.53 mmol, 3.0 eq) were added and the mixture was stirred for further 1h at RT. The solvent was evaporated to dryness. The residue was dissolved in DCM and washed with water and with sat. NaHCO3-solution. The organic layer was evaporated to dryness and the resulting residue was purified by preparative chromatography (water / acetonitrile, gradient). The combined product-containing fractions were washed with water and NaHCO3-solution. The organic layer was dried with sodium sulfate, filtered and evaporated to dryness to yield in 27.4 mg (0.065 mmol, 37%) of the desired product as off-white solid with purity of 99%. For analytical data see Table 2 below.

[0699] According to either one or the other synthetic scheme from 1 and 2, the following compounds were synthesized: Example No. 32, Example No. 109, Example No. 131 , Example No. 66, Example No. 26, Example No 45, Example No. 133, Example No. 69, Example No. 50, Example No. 61 , Example No. 132, Example No. 110, Example No. 63, Example No. 68, Example No. 125, Example No. 166, Example No. 174, Example No. 76, Example No. 38, Example No. 168, Example No. 134, Example No. 101, Example No. 51 , Example No. 176, Example No. 107, Example No. 35, Example No. 21 , Example No. 46, Example No. 55, Example No. 130, Example No. 129, Example No. 171, Example No. 147, Example No. 100, Example No. 85, Example No. 36, Example No. 173, Example No. 113, Example No. 72, Example No. 169, Example No. 167, Example No. 99, Example No. 27, Example No. 71 , Example No. 124, Example No. 106, Example No. 14, Example No. 119, Example No. 3, Example No. 4, Example No. 118, Example No. 2, Example No. 163, Example No. 95, Example No. 121, Example No. 143, Example No. 73, Example No. 138, Example No. 28, Example No. 197, Example No. 44, Example No. 12, Example No. 144, Example No. 183, Example No. 64, Example No. 11 , Example No. 141, Example No. 25, Example No. 80, Example No. 151, Example No. 104, Example No. 17, Example No. 142, Example No. 159, Example No. 13, Example No. 84, Example No. 49, Example No. 30, Example No. 122, Example No. 153, Example No. 120, Example No. 86, Example No. 48, Example No. 29, Example No. 74, Example No. 193, Example No. 5, Example No. 75, Example No. 190, Example No. 1 , Example No. 152, Example No. 160, Example No. 79, Example No. 77, Example No. 180, Example No. 19, Example No. 149, Example No. 154, Example No 10, Example No. 87, Example No. 47, Foreignfiling_text P24-163

[0700] 53

[0701] Example No. 158, Example No. 7, Example No. 18, Example No. 57, Example No. 162, Example No. 150, Example No. 111, Example No. 145, Example No. 140, Example No. 188, Example No. 56, Example No. 157, Example No. 156, Example No. 146, Example No. 148, Example No. 92, Example No. 70, Example No 37, Example No 42, Example No. 172, Example No. 16, Example No. 164, Example No. 43, Example No. 94, Example No. 137, Example No. 78, Example No. 54, Example No. 23, Example No. 170, Example No. 6, Example No. 161, Example No. 177, Example No. 237, Example No. 224, Example No. 222, Example No. 226,

[0702] Example No. 234, Example No. 216, Example No. 223, Example No. 233, Example No. 227,

[0703] Example No. 218, Example No. 219, Example No. 221, Example No. 235, Example No. 238,

[0704] Example No. 225.

[0705] 3. Synthesis of N-[1-(isoquinolin-5-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine- 4-carboxamide (Example No. 34) i. Synthesis of 1-(isoquinolin-5-yl)-1H-1,3-benzodiazol-2-amine

[0706] 2-Aminobenzimidazole (100 mg, 0.75 mmol, 1.0 eq), 5-bromoisoquinoline (175 mg, 0.83 mmol, 1.1 eq), cesium carbonate (734 mg, 2.25 mmol, 3.0 eq), copper(l) iodide (28.6 mg, 0.15 mmol, 0.2 eq) and 8-hydroxyquinoline (32.7 mg, 0.23 mmol, 0.3 eq) were suspended in dimethyl sulfoxide (7 mL) and the mixture was stirred 18 h at 130°C. The mixture was evaporated to dryness. The residue was diluted with DCM and washed with water and sat. NaHCO3-solution. The organic layer was evaporated to dryness and the resulting residue was purified by preparative chromatography water / ACN, gradient). To the product containing fractions were added water and a NaHCO3-solution and the mixture was extracted with DCM twice. The organic layers were dried with sodium sulfate, filtered and evaporated to dryness to yield in the desired product (18.0 mg, 0.064 mmol, 9%) of the desired product as colorless oil. Rt LC / MS (Method A) = 0.98 min, (M+H) 261. j. Synthesis of N-[1-(isoquinolin-5-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine- 4-carboxamide

[0707] 6-methoxypyrimidine-4-carboxylic acid (14.4 mg, 0.09 mmol, 1.5 eq), TBTLI (35.0 mg, 0.11 mmol, 1.7 eq) and N-ethyldiisopropylamine (32.5 pl, 0.19 mmol, 3.0 eq) were dissolved in N,N- dimetylformamide (1 mL) and the mixture was stirred for 5min at RT. To the mixture was added a solution of 1-(isoquinolin-5-yl)-1H-1,3-benzodiazol-2-amine (18.0 mg, 0.06 mmol, 1.0 eq) in N,N-dimetylformamide (4 mL) and the mixture was stirred for 1h at rt. Further 6- methoxypyrimidine-4-carboxylic acid (14.7 mg, 0.10 mmol, 1.5 eq), TBTU (30.6 mg, 0.10 mmol, 1.5 eq) and N-ethyldiisopropylamine (0.03 mL, 0.19 mmol, 3.0) were added and the mixture stirred for further 2h at RT. The mixture was evaporated to dryness. The residue was dissolved in DCM and washed with water / sat. NaHCO3-solution. The organic layer was evaporated to dryness and the residue was purified by preparative chromatography (water / ACN, gradient). Product-containing fractions were combined and NaHCO3-solution was added and then extracted with DCM. The organic layer was dried with sodium sulfate, filtered and evaporated to dryness to get the desired product (19.0 mg, 0.047 mmol, 75%) as a colorless oil. For analytical data see Table 2 below. Foreignfiling_text P24-163

[0708] 54

[0709] According to synthetic scheme 3, the following compounds were synthesized: Example No. 52, Example No. 53, Example No. 98, Example No. 15, Example No. 93, Example No. 24, Example No. 103, Example No. 139.

[0710] 4. Synthesis of N'-[6-fluoro-1-(1-methyl-1H-indazol-5-yl)-1H-1,3-benzodiazol-2- yl]ethanediamide (Example N k. Synthesis of N'-[6-fluoro-1-(1-methyl-1H-indazol-5-yl)-1H-1,3-benzodiazol-2- yl]ethanediamide

[0711] Oxamic acid (23.7 mg, 0.27 mmol, 1 ,5 eq), TBTLI (85.5 mg, 0.27 mmol, 1.5 eq), 6-fluoro-1-(1- methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-amine (50.0 mg, 0.18 mmol, 1.0 eq) and N- ethyldiisopropylamines (90.6 pl, 0.53 mmol, 3.0 eq) were dissolved in N,N-dimethylformamide (4 mL) and the mixture was stirred for 1 h at RT. The solvent was evaporated under reduced pressure. The residue was diluted with DCM and washed with water and with sat. NaHCO3- solution. The residue was sonicated with ACN and filtered and then washed with water and purified by preparative chromatography (water / ACN, gradient) to yield in the desired product (16.0 mg, 0.042, 24%) as light beige solid with purity of 93%. For analytical data see Table 2 below.

[0712] According to synthetic scheme 4, the following compounds were synthesized: Example No. 195, Example No. 135, Example No. 175, Example No. 184, Example No. 196, Example No. 187, Example No. 102, Example No. 186, Example No. 105, Example No. 189, Example No. 104, Example No. 182, Example No. 178.

[0713] 5. Synthesis of N-[1-(4-carbamoylphenyl)-6-fluoro-1H-1,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide (Example No. 191)

[0714] HATLI (155 mg, 0.41 mmol, 1.5 eq) and triethylamine (113 pl, 0.82 mmol, 3.0 eq) were added to a stirred mixture of 4-[6-fluoro-2-(6-methoxypyrimidine-4-amido)-1 H-1,3-benzodiazol-1- yl]benzoic acid (150 mg, 0.27 mmol, 1.0 eq), synthesized according to scheme 1) in N,N- dimethylformamide (2 mL). After 15 min ammonia solution in dioxane (1.36 mL, 0.54 mmol, 2.0 eq) was added and the mixture was stirred at RT for 4 h. Water was added and the mixture was filtered. The residue was washed with water, ACN and diethyl ether and dried in vacuo at 50°C to afford the desired product (6.50 mg, 0.02 mmol) as a grey solid. The crude product was Foreignfiling_text P24-163

[0715] 55 purified by prep. HPLC on C18. Fraction 7-9 were combined and lyophillized to afford N-[1-(4- carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide (6,50 mg; 0,016 mmol, 6%) as an off-white solid. For analytical data see Table 2 below.

[0716] According to synthetic scheme 5, the following compounds were synthesized: Example No. 185, Example No. 179, Example No. 22, Example No. 31 , Example No. 41 , Example No. 192, Example No. 40, Example No. 112, Example No. 181 , Example No. 81 , Example No. 59, Example No. 91 , Example No. 123, Example No. 165, Example No. 20, Example No. 33, Example No. 39, Example No. 58, Example No. 60.

[0717] 6. Synthesis of N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1H-1,3- benzodiazol-2-yl)-6-methoxypyrimidine-4-carboxamide (Example No. 115) m. Synthesis of 1-[2-(morpholin-4-yl)ethyl]-5-nitro-1 H-indazole

[0718] To 5-nitro-1 H-indazole (2.00 g, 12.0 mmol, 1.0 eq) and 4-(2-chloroethyl)morpholine hydrochloride (2.50 g, 13.2 mmol, 1.1 eq) in DMF (40 mL) was added potassium carbonate (5.08 g, 36.0 mmol, 3.0 eq,) at RT under nitrogen atmosphere. The mixture was stirred at 60°C for 12h. The reaction mixture was quenched with water (50 mL) and extracted three times with ethyl acetate. The combined organic layers were washed with brine twice. Then organic layer was dried over sodium sulfate, filtered and evaporated to dryness. The residue was purified by flash silica gel chromatography (ethyl acetate / petroleum ether) to yield in the desired product (2.05 g, 6.95 mmol, 58%) as a brownish solid. Rt LC / MS (Method F) = 0.34 min, (M+H) 277. n. Synthesis of 1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-amine

[0719] To a well stirred solution of 1-[2-(morpholin-4-yl)ethyl]-5-nitro-1 H-indazole (2.05 g, 6.95 mmol, 1.0 eq) in ethanol (80 mL) and water (20 mL) were added ammonium chloride (1.90 g, 34.8 mmol, 5.0 eq) and Fe (1 .96 g, 34.8 mmol, 5.0 eq) at RT. The mixture was stirred at 90 °C for 5 h. The reaction was filtered through Celite and the filtrate evaporated to dryness. The residue obtained was dissolved in ethyl acetate and washed with water and the organic layer evaporated to dryness again to yield in the desired product (810 mg, 2.94 mmol, 42 %) of a dark solid. It was used in the next step without further purification. Rt LC / MS (Method F) = 1.27 min, (M+H) 247.

[0720] The final product (Example No. 115) was synthesized as described by scheme 1. For analytical data see Table 2 below.

[0721] According to synthetic scheme 6, the following compounds were synthesized: Example No. 126, Example No. 88, Example No. 114, Example No. 108, Example No. 128, Example No. 127, Example No. 116, Example No. 96, Example No. 82, Example No. 90, Example No. 97, Example No. 9, Example No. 83, Example No. 155, Example No. 136, Example No. 65, Example No. 117, Example No. 89, Example No. 8, Example No. 220, Example No. 231 , Example No. 229, Example No. 215, Example No. 232, Example No. 230, Example No. 236, Example No. 228, Example No. 217. Foreignfiling_text P24-163

[0722] 56

[0723] The compounds described in the following Table 2 were prepared using the appropriate starting materials using a procedure as described above. Table 2 Foreignfiling_text P24-163

[0724] 57 Foreignfiling_text P24-163

[0725] 58 Foreignfiling_text P24-163

[0726] 59 Foreignfiling_text P24-163

[0727] 60 Foreignfiling_text P24-163

[0728] 61 Foreignfiling_text P24-163

[0729] 62 Foreignfiling_text P24-163

[0730] 63 Foreignfiling_text P24-163

[0731] 64 Foreignfiling_text P24-163

[0732] 65 Foreignfiling_text P24-163

[0733] 66 Foreignfiling_text P24-163

[0734] 67 Foreignfiling_text P24-163

[0735] 68 Foreignfiling_text P24-163

[0736] 69 Foreignfiling_text P24-163

[0737] 70 Foreignfiling_text P24-163

[0738] 71 Foreignfiling_text P24-163

[0739] 72 Foreignfiling_text P24-163

[0740] 73 Foreignfiling_text P24-163

[0741] 74 Foreignfiling_text P24-163

[0742] 75 Foreignfiling_text P24-163

[0743] 76 Foreignfiling_text P24-163

[0744] 77 Foreignfiling_text P24-163

[0745] 78 Foreignfiling_text P24-163

[0746] 79 Foreignfiling_text P24-163

[0747] 80 Foreignfiling_text P24-163

[0748] 81 Foreignfiling_text P24-163

[0749] 82 Foreignfiling_text P24-163

[0750] 83 Foreignfiling_text P24-163

[0751] 84 Foreignfiling_text P24-163

[0752] 85 Foreignfiling_text P24-163

[0753] 86 Foreignfiling_text P24-163

[0754] 87 Foreignfiling_text P24-163

[0755] 88 Foreignfiling_text P24-163

[0756] 89 Foreignfiling_text P24-163

[0757] 90 Foreignfiling_text P24-163

[0758] 91 Foreignfiling_text P24-163

[0759] 92 Foreignfiling_text P24-163

[0760] 93 Foreignfiling_text P24-163

[0761] 94 Foreignfiling_text P24-163

[0762] 95 Foreignfiling_text P24-163

[0763] 96 Foreignfiling_text P24-163

[0764] 97 Foreignfiling_text P24-163

[0765] 98 Foreignfiling_text P24-163

[0766] 99 Foreignfiling_text P24-163

[0767] 100 Foreignfiling_text P24-163

[0768] 101 Foreignfiling_text P24-163

[0769] 102 Foreignfiling_text P24-163

[0770] 103 Foreignfiling_text P24-163

[0771] 104 Foreignfiling_text P24-163

[0772] 105 Foreignfiling_text P24-163

[0773] 106 Foreignfiling_text P24-163

[0774] 107 Foreignfiling_text P24-163

[0775] 108 Foreignfiling_text P24-163

[0776] 109 Foreignfiling_text P24-163

[0777] 110 Foreignfiling_text P24-163

[0778] 111 Foreignfiling_text P24-163

[0779] 112 Foreignfiling_text P24-163

[0780] 113 Foreignfiling_text P24-163

[0781] 114 Foreignfiling_text P24-163

[0782] 115 Foreignfiling_text P24-163

[0783] 116 Foreignfiling_text P24-163

[0784] 117 Foreignfiling_text P24-163

[0785] 118 Foreignfiling_text P24-163

[0786] 119 Foreignfiling_text P24-163

[0787] 120 Foreignfiling_text P24-163

[0788] 121 Foreignfiling_text P24-163

[0789] 122 Foreignfiling_text P24-163

[0790] 123 Foreignfiling_text P24-163

[0791] 124 Foreignfiling_text P24-163

[0792] 125 Foreignfiling_text P24-163

[0793] 126

[0794] Foreignfiling_text P24-163

[0795] 127 Foreignfiling_text P24-163

[0796] 128 Foreignfiling_text P24-163

[0797] 129 Foreignfiling_text P24-163

[0798] 130 Foreignfiling_text P24-163

[0799] 131 Foreignfiling_text P24-163

[0800] 132 Foreignfiling_text P24-163

[0801] 133 Foreignfiling_text P24-163

[0802] 134

[0803] Biological data

[0804] TREX1 nuclease assay - determination of TREXI inhibition (IC50 TREX1):

[0805] The IC50 values were determined by a biochemical TREX1 nuclease assay. TREX1 (three prime repair exonuclease 1) degrades cytosolic ssDNA and dsDNA molecules that feature a 3’ overhang. A mixture of TREX1 protein and the test substance were incubated at different concentrations with addition of fluorescently labelled DNA substrate. Degradation of a 5’-FAM / 3’-BHQ1 dual labelled substrate, where iterative removal of nucleotides from the 3’ ends of oligos 1 and 2 causes an increase in fluorescent signal that is proportional to the amount of product.

[0806] In detail: The enzymatic TREX1 assay was carried out as Fluorescence Intensity (Fl) based 1536-well assay. Purified human recombinant TREX1 (human TREX1 , amino acids 1-242, UniProt ID Q9NSLI2, expressed in E. coli) was incubated in assay buffer for 30 minutes with the TREX1 inhibitor in various concentrations and without test substance as negative or neutral control. The assay buffer comprised 20 mM TRIS pH 7.5, 5 mM MgCh, 1 mM DTT, BSA 0.1% (1 mg / mL), 0.01% (v / v) IGEPAL® CA-630. The test-substance solutions were dispensed into the microtitre plates using a Hummingbird capillary pipettor (Digilab). Reactions were initiated by the addition of FAM / BHQ1 dual labelled DNA substrate (generated by annealing of oligo 1 : [FAM]-CTAAGTTCGTCAGGATTCCAGCATTGTAACAGTGATAGAG, and oligo 2: GCTGGAATCCTGACGAACTTAG -[BHQ1] (Integrated DNA Technologies)) in assay buffer. The pharmacologically relevant assay volume was 5 pl. The final concentrations in the assay during incubation of the reaction mixture were 0.03 - 0.04 nM TREX1 and 40 nM DNA substrate. After 60 min at room temperature, reactions were quenched by the addition of 3 pl of stop buffer (270 mM EDTA, 45 mM TRIS pH 7.5). The plates were analysed in a plate reader (PheraStar FSX, BMG LabTech) measuring fluorescence at 520 nm following excitation at 485 nm. The amount of product generated is directly proportional to the amounts of light emitted, i.e. the relative fluorescence units (RFU) at 520 nm. The measurement data were processed by means of the Genedata Screener software. In particular, IC50 values were determined by fitting a dose-response curve to the data points using nonlinear regression analysis.

[0807] IC50 = half-maximum inhibitory concentration

[0808] FAM = carboxyfluorescein BHQ1 = Black Hole Quencher 1 TRIS = tris(hydroxymethyl)aminomethane MgCh = magnesium chloride DTT = dithiothreitol

[0809] BSA = Bovine Serum Albumin Foreignfiling_text P24-163

[0810] 135

[0811] EDTA = ethylenediamine tetraacetate

[0812] RT = room temperature

[0813] Results

[0814] The results are summarized in Table 3 below, wherein the following classifications were applied.

[0815] TREX1 IC50: A: IC5o < 0.2 pM; B: IC5o < 1 pM; C: IC5o < 10 pM. Table 3 Foreignfiling_text P24-163

[0816] 136 Foreignfiling_text P24-163

[0817] 137 Foreignfiling_text P24-163

[0818] 138 Foreignfiling_text P24-163

[0819] 139 Foreignfiling_text P24-163

[0820] 140

Claims

Foreignfiling_text P24-163141Claims1. A compound of formula (I)or a stereoisomer, tautomer, N-oxide, or pharmaceutically acceptable salt thereof; whereinR1is C(=O)R11, whereinR11is NRARB, ORC, Ci-C4-alkyl, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RD; orR1is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE;R2is H;R3is -CH2-R33, whereinR33is 3- to 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RG; orR3is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered saturated, partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RH;R4is H, or halogen;R5is H, or halogen;Foreignfiling_text P24-163142R6is H, or halogen; andR7is H, or halogen; and whereinRAis H, or Ci-C4-alkyl;RBis H, or Ci-C4-alkyl;Rcis H, or Ci-C4-alkyl;RDis halogen, Ci-C2-alkyl, or Ci-C2-alkoxy;REis halogen, OH, NH2, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl, or Ci-C4-alkoxy; or two REtogether form =0;RGis halogen, CN, NH2, OH, C(=O)NR'RJ, Ci-C4-alkyl, Ci-C4-haloalkyl, Ci-C4-alkyl-NR'RJ, C1- C4-alkyl-C(=O)NR'RJ, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy, Ci-C4-hydroxyalkoxy, or C1-C4- alkoxy-Ci-C4-alkyl;RHis halogen, CN, NR'RJ, ORK, C(=O)RL, S(=O)RM, S(=O)2RM, S-RM, Ci-C4-alkyl, C1-C4- haloalkyl, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl-ORK, Ci-C4-alkyl-C(=O)RL, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl,or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RN; or two RHtogether form =0;R1is H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp;RJis H, or Ci-C4-alkyl;RKis H, Ci-C4-alkyl, Ci-C4-hydroxyalkyl, Ci-C4-alkyl-NR°Rp, Ci-C4-alkyl-C(=O)NR°Rp, or 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl, or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RR;RLis NR'RJ, or ORK;RMis Ci-C2-alkyl;RNis Ci-C4-alkyl, or Ci-C4-alkyl-NR°Rp;R° is H, Ci-C4-alkyl, or C(=O)RQ;Rpis H, or Ci-C4-alkyl;RQis Ci-C4-alkyl, Ci-C4-aminoalkyl, -CH2-(O-CH2CH2)n-O-CH3, -CH2CH2-(O-CH2CH2)n-O- CH3, -CH2-(O-CH2CH2)n-NH2, -CH2CH2-(O-CH2CH2)n-NH2, wherein in each case independently n is 0, 1 , 2, 3, or 4;RRis 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents Rs; andRsis NR°RP.

2. The compound according to claim 1 , whereinR1is C(=O)R11,Foreignfiling_text P24-163143 whereinR11is NRARB, ORC, Ci-C4-alkyl, or phenyl, wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RD; orR1is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered partially or fully unsaturated, or aromatic carbobicyclyl or heterobicyclyl; wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more, same or different substituents RE.

3. The compound according to claim 1 or 2, wherein4. The compound according to any one of claims 1 to 3, whereinR3is -CH2-R33, whereinR33is 4- to 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S- atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RG; orR3is 5- or 6-membered saturated, partially or fully unsaturated, or aromatic carbocyclyl or heterocyclyl, or 9- or 10-membered saturated, partially or fully unsaturated, or aromaticForeignfiling_text P24-163144 carbobicyclyl or heterobicyclyl, wherein the aforementioned heterocyclyl or heterobicyclyl independently comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RH; whereinRGis OH, C(=O)NR'RJ, Ci-C4-alkyl-NR'RJ, Ci-C4-alkyl-C(=O)NR'RJ, Ci-C4-hydroxyalkyl, C C4-alkoxy, Ci-C4-hydroxyalkoxy, or Ci-C4-alkoxy-Ci-C4-alkyl;RHis halogen, CN, NR'RJ, ORK, C(=O)RL, S(=O)RM, S(=O)2RM, S-RM, Ci-C4-alkyl, Ci-C4- haloalkyl, Ci-C4-alkyl-NR'RJ, Ci-C4-hydroxyalkyl, Ci-C4-alkoxy-Ci-C4-alkyl, or 5- or e- membered saturated, partially or fully unsaturated, or aromatic carbocyclyl, heterocyclyl, carbocyclyl-Ci-C2-alkyl,or heterocyclyl-Ci-C2-alkyl, wherein the aforementioned heterocyclyl comprises one or more, same or different heteroatoms selected from O, N, and S, wherein said N- and / or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable atom in the aforementioned groups is independently unsubstituted or substituted with one or more same or different substituents RN; or two RHtogether form =0.

5. The compound according to any one of claims 1 to 4, whereinForeignfiling_text P24-163Foreignfiling_text P24-163Foreignfiling_text P24-1631476. The compound according to any one of claims 1 to 5, wherein R4is H.

7. The compound according to any one of claims 1 to 6, wherein R5is H, Cl, or F.

8. The compound according to any one of claims 1 to 7, wherein R6is H, Cl, or F.

9. The compound according to any one of claims 1 to 8, wherein R7is H, Cl, or F.

10. The compound according to any one of claims 1 to 9, wherein the compound is selected from the group consisting ofN-[1-(3-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]pyridine-2-carboxamide;N-[6-fluoro-1-(2-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[6-chloro-1-(2-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[1-(3-hydroxyphenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[1-(2-cyanophenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;6-methoxy-N-[1-(3-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1-(3-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]pyrazine-2-carboxamide;6-methoxy-N-{1-[(2-methoxyphenyl)methyl]-1H-1,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;6-methoxy-N-{1-[(3-methoxyphenyl)methyl]-1H-1,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;N-[1-(3-cyanophenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-{1-[2-(2-hydroxyethyl)phenyl]-1 H-1,3-benzodiazol-2-yl}-6-methoxypyrimidine-4-carboxamide;N-{1-[2-(2-hydroxyethoxy)phenyl]-1H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;6-methoxy-N-{1-[2-(trifluoromethyl)phenyl]-1 H-1,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;N-[7-fluoro-1-(4-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;5-methoxy-N-[1-(4-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]pyridine-2-carboxamide;N-[1-(4-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]-5-methylpyridine-2-carboxamide;N-[1-(4-cyanophenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-{1-[4-(dimethylamino)phenyl]-1H-1,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;N-[1-(4-methoxyphenyl)-1H-1,3-benzodiazol-2-yl]-5-methylpyrazine-2-carboxamide;N-[1-(4-hydroxyphenyl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[1-(4-carbamoylphenyl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;Foreignfiling_text P24-163148N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2-carboxamide;N-(1-benzyl-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[6-fluoro-1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-(1-{[3-(carbamoylmethyl)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2-carboxamide;N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;N-[1-(3,4-dimethoxyphenyl)-4,6-difluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1 -( 1 -ethyl- 1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-{1-[4-(1-methyl-1H-pyrazol-4-yl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;N-[1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-(1-{4-[(pyridazin-3-yl)methoxy]phenyl}-1 H-1, 3-benzodiazol-2-yl)pyrimidine-4- carboxamide;N-(1-{[3-(2-hydroxyethoxy)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;N-(1-{[2-(hydroxymethyl)phenyl]methyl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;N-(1-{[3-(2-hydroxyethyl)phenyl]methyl}-1 H-1, 3-benzodiazol-2-yl)pyrimidine-4- carboxamide;N-[1-(2-oxo-2,3-dihydro-1 H-1 ,3-benzodiazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;N-[1 -( 1 ,3-dihydro-2-benzofuran-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]-1-methyl-6-oxo-1 ,6-dihydropyrimidine-4- carboxamide;N-[1-(1-methyl-1 H-indazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;6-methoxy-N-[1-(1 -methyl- 1 H-indazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1-(1-methylpiperidin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-2-carboxamide;N-[1-(3,4-dimethoxyphenyl)-4,6-difluoro-1 H-1 ,3-benzodiazol-2-yl]-5-fluoropyridine-2- carboxamide;N-[1-(pyridin-4-yl)-1 H-1 , 3-benzodiazol-2-yl]pyrimidine-4- carboxamide;N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2- carboxamide;5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-2- carboxamide;N-[1-(phthalazin-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-{1-[4-(methylcarbamoyl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;N-(1-{4-[(2-hydroxyethyl)carbamoyl]phenyl}-1H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;N-[1-(4-{[2-(dimethylamino)ethyl]carbamoyl}phenyl)-1H-1,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;N-{1-[3-(methylcarbamoyl)phenyl]-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;N-[1-(4-methanesulfinylphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1-(4-methanesulfonylphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-(1-{3-[(2-hydroxyethyl)carbamoyl]phenyl}-1H-1 ,3-benzodiazol-2-yl)pyrimidine-4-carboxamide;N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine- 4-carboxamide;Foreignfiling_text P24-163149N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;5-fluoro-N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyridine-2- carboxamide;N-[1-(isoquinolin-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine- 2-carboxamide;N-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2- carboxamide;N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide;N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;6-methoxy-N-[1-(4-methoxyphenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-fluoropyridine-2- carboxamide;N-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2- carboxamide;N-[6-fluoro-1-(1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine- 2-carboxamide;N-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-2-oxopropanamide;N-{1-[3-({5-[4-(dimethylamino)piperidin-1-yl]pyridazin-3-yl}oxy)phenyl]-1H-1,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;N-{1-[2-(2-hydroxypropyl)phenyl]-1 H-1 ,3-benzodiazol-2-yl}pyrimidine-4-carboxamide;N-{1-[4-({5-[4-(dimethylamino)piperidin-1-yl]pyridazin-3-yl}oxy)phenyl]-1H-1,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;N'-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-N-methylethanediamide;N'-[1-(4-cyanophenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)-5- methoxypyrazine-2-carboxamide;5-methoxy-N-[1-(1 -methyl- 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrazine-2-carboxamide;N-[1-(4-cyanophenyl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4- carboxamide;N-{1-[4-(2-acetamidoethoxy)phenyl]-1 H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1 -( 1 ,3-dimethyl-2-oxo-2,3-dihydro-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide;N-(1-{4-[2-(4-aminobutanamido)ethoxy]phenyl}-1 H-1 ,3-benzodiazol-2-yl)-6-hydroxypyrimidine-4- carboxamide;N-{1-[1-(2-aminoethyl)-1 H-indazol-5-yl]-6-fluoro-1 H-1 ,3-benzodiazol-2-yl}-5-methoxypyrazine-2- carboxamide;N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;Foreignfiling_text P24-163150N-{1-[4-(dimethylca rbamoyl)phenyl]-6-fluoro-1 H-1, 3-benzodiazol-2-yl}pyrimidine-4- carboxamide;N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-5-methoxypyrazine-2-carboxamide;6-methoxy-N-[1-(1 ,3,3-trimethyl-2-oxo-2,3-dihydro-1 H-indol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;N-[1-(3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]-6- methoxypyrimidine-4-carboxamide;N-[1-(1-methyl-2,2-dioxo-1 ,3-dihydro-2A6,1-benzothiazol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;5-fluoro-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;6-methoxy-N-[1-(1-methyl-2,2-dioxo-1 ,3-dihydro-2A6, 1-benzothiazol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;5-methyl-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrazine-2- carboxamide;N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2-carboxamide;5-methoxy-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1,3-benzodiazol-2-yl]pyridine-2- carboxamide;3-amino-N-[1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyridine-2- carboxamide;N-{1-[4-(dimethylcarbamoyl)phenyl]-6-fluoro-1 H-1 ,3-benzodiazol-2-yl}-6-methoxypyrimidine-4- carboxamide;N-[1-(4-carbamoylphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[1 -( 1 ,3,3-trimethyl-2-oxo-2,3-dihydro-1 H-indol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;N-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4-carboxamide;N-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N'-[1-(2,6-dimethoxyphenyl)-6-fluoro-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;6-methoxy-N-[1-(2,3,3-trimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;N-(1-{1-methyl-1 H-pyrrolo[3,2-b]pyridin-7-yl}-1 H-1 ,3-benzodiazol-2-yl)pyrimidine-4- carboxamide;N-[1-(2,3,3-trimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;6-methoxy-N-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]pyrimidine-4-carboxamide;N'-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2-yl]ethanediamide;N-methyl-N'-[1-(2-methyl-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5-yl)- 1 H-1 ,3-benzodiazol-2- yl]ethanediamide;N'-[6-fluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;N-{1-[2-(2-hydroxyethyl)-3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl]-1 H-1 ,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;N-[1-(3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;N'-[6-fluoro-1-(1-methyl-1 H-1 ,3-benzodiazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-N- methylethanediamide;N'-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-N-methylethanediamide;Foreignfiling_text P24-163151N-{1-[2-(2-aminoethyl)-3,3-dimethyl-1-oxo-2,3-dihydro-1H-isoindol-5-yl]-1 H-1,3-benzodiazol-2- yl}pyrimidine-4-carboxamide;N-(6-fluoro-1-{1-[2-(morpholin-4-yl)ethyl]-1 H-indazol-5-yl}-1 H-1 ,3-benzodiazol-2-yl)-6- methoxypyrimidine-4-carboxamide;N-(6-fluoro-1-{1-[2-(1-methylpiperidin-4-yl)ethyl]-1H-indazol-5-yl}-1 H-1,3-benzodiazol-2-yl)-5- methoxypyrazine-2-carboxamide;N-(1-{2-[2-(dimethylamino)ethyl]-3,3-dimethyl-1-oxo-2,3-dihydro-1 H-isoindol-5-yl}-1 H-1,3- benzodiazol-2-yl)-6-methoxypyrimidine-4-carboxamide;N'-[4,6-difluoro-1-(1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;N'-[6-fluoro-1-(1-methyl-1H-indazol-5-yl)-1 H-1,3-benzodiazol-2-yl]-N-methylethanediamide;N-[6-fluoro-1-(pyridin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[6-fluoro-1-(2-methoxypyridin-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[6-fluoro-1-(6-methylpyridin-3-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[6-fluoro-1-(2-methyl-2H-indazol-6-yl)-1H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[6-fluoro-1-(2-methylpyridin-4-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[6-fluoro-1-(1-methyl-1 H-pyrazol-4-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[6-fluoro-1-(2-fluoropyridin-4-yl)-1H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4- carboxamide;N-[6-fluoro-1-(7-fluoro-1-methyl-1 H-indazol-5-yl)-1 H-1,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N-[6-fluoro-1-(7-fluoro-1-methyl-1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]pyrimidine-4- carboxamide;5-chloro-N-[1-(4-cyanophenyl)-6-fluoro-1 H-1,3-benzodiazol-2-yl]-3-fluoropyridine-2- carboxamide;N-[1-(4-cyanophenyl)-6-fluoro-1 H-1,3-benzodiazol-2-yl]-5-fluoro-6-methoxypyrimidine-4- carboxamide;N-[1 -( 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]-6-methoxypyrimidine-4-carboxamide;N'-[1 -( 1 H-indazol-5-yl)-1 H-1 ,3-benzodiazol-2-yl]ethanediamide;Pyrazine-2-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;6-Methyl-pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;Pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;6-Ethyl-pyrimidine-4-carboxylic acid [1-(4-methoxy-phenyl)-1 H-benzoimidazol-2-yl]-amide;N-(1-(2-(2-hydroxyethyl)-3,3-dimethyl-1-oxoisoindolin-5-yl)-1H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;N-(6-fluoro-1-(2-methyl-2H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;N-(1-(2-(2-(dimethylamino)ethyl)-3,3-dimethyl-1-oxoisoindolin-5-yl)-1H-benzo[d]imidazol-2- yl)pyrimidine-4-carboxamide;N-(6-fluoro-1-(6-methoxypyridin-3-yl)-1H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;N-(6-fluoro-1-(2-methyl-2H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)pyrimidine-4-carboxamide;N-(6-fluoro-1-(1-(2-(1-methylpiperidin-4-yl)ethyl)-1H-indazol-5-yl)-1 H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;N-(6-fluoro-1-(1-methyl-1H-indazol-6-yl)-1 H-benzo[d]imidazol-2-yl)pyrimidine-4-carboxamide;Foreignfiling_text P24-163152N-(6-fluoro-1-(1-methyl-1H-indazol-6-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;N-(6-fluoro-3'-methyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4-carboxamide;N-(6-fluoro-3'-methyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)-6-methoxypyrimidine-4-carboxamide; N-(1-(6-chloropyridin-3-yl)-6-fluoro-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;N-(1-(6-(dimethylamino)pyridin-3-yl)-6-fluoro-1H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;N-(6-fluoro-1-(1-methyl-1H-pyrazolo[3,4-c]pyridin-5-yl)-1H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;N-(1-(1-(2-aminoethyl)-1H-indazol-5-yl)-6-fluoro-1H-benzo[d]imidazol-2-yl)pyrimidine-4- carboxamide;N-(1-(1-(2-aminoethyl)-1H-indazol-5-yl)-6-fluoro-1H-benzo[d]imidazol-2-yl)-6- methoxypyrimidine-4-carboxamide;N-(6-fluoro-1'-(2-hydroxyethyl)-2'-methyl-TH-[1,5'-bibenzo[d]imidazol]-2-yl)-6- methoxypyrimidine-4-carboxamide;N-(1-(1 ,4-dimethyl-1 H-indazol-6-yl)-6-fluoro-1H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;N-(6-fluoro-3'-(2-hydroxyethyl)-2'-methyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)-6- methoxypyrimidine-4-carboxamide;N-(6-fluoro-3'-(2-hydroxyethyl)-2'-methyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4- carboxamide;N-(6-fluoro-1-(2-(methylthio)pyridin-4-yl)-1H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide;N-(6-fluoro-T,2'-dimethyl-TH-[1,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4-carboxamide;N-(6-fluoro-T-(2-hydroxyethyl)-2'-methyl-1'H-[1,5'-bibenzo[d]imidazol]-2-yl)pyrimidine-4- carboxamide;N-(6-fluoro-1-(5-fluoropyridin-3-yl)-1 H-benzo[d]imidazol-2-yl)-6-methoxypyrimidine-4- carboxamide; andN-(6-fluoro-2',3'-dimethyl-3'H-[1,5'-bibenzo[d]imidazol]-2-yl)-6-methoxypyrimidine-4- carboxamide.

11. A pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound according to any one of claims 1 to 10 and optionally a pharmaceutically acceptable carrier, diluent or excipient.

12. A compound according to any one of claims 1 to 10 or a pharmaceutical composition according to claim 11 for use in medicine.

13. A compound according to any one of claims 1 to 10 or a pharmaceutical composition according to claim 11 for use in treating or preventing a disease selected from the group consisting of cancer, such as breast, small cell lung cancer and colorectal cancer, in particular cancers with chromosomal instability, TREX1 -mediated autoimmune diseases, inflammatory myocarditis, Aicardi-Goutieres syndrome (AGS), familial chilblain lupus (FCL), systemic lupus erythematosus (SLE) and retinal vasculopathy with cerebral leukodystrophy (RVCL).