Antifibrotic (1E)-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime derivatives

Abstract

The present invention is directed to novel compounds, SIR agonist compounds of Formula I, compositions and methods for the prevention and / or treatment of inflammation in various tissues and organs. Preferably, embodiments of the present invention relate to the use of said compounds in the prevention and / or treatment of excessive production of pro-inflammatory cytokines in a medical or disease condition. The prior art compound crosses the blood-brain barrier (BBB) and acts on the central nervous system (CNS). The CNS activity is not a desired effect in anti-inflammatory treatment outside the brain. Thus, we have developed novel compounds having anti-inflammatory activity with no, or minimal CNS activity.

Description

[0001] P142395-17867-LG

[0002] Antifibrotic (1 E)-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime derivatives

[0003] Field of the invention

[0004] The present invention is directed to compositions and methods for the prevention, and / or treatment of inflammation in various tissues and organs. In particular, embodiments of the present invention relate to the use of Sigma-1 receptor (SIR) agonists for use in the prevention and / or treatment of excessive production of pro-inflammatory cytokines in a medical or disease condition. Fluvoxamine has been claimed in patent applications WO2015 / 118365 (PCT / HU2015 / 000014) as a SIR agonist, and it has shown anti-inflammatory properties.

[0005] Fluvoxamine is an antidepressant drug that crosses the blood-brain barrier (BBB) and acts on the central nervous system (CNS). The CNS activity is not a desired effect in anti-inflammatory treatment outside the brain. Transport / permeability of a compound towards the CNS can be decreased by enhancement of polarity and reducing lipophilicity. Metabolites forming during the drug's metabolism in the body could be suitable for treating inflammation due to their enhanced polarity, but these compounds have poor absorption and fast elimination properties. Thus, we have developed metabolites of the drug and prodrugs of its metabolites having anti-inflammatory activity with no, or minimal CNS activity. In a preferred embodiment, the inflammation modulators are metabolites, prodrugs or derivatives of metabolites of fluvoxamine.

[0006] Background art

[0007] The human body responds to various injuries and stimuli, including pathogens, toxic substances or any harmful agent. Inflammation is a crucial biological process functioning as part of the immune system's defense mechanism to eliminate injury, clear out damaged tissue, and initiate tissue repair. Inflammation occurs in a highly regulated and meticulously choreographed manner; it may start rapidly, become severe in days, or can progress to a chronic state which lasts for prolonged periods, even for months or years.

[0008] The prevalence of diseases associated with chronic inflammation has increased persistently for the next 30 years in the United States. In 2000, nearly 125 million Americans were living with chronic conditions, and 61 million (21%) had more than one. Worldwide, 3 of 5 people die due to chronic inflammatory diseases like stroke, chronic respiratory diseases, heart disorders, cancer, obesity, and diabetes.

[0009] There are several chronic inflammatory disorders with no cure. Most are managed with symptomatic therapy; however, in some cases, besides life-long anti-inflammatory medication, the disease progresses; therefore, novel treatments are needed.

[0010] The hallmarks of inflammation are the infiltration of the primary inflammatory cells such as macrophages, lymphocytes, and plasma cells in the tissue site, producing inflammatory cytokines such as interleukin-1 beta (IL-1 B), IL-6 or tumor necrosis factor-alpha (TNF- a), growth factors, enzymes and hence contributing to the progression of tissue damage

[0011] The Sigma-1 receptor (S1 R) is a highly conserved chaperone protein primarily studied in the central nervous system, but it is also expressed in peripheral tissues [Cureus. 2023 Mar 4;15(3):e35756. doi: 10.7759 / cureus.35756], S1 R modulates several cellular processes, including calcium signaling, inflammation, oxidative stress, and apoptosis. It primarily resides in the endoplasmic reticulum membrane and acts as a chaperone, influencing the activity of ion channels, receptors, and signaling pathways.

[0012] Activation of the S1 R has been shown to modulate systemic and local inflammation and reduce the production of proinflammatory cytokines, such as TNF-a, IL-1 p, and ilL-6. This is often linked to inhibiting the NF-KB signaling pathway, a critical regulator of inflammatory responses. The NF- KB pathway acts as a bridge between toll-like receptor (TLR)TLR2 activation and the inflammatory response. Once TLR2 is activated, it initiates a signaling cascade that activates NF-KB, resulting in the transcription of pro-inflammatory genes that exacerbate inflammation. TLRs are also found in non-immune cells such as kidney tubular epithelial systemic and local inflammation, cells, endothelial cells, podocytes, and mesangial cells ront. (Cell. Neurosci., 20 September 2018 Sec. Non-Neuronal Cells Volume 12 - 2018 | https: / / doi.org / 10.3389 / fncel.2018.00314).

[0013] Fluvoxamine showed promising anti-inflammatory effects in various preclinical models. In activated microglial cells TNF-a level can be reduced fluvoxamine treatment Sci. Rep. 2017;7(1):1-17. doi: 10.1038 / s41598-017-04968-z. In another study fluvoxamine diminished high expression of IL-1 B and TNF- TNF-a in rodent arthritis model (Environ Sci Pollut Res Int. 2023 Feb;30(6):14580-14591. doi: 10.1007 / s11356-022-23142-1 and also in liver inflammatory induced by bile duct ligation Heliyon. 2022 Dec 15;8(12):e12344. doi: 10.1016 / j.heliyon.2022.e12344. and experimental colitis (Int J Mol Sci. 2020 Jun 5;21(11):4046. doi: 10.3390 / ijms21114046.). These findings suggest that the S1 R could be a novel target for the development of anti-inflammatory drugs. (Biomolecules. 2022 Feb 25;12(3):363. doi: 10.3390 / biom 12030363).

[0014] Brief description of the invention

[0015] The invention relates to a SIR agonist compound for use in inhibiting, controlling, reversing or preventing inflammation in a tissue and / or in an organ of a subject, preferably a patient. The invention relates to a SIR agonist compound for use in the treatment or prevention of inflammation, preferably of acute or chronic inflammation in a tissue and / or in an organ of a subject, preferably a patient. In a preferred embodiment the invention relates to a SIR agonist compound for use in inhibiting; controling, reversing or preventing inflammation preferably acute or chronic in a tissue and / or in an organ wherein one or more inflammatory substances are elevated, in said tissue, preferably said inflammatory substances being selected from proinflammatory cytokines, such as TNF-a, IL-1 (3, IL-6 inflammatory mediators like NF-KB or enzymes like matrix metalloproteinases (MMP)s —or toll-like receptors.

[0016] Preferably, the tissue of the subject or patient is the tissue of an organ selected from the group consisting of kidney, lung, liver, gastrointestinal system, secretory tissues, like pancreatic tissue, vasculature, ligaments skin, eye, and the urogenital system, more preferably kidney, lung, liver, gastrointestinal system, urogenital system including the endometrium, joints and ligaments, skin and eye; even more preferably the kidney, lung, gastrointestinal system, the urogenital system including the endometrium, highly preferably the kidney and the eye. Preferably, the organ of the subject or patient is selected from the group consisting of kidney, lung, liver, gastrointestinal system, secretory glands, vasculature, ligaments, skin, eye and the urogenital system including the endometrium, more preferably the kidney, lung, liver, gastrointestinal system, the urogenital system including the endometrium, ligaments, skin and eye; even more preferably the kidney, lung and gastrointestinal system, highly preferably the kidney and the lungand the eye.

[0017] 1 . In an embodiment of the invention the S1 R agonist compound is an S1 R agonist compound having the following formula I

[0018] Formula I wherein

[0019] R1is selected from -H; -CH2-CH2-NH2; -CH2-CH2-NH-CO-C1-2 alkyl optionally substituted with one or more halogen; -CH2-CH2-NH-CO-O-C1-3 linear or branched chain alkyl, optionally substituted with phenyl; -CH2-CH2-NH2 substituted on the amin moiety with Fmoc-Val-Cit- PAB-, -CH2-CH2-OH, -CH2-CO-OH, -CH2-CO-NH2, -CH2-CO-OC1-2 alkyl,

[0020] X is selected from CH2 or C(O);

[0021] Y is selected from O, S or NH;

[0022] R2 is selected from -H; -C1-2 alkyl, preferably methyl; -CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CO-C3-6 cycloalkyl; or -SO2-C1-6 linear or branched chain alkyl; with the proviso that the compound is excluded where R1 is -CH2-CH2-NH2, X is CH2, Y is O and R2 is methyl (i.e fluvoxamine); with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2, -CH2-CH2-OH, -CH2-CO-OH or -CH2-CO-NH2, X is CH2, Y is O and R2 is -H or -C1-2 alkyl; with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2 or -CH2-CH2- NH-CO-C1-2 alkyl, X is C(O), Y is O and R2 is -H; or a pharmaceutically acceptable salt thereof.

[0023] The compounds and / or general formulas disclosed by WO2015 / 118365 (PCT / HU2015 / 000014) are excluded from the presently claimed scope.

[0024] Preferably, those compounds are excluded where:

[0025] R1 is -CH2-CH2-NH2 or -CH2-CO-NH2, X is CH2, Y is O and R2 is -H or-C1-2 alkyl;

[0026] R1 is -CH2-CH2-OH, or -CH2-CO-OH, X is CH2, Y is O and R2 is -H or methyl; and

[0027] R1 is -CH2-CH2-NH2 or -CH2-CH2-NH-CO-methyl, X is C(O), Y is O and R2 is -H.

[0028] 2. Compound of point 1 , wherein X is C(O) and R2 is -H or -C1-2 alkyl.

[0029] 3. Compound of point 1 , wherein X is CH2.

[0030] 4. Compound of any of point 1 to 3, wherein Y is O.

[0031] 5. Compound of any of point 1 to 4, wherein R1is -CH2-CH2-NH2.

[0032] 6. In a preferred embodiment of the invention the S1 R agonist compound of point 1 is an S1 R agonist compound having the following formula II

[0033] Formula II wherein R1 is as defined above in claim 1

[0034] R3 is selected from -CH2-O-C1-2 alkyl, preferably the alkyl is methyl; -CH2-O-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CH2-O-CO-C3-6 cycloalkyl; -CH2-NH-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms, -CH2-NH-SO2-C1-6 linear or branched chain alkyl; -CH2-S-C1-6 linear or branched chain alkyl, -CH2-OH or-COOH with the proviso that the compound is excluded where R1 is -CH2-CH2-NH2, X is CH2, Y is O and R2 is methyl (i.e fluvoxamine); with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2, -CH2-CH2-OH, -CH2-CO-OH or -CH2-CO-NH2, and R3 is -CH2-OH or-CH2-O-C1-2 alkyl; with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2 or -CH2-CH2- NH-CO-C1-2 alkyl, and R3 is -COOH; or a pharmaceutically acceptable salt thereof.

[0035] 7. Compound of point 6, wherein R1is -CH2-CH2-NH2.

[0036] 8. Compound of point 6 or 7, wherein R3 is selected from -CH2-O-C1-2 alkyl, preferably the alkyl is methyl; -CH2-O-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CH2-O-CO-C3-6 cycloalkyl; -CH2-NH-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms, or-COOH.

[0037] 9. Compound selected from

[0038] Ex.01 .) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetate

[0039] Ex.02.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime

[0040] Ex.03.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate

[0041] Ex.04.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentylcyclopropane carboxylate

[0042] Ex.05.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclobutanecarboxylate

[0043] Ex.06.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclopentanecarboxylate

[0044] Ex.07.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclo h exa n eca rboxylate

[0045] Ex.08.) (1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oxime Ex.09.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl pivalate

[0046] Ex.10.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl 2-methylpropanoate

[0047] Ex.11 .) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2- methylpropanamide

[0048] Ex.12.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2,2- dimethylpropanamide

[0049] Ex.13.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}acetamide

[0050] Ex.14.) (5E)-5-[(2-hydroxyethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0051] Ex.15.) (5E)-5-[(carboxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0052] Ex.17.) 2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetamide

[0053] Ex.19.) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0054] Ex.21 .) ethyl [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetate

[0055] Ex.24.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4(trifluoromethyl)phenyl]pentyl}methanesulfon amide

[0056] Ex.25.) (5E)-5-({[(trifluoroacetyl)amino]methoxy}imino)-5-[4-(trifluoromethyl)phenyl]pentyl trifluoroacetate

[0057] Ex.26.) isopropyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]eth yljcarbamate

[0058] Ex.27.) benzyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethyl} carbamate.

[0059] The compound of example 3 is a preferred embodiment.

[0060] 10. Intermediate compound for the preparation of compounds of any of points 1 to 9, selected from

[0061] 1.1.) 5-bromo-1-[4-(trifluoromethyl)phenyl]pentan-1-one (starting material for i.2 )

[0062] 1.2.) 5-oxo-5-[4-(trifluoromethyl)phenyl]pentyl acetate (starting material for ex.1 )

[0063] 1.3.) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetate (ex.2)

[0064] 1.4.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec-5- en-1 -yl acetate (ex.3)

[0065] 1.6.) tert-butyl{2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethyl} carbamate

[0066] 1.7.) tert-butyl{2-[({(1 E)-5-oxo-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]ethyl} carbamate

[0067] 1.8.) (9E)-2,2-dimethyl-4-oxo-10-[4-(trifluoromethyl)phenyl]-3,8-dioxa-5,9-diazatetradec-9-en- 14-oic acid

[0068] 1.9.) 2-{5-oxo-5-[4-(trifluoromethyl)phenyl]pentyl}-1 H-isoindole-1 ,3(2H)-dione

[0069] 1.10.) 2-{(5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl}-1 H-isoindole-1 ,3(2H)-dione

[0070] 1.11.) tert-butyl {2-[({(1 E)-5-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1-[4-(trifluoromethyl) phenyl]pentylidene}amino)oxy]ethyl}carbamate i.12.) 5-azido-1-[4-(trifluoromethyl)phenyl]pentan-1-one i.13) (1 E)-5-azido-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime

[0071] 1.14.) tert-butyl {2-[({(1 E)-5-azido-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethylcarbamate

[0072] 1.15.) tert-butyl {2-[({(1 E)-5-amino-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}carbamate

[0073] 1.16.) tert-butyl {2-[({(1 E)-5-acetamido-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethylcarbamate (ex.13)

[0074] 1.17.) tert-butyl {2-[({(1 E)-5-(isobutyrylamino)-1-[4-(trifluoromethyl)phenyl] pentylidene} amino)oxy]ethyl}carbamate (ex.11)

[0075] 1.18.) tert-butyl {2-[({(1 E)-5-[(2,2-dimethylpropanoyl)amino]-1-[4-(trifluoromethyl)phenyl] pentylidene}amino)oxy]ethyl}carbamate) (ex.12) i .19.) tert-butyl {(4E)-11 ,11 -dioxido-5-[4-(trifluoromethyl)phenyl]-3-oxa-11 -thia-4,10- diazadodec-4-en-1 -yljcarbamate (ex.24)

[0076] 1.20.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec-

[0077] 5-en-1 -yl cyclopropanecarboxylate (ex.4)

[0078] 1.21 .) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec-

[0079] 5-en-1-yl cyclo butanecarboxylate (ex.5)

[0080] 1.22.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec-

[0081] 5-en-1-yl cyclopentanecarboxylate (ex.6)

[0082] 1.23.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec-

[0083] 5-en-1-yl cyclohexanecarboxylate (ex.7)

[0084] 1.24.) 5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one (i.25)

[0085] 1.25.) (1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime (i.26)

[0086] 1.26.) tert-butyl {2-[({(1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentylidene} amino) oxy]ethyl}carbamate (ex.8)

[0087] 1.27.) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate

[0088] 1.28.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(ethoxymethyl)oxime

[0089] 1.29.) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanal

[0090] 1.30.) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0091] 1.31 .) 5-oxo-5-[4-(trifluoromethyl)phenyl]pentanoic acid (ex.19)

[0092] 1.32.) ethyl 5-oxo-5-[4-(trifluoromethyl)phenyl]pentanoate

[0093] 1.33.) ethyl (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoate

[0094] 1.34.) ethyl (5E)-5-[(2-ethoxy-2-oxoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]penta noate

[0095] (ex.15)

[0096] 1.35.) ethyl (5E)-5-[(hydroxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoate (ex.14)

[0097] 1.36.) (5E)-5-[(2-acetamidoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate

[0098] 1.37.) N-{2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl} acetamide i.38.) N-{2-[({(1 E)-5-oxo-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}acetamide (ex.16) 1.39.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1 -yl pivalate (ex.9)

[0099] 1.40.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1 -yl 2-methylpropanoate (ex.10).

[0100] 11 . In a preferred embodiment, the following compounds are excluded from the claimed scope:

[0101] Ex.16.) (5E)-5-[(2-acetamidoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0102] Ex.17.) 2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetamide

[0103] Ex.18.) (1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-oneO-(2-hydroxyethyl)oxime

[0104] Ex.20.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0105] Ex.22.) [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetic acid

[0106] Ex.23.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oxime.

[0107] 12. S1 R agonist compound having the following formula I for use as medicine; or for use in the treatment or prevention of acute and / or chronic inflammation, wherein

[0108] R1is selected from -H; -CH2-CH2-NH2; -CH2-CH2-NH-CO-C1-2 alkyl optionally substituted with one or more halogen; -CH2-CH2-NH-CO-O-C1-3 linear or branched chain alkyl, optionally substituted with phenyl; -CH2-CH2-NH2 substituted on the amin moiety with Fmoc-Val-Cit- PAB-, -CH2-CH2-OH, -CH2-CO-OH, -CH2-CO-NH2, -CH2-CO-OC1-2 alkyl,

[0109] X is selected from CH2 or C(O);

[0110] Y is selected from O, S or NH;

[0111] R2 is selected from -H; -C1-2 alkyl, preferably methyl; -CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CO-C3-6 cycloalkyl; or -SO2-C1-6 linear or branched chain alkyl; with the proviso that the compound is excluded where R1 is -CH2-CH2-NH2, X is CH2, Y is O and R2 is methyl (i.e fluvoxamine); with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2, -CH2-CH2-OH, or -CH2-CO-NH2, X is CH2, Y is O and R2 is -H or -C1-2 alkyl; with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2, X is C(O), Y is O and R2 is -H; or a pharmaceutically acceptable salt thereof.

[0112] The compounds and / or general formulas disclosed by WO2015 / 118365 (PCT / HU2015 / 000014) are excluded from the presently claimed scope.

[0113] Preferably, those compounds are excluded where:

[0114] R1 is -CH2-CH2-NH2 or -CH2-CO-NH2, X is CH2, Y is O and R2 is -H or-C1-2 alkyl;

[0115] R1 is -CH2-CH2-OH, or -CH2-CO-OH, X is CH2, Y is O and R2 is -H or methyl; and

[0116] R1 is -CH2-CH2-NH2 or -CH2-CH2-NH-CO-methyl, X is C(O), Y is O and R2 is -H.

[0117] 13. Compound for use according to point 12, wherein X is C(O) and R2 is -H or -C1-2 alkyl.

[0118] 14. Compound for use according to point 12, wherein X is CH2.

[0119] 15. Compound for use according to any of points 12 to 14, wherein Y is O.

[0120] 16. Compound for use according to any of points 12 to 15, wherein R1is -CH2-CH2-NH2.

[0121] 17. Compound for use according to point 12, wherein the S1 R agonist compound having the following formula II

[0122] Formula II wherein R1 is as defined above in claim 1

[0123] R3 is selected from -CH2-O-C1-2 alkyl, preferably the alkyl is methyl; -CH2-O-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CH2-O-CO-C3-6 cycloalkyl; -CH2-NH-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms, -CH2-NH-SO2-C1-6 linear or branched chain alkyl; -CH2-S-C1-6 linear or branched chain alkyl, -CH2-OH or -COCH with the proviso that the compound is excluded where R1 is -CH2-CH2-NH2, X is CH2, Y is O and R2 is methyl (i.e fluvoxamine); with the proviso that the compounds are excluded where R1 is -CH2-CH2-OH, or -CH2-CO- NH2, and R3 is -CH2-OH or-CH2-O-C1-2 alkyl; with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2, and R3 is - COCH; or a pharmaceutically acceptable salt thereof.

[0124] 18. Compound for use according to any of points 17, wherein R1is -CH2-CH2-NH2.

[0125] 19. Compound for use according to any of points point 17 or 18, wherein R3 is selected from - CH2-O-C1-2 alkyl, preferably the alkyl is methyl; -CH2-O-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CH2-O-CO-C3-6 cycloalkyl; - CH2-NH-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms, or-COOH.

[0126] 20. Compound for use in the treatment and / or prevention of acute and / or chronic inflammation, wherein the compound is selected from:

[0127] Ex.01 .) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetate

[0128] Ex.02.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime

[0129] Ex.03.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate

[0130] Ex.04.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentylcyclopropane carboxylate

[0131] Ex.05.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclobutanecarboxylate

[0132] Ex.06.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclopentanecarboxylate

[0133] Ex.07.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclo h exa n eca rboxylate

[0134] Ex.08.) (1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oxime

[0135] Ex.09.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl pivalate

[0136] Ex.10.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl 2-methylpropanoate

[0137] Ex.11 .) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2- methylpropanamide

[0138] Ex.12.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2,2- dimethylpropanamide

[0139] Ex.13.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}acetamide

[0140] Ex.14.) (5E)-5-[(2-hydroxyethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0141] Ex.15.) (5E)-5-[(carboxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0142] Ex.16.) (5E)-5-[(2-acetamidoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0143] Ex.17.) 2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetamide

[0144] Ex.19.) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0145] Ex.21 .) ethyl [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetate

[0146] Ex.22.) [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetic acid

[0147] Ex.23.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oxime

[0148] Ex.24.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4(trifluoromethyl)phenyl]pentyl}methanesulfon amide

[0149] Ex.25.) (5E)-5-({[(trifluoroacetyl)amino]methoxy}imino)-5-[4-(trifluoromethyl)phenyl]pentyl trifluoroacetate

[0150] Ex.26.) isopropyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]eth yljcarbamate

[0151] Ex.27.) benzyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethyl} carbamate Preferably, the compound according any of point 1 -9 is for use in the prevention or treatment of acute and / or chronic inflammation in a disorder, said disorder is selected from the group consisting of renal diseases, lung diseases, , intestinal diseases, hepatic diseases, eye diseases, diseases of the urogenital tract including the endometrium, dermal diseases, metabolic diseases, autoimmune diseases, diseases of the joints and ligaments (of the musculoskeletal system), diseases related to the use of other therapeutical drugs / processes (e.g. irradiation, chemotherapy, post-operative conditions and side-effect of surgery), to burns, to various toxins, chemical or mechanical injuries.

[0152] More preferably said disorder is selected from the group consisting of renal diseases, lung diseases, gastrointestinal diseases, hepatic diseases, eye diseases, skin diseases, and diseases of the urogenital tract including the endometrium.

[0153] Even more preferably said disorder is selected from the group consisting of renal diseases and lung and eye diseases. Very preferably the disease is a renal disease. Very preferably the disease is a lung disease. Very preferably the disease is an eye disease

[0154] The invention further relates to a method comprising the step of administering a S1 R agonist as disclosed herein to subject or patient wherein a tissue of said subject or patient is affected by acute and / or chronic inflammation and thereby inhibiting, controlling or reversing acute and / or chronic inflammation in said tissue, preferably production of inflammatory agents in said tissue, said method comprising administering to said tissue a S1 R agonist compound (S1 R agonist). Preferably said tissue affected by acute and / or chronic inflammation is targeted and / or contacted by the S1 R agonist.

[0155] The method according to the invention wherein the S1 R agonist is contacted with a tissue of a subject or patient whereby acute and / or chronic inflammation is prevented or ameliorated in said tissue of the patient.

[0156] The method according to the invention wherein said S1 R agonist is administered to said patient in a dose sufficient for agonizing S1 R in the tissue of the patient.

[0157] The method according to the invention wherein said S1 R agonist is administered in a dose sufficient for preventing, controlling, inhibiting or reversing production of inflammatory agents.

[0158] Preferably, said method comprising administering to an S1 R expressing tissue as defined herein; a S1 R agonist compound as defined herein; whereby an effective level of the S1 R agonist is provided in said tissue and wherein the S1 R agonist is contacted with a tissue of a patient whereby acute and / or chronic inflammation is prevented or ameliorated in said tissue of the patient.

[0159] In a highly preferred embodiment the S1 R agonist compound is administered to the subject or preferably to a patient during of acute and / or chronic inflammation in the tissue of said subject or preferably a patient.

[0160] The invention also relates to a cosmetic method for the treatment of a subject having acute and / or chronic inflammation effecting the skin said method comprising the step of administering a compound as defined above in an effective dose, to the area of the skin affected by acute and / or chronic inflammation; preferably in the form that is suitable for topical, percutaneous, or transdermal application (e.g. cream, lotion, ointment, etc)

[0161] In an embodiment the compound for use according to the invention is in the form of or is present in a pharmaceutical composition.

[0162] Thus, the invention relates to a pharmaceutical composition or a cosmetic composition comprising the compound of the invention for use according to the invention said composition also comprising a pharmaceutically acceptable carrier or excipient. Preferably the pharmaceutical composition is for or is suitable for oral, parenteral (including intravenous, intramuscular, intrasynovial, intrathecal, intranasal, intratracheal, intraosseal, intracardiac, intragastrical, intrabuccal, intravaginal, intrarectal, percutaneous, subcutaneous, sublingual), topical or transdermal, administration into said tissue of the patient.

[0163] Said pharmaceutical compositions may be formulated as pills, tablets, tabs, coated tablets, film tablets, capsules, powders, granulates, sustained-release formulations, suspensions, injections, drops, sprays, aerosols, suppositories, ointments, creams, pastes, syrup, lotion or gels.

[0164] Most preferably the pharmaceutical composition is present in the form of tablets either for oral, percutaneous (cream, gels) or topical (drops, aerosol) administration.

[0165] Detailed description of the invention

[0166] DEFINITIONS

[0167] A “subject” as used herein is an individual of an animal species, preferably a vertebrate, more preferably a mammalian or avian species, in particular a mammalian species, highly preferably the individual is a primate, a hominid or a human.

[0168] A “patient” is a subject who is or intended to be under medical or veterinarian observation, supervision, diagnosis or treatment.

[0169] A “treatment” refers to any process, action, application, therapy, or the like, wherein the subject or patient is under aid, in particular medical or veterinarian aid with the object of improving the subjects’s or patient’s condition, either directly or indirectly. Improving the subjects’s condition may include improving an aesthetic condition (cosmetic treatment) and / or may include, in particular, restoring or maintaining normal function of an organ or tissue, preferably at least partly restoring or maintaining health (medical or veterinarian treatment). Treatment typically refers to the administration of an effective amount of a compound or composition described herein. Treatment may relate to or include medical or veterinarian treatment and cosmetic treatment, in particular medical or veterinarian treatment.

[0170] A “composition” of the invention is a composition of matter which comprises at least one biologically active substance suitable for treating acute and / or chronic inflammation as defined herein in an effective amount. Compositions may also comprise further biologically active substances useful e.g. in a combination therapy. Furthermore, the compositions may comprise biologically acceptable carriers, formulation agents, excipients etc. which are well known in the art.

[0171] The terms “effective amount” or “therapeutically effective amount” are intended to qualify the amount of a therapeutic agent required to relieve to some extent one or more of the symptoms of a condition, disease or disorder, including but not limited to: 1 ) reducing the number of macrophages; 2) reducing the production of proinflammatory cytokines and chemokines, and / or increasing the level of anti-inflammatory cytokines; 3) reducing the size of the inflamed tissue 4) improving to at least some extent the physiological function of the tissue due to any of 1) to 3);

[0172] As used herein, the term “alkyl” alone or in combinations means a straight or branched-chain hydro-carbon group containing preferably from 1 to 6, preferably 1 to 4 or 1 to 3 carbon atom(s) or 1 to 2 carbon atom(s) [i.e. “C(1-6)” “C(1-4)” or“C(1-3)” or“C(1-2)” alkyl groups, respectively], such as methyl, ethyl, propyl, isopropyl, butyl, sec-butyl and t-butyl.

[0173] As used herein, the term “alkoxy” means an alkyl-O- group in which the alkyl group is as previously described. Non-limiting examples of suitable alkoxy groups include methoxy, ethoxy, n-propoxy, isopropoxy and n-butoxy, preferably methoxy. The bond to the parent moiety is through the oxygen (if to a carbon atom, ether oxygen).

[0174] The term “alkoxy alkyl” means an alkyl group which is substituted by an alkoxy group, i.e. an alkyl- O- group as previously described. The bond to the alkyl moiety is through the oxygen i.e. it is an ether oxygen.

[0175] An “alkenyl” as used herein, alone or in combinations, means a straight or branched-chain unsaturated hydrocarbon group containing at least one carbon-carbon double bond, said hyd rocarbon group containing p refe ra b ly f ro m 2 to 6, p refe rably2 to4 or2 to 3 or2 carbon atom(s) [i.e. “C(2-6)” “C(2-4)” or “C(2-3)” or “C(2-2)” alkyl groups].

[0176] The term “cycloalkyl” as used herein is a non-aromatic carbon-based alkyl ring composed of at least three carbon atoms.

[0177] A “heterocyclic” ring as used herein is a cyclic moiety that has, besides carbon atom(s), atoms of at least one non-carbon element(s) as member(s) of its ring(s). Preferably the ring(s) of the heterocyclic moiety is / are 5 to 6 membered ring(s).

[0178] The term “heterocycloalkyl” refers to a “heterocyclic” ring which is derivable from cycloalkyl group as defined above, wherein at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen or oxygen.

[0179] The term “aryl” as used herein is a group that contains any carbon-based aromatic ring which is preferably a mono- or bicyclic group. The term aryl also includes optionally “heteroaryl” which is defined as a group that contains an aromatic group that has at least one heteroatom incorporated within the ringof the aromatic group. Examples of heteroatoms include but not limited to nitrogen and oxygen. Optionally, the term “aryl” is limited to non-heteroaryl which is also included into the term aryl and defines a group that contains an aromatic group that does not contain a heteroatom.

[0180] A “substituted” moiety comprises a substituent selected from the groups and moieties as defined herein; however a substituent is smaller, i.e. shorter, i.e. consists of not more, preferably less atoms than the moiety which is / are substituted thereby.

[0181] When a moiety indicated in a formula is “not present” it means that there is a single (covalent) bond in the structure illustrated by the formula linking the atoms indicated in the vicinity of the moiety which is not present.

[0182] “Inflammatory mediators”:

[0183] Inflammatory mediators are a variety of small molecules and proteins produced by different cell types. These mediators are important players of inflammatory response to injury or harmful agents. There are severeal classes of of these biomolecules including but not limited to:

[0184] 1. Cytokines including proinflammatory cytokines like tumor necrosis factor-alpha (TNF-a), interleukin-6 (IL-6), and interleukin-1 beta (IL-1|3) or anti-inflammatory cytokines like IL-10

[0185] 2. Lipid mediators like prostaglandins and leukotrienes

[0186] 3. Immune cells like macrophages, lymphocytes and neutrophils

[0187] 4. Enzymes, like MMPs that degrade injured tissue

[0188] The term “comprises” or “comprising” or “including” are to be construed here as having a non- exhaustive meaning and allow the addition or involvement of further features or method steps or components to anything which comprises the listed features or method steps or components. “Comprising” can be substituted by “including” if the practice of a given language variant so requires or can be limited to “consisting essentially of” if other members or components are not essential to reduce the invention to practice. Brief description of the drawings

[0189] Figure 1 . depicts Compound 1 ’ s (example 23) Dose curve of MTT and LDH assay in HK-2 cells Values are represented as means ± SD. * p < 0.05 vs. Control, ** p < 0.01 vs. Control, *** p < 0.001 vs. Control, (n = 8 / group).

[0190] Figure 2. depicts Compound 1 ’ s (example 3) Dose curve of MTT and LDH assay in HK-2 cells Values are represented as means ± SD. * p < 0.05 vs. Control, ** p < 0.01 vs. Control, *** p < 0.001 vs. Control, (n = 8 / group).

[0191] Figure 3. depicts Compound 1 (example 23) and Compound 2 (example 3) effect on inflammatory responses in HK-2 cells. Control, lipopolysaccharide (LPS), and LPS+ Fluvoxamine (LPS+FLU) or LPS + Compound-1 (LPS + Compound 1 ) or Compound-2 (LPS + Compound 2) -treated HK-2 cells. mRNA expression of interleukin-6 (IL6), interleukin-1 p (IL1 B), nuclear factor KB (NFKB1), and tumor necrosis factor-a (TNF), mRNA expressions were normalized to RN18S. Values are represented as means ± SD. * p < 0.05 vs. Control, ** p < 0.01 vs. Control, *** p < 0.001 vs. Control, # p < 0.05 vs. LPS, ## p < 0.01 vs. LPS (n = 5 / group).

[0192] Figure 4. depicts Compound 1 (example 23) and Compound 2 (example 3) effect on inflammatory responses in HK-2 cells. Control, lipopolysaccharide (LPS), and LPS+ Fluvoxamine (LPS+FLU) or LPS + Compound-1 (LPS + Compound 1 ) or Compound-2 (LPS + Compound 2) -treated HK-2 cells. mRNA expression of toll-like receptor-2 (TLR2) and toll-like receptor-4 (TLR4), mRNA expressions were normalized to RN18S. Values are represented as means ± SD. * p < 0.05 vs. Control, ** p < 0.01 vs. Control, *** p < 0.001 vs. Control, # p < 0.05 vs. LPS, ## p < 0.01 vs. LPS (n = 5 / group).

[0193] Figure 5. depicts Compound 1 (example 23) and Compound 2 (example 3) effect on inflammatory responses in HK-2 cells. Control, lipopolysaccharide (LPS), and LPS+ Fluvoxamine (LPS+FLU) or LPS + Compound-1 (LPS + Compound 1 ) or Compound-2 (LPS + Compound 2) -treated HK-2 cells. mRNA expression of nuclear factor KB (NFKB1 ), mRNA expressions were normalized to RN18S. Values are represented as means ± SD. * p < 0.05 vs. Control, ** p < 0.01 vs. Control, *** p < 0.001 vs. Control, # p < 0.05 vs. LPS, ## p < 0.01 vs. LPS (n = 5 / group).

[0194] Figure 6. depicts Compound 1 (example 23) and Compound 2 (example 3) effect on inflammatory responses in HK-2 cells. Control, lipopolysaccharide (LPS), and LPS+ Fluvoxamine (LPS+FLU) or LPS + Compound-1 (LPS + Compound 1 ) or Compound-2 (LPS + Compound 2) -treated HK-2 cells. mRNA expression of macrophage chemoattractant protein-1 (MCP-1 ), mRNA expressions were normalized to RN18S. Values are represented as means ± SD. * p < 0.05 vs. Control, ** p < 0.01 vs. Control, *** p < 0.001 vs. Control, # p < 0.05 vs. LPS, ## p < 0.01 vs. LPS (n = 5 / group).

[0195] Examples

[0196] General information

[0197] METHODS:

[0198] Commercially available reagents and solvents were used without further purification. The reactions were monitored by TLC, with Kieselgel 60 F 254 (Merck) plates and visualized by UV light.

[0199] Analytical LC-MS ESI-MS was performed on a Waters Acquity SQD MS detector equipped with separation module 20 Waters Alliance 2795 HPLC and Waters 996 PDA detector.

[0200] Analytical HPLC / MS was performed by system using reverse phase HPLC column. Method: Waters XBridge C18 (5 cm x 4.6 mm, 5 pm), gradient 0-95 % B over 7.00 min (0.00 min 5 % B, 0.50 min 5 % B, 5.50 min 95 % B, 6.00 min 95 % B, 6.50 min 5 % B, 7.00 min 5 % , Solvent A: MilliQ Water / 0.1% HCOOH, Solvent B: AcCN, flow = 2.0 mL / min. Separation module was Waters Alliance 2795. 25

[0201] UV spectra were recorded using a Waters 996 PDA detector. Mass spectra were obtained using Waters SQD MS detector (ionization: ES+ / ES-, source block temp: 120 °C, desolvation temp: 350 °C, desolvation gas: 400 L / h, cone gas: 100 L / h, capillary: 3000 V, cone: 25 V, extractor: 3 V, Rf lens: 0.2 V, scan: 120 to 1000 m / z in 1 sec., interscan delay: 0.1 s).

[0202] The preparative purifications were made on Waters Sun Fire RP C18 10um column. Instruments: 30 Waters 600 Controller Pump, 2487 Dual Absorbance Detector, 2700 Sample manager equipped with Waters Fraction Collector. Solvent A: Water / 0.1% HCOOH, Solvent B: AcCN, flow = 12.0 mL / min. Gradient elution from 15-to 70% B over 16.00 min.

[0203] The NMR spectra were recorded on a Bruker Avance 300 spectrometer operating at 7.05 Tesla magnetic field, equipped with a 5 mm dual inverse z-grad probe head, in deuterated 35 dimethylsulfoxide (DMSO-d6) solution, at 30 °C. The instrument was controlled and the data were processed using TopSpin 1 .3 software package.

[0204] Cell lines and in vitro model of inflammation

[0205] Human proximal tubular epithelial cells (HK-2; LGC Standards, cat. no. CRL-2190, American Type Culture Collection, Manassas, VA, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1 % penicillin / streptomycin (Gibco). Cells were incubated at 37 °C in a humidified atmosphere containing 5% CO2 and 95% air and plated in 24-well plates (Biologix, Saint Louis, MO, USA). For reverse transcription-quantitative polymerase chain reaction (RT- qPCR), cells were plated at 105 cells / well. Before treatment, a 24 h or 4 h growth arrest period in a serum-free medium was implemented across all experiments. For all experiments, untreated cells were used as controls.

[0206] HK-2 cells were incubated for 24 h with 1 pg / mL of LPS, either alone or in combination with 10 pM of compound of example 23 (compound 1) or compound of example 3 (compound 2)

[0207] Cell viability and proliferation assay

[0208] To test the possible cytotoxic effect of the said compounds cell viability was determined in 96- well plate by (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) MTT and LDH assay after 24-hours treatment with the said S1 R compounds (Roche Diagnostics, Mannheim, Germany). Live cells from triplicate wells were counted in a Burker chamber.

[0209] Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)

[0210] Total RNAwas isolated using the RT050 Total RNA Isolation Mini Kit (Geneaid Biotech, New Taipei City, Taiwan). The quality and quantity of the RNA were measured on a NanoDrop ND-1000 spectrophotometer (Baylor College of Medicine, Houston, TX, USA). Complementary DNA (cDNA) 1000 ng of IL1 B, IL6, NFKB1 , TLR2, TLR4, and TNF mRNA from HK2-2 cells was reverse- transcribed using a First Strand cDNA Synthesis Kit for RT-PCR (Thermo Fisher Scientific). Amplification was performed in a reaction mixture containing 1 pL of cDNA, 10 pL of SYBR Green I Master Mix (Roche Diagnostics, Mannheim, Germany), and 10 pmol / pL of each specific primer (Invitrogen). Data analysis was conducted using LightCycler 480 software version 1.5.0 (Roche Diagnostics). Gene expression levels were normalized to 18S ribosomal RNA (Rn18s or RN18S) expression within the same samples (Table 1 ).

[0211] Product

[0212] Gene NCBI Ref No. Primer Pairs „ , „

[0213] Length (bp4)

[0214] Forward: 5' CCAATCTTCATTGCTCAAGTGTC 3'

[0215] IL1B NG_008851 .1 88

[0216] Reverse: 5' CATTGCCACTGTAATAAGCCATC 3'

[0217] Forward: 5' CCACTCACCTCTTCAGAACG 3'

[0218] IL6 NG_01 1640.1 208

[0219] Reverse: 5' I I 1 1 CACCAGGCAAGTCTCC 3'

[0220] Forward: 5' GCGGCTCATGTTTACAGCTT 3'

[0221] NFKB1 NG_050628.1 213

[0222] Reverse: 5' CGAATCTGGATGTCATCTTTCTG 3'

[0223] Forward: 5' GGCGGCGACGACCCATTC 3'

[0224] RN18S NR_003286.4 136

[0225] Reverse: 5' TGGATGTGGTAGCCGTTTCTCAGG 3'

[0226] Forward: 5' TCGGAGTTCTCCCAGTTTCT 3'

[0227] TLR2 NG_016229.2 169

[0228] Reverse: 5' GCTTCAACCCACAACTACCA 3'

[0229] Forward: 5' CGTGGAGGTGGTTCCTAATA 3'

[0230] TLR4 NG_01 1475.2 1 16

[0231] Reverse: 5' GCCTCAGGGGATTAAAGCTC 3'

[0232] Forward: 5' AACGGAGCTGAACAATAGGC 3'

[0233] TNF NG_007462.1 176

[0234] Reverse: 5' GGGCGATTACAGACACAACT 3' Table 1. Nucleotide sequence of specific primer pairs applied for the real time detection of the examined genes and conditions of the PCR reactions.

[0235] Statistical analysis

[0236] Data were analyzed using GraphPad Prism software (GraphPad Software Inc., La Jolla, CA, USA).

[0237] After testing the normality with Kolmogorov-Smirnov test, numerical datasets from all experiments were analyzed using the Mann-Whitney U-test for two group’s comparison and Kruskal-Wallis test when there were 3 or more groups. P values less than 0.05 were considered to indicate statistically significant differences. Values for all measurements were expressed as means +- standard deviation. Synthesis of intermediate compounds i.1.) 5-bromo-1 -[4-(trifluoromethyl)phenyl]pentan-1-one 300 mg 5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one was suspended in 5 ml 48% HBr and stirred at 120 oC for 2 hours. The reaction mixture was allowed to cool to room temperature and poured into saturated NaCl solution and extracted with 2x20 ml EtOAc. The organic layer was separated and dried over magnesium-sulphate. The solvent was removed under reduced pressure, an oily product was obtained. The product was in the next step without purification.

[0238] Yield: 328 mg (92 %) LCMS purity: 89 %, MW calc. Ci2Hi2BrF3O monoisotopic Rt4.88 min , UV- VIS Abs. max 242 nm i.2.) 5-oxo-5-[4-(trifluoromethyl)phenyl]pentyl acetate (BSZ1897NY)

[0239] (3.09 g) 10 mmol 5-bromo-1-[4-(trifluoromethyl)phenyl]pentan-1-one was dissolved in 15 ml dry DMF and 2.46 g (30 mmol) anhydrous NaOAc was added and stirred at 100 °C for 2 hours. The solvent was removed in vacuo and the residue was taken up with EtOAc and water. The organic layer was separated and dried over sicc.MgSO4. The desiccant was filtered off, solvent was removed under reduced pressure, product was obtained as yellow oil.

[0240] Yield :2.52 g (87%) yellowish oil.

[0241] Molecular formula: C14H15F3O3, [M+1 ]+289.1 , Rt:4.23 min UV-VIS Abs. max 241 nm. i.3.) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetate (BSZ1896NKR)

[0242] 1 .44 g (5 mmol) 5-oxo-5-[4-(trifluoromethyl)phenyl]pentyl acetate was dissolved in 50 ml etanol and 0.69g (10 mmol) hydroxyl-amine hydrochloride, 0.42g (10 mmol) sodium hydrogencarbonate were added to the solution and stirred at 80 °C for 1 hour. The insoluble inorganics was filtered out and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 2x20 ml ethyl-acetate. The organic layer was separated and dried over magnesium-sulphate. The desiccant was filtered off, solvent was removed under reduced pressure, an oily product was obtained.

[0243] Molecular Formula:Ci4Hi6F3NO3, LCMS purity: 99.2% [M+1 ]+304.1 , Rt:4.02 min UV-VIS Abs. max 242 nm.

[0244] 1HNMR 6 11 .52 (s, 1 H); 7.85 (d, 2H, J=8.3 Hz); 7.74 (d, 2H, J=8.2 Hz); 3.99 (t, 2H, 6.2 Hz); 3.30-3.28 (m, 2H); 2.78 (t, 2H, J=7.4 Hz); 1 .96 (s, 3H); 1 .62-1 .58 (m, 2H) i.4.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec-5- en-1 -yl acetate (BSZ1987N)

[0245] 600 mg (1.98mmol) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetate was dissolved in anhydrous acetonitrile and 1 .29 g (3.96 mmol) sicc. cesium-carbonate was added to the solution. The reaction mixture was stirred at 50 °C for 20 min. Then 0.46 g (2.08 mmol) 2-(Boc- amino)ethyl bromide were added to the suspension and the reaction mixture was stirred at 70- 80 °C for 60-90 min.

[0246] After the completion, the insoluble inorganics was filtered off and the solvent was removed under reduced pressure. The residue was taken up with 30 ml brine and extracted with 3x25 ml ethylacetate. The combined organic layerwas dried over MgSO4. The desiccant was filtered off and the solvent was removed to title compound, (yellowish oil) The crude product was purified by column chromatography (Kieselgel, hexane / ethyl-acetate, as eluent)

[0247] Yield: 660mg (75%) Molecular Formula : C21H29F3N2O5, LCMS purity:98.7% [M+1 ]+447.1 , Rt:4.87 min UV-VIS Abs. max 263 nm.

[0248] 1HNMR 6 7.86 (d, 2H, J=8.2 Hz); 7.76 (d, 2H, J=8.3 Hz); 6.86 (t, 1 H, J=4.9 Hz); 4.13 (t, 2H, J=5.7 Hz); 3.98 (t, 2H, J=6.2 Hz); 3.28-3.22 (m, 2H); 2.79 (t, 3H, J=7.5 Hz); 1 .96 (s, 3H); 1 .61-1 .54 (m, 3H); 1 .39 (s, 9H) i.5.) (1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime (BSZ1848KR)

[0249] 800 mg5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one (3.07 mmol) was dissolved in 40 ml etanol and 0.42g (6.14 mmol) hydroxyl-amine hydrochloride and 0.51 g (6.14) mmol sodium hydrogencarbonate were added to the solution and stirred at 80 °C for 1 hour. The insoluble inorganics was filtered out and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 3x20 ml ethyl-acetate. The organic layer was separated and dried over magnesium-sulphate. The desiccant was filtered off, solvent was removed under reduced pressure, an oily product was obtained.

[0250] The crude productwas purified by column chromatography (Kieselgel, hexane / ethyl-acetate(4:1), as eluent) Molecular Formula: C13H16F3NO2, LCMS purity: 98.8% [M+1 ]+276.1 , [M-1 ]’ 274.1 Rt:4.03 min UV- VIS Abs. max 258 nm.

[0251] 1HNMR 5 11.48 (s, 1 H); 7.85 (d, 2H, J=8.2 Hz); 7.74 (d, 2H, J=8.3 Hz); 3.30-3.28 (m, 2H); 3.18 (s, 3H); 2J1 (t, 2H, J=7.3 Hz); 1 .54-1 .45 (m, 4H) i.6.) tert-butyl{2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethyl} carbamate

[0252] 0.89 g (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1-yl acetate (2 mmol) was dissolved in 40 ml ammonia saturated MeOH and placed into a sealed tube. It was stirred for 16 hours at 60 °C. The solvent was removed and the crude product was purified by column chromatography. (Kieselgel, chloroform-methanol 10:1) colorless oil.

[0253] Isolated yield: 0.68g (85%) Molecular Formula : CI9H27F3N2O4, LCMS purity: 98.6%, [M+1 ]+405.1 , [M-1]’ 403.1 , Rt: 4.34 min. i.7.) tert-butyl {2-[({(1 E)-5-oxo-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]ethyl} carbamate (

[0254] 0.68 g (1.68 mmol) tert-butyl{2-[({(1 E)-5-hydroxy-1-[4(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethyljcarbamate was dissolved in 20 ml anhydrous dichloromethane (freshly distilled from P2O5) and 0.785 g (1 .84 mmol) Dess-Martin reagent (Dess-Martin periodinane) was added and the reaction mixture was stirred for 16 hours. The organic layer was washed with 2x30 ml 5% aq. sodium hydrogencarbonate. The organic layer was separated, dried and the solvent was removed under reduced pressure. The crude product was purified by column chromatography. (Kieselgel, chloroform-methanol 20:1) Yield: 0.45 g (67%)

[0255] Molecular Formula:Ci9H25F3N2O4, LCMS purity: 92.5%, [M+1 ]+403.1 , Rt: 4.34 min.1HNMR 5 9.65 (s, 1 H); 7.89 (d, 2H, J=8.2 Hz); 7.77 (d, 2H, J=8.4 Hz); 6.88 (t, 1 H, J=4.4 Hz); 4.13 (t, 2H, J=5.7 Hz); 3.26-3.22 (m, 2H); 2J1 (t, 2H, J=7.4 Hz); 2.48 (m, 2H); 1 .70 (quintet, 2H, J=6.7 Hz); 1.36 (s, 9H) i.8.) (9E)-2,2-dimethyl-4-oxo-10-[4-(trifluoromethyl)phenyl]-3,8-dioxa-5,9-diazatetradec-9-en- 14-oic acid

[0256] 804 mg (2 mmol) tert-butyl {2-[({(1 E)-5-oxo-1-[4(trifluoromethyl)phenyl] pentylidene}amino)oxy] ethyl} carbamate was dissolved in 20 ml acetonitrile and 942 mg 6 mmol Na2CO3-1 .5H2O2(sodium percarbonate) in aq. solution was added and stirred for 24 hours and the solvent was allowed to evaporate to dryness in a recrystallization dish (72 hours). The residue was taken up with 10 % NaH2PO4solution and extracted with 3x15 ml ethyl-acetate. The organic layer was separated, dried and the solvent was removed under reduced pressure. The product was used in the next step without purification. Molecular formula: C2oH27F3N205, i.9.) 2-{5-oxo-5-[4-(trifluoromethyl)phenyl]pentyl}-1 H-isoindole-1 ,3(2H)-dione (BSZ2255NT)

[0257] 550 mg (1.77 mmol) 5-bromo-1-[4-(trifluoromethyl)phenyl]pentan-1-one was dissolved in 5 ml anhydrous DMF and 345 mg (1.87 mmol) potassium phthalimide was added tot he reaction mixture and it was stirred at 80 °C for 5 hours. The solvent was removed under reduced pressure the residue was taken up with 20 ml water and the crude product was filtered off and washed with 10-15 ml water then dried. The product was used in the next step without purification.

[0258] Yield: 602 mg (90%) Molecular formula : C20HI6F3NO3, LCMS purity: 98.9%, [M+1 ]+376.2, Rt: 4.75 min.

[0259] 1HNMR 5 8.12 (d, 2H, J=8.1 Hz); 7.87 (d, 2H, J=8.4 Hz); 7.85-7.81 (m, 4H); 3.62 (t, 2H, J=6.2 Hz);

[0260] 3.13 (t, 2H, J= 6.6 Hz); 1 .66-1 .64 (m, 4H) i.10.) 2-{(5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl}-1 H-isoindole-1 ,3(2H)-dione (BSZ2266N)

[0261] 600 mg (1.6 mmol) 2-{5-oxo-5-[4-(trifluoromethyl)phenyl]pentyl}-1 H-isoindole-1 ,3(2H)-dione was dissolved in 55 ml etanol and 222 mg (3.2 mmol) hydroxyl-amine hydrochloride and 269 mg NaHCO3(3.2 mmol) were added to the solution and stirred at 80 °C for 1 .5 hour. The insoluble inorganics was filtered out and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 2x25 ml ethyl-acetate / tethahydrofuran (4:1 ). The organic layer was separated and dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound.

[0262] Yield: 590 mg (94%) Molecular formula: C20H17F3N2O3 , LCMS purity: 87.6%, [M +1 ]+391 .1 , Rt: 4.55 min. i.11.) tert-butyl {2-[({(1 E)-5-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1-[4-(trifluoromethyl) phenyl]pentylidene}amino)oxy]ethyl}carbamate

[0263] 580 mg (1.49mmol) 2-{(5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl}-1 H-isoindole- 1 ,3(2H)-dione was dissolved in 60 ml anhydrous acetonitrile and 966 (2.97 mmol) mg freshly desiccated Cs2CO3and 399 mg (1 .78 mmol) 2-(Boc-amino)ethyl bromide were added to the suspension and the reaction mixture was stirred at 70-80 °C for 60-90 min.

[0264] After the completion, the insoluble inorganics was filtered off and the solvent was removed under reduced pressure. The residue was taken up with 30 ml brine and extracted with 3x25 ml ethylacetate. The combined organic layerwas dried over MgSO4. The desiccant was filtered off and the solvent was removed to give the title compound.

[0265] Yield: 632 mg (80 %)Molecular formula: C27H30F3N3O5, [M+1 ]+534.1 , Rt:5.32 min. The title compound was used in the next step without purification. i.12.) 5-azido-1 -[4-(trifluoromethyl)phenyl]pentan-1-one (BSZ2282N3)

[0266] 620 mg (2 mmol) 5-bromo-1-[4-(trifluoromethyl)phenyl]pentan-1-one was dissolved in anhydrous DMF and 260mg (4 mmol) NaN3was added to the solution then stirred at 60 °C for 2 hours. The solvent was removed under reduced pressure (not allowed to evaporate to dryness) and the residue was suspended in 30 ml water. The crude product was extracted with 2x30 ml ethyl- acetate. The combined organic layer was separated, dried over MgSO4. The desiccant was filtered off and the solvent was removed under reduced pressure to give the title compound.

[0267] Yield:521 mg (96%) Molecular formula: C12H12F3N3O, Rt: 4.75 min, LCMS purity: 88%. i.13) (1 E)-5-azido-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime (BSZ2281 N)

[0268] 500 mg (1.84 mmol) 5-azido-1-[4-(trifluoromethyl)phenyl]pentan-1-one was dissolved in 50 ml ethanol and 253 mg (3.68 mmol) hydroxyl-amine hydrochloride and 309 mg (3.68 mmol) NaHCO3were added to the reaction mixture and stirred at reflux temperature for an hour. The insoluble inorganics was filtered out and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 2x30 ml ethyl-acetate. The organic layer was separated and dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound.

[0269] Yield: 488 mg (92%)

[0270] Molecular Formula: C12H13F3N4O, Rt: 4.59 min, [M +1 ]+287.2, [M-1 ]' 285.2 UV-VIS Abs. max 257 nm. i.14.) tert-butyl {2-[({(1 E)-5-azido-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethylcarbamate (BSZ2283N)

[0271] 480 mg (1 .68 mmol) (1 E)-5-azido-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime was dissolved in 65 ml anhydrous acetonitrile and 1098 mg (3.38 mmol) freshly desiccated Cs2CO3and 454 mg (2.03 mmol) 2-(Boc-amino)ethyl bromide were added to the suspension and the reaction mixture was stirred at 70-80 °C for 60-90 min.

[0272] After the completion, the insoluble inorganics was filtered off and the solvent was removed under reduced pressure. The residue was taken up with 35 ml brine and extracted with 3x20 ml ethyl- acetate. The combined organic layer was dried over MgSO4. The desiccant was filtered off and the solvent was removed to give the title compound. Yield: 640 mg (89%)

[0273] Molecular Formula: CighheFsNsOs, LCMS purity: 86.8%, Rt: 5.35 min, [M+1 ]+429.1 .

[0274] The title compound was used in the next step without purification. i.15.) tert-butyl {2-[({(1 E)-5-amino-1 -[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}carbamate (BSZ2287U)

[0275] Method A

[0276] 450 mg (0.84 mmol) tert-butyl {2-[({(1 E)-5-(1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-1 -[4- (trifluoromethyl) phenyl]pentylidene}amino)oxy]ethyl}carbamate was suspended in 30 ml etanol and 168pl (169 mg, 3.38 mmol) hydrazine monohydrate and stirred at reflux temperature for 6 hours. The reaction monitored by HPLC. After the starting material and intermediate (2-{(7E)- 15,15-dimethyl-13-oxo-7-[4-(trifluoromethyl)phenyl]-9,14-dioxa-2,8,12-triazahexadec-7- enoyljbenzoic acid) were disappeared, the solvent was removed under reduced pressure and the residue was taken up with 20 ml 10% aq. Na2CO3and extracted with 3x20 ml ethyl-acetate. The combined organic layer was separated, dried over MgSO4. The desiccant was filtered off and the solvent was removed under reduced pressure to give the title compound. (viscous oil)

[0277] Yield: 191 mg (56 %) Formula : CigbhsFsNsOs Rt: 3.04 min. [M+1 ]+404.2

[0278] Method B. 150 mg (0.34 mmol) tert-butyl {2-[({(1 E)-5-azido-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}carbamate was dissolved in 10 mlTHF at 0 °C under argon atmosphere, 110 mg (0.42 mmol) triphenylphosphine and 5 ml degassed distilled water were added to the reaction mixture then stirred at room temperature for 16 hours. After the completion, the solvent was evaporated until half of the volume remained and diluted with 30 ml ethyl acetate and washed t with 10ml saturated aq. K2CO3. The organic layer was separated and the aqeuous layer was extracted with 10 ml ethyl-acetate. The organic layer was separated and the combined organic layer was dried over sicc. Na2SO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. Yield : 119 mg (84%)

[0279] The title compound was used in the next step without purification. i.16.) tert-butyl {2-[({(1 E)-5-acetamido-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethylcarbamate (BSZ2291 N2)

[0280] 50 mg (0.12 mmol) tert-butyl {2-[({(1 E)-5-amino-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}carbamate was dissolved in 10 ml anhydrous dichloromethane at 0 °C and 21 pl (0.15 mmol) triethylamine and 10 pl (10.7 mg, 0.14 mmol) acetyl-chloride was added to the reaction mixture then stirred for 2 hours at room temperature. The solvent was removed under reduced pressure and the residue was taken up with 10 ml 5% NaHCO3and extracted with 2x15 ml ethyl-acetate. The combined organic layer was dried over sicc. Na2SO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound.

[0281] Yield: 55 mg (71%) Molecular formula: C21H30F3N3O4, LCMS purity: 91.7%, Rt: 4.24 min, [M+1]+446.2, [M-1 ]- 444.2. UV-VIS Abs. max 263.1 nm. i. 17.) tert-butyl {2-[({(1 E)-5-(isobutyrylamino)-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] 62 mg (0.15 mmol) tert-butyl {2-[({(1 E)-5-amino-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}carbamate was dissolved in 1 1 ml anhydrous dichloromethane at 0 °C and 28 pl (0.18 mmol) triethylamine and 18 pl (18.7 mg, 0.17 mmol) isobutyryl chloride was added to the reaction mixture then stirred for 2 hours at room temperature. The solvent was removed under reduced pressure and the residue was taken up with 10 ml 5% NaHCO3and extracted with 2x15 ml ethyl-acetate. The combined organic layer was dried over sicc. Na2SO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound.

[0282] Yield: 55 mg (71 %) Molecular formula: C23H34F3N3O4, Rt: 4.61 min, [M+1 ]+374.2, [M-1 ]' 372.2. UV- VIS Abs. max 266.1 nm. i.18.) tert-butyl {2-[({(1 E)-5-[(2,2-dimethylpropanoyl)amino]-1 -[4-(trifluoromethyl)phenyl] pentylidene}amino)oxy]ethyl}carbamate (BSZ231 OB)

[0283] 60 mg (0.15 mmol) tert-butyl {2-[({(1 E)-5-amino-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}carbamate was dissolved in 10 ml anhydrous dichloromethane at 0 °C and 28 pl (0.18 mmol) triethylamine and 20 pl (19.8 mg, 0.16 mmol) isobutyryl chloride was added to the reaction mixture then stirred for 2 hours at room temperature. The solvent was removed under reduced pressure and the residue was taken up with 10 ml 5% NaHCO3and extracted with 2x15 ml ethyl-acetate. The combined organic layer was dried over sicc. Na2SO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound.

[0284] Yield: 59 mg (82%) Molecular formula: CI9H28F3N3O3, Rt: 4.84 min, [M+1 ]+488.1 , [M-1 ]’ 486.1 . UV- VIS Abs. max 264.1 nm. i.19.) tert-butyl {(4E)-11 ,11 -dioxido-5-[4-(trifluoromethyl)phenyl]-3-oxa-11 -thia-4,10- diazadodec-4-en-1 -yljcarbamate (BSZ2312N) 40 mg (0.1 mmol) {2-[({(1 E)-5-amino-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethyljcarbamate was dissolved in 2 ml anhydrous pyridine and the reaction mixture was cooled to 0 °C then 13.1 mg (0.12 mmol) methanesulfonyl chloride was added to the solution and stirred at room temperature overnight. The solvent was removed under reduced pressure and the residue was taken up with 5 ml 5% NaHCO3and extracted with 3x15 ml ethyl-acetate. The combined organic layer was dried over sicc. Na2SO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound.

[0285] Yield: 21 mg (44%) Molecularformula: CzoHaoFaNaOsS, Rt: 4.52 min, [M+1 ]+482.2, [M-1]’ 482.2. UV- VIS Abs. max 265 nm. i.20.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1 -yl cyclopropanecarboxylate (BSZ2265N2)

[0286] 70 mg (0.17 mmol) tert-butyl{2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethyl} carbamate, 36 pl (0.21 mmol) DIPEA were dissolved in 5 ml anhydrous dichloromethane at 0 °C then 19 pl (22mg, 0.21 mmol) cyclopropanecarbonyl chloride was added to the reaction mixture then stirred overnight at room temperature. After the completion, the solvent was removed under reduced pressure and the residue was taken up with 5 ml 5% NaHCO3and extracted with 3x15 ml ethyl-acetate. The combined organic layer was dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. Yield: 72 mg (87%) Molecularformula: C23H31F3N2O5, Rt: 5.33 min, [M+1 ]+472.2., UV-VIS Abs. max 263 nm

[0287] The title compound was used in the next step without purification. i.21.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1-yl cyclo butanecarboxylate (BSZ2322N)

[0288] 50 mg (0.12 mmol) tert-butyl{2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethyl} carbamate, 26 pl (0.15 mmol) DIPEA were dissolved in 5 ml anhydrous dichloromethane at 0 °C then 17 pl (18 mg, 0.21 mmol) cyclobutanecarbonyl chloride was added to the reaction mixture then stirred overnight at room temperature. After the completion, the solvent was removed under reduced pressure and the residue was taken up with 5 ml 5% NaHCO3and extracted with 3x10 ml ethyl-acetate. The combined organic layer was dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. Yield: 51 mg (85 %) Molecular formula: C24H33F3N2O5, Rt: 5.42 min, UV- VIS Abs. max 263 nm.

[0289] The title compound was used in the next step without purification. i.22.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1-yl cyclopentanecarboxylate ()

[0290] 50 mg (0.12 mmol) tert-butyl{2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethyl} carbamate, 26 pl (0.15 mmol) DIPEA were dissolved in 5 ml anhydrous dichloromethane at 0 °C then 18 pl (20 mg, 0.15 mmol) cyclopentanecarbonyl chloride was added to the reaction mixture then stirred overnight at room temperature. After the completion, the solvent was removed under reduced pressure and the residue was taken up with 5 ml 5% NaHCO3and extracted with 3x10 ml ethyl-acetate. The combined organic layer was dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. Yield: 53 mg (87 %), Molecular Formula :C25H35F3N2O5, Rt: 5.69 min, [M+1 ]+501.1 , UV-VIS Abs. max 264 nm. i.23.) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1-yl cyclohexanecarboxylate (BSZ2322B8)

[0291] 80 mg (0.20 mmol) tert-butyl{2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethyl} carbamate, 41 pl (0.24 mmol) DIPEA were dissolved in 6 ml anhydrous dichloromethane at 0 °C then 32 pl (35 mg, 0.24 mmol) cyclopentanecarbonyl chloride was added to the reaction mixture then stirred overnight at room temperature. After the completion, the solvent was removed under reduced pressure and the residue was taken up with 5 ml 5% NaHCO3and extracted with 3x10 ml ethyl-acetate. The combined organic layer was dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. Yield: 84 mg (83 %), Molecular Formula: C26H37F3N2O5, Rt: 5.88 min, [M+1 ]+515.2, UV-VIS Abs. max 264 nm. i.24.) 5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one (BSZ2244I)

[0292] 500 mg (1.62 mmol) 5-bromo-1-[4-(trifluoromethyl)phenyl]pentan-1-one was dissolved in 8 ml anhydrous DMF and 125 mg (1 .80 mmol) sodium thiomethoxide was added to the solution then stirred at 55-60 °C for 2 hours under argon atmosphere. After the completion, the solvent was removed under reduced pressure (not allowed to evaporate to dryness) and the residue was suspended in 30 ml water. The crude product was extracted with 2x30 ml ethyl-acetate. The combined organic layer was separated, dried over MgSO4. The desiccant was filtered off and the solvent was removed under reduced pressure to give the title compound. Yield: 428 mg (96%)

[0293] Molecular Formula:Ci3Hi5F3OS Rt: 4.81 min, [M+1 ]+277.1

[0294] The title compound was used in the next step without purification. i.25.) (1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime (BSZ2244IHA)

[0295] 350 mg (1.26 mmol) 5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one was dissolved in 40 ml etanol under inert atmosphere and 175 mg (2.54 mmol) hydroxyl-amine hydrochloride and 213 mg NaHCO3(2.54 mmol) were added to the solution and stirred at 80 °C for 1.5 hour. The insoluble inorganics was filtered out and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 2x25 ml ethyl-acetate. The organic layer was separated and dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound.

[0296] Yield: 342 mg (93%), Molecular formula: C13H16F3NOS, LCMS purity: 95.6%, Rt:4.57 min, [M+1]+292.1 , [M-1 ]- 292.1 , UV-VIS Abs. max 257 nM. i.26.) tert-butyl {2-[({(1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentylidene} amino) oxy]ethyl}carbamate (BSZ2292N)

[0297] 300 mg (1 .03 mmol) was dissolved in 40 ml anhydrous acetonitrile and 670 mg (2.06 mmol freshly desiccated Cs2CO3and 277 mg (1.24 mmol) 2-(Boc-amino)ethyl bromide were added to the suspension and the reaction mixture was stirred at 70-80 °C for 90 min. The reaction was monitored by TLC. After the completion, the insoluble inorganics was filtered off and the solvent was removed under reduced pressure. The residue was taken up with 30 ml brine and extracted with 3x25 ml ethyl-acetate. The combined organic layerwas dried over MgSO4. The desiccant was filtered off and the solvent was removed to give the title compound.

[0298] Molecular formula: C2OH29F3N203S, Rt:5.47 min, [M+1 ]+435.2, UV-VIS Abs. max 263 nM. i.27.) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate (BSZ2183NN)

[0299] 420 mg (1.38 mmol) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetate and 673 mg (2.07 mmol) Cs2CO3were stirred in 40 ml anhydrous acetonitrile for 10 min at 45-50 °C and 154 pl (156 mg, 1.66 mmol) chloromethyl ethyl ether was added to the reaction mixture and heated to 70-80 °C and stirred for an hour. The reaction was monitored by TLC. After the completion, the insoluble inorganicswas filtered off and the solvent was removed under reduced pressure. The residue was taken up with 30 ml brine and extracted with 3x20 ml ethyl-acetate. The combined organic layer was dried over MgSO4. The desiccant was filtered off and the solvent was removed to give the title compound.

[0300] Yield: 410 mg (82%) Molecular formula: C17H22F3NO4, Rt:4.94 min, [M+1]+362.1 , UV-VIS Abs. max 258 nM. i.28.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(ethoxymethyl)oxime

[0301] 380 mg (1 mmol) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate was dissolved in 20 ml methanol / NH3(6N solution) in a sealed flask and stirred at 50-55 °C for 16 hours. The solvent was removed under reduced pressure and the oily residue was purified by column chromatography (Kieselgel, hexane / ethyl-acetate 2:1 ) to give the title compound.

[0302] Yield: 297 mg (85%) Molecular formula: CisHzoFsNOs, [M+1 ]+320.1 , Rt: 4.22 min., UV-VIS Abs. max 257 nM.

[0303] 1HNMR 57.88 (d, 2H, J=8.1 Hz); 7.78 (d, 2H, =8.9 Hz); 5.25 (s, 2H); 4.36 (1 H, t, J=5.1 Hz);3.65 (q, 2H, J=7.0 Hz); 3.38 (2H, t, J=5.6 Hz); 2.81 (2H, t, J=7.3 Hz); 1 .47 (m, 4H); 1 .13 (t, 3H, J=7.1 Hz) i.29.) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanal (BSZ2186N)

[0304] 290 mg (0.91 mmol) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanal (1 E)- 5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(ethoxymethyl)oxime was dissolved in 15 ml anhydrous dichloromethane and 463 mg (1 .09 mmol) Dess-Martin reagent (Dess-Martin periodinane) was added and stirred for 16 hours. The organic layer was washed with 2x10 ml 5% aq. sodium hydrogencarbonate. The organic layer was separated, dried and the solvent was removed under reduced pressure. The crude product was purified by column chromatography. (Kieselgel, chloroform-methanol 20:1) Yield: 205 mg (71%)

[0305] Molecular Formula: CI5HI8F3NO3, LCMS purity: 97.7%, [M+1 ]+318.1 , Rt: 4.62 min., UV-VIS Abs. max 258 nM.

[0306] 1HNMR 5 9.66 (t, 1 H, J=1 .2 Hz); 7.91 (d, 2H, J=8.4 Hz); 7.79 (d, 2H, J=8.4 Hz); 5.25 (s, 2H); 3.65 (q, 2H, J=7.2 Hz); 2.81 (m, 2H); 2.53 (m, 2H); 1 .71 (q, 2H, J=7.8 Hz); 1 .13 (t, 3H, J=6.9 Hz) i.30.) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid (BSZ2189N)

[0307] 200 mg (0.63 mmol) was dissolved in 15 ml acetonitrile and 297 mg (1 .89 mmol) Na2CO3-1 .5H2O2(sodium percarbonate) in aq. solution was added and stirred for 24 hours and the solvent was allowed to evaporate to dryness in a recrystallization dish (72 hours). The residue was taken up with 10 % NaH2PO4solution and extracted with 3x10 ml ethyl-acetate. The organic layer was separated, dried over sicc. Na2SO4, and the solvent was removed under reduced pressure. The product was used in the next step without purification. Yield: 186 mg (93%)

[0308] Molecularformula: CI5HI8F3NO4, LCMS purity: 92.9%, [M+1 ]+334.1 , %, [M-1]’ 332.1, Rt: 4.19 min., UV-VIS Abs. max 257 nM. i.31.) 5-oxo-5-[4-(trifluoromethyl)phenyl]pentanoic acid (BSZ2242T)

[0309] 185 mg (0.55 mmol) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid was dissolved in 10 ml dioxane 10Opl water and 10Opl 37% hydrochloric acid (2.75 mmol ) were added to the reaction mixture then stirred at reflux temperature overnight. The reaction mixture was allowed to cool to room temperature and the precipitated title compound was filtered off. The mother liquor was evaporated under reduced pressure and the residue was taken up with 10 ml ethyl-acetate. The aqueous layer was extracted with 2x10 ml ethyl-acetate. The organic layers were combined, dried over Na2SO4. The desiccant was filtered off and the solvent was removed under pressure to give the title compound. Yield: 131 mg (88%)

[0310] Molecularformula: C12H11F3O3, LCMS purity: 100 %, [M+1 ]+261 .0, %, [M-1 ]’ 259.0, Rt: 3.58 min., UV-VIS Abs. max 239 nM.

[0311] 1HNMR 5 8.14 (d, 2H, J=8.1 Hz); 7.89 (d, 2H, J=8.2 Hz); 3.12 (t, 2H, J=7.1 Hz); 2.31 (t, 2H, J=7.4 Hz); 1 .85 (quintet, 2H, J=7.2 Hz) i.32.) ethyl 5-oxo-5-[4-(trifluoromethyl)phenyl]pentanoate (BSZ2243) 120 mg (0.46 mmol) 5-oxo-5-[4-(trifluoromethyl)phenyl]pentanoic acid was dissolved 10 ml anhydrous dichloromethane and 118 pl (175mg, 1.38 mmol) oxalyl- chloride and 5 pl DMF as catalyst was added to the reaction mixture (evolution of gas can be observed) and stirred at 35- 40 °C for an hour. The solvent was removed under reduced pressure and the oily residue was treated with 15 ml anhydrous ethanola and stirred at room temperature for an hour. The excess of the ethanol was evaporated under reduced pressure to give the title compound. Yield: 124 mg (94%)

[0312] Molecularformula: C14H15F3O3, [M+1]+289.0, %, Rt:4.44 min., UV-VIS Abs. max 242 nM.

[0313] The title compound was used in the next step without purification. i.33.) ethyl (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoate (BSZ2244)

[0314] 120 mg (0.41 mmol) ethyl 5-oxo-5-[4-(trifluoromethyl)phenyl]pentanoate was dissolved in 30 ml etanol and 56 mg (0.82 mmol) hydroxyl-amine hydrochloride, 69 mg (0.82 mmol) sodium hydrogencarbonate were added to the solution and stirred at 80 °C for 1 hour. The insoluble inorganics was filtered out and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 2x20 ml ethyl-acetate. The organic layer was separated and dried over magnesium-sulphate. The desiccant was filtered off, solvent was removed under reduced pressure to give the title compound.

[0315] Yield: 105 mg (83%) Molecular formula: C14H16F3NO3, [M+1 ]+304.1 , %, [M-1 ]’ 302.1 , Rt: 4.19 min., UV-VIS Abs. max 262 nM.

[0316] 1HNMR 5 11 .55 (brs, 1 H); 7.87 (d, 2H, J=8.2 Hz); 7.73 (d, 2H, J=8.3 Hz); 2.78 (t, 2H, J=7.5 Hz);

[0317] 2.25 (t, 2H, J=7.3 Hz); 1 .67 (q, 2H, J=7.3 Hz) i.34.) ethyl (5E)-5-[(2-ethoxy-2-oxoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoate

[0318] (BSZ2244E)

[0319] 100 mg (0.34 mmol) ethyl (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoate, 95 mg (0.68 mg) sicc. K2CO3, 10 mg sicc. KI (potassium iodide) were suspended in 40 ml anhydrous acetonitrile and 46pl (0.41 mmol, 69 mg) ethyl bromoacetate was added to the reaction mixture and stirred at 70-80 °C for 2 hours. The reaction was monitored byTLC. After the completion, the insoluble inorganics was filtered off and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 2x25 ml ethyl-acetate. The organic layer was separated and dried overMgSO4. The desiccant was filtered off, solvent was removed under reduced pressure to give the title compound. Yield: 116 mg (86%) Molecular formula: Ci8H22F3NO5, [M + 1 ]+390.1 , LCMS purity: 95.6 %, Rt: 4.97 min., UV-VIS Abs. max 258 nM. i.35.) ethyl (5E)-5-[(hydroxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl] penta noate (BSZ2249N)

[0320] 80 mg (0.26 mmol) ethyl (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoate and 564 mg (0.52 mmol) sicc. Cs2CO3were suspended in 40 ml anhydrous acetonitrile and 26 pl (0.36 mmol, 46 mg) 2-bromoethanol was added to the reaction mixture and stirred at 70-80 °C for 2 hours. The reaction was monitored byTLC. After the completion, the insoluble inorganics was filtered off and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 3x15 ml ethyl-acetate. The organic layer was separated and dried over MgSO4. The desiccant was filtered off, solvent was removed under reduced pressure to give the title compound. Yield: 85 mg (93%) Molecular formula: C16H20F3NO4, [M +1 ]+348.1 , [M-1 ]" 346.1 Rt: 4.22 min., UV-VIS Abs. max 257 nM. i.36.) (5E)-5-[(2-acetamidoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate (BSZ2235N)

[0321] 120 mg (0.35 mmol) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate was dissolved in 10 ml anhydrous dichloromethane at 0 °C and 59 pl (0.42 mmol) triethylamine and 42 pl (30 mg, 0.38 mmol) acetyl-chloride was added to the reaction mixture then stirred for 3 hours at room temperature. The solvent was removed under reduced pressure and the residue was taken up with 10 ml 5% NaHCO3and extracted with 2x15 ml ethyl-acetate. The combined organic layer was dried over sicc. Na2SO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. Yield: 126 mg (94 %), Molecular formula: Ci8H23F3N2O4, [M+1 ]+389.0, Rt: 4.02 min, UV-VIS Abs. max 264 nM. i.37.)N-{2-[({(1 E)-5-hyd roxy-1-[4-(trifluoromethyl)phenyl] pentylidene} amino)oxy]

[0322] 120 mg (0.31 mmol) (5E)-5-[(2-acetamidoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate was dissolved in 30 ml ammonia saturated MeOH and placed into a sealed tube. It was stirred for 16 hours at 55-60 °C. The solvent was removed and the crude product was purified by column chromatography. (Kieselgel, chloroform-methanol 10:1), colorless oil.

[0323] Isolated yield: 81 mg (76 %) Molecular formula:, C16H21F3N2O3, LCMS purity:93.9%, [M+1 ]+347.1 , [M-1]’ 345.1, Rt: 3.45 min, UV-VIS Abs. max 261 nM

[0324] 1HNMR 57.91 (t, 1 H, J=5.4 Hz); 7.86 (d, 2H, J=8.2 Hz); 7.76 (d, 2H, J=8.3 Hz); 4.37 (t, 2H, J=5.0 Hz); 4.14 (t, 2H, H=5.8 Hz); 3.39-3.35 (m, 3H); 2J1 (t, 2H, J=6.7 Hz); 1 .81 (s, 3H); 1 .49-1 .44 (m, 4H) i.38.) N-{2-[({(1 E)-5-oxo-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}acetamide (BSZ2238N)

[0325] 80 mg (0.91 mmol) (5E)-5-[(ethoxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanal (1 E)-5- hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(ethoxymethyl)oxime was dissolved in 15 ml anhydrous dichloromethane and 463 mg (1.09 mmol) Dess-Martin reagent (Dess-Martin periodinane) was added and stirred for 16 hours. The organic layer was washed with 2x10 ml 5% aq. sodium hydrogencarbonate. The organic layer was separated, dried and the solvent was removed under reduced pressure. The crude product was purified by column chromatography. (Kieselgel, chloroform-methanol 20:1) Yield: 68 mg (85%)

[0326] Molecular Formula: Ci6Hi9F3N2O3, LC MS purity: 95.2%, [M+1]+345.1 , [M-1] 343.1 Rt: 3.71 min., UV-VIS Abs. max 261 nM.

[0327] 1HNMR 5 9.65 (t, 1 H, J=1 .26 Hz); 8.02 (t, 1 H, J=7.8 Hz); 7.89 (d, 2H, J=8.3 Hz); 7.78 (d, 2H, 7.9 Hz); 4.15 (2H, 5.7 Hz); 3.39-3.35 (m, 3H); 2.78 (t, 2H, J=7.2 Hz); 4.23 (t, 1 H, J=6.2 Hz); 1 .81 (s, 3H); 1.75-1 .66 (m, 2H) i.39.) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1 -yl pivalate (BSZ2259)

[0328] 82 mg (0.20 mmol) tert-butyl{2-[({(1 E)-5-hydroxy-1 -[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethyl} carbamate, 41 pl (0.24 mmol) DIPEA were dissolved in 6 ml anhydrous dichloromethane at 0 °C then 29 pl ( 23 mg, 0.24 mmol) pivaloyl chloride was added to the reaction mixture then stirred overnight at room temperature. After the completion, the solvent was removed under reduced pressure and the residue was taken up with 5 ml 5% NaHCO3and extracted with 3x10 ml ethyl-acetate. The combined organic layerwas dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. Yield:72mg (73%)

[0329] Molecular Formula: C24H35F3N2O5, LCMS purity: 98.4 %, [M+1 ]+489.1 , Rt: 5.69 min., UV-VIS Abs. max 263 nM.

[0330] 1HNMR 57.86 (d, 2H, J= 8.3 Hz); 7.75 (d, 2H, J=8.5 Hz); 6.87 (t, 1 H, J=4.2 Hz); 4.12 (t, 2H, J=5.9 Hz); 3.99 (t, 2H, J=5.8 Hz); 3.27-3.21 (m, 2H); 2.80 (t, 2H, J=7.5 Hz); 1 .60-1 .48 (m , 4H); 1 .36 (s, 9H); 1.06 (s, 9H) i.40.) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec-

[0331] 5-en-1 -yl 2-methylpropanoate (BSZ2260)

[0332] 83 mg (0.20 mmol) tert-butyl{2-[({(1 E)-5-hydroxy-1 -[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy] ethyl} carbamate, 42 pl (0.24 mmol) DIPEA were dissolved in 6 ml anhydrous dichloromethane at 0 °C then 25 pl ( 26 mg, 0.24 mmol) isobutyryl chloride was added to the reaction mixture then stirred overnight at room temperature. After the completion, the solvent was removed under reduced pressure and the residue was taken up with 5 ml 5% NaHCO3and extracted with 3x10 ml ethyl-acetate. The combined organic layerwas dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. Yield:69 mg (72 %) Molecular Formula: C23H33F3N2O5, LCMS purity: 99.1 %, [M+1 ]+475.1 , Rt: 5.49 min., UV-VIS Abs. max 263 nM.

[0333] 1HNMR 5 7.86 (d, 2H, J=8.2 Hz); 7.76 (d, 2H, J=8.4 Hz); 6.86 (t, 2H, J=5.6 Hz); 4.12 (t, 2H, J=5.5 Hz); 4.00 (t, 2H, J=5.9 Hz); 3.25-3.18 (m, 2H); 2.80 (t, 2H, J=7.5 Hz); 1 .61-1 .57 (m, 2H); 1 .54-1 .53 (m, 2H); 1 .36 (s, 9H); 1 .01 (d, 6H, J=7.0 Hz) i.41 .) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10-diazatetradec- 5-en-1 -yl trifluoroacetate

[0334] 80 mg (0.2 mmol) tert-butyl {2-[({(1 E)-5- hydroxy-1 [4(trifluoromethyl)phenyl]p entylidene}amino)oxy]ethyl} carbamate (i.6.) and 42 pl (0.24 mmol, 30 mg) DIPEA were dissolved in 10 ml anhydrous dichloromethane at 0 °C then 33 pl (50 mg, 0.24 mmol) trifluoroacetic anhydride was added in one portion to the solution. The reaction mixture was stirred for 16 hours at room temperature. The solvent was removed under reduced pressure and the residue was taken up with cold 5 ml aq. (saturated at 0 oC) NaHCO3. The crude product was extracted with 2x10 ml ethyl-acetate, the organic layer was separated, dried over MgSO4. The desiccant was filtered off, the solvent was evaporated to give the title compound. The crude product was used in the next step without purification.

[0335] Molecular Formula : C21H26F6N2O5 LCMS purity: 88%, [M+1]+500.1 , UV-VIS Abs. max 262 nM.

[0336] Synthesis of S1 R agonist compounds

[0337] Ex.01.) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetate (BSZ1896NKR)

[0338] (same as i.3.)

[0339] 1 .44 g (5 mmol) 5-oxo-5-[4-(trifluoromethyl)phenyl]pentyl acetate was dissolved in 50 ml etanol and 0.69 g (10 mmol) hydroxyl-amine hydrochloride, 0.42 g (10 mmol) sodium hydrogencarbonate were added to the solution and stirred at 80 °C for 1 hour. The insoluble inorganics was filtered out and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 2x20 ml ethyl-acetate. The organic layer was separated and dried over magnesium-sulphate. The desiccant was filtered off, solvent was removed under reduced pressure, an oily product was obtained.

[0340] Molecular Formula:Ci4Hi6F3NO3, LCMS purity:99.2% [M+1]+ 304.1 , Rt:4.02 min UV-VIS Abs. max 242 nm.

[0341] 1HNMR 5 11 .52 (s, 1 H); 7.85 (d, 2H, J=8.3 Hz); 7.74 (d, 2H, J=8.2 Hz); 3.99 (t, 2H, 6.2 Hz); 3.30-3.28 (m, 2H); 2.78 (t, 2H, J=7.4 Hz); 1 .96 (s, 3H); 1 .62-1 .58 (m, 2H)

[0342] Ex.2.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime (BSZ1984N)

[0343] 120 mg (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetate (0.39 mmol) (i.3. or ex.1.) was dissolved in 20 ml ammonia saturated MeOH and placed into a sealed tube. It was stirred for 16 hours at 55-60 °C. The solvent was removed and the crude product was purified by column chromatography. (Kieselgel, chloroform-methanol 10:1), yellowish oil.

[0344] Isolated yield: 76 mg (73 %) Molecular formula:, C12H14F3NO2, LCMS purity: 100%, [M+1 ]+262.1 , [M-1 ]' 260.1 , Rt: 3.29 min, UV-VIS Abs. max 254 nM.

[0345] 1HNMR 611 .46 (s, 1 H); 7.85 (d, 2H, J=8.0 Hz); 7.74 (d, 2H, J=8.3 Hz); 4.35 (t, 1 H, J=5.1 Hz); 3.40-

[0346] 3.36 (m, 2H); 2.76 (t, 2H, J=6.9 Hz);1 .46-1 .44 (m, 4H)

[0347] Ex.03.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate (BSZ1989N2)

[0348] 130 mg (0.29 mmol ) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl acetate (i.4.) was dissolved in 10 ml dichloromethane and cooled to 0 °C then 2.4 mlTFAwas added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield:61 mg (61 %)

[0349] Molecular Formula: C16H21F3N2O3, LCMS purity 96.4 % [M+1]+347.1 , Rt:2.99 min UV-VIS Abs. max 261 nm.

[0350] 1HNMR 67.89 (d, 2H, J=8.0 Hz); 7.79 (d, 2H, J=8.4 Hz); 7.52 (brs, 2H); 4.31 (t, 2H, J=5.0 Hz); 3.99 (t, 2H, J=6.4 Hz); 3.28-3.24 (m, 2H); 3.14 (t, 2H, J=5.6 Hz); 1 .96 (s, 3H); 1 .63-1 .46 (m, 4H) Ex.04.)(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentylcyclopropane carboxylate (BSZ2274N)

[0351] 130 mg (0.29 mmol ) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl cyclopropanecarboxylate (i.20) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 2.4 ml TFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield:62mg (61 %)

[0352] Molecular Formula: C18H23F3N2O3, LCMS purity 100 % [M +1 ]+373.1 , Rt:3.00 min UV-VIS Abs. max 259 nm.

[0353] 1HNMR 6 7.89 (d, 2H, J=8.2 Hz); 7.77 (d, 2H, 8.2 Hz); 4.20 (t, 2H, 5.5); 4.01 (t, 2H, 6.1 Hz); 3.28- 3.17 (m, 2H); 2.96 (t,2H, J=5.5 Hz); 2.83 (t, 2H, J=7.2 Hz); 1 .62-1 .49 (m, 4H); 1 .13-1 .21 (m, 1 H);

[0354] 0.87-0.73 (m, 4H)

[0355] Ex.05.(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclobutanecarboxylate (BSZ2327BK)

[0356] 110 mg (0.29 mmol ) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl cyclobutanecarboxylate (i.21 .) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 2.4 ml TFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield :49mg (87%)

[0357] Molecular Formula: CI9H25F3N2O3, LCMS purity 98.2 % [M+1 ]+388.1 , Rt:3.39 min UV-VIS Abs. max 253 nm.

[0358] 1HNMR 5 7.86 (d, 2H, J=8.1 Hz); 7.75 (d, 2H, J=8.4 Hz); 4.16 (t, 2H, J=5.1 Hz); 4.01 (t, 2H, J=6.0 Hz); 3.28-3.26 (m, 2H); 3.14-3.08 (m, 1 H); 2.89-2.80 (m, 4H); 2.11 -1 .96 (m, 4H); 1 .93-1 .92 (m, 1 H); 1 .89-1 .71 (m,1 H); 1 .62-1 .57 (m, 4H) Ex.06.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclopentanecarboxylate (BSZ2330A)

[0359] 80 mg (0.29 mmol ) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl cyclopentanecarboxylate (i.22.) was dissolved in 8 ml dichloromethane, cooled to 0 °C then 1 .6 ml TFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield:23 mg (64%)

[0360] Molecular Formula: C20H27F3N2O3, LCMS purity 100 % [M+1 ]+401 .2, Rt:3.53 min UV-VIS Abs. max 258 nm.

[0361] 1HNMR 6 7.86 (d, 2H, J= 8.1 Hz); 7.76 (d, 2H, J= 8.4 Hz); 4.20 (t, 2H, J=5.7 Hz); 4.01 (t, 2H, J=6.0 Hz); 3.46-3.45 (m, 2H); 2.97 (t, 2H, J=5.6 Hz);2.84 (t, 2H, J=7.8 Hz); 2.68-2.61 (m, 1 H); 1 .78-1 .69

[0362] (m, 2H); 1.62-1.48 (m, 10H)

[0363] Ex.07 (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclohexanecarboxyl ate

[0364] 100 mg (0.29 mmol ) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl cyclohexanecarboxylate (i.23.) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 ml TFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 54 mg (67 %)

[0365] Molecular Formula: C21 H29F3N2O3, LCMS purity 100 % [M+1 ]+401 .2, Rt:3.65 min UV-VIS Abs. max 253 nm.

[0366] 1HNMR 5 7.87 (d, 2H, J=8.1 Hz); 7.77 (d, 2H, J= 8.4 Hz); 4.19 (t, 2H, J=5.4 Hz); 4.01 (t, 2H, J=5.7 Hz); 2.96 (t, 2H, J=5.7 Hz); 2.83 (t, 2H, 7.8 Hz); 2.26-2.17 (m, 1 H); 1 .73-1 .70 (m, 2H); 1 .61 -1 .48 (m, 8H); 1.28-1.16 (m, 6H) Ex.08. (1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oxime

[0367] (BSZ2293NU)

[0368] 65 mg (0.15 mmol ) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl cyclohexanecarboxylate (i.26) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 ml TFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 21 mg (42 %)

[0369] Molecular Formula: C15H21 F3N2OS, LCMS purity 100 % [M+1 ]+335.1 , Rt:3.02 min UV-VIS Abs. max 252 nm.

[0370] 1HNMR 6 7.87 (d, 2H, J=8.2 Hz); 7.76 (d, 2H, J=8.2 Hz); 4.19 (t, 2H, J=5.5 Hz); 3.26-3.24 (m, 2H);

[0371] 2.96 (t, 2H, J=5.4 Hz); 2.82 (t, 2H, J=6.6 Hz); 2.45-2.44 (m, 2H); 1 .99 (s, 3H); 1 .55-1 .53 (m, 4H)

[0372] Ex.09.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl pivalate (BSZ2261 )

[0373] 49 mg (0.10 mmol ) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl pivalate (i.39.) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 ml TFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 27mg (69 %)

[0374] Molecular Formula: CI9H27F3N2O3, LCMS purity 98.8 % [M+1 ]+389.2, Rt:3.24 min UV-VIS Abs. max 258 nm.1HNMR 5 7.86 (d, 2H, J=8.2 Hz); 7.76 (d, 2H, J=8.2 Hz); 4.17 (t, 2H, 5.7 Hz); 4.00 (t, 2H, J=5.8 Hz); 3.26-3-24 (m, 2H); 2.92 (t, 2H, J=5.6 Hz); 2.83 (t, 2H, J=7.1 Hz); 1 .61-1 .48 (m, 4H); 1 .09 (s, 9H) Ex.10.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl 2-methylpropanoate (BSZ2262T)

[0375] 55 mg (0.1 1 mmol ) (5E)-13,13-dimethyl-11 -oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl 2-methylpropanoate (i.40.) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 ml TFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 21 mg (55%)

[0376] Molecular Formula: C18H25F3N2O3, LCMS purity 98.7 % [M+1 ]+375.1 , Rt:3.15 min UV-VIS Abs. max 258 nm.

[0377] 1HNMR 5 7.86 (d, 2H, J=7.8 Hz); 7.76 (d, 2H, J=81 . Hz); 4.17 (t, 2H, J=5.7 Hz); 4.01 (d, 2H, J=5.7 Hz); 3.26-3.20 (m, 2H);2.94-2.87 (m, 2H); 2.83 (t, 2H, J=7.1 Hz); 2.45-2.40 (m, 1 H, ); 1 .61 -1 .49 (m, 4H); 1.01 (d, 6H, J=6.9 Hz)

[0378] Ex.11.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2- methylpropanamide (BSZ2297T)

[0379] 50 mg (0.10 mmol ) tert-butyl{2-[({(1 E)-5-(isobutyrylamino)-1 -[4-(trifluoromethyl)phenyl] pentylidene} amino)oxy]ethyl}carbamate (i.17.) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 mlTFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 24 mg (61 %)

[0380] Molecular Formula: C18H26F3N3O2, LCMS purity 100 % [M +1 ]+375.2, Rt:2.88 min UV-VIS Abs. max 259 nm.

[0381] 1HNMR 5 7.88 (d, 2H, J=8.1 Hz); 7.77 (d, 2H, 8.3 Hz); 7.66 (t, 1 H, 5.4 Hz); 4.31 (t, 2H, J=4.4 Hz); 3.20-3.16 (m, 2H); 3.04-2.97 (m, 4H); 2.84 (m, 2H); 2.29 (m, 1 H); 1 .44-1 .42 (m, 4H); 1 .01 (6H, J=6.9 Hz) Ex.12.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2,2- dimethylpropanamide (BSZ2311 N)

[0382] 50 mg (0.10 mmol) tert-butyl {2-[({(1 E)-5-[(2,2-dimethylpropanoyl)amino]-1 -[4- (trifluoromethyl)phenyl]pentylidene}amino)oxy]ethyl}carbamate (i.18.) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 mlTFAwas added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield:21 mg (54%)

[0383] Molecular Formula: CigbhsFsNsCh, LCMS purity 98.9 % [M+1 ]+388.2, Rt:2.98 min UV-VIS Abs. max 259 nm.

[0384] 1HNMR 5 7.85 (d, 2H, J=8.1 Hz); 7.75 (d, 2H, J=8.4 Hz); 7.36 (t, 1 H, J=4.8 Hz); 4.13 (t, 2H, J=5.7 Hz); 3.03 (m, 2H); 2.85 (t, 2H, J= 5.7 Hz); 2.79 (m, 2H); 1 .89 (m,2H); 1 .41 (m, 4H); 1 .02 (s, 9H)

[0385] Ex.13.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}acetamide

[0386] (BSZ2300N)

[0387] 42 mg (0.09 mmol ) tert-butyl {2-[({(1 E)-5-acetamido-1 -[4-(trifluoromethyl)phenyl] pentylidene}amino)oxy]ethyl}carbamate (i.16.) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 mlTFAwas added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 23 mg (72%)

[0388] Molecular Formula: C16H22F3N3O2, LCMS purity 100% [M+1 ]+346.1 , Rt:2.66 min UV-VIS Abs. max 252 nm.

[0389] 1HNMR 5 7.89 (d, 2H, J=8.1 Hz); 7.77 (d, 2H, 8.3 Hz); 7.66 (t, 1 H, 5.4 Hz); 4.31 (t, 2H, J=4.4 Hz);

[0390] 3.20-3.16 (m, 2H); 3.04-2.97 (m, 4H); 2.84 (m, 2H); 1 .82 (s, 3H); 1 .44-1 .42 (m, 4H) Ex.14.) (5E)-5-[(2-hydroxyethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid (BSZ2245)

[0391] 100 mg (0.29 mmol ) ethyl (5E)-5-[(hydroxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl] pentanoate (i.35.) was dissolved in 10 ml methanol and 23 mg (0.57 mmol) NaOH (in 1 ml water) was added to the reaction mixture and stirred for an hour at room temperature. After the completion the solvent was evaporated under reduced pressure and the residue was taken up with 20 ml water and washed with 2x10 ml diethyl-ether. The aqueous layer was separated and the pH was adjusted to pH=3-4. The precipitated product was filtered off washed with 2-3 ml water and dried. (60mg, (65%) The acidic mother liquor was extracted with 2x10 ml ethyl-acetate and the combined organic layer was dried over MgSO4. The desiccant was filtered off and the solvent was removed under reduced pressure to give the title compound. (18 mg, 19%) Overall yield :84%

[0392] Molecular Formula: C14H16F3NO4, LCMS purity 96.9 % [M+1 ]+320.1 , [M-1 ] 318.1 Rt:3.54 min UV- VIS Abs. max 262 nm.

[0393] 1HNMR 57.89 (d, 2H, J=8.2 Hz); 7.76 (d, 2H, J=8.3 Hz); 4.17 (t, 1 H, J=5.1 Hz); 3.66 (t, 2H, 5.4 Hz);

[0394] 3.51-3.45 (m, 2H); 2.80 (m, 2H); 2.25 (t, 2H, J=7.4 Hz); 1 .68 (quintet, 2H, J=7.2 Hz)

[0395] Ex.15.) (5E)-5-[(carboxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid (BSZ2244)

[0396] 97 mg (0.25 mmol) ethyl (5E)-5-[(2-ethoxy-2-oxoethoxy)imino]-5-[4- (trifluoromethyl)phenyl]pentanoate (i.34.) was dissolved in 10 ml methanol and 40 mg (1 .0 mmol) NaOH (in 3 ml water) was added to the reaction mixture and stirred for an hour at room temperature. After the completion, the solvent was evaporated under reduced pressure and the residue was taken up with 15 ml water and washed with 2x10 ml diethyl-ether. The aqueous layer was separated and the pH was adjusted to pH=3-4. The precipitated product was filtered off washed with 2-3 ml water and dried.

[0397] Yield: 53 mg (64%) Molecular Formula: C14H14F3NO5, LCMS purity 95.6 % [M+1]+334.1 , [M-1 ]’ 332.1 , Rt:3.46 min UV-VISAbs. max 258 nm.

[0398] 1HNMR 5 12.44 (brs, 1 H); 7.87 (d, 2H, J=8.2 Hz); 7.77 (d, 2H, 8.4 Hz); 4.72 (s, 2H); 2.83 (t, 2H,

[0399] J=7.5 Hz); 2.29 (t, 2H, J=7.2 Hz); 1 .72 (quintet, 2H, J=7.51 Hz) Ex.16.) (5E)-5-[(2-acetamidoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid

[0400] (BSZ2239T)

[0401] 86 mg (0.25 mmol) N-{2-[({(1 E)-5-oxo-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]ethyl}acetamide (i.38.) was dissolved in 10 ml acetonitrile and 245 mg (1.56 mmol) Na2CO3-1 .5H2O2(sodium percarbonate) in aq. solution was added and stirred for 24 hours and the solvent was allowed to evaporate to dryness in a recrystallization dish (72 hours). The residue was taken up with 10 % NaH2PO4solution and extracted with 3x15 ml ethyl-acetate. The organic layer was separated, dried and the solvent was removed under reduced pressure.

[0402] The crude product was purified by HPLC chromatography.

[0403] Yield: 28 mg, (31 %)

[0404] Molecular formula: CI6HI9F3N2O4, LCMS purity 97.3 % [M+1 ]+361 .1 , [M-1 ]' 359.1 , Rt:4.97 min UV- VIS Abs. max 262 nm.

[0405] 1HNMR 57.89 (d, 2H, J=8.2 Hz); 7.76 (d, 2H, J=8.3 Hz); 4.14 (t, 2H, J=5.7 Hz); 3.39-3.33 (m, 4H);

[0406] 2.79 (m, 2H); 2.25 (t, 2H, J=7.4 Hz); 1 .82 (s, 3H); 1 .68 (quintet, 2H, J=7.5 Hz)

[0407] Ex.17.) 2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetamide

[0408] (BSZ2197)

[0409] 120 mg (0.31 mmol) (ethyl [({(1 E)-5-acetoxy-1-[4-

[0410] (trifluoromethyl)phenyl]pentylidene}amino)oxy]acetate)) was dissolved in 30 ml ammonia saturated MeOH (6N) and placed into a sealed tube. It was stirred for 24 hours at 55-60 °C. The solvent was removed and the crude product was purified by HPLC chromatography. Yield 57 mg (59 %)

[0411] Molecular formula: Ci4Hi7F3N2O3, LCMS purity 100 % [M+1 ]+319.1 , [M-1 ] 317.1 , Rt:3.25 min UV- VIS Abs. max 264 nm.

[0412] 1HNMR 57.85 (d, 2H, J=8.3 Hz); 7.76 (d, 2H, J=8.5 Hz); 4.36 (t, 2H, J=5.1 Hz); 3.39-3.35 (m, 3H);

[0413] 3.28-3.26 (m, 2H); 2.85 (m, 2H); 1 .48-1 .40 (m, 4H) Ex.18.) (1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-hydroxyethyl)oxime (BSZ2199N)

[0414] 80 mg (0.29 mmol) (1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one oxime (i.5.), 189 mg (0.58 mmol) sicc. Cs2CO3and 5 mg KI (potassium iodide) were suspended in 40 ml anhydrous acetonitrile and 29 pl (0.4 mmol, 51 mg) 2-bromoethanol was added to the reaction mixture and stirred at 70-80 °C for 2 hours. The reaction was monitored by TLC. After the completion, the insoluble inorganics was filtered off and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 3x15 ml ethyl-acetate. The organic layer was separated and dried over MgSO4. The desiccant was filtered off, solvent was removed under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 51 mg (55%) Molecular formula: CisHzoFsNOs, [M+1]+320.1 , Rt: 4.14 min., UV-VIS Abs. max 261 nM.

[0415] 1HNMR 57.86 (d, 2H, J=8.1 Hz); 7.76 (d, 2H, J=8.3 Hz); 4.68 (t, 1 H, J=5.5 Hz); 4.17 (t, 2H, J=5.1 Hz); 3.65 (q, 2H, J=5.2 Hz); 3.28-3.26 (m, 2H); 3.19 (s, 3H); 2.79 (m, 2H); 1 .51-1 .49 (m, 4H)

[0416] Ex.19.) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoic acid (BSZ2190N4U)

[0417] 65 mg (0.25 mmol) 5-oxo-5-[4-(trifluoromethyl)phenyl]pentanoic acid (i.31 .) in 15 ml etanol and 34 mg (0.5 mmol) hydroxyl-amine hydrochloride and 42 mg NaHCO3(0.5 mmol) were added to the solution and stirred at 80 °C for 1 .5 hour. The insoluble inorganics was filtered out and the filtrate was evaporated under reduced pressure. The residue was taken up with water, acified with 2N HCL to pH=4 and extracted with 2x15 ml ethyl-acetate (4:1). The organic layer was separated and dried over sicc. MgSO4. The desiccant was filtered off, the solvent was removed under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 14 mg (20%)

[0418] Molecular formula: CI2HI2F3NO3, [M+1 ]+276.1 , [M-1]’ 274.1 , Rt: 3.39 min., UV-VIS Abs. max 260 nM.

[0419] 1HNMR 5 11 .55 (brs, 1 H); 7.87 (d, 2H, J=8.2 Hz); 7.73 (d, 2H, J=8.3 Hz); 2.78 (t, 2H, J=7.5 Hz);

[0420] 2.25 (t, 2H, J=7.3 Hz); 1 .67 (q, 2H, J=7.3 Hz) Ex.20.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acid (BSZ2183N1 )

[0421] 42 mg (0.1 mmol ) (9E)-2,2-dimethyl-4-oxo-10-[4-(trifluoromethyl)phenyl]-3,8-dioxa-5,9- diazatetradec-9-en-14-oic acid (i.8.) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 mlTFAwas added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC. Yield: 17 mg (53 %)

[0422] Molecular Formula: C14H17F3N2O3, LCMS purity 100% [M+1 ]+319.1 , Rt: 2.85 min UV-VIS Abs. max 258 nm.

[0423] 1HNMR 5 7.89 (d, 2H, J=8.2 Hz); 7.76 (d, 2H, 8.3 Hz); 4.25 (t, 2H, J=4.7 Hz); 3.89 (m, 2H); 3.04 (t, 2H, J=4.1 Hz); 2.84 (t, 2H, J=6.7 Hz); 2.11 -2.07 (m, 2H); 1 .72-1 .63 (m, 2H)

[0424] Ex.21.) ethyl [({(1 E)-5-methoxy-1 -[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetate

[0425] (BSZ2002N)

[0426] 100 mg (0.36 mmol) (1 E)-5-methoxy-1 -[4-(trifluoromethyl)phenyl]pentan-1 -one oxime (i.5.), 100 mg (0.72 mg) sicc. K2CO3, 10 mg sicc. KI (potassium iodide) were suspended in 40 ml anhydrous acetonitrile and 48 pl (0.43 mmol, 72 mg) ethyl bromoacetate was added to the reaction mixture and stirred at 70-80 °C for 3 hours. The reaction was monitored by TLC. After the completion, the insoluble inorganics was filtered off and the filtrate was evaporated under reduced pressure. The residue was taken up with water and extracted with 2x25 ml ethyl-acetate. The organic layer was separated and dried over MgSO4. The desiccant was filtered off, the solvent was evaporated under reduced pressure to give the title compound. Yield: 96 mg (73 %) Molecular formula: C17H22F3NO4, [M+1 ]+362.1 , LCMS purity: 96.7 %, Rt: 4.81 min., UV-VIS Abs. max 259 nM.

[0427] 1HNMR 5 7.84 (d, 2H, J=8.4 Hz); 7.78 (d, 2H, J=8.6 Hz); 4.80 (s, 2H); 4.14 (q, 2H, J=7.1 Hz); 3.31 - 3.19 (m, 2H); 3.18 (s, 3H); 2.83 (t, 2H, J=7.2 Hz); 1 .53-1 .52 (m, 4H); 1 .20 (t, 3H, J= 7.1 Hz) Ex.22.) [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetic acid

[0428] 90 mg (0.25 mmol ) ethyl [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino) oxy]acetate (ex.21 .) was dissolved in 10 ml methanol and 20 mg (0.5 mmol) NaOH (in 3 ml water) was added to the reaction mixture and stirred for an hour at room temperature. After the completion, the solvent was evaporated under reduced pressure and the residue was taken up with 15 ml water and washed with 2x10 ml diethyl-ether. The aqueous layer was separated and the pH was adjusted to pH=3-4. The precipitated product was filtered off washed with 2-3 ml water and dried.

[0429] Yield: 52 mg (63 %) Molecular Formula: CI5HI8F3NO4, LCMS purity 93.9 % [M+1 ]+334.1 , [M-1 ]’ 334.1 , Rt:3.98, min UV-VIS Abs. max 257 nm.

[0430] 1HNMR 57.84 (d, 2H, J=8.3 Hz); 7.77 (d, 2H, J=8.4 Hz); 4.70 (m, 2H); 3.31-3.28 (m, 2H); 3.19-3.18 (m, 4H); 2.82 (t, 2H, 6.9 Hz); 1 .54-1 .51 (m, 4H)

[0431] Ex.23.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oxime

[0432] (BSZ1991 NE)

[0433] 50 mg (0.10 mmol ) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetate (ex.3.) was dissolved in 10 ml dichloromethane, cooled to 0 °C then 1 .6 mlTFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound, (during the evaporation, the temperature of the reaction mixture must not exceed 45 °C.) The crude product was purified by HPLC. Yield: 24 mg (61%)

[0434] Molecular Formula: CuHwFs^Ch, LCMS purity 100 % [M+1 ]+305.1 , Rt:2.60 min UV-VIS Abs. max 260 nm.

[0435] 1HNMR 57.86 (d, 2H, J=8.1 Hz); 7.76 (d, 2H, 8.4 Hz); 4.17 (t, 2H, J=5.6 Hz); 3.40-3.36 (m, 3H);

[0436] 2.91 (t, 2H, J=5.4 Hz); 2.79 (t, 2H, J=6.8 Hz); 1 .89 (m, 2H); 1 .50-1 .46 (m, 4H) Ex.24.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4(trifluoromethyl)phenyl]pentyl}methanesulfon

[0437] 80 mg (0.16mmol ) tert-butyl {(4E)-11 ,11-dioxido-5-[4-(trifluoromethyl)phenyl]-3-oxa-11-thia- 4,10-diazadodec-4-en-1-yl}carbamate (i.19) was dissolved in 6 ml dichloromethane and cooled to °C then 1 .2 ml TFA was added in one portion to the reaction mixture and was allowed to warm up to room temperature and stirred for an hour. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC.

[0438] Molecular Formula: CisHzzFaNaOaS, LCMS purity 100% [M+1 ]+ 382.1 , [M-1 ]' 380.1 Rt:2.08 min UV- VIS Abs. max 259 nm.

[0439] 1HNMR 6 12.5 (brs, 1 H); 7.89 (d, 2H, J=8.2 Hz); 7.77 (d, 2H, J=8.3 Hz); 4.23 (t, 2H, J=8.3 Hz); 3.34-3.31 (m, 2H); 3.02 (t, 2H, J=5.9 Hz); 2.92 (m, 2H); 2.85 (s, 3H); 2.84-2.81 (m, 2H); 1 .48 (m, 4H)

[0440] Ex.25.) (5E)-5-({[(trifluoroacetyl)amino]methoxy}imino)-5-[4-(trifluoromethyl)phenyl]pentyl trifluoroacetate

[0441] 50 mg (0.1 mmol) (5E)-13,13-dimethyl-11-oxo-5-[4-(trifluoromethyl)phenyl]-7,12-dioxa-6,10- diazatetradec-5-en-1-yl trifluoromethyl carbonate (i.41 .) was dissolved in 5 ml dichloromethane and cooled to 0 °C. 2 ml TFA was added to the reaction mixture and was allowed to room temperature and stirred for 20 minutes. The reaction mixture was chilled to 0 °C again and 14 pl trifluoroacetic anhydride (21 mg, 0.1 mmol) was added to the reaction mixture and stirred for room temperature for an 2 hours. The solvent was removed under reduced pressure to give the title compound.

[0442] Molecularformula: Ci8Hi7F9N2O4, [M+1]+497.1 , [M-1]' 495.1 Rt:2.08 min UV-VIS Abs. max 261 nm.

[0443] 1HNMR 5 9.52 (t, 1 H, J=5.1 Hz); 7.87 (d, 2H, J=8.2 Hz); 7.77 (d, 2H, 8.4 Hz); 4.35 (t, 2H, J=6.2 Hz);

[0444] 4.26 (t, 2H, J=5.2 Hz); 3.55-3.53 (m, 2H); 2.80 (m, 2H); 1 .72-1 .65 (m, 2H); 1 .54-1 .47 (m, 2H) Ex.26.) isopropyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]eth yljcarbamate

[0445] 80 mg (0.25 mmol) (1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2- aminoethyl)oxime (fluvoxamine free base), 52 pl (0.3 mmol, 39 mg) DIPEA were dissolved in 5 ml anhydrous dichloromethane and 36 mg (0.3 mmol) isopropyl chloroformate was added to the solutuin and stirred for 4 hours at room temperature. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC.

[0446] Molecularfomula: CI9H27F3N2O4, Rt:5.07 min. [M+1]+405.1 , [M-1]’ 403.1

[0447] 1HNMR 5 7.85 (d, 2H, J=8.2 Hz); 7.75 (d, 2H, J=8.4 Hz); 7.05 (t, 1 H, J=5.8 Hz); 4.73 (septet, 1 H, J=6.2 Hz); 4.14 (t, 2H, J=5.8 Hz); 3.15-3.20 (m, 4H); 3.18 (s, 3H); 2.79-2.73 (m, 2H); 1.53-1.44 (m, 4H); 1.14 (d, 6H, J=6.2 Hz)

[0448] Ex.27.) benzyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethylcarbamate

[0449] 80 mg (0.25 mmol) (1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2- aminoethyl)oxime (fluvoxamine free base), 52 pl (0.3 mmol, 39 mg) DIPEA were dissolved in 5 ml anhydrous dichloromethane and 36 mg (0.3 mmol) isopropyl chloroformate was added to the solutuin and stirred for 4 hours at room temperature. The solvent was evaporated under reduced pressure to give the title compound. The crude product was purified by HPLC.

[0450] Molecularfomula: CI9H27F3N2O4, Rt:5.07 min. [M+1]+405.1 , [M-1 ]’ 403.1

[0451] 1HNMR 57.85 (d, 2H, J=7.9 Hz); 7.75 (d, 2H, J=8.4 Hz); 7.32-7.23 (m, 6H); 5.00 (m, 2H); 4.16 (t, 2H, J=5.7 Hz); 3.27-3.25 (m, 4H); 3.17 (s, 3H); 2.76 (m, 2H, J=6.7 Hz); 1 .52-1 .42 (m, 4H) Ex.28.) N-[(9H-fluoren-9-ylmethoxy)carbonyl]valyl-N~5~-carbamoyl-N-(4-{(8E)-3-oxo-9-[4-

[0452] (trifluoromethyl)phenyl]-2,7,14-trioxa-4,8-diazapentadec-8-en-1 -yl}phenyl)-L-ornithinamide

[0453] 2.00 mg ((1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oxime (fluvoxamine free base), 5.0 mg Fmoc-Val-Cit-PAB-PNP and 3.4 pl DIPEA were dissolved in 250 pl anhydrous DMF. The reaction mixture was stirred for an hour and monitored by HPLC.

[0454] Yield:1.4 mg (22%) Molecular formula: C49H58F3N7O9, Rt:5.17 min. [M+1]+946.1.

[0455] Biological results

[0456] To examine the cellular toxicity of the chemical entities, we performed cellular examinations on NIH3T3 as a non-tumorous control. We found that the compounds do not show toxic effects on the cell lines NIH3T3 mentioned above.

[0457] To examine the cellular toxicity of the chemical entities, preferably Compound 1 (example 23) and Compound 2 (example 3), specifically in human kidney epithelial cells, we performed MTT and LDH assay to test cell viability. Compound 1 did not show toxic effects applied in a dose of 10 uM or below, while Compound 2 showed no toxic effects applied in a dose of 5 uM or below.

[0458] To assess whether S1 R activation can mitigate tubular inflammation, we examined the mRNA expression of IL1 B, IL6, TNFalpha, TLR2, TLR4 NFKB1 and MCP-1, after LPS induction in HK-2 cells. LPS treatment markedly increased TLR2 and TLR4 expression, leading to a subsequent rise in NFKB1 and proinflammatory cytokine levels. Compound-1 and Compound-2 treatment reduced the LPS-induced increase in the mRNA expression of all genes except of MCP-1

Claims

Claims1. S1 R agonist compound of formula IFormula I whereinR1is selected from -H; -CH2-CH2-NH2; -CH2-CH2-NH-CO-C1-2 alkyl optionally substituted with one or more halogen; -CH2-CH2-NH-CO-O-C1-3 linear or branched chain alkyl, optionally substituted with phenyl; -CH2-CH2-NH2 substituted on the amin moiety with Fmoc-Val-Cit- PAB-, -CH2-CH2-OH, -CH2-CO-OH, -CH2-CO-NH2, -CH2-CO-OC1-2 alkyl,X is selected from CH2 or C(O);Y is selected from O, S or NH;R2 is selected from -H; -C1-2 alkyl, preferably methyl; -CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CO-C3-6 cycloalkyl; or -SO2-C1-6 linear or branched chain alkyl; with the proviso that the compound is excluded where R1 is -CH2-CH2-NH2, -CH2-CH2-OH, - CH2-CO-OH or -CH2-CO-NH2, X is CH2, Y is O and R2 is -H or -C1-2 alkyl; with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2 or -CH2-CH2- NH-CO-C1-2 alkyl, X is C(O), Y is O and R2 is -H; or a pharmaceutically acceptable salt thereof.

2. Compound of claim 1 , wherein X is C(O) and R2 is -H or -C1-2 alkyl.

3. Compound of claim 1 , wherein X is CH2.

4. Compound of any of claims 1 to 3, wherein Y is O.

5. Compound of any of claims 1 to 4, wherein R1is -CH2-CH2-NH2.

6. Compound of claim 1 , wherein the S1 R agonist compound is an S1 R agonist compound of formula IIFormula II wherein R1 is as defined above in claim 1R3 is selected from -CH2-O-C1-2 alkyl, preferably the alkyl is methyl; -CH2-O-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CH2-O-CO-C3-6 cycloalkyl; -CH2-NH-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms, -CH2-NH-SO2-C1-6 linear or branched chain alkyl; -CH2-S-C1-6 linear or branched chain alkyl, -CH2-OH or-COOH with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2, -CH2-CH2-OH, -CH2-CO-OH or -CH2-CO-NH2, and R3 is -CH2-OH or-CH2-O-C1-2 alkyl; with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2 or -CH2-CH2- NH-CO-C1-2 alkyl, and R3 is -COOH; or a pharmaceutically acceptable salt thereof.

7. Compound of claim 6, wherein R1is -CH2-CH2-NH2.

8. Compound of claim 6 or 7, wherein R3 is selected from -CH2-O-C1-2 alkyl, preferably the alkyl is methyl; -CH2-O-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CH2-O-CO-C3-6 cycloalkyl; -CH2-NH-CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms, or-COOH.

9. Compound selected fromEx.01 .) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetateEx.02.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one oximeEx.03.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetateEx.04.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentylcyclopropane carboxylateEx.05.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclobutanecarboxylateEx.06.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclopentanecarboxylateEx.07.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclo h exa n eca rboxylateEx.08.) (1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oximeEx.09.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl pivalateEx.10.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl 2-methylpropanoateEx.11 .) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2- methylpropanamideEx.12.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2,2- dimethylpropanamideEx.13.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}acetamideEx.14.) (5E)-5-[(2-hydroxyethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acidEx.15.) (5E)-5-[(carboxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acidEx.17.) 2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetamideEx.19.) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoic acidEx.21 .) ethyl [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetateEx.24.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4(trifluoromethyl)phenyl]pentyl}methanesulfon amideEx.25.) (5E)-5-({[(trifluoroacetyl)amino]methoxy}imino)-5-[4-(trifluoromethyl)phenyl]pentyl trifluoroacetateEx.26.) isopropyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]eth yljcarbamateEx.27.) benzyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethyl} carbamate10. S1 R agonist compound having the following formula Ifor use in the treatment or prevention of acute and / or chronic inflammation, whereinR1is selected from -H; -CH2-CH2-NH2; -CH2-CH2-NH-CO-C1-2 alkyl optionally substituted with one or more halogen; -CH2-CH2-NH-CO-O-C1-3 linear or branched chain alkyl, optionally substituted with phenyl; -CH2-CH2-NH2 substituted on the amin moiety with Fmoc-Val-Cit- PAB-, -CH2-CH2-OH, -CH2-CO-OH, -CH2-CO-NH2, -CH2-CO-OC1-2 alkyl,X is selected from CH2 or C(O);Y is selected from O, S or NH;R2 is selected from -H; -C1-2 alkyl, preferably methyl; -CO-C1-6 linear or branched chain alkyl, optionally substituted with one or more halogen atoms; -CO-C3-6 cycloalkyl; or -SO2-C1-6 linear or branched chain alkyl; with the proviso that the compound is excluded where R1 is -CH2-CH2-NH2, X is CH2, Y is O and R2 is methyl (i.e fluvoxamine); with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2, -CH2-CH2-OH, or -CH2-CO-NH2, X is CH2, Y is O and R2 is -H or -C1-2 alkyl; with the proviso that the compounds are excluded where R1 is -CH2-CH2-NH2, X is C(O), Y is O and R2 is -H; or a pharmaceutically acceptable salt thereof.

11. Compound as defined in any of claims 1-9 or a compound selected from the list below, for use in the treatment or prevention of acute and / or chronic inflammation:Ex.01 .) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentyl acetateEx.02.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one oximeEx.03.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl acetateEx.04.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentylcyclopropane carboxylateEx.05.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclobutanecarboxylateEx.06.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclopentanecarboxylateEx.07.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl cyclo h exa n eca rboxylateEx.08.) (1 E)-5-(methylthio)-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oximeEx.09.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl pivalateEx.10.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl 2-methylpropanoateEx.11 .) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2- methylpropanamideEx.12.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}-2,2- dimethylpropanamideEx.13.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentyl}acetamideEx.14.) (5E)-5-[(2-hydroxyethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acidEx.15.) (5E)-5-[(carboxymethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acidEx.16.) (5E)-5-[(2-acetamidoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acidEx.17.) 2-[({(1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetamideEx.18.) (1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentan-1-oneO-(2-hydroxyethyl)oximeEx.19.) (5E)-5-(hydroxyimino)-5-[4-(trifluoromethyl)phenyl]pentanoic acidEx.20.) (5E)-5-[(2-aminoethoxy)imino]-5-[4-(trifluoromethyl)phenyl]pentanoic acidEx.21 .) ethyl [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetateEx.22.) [({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy]acetic acidEx.23.) (1 E)-5-hydroxy-1-[4-(trifluoromethyl)phenyl]pentan-1-one O-(2-aminoethyl)oximeEx.24.) N-{(5E)-5-[(2-aminoethoxy)imino]-5-[4(trifluoromethyl)phenyl]pentyl}methanesulfon amide Ex.25.) (5E)-5-({[(trifluoroacetyl)amino]methoxy}imino)-5-[4-(trifluoromethyl)phenyl]pentyl trifluoroacetateEx.26.) isopropyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene} amino)oxy]eth yljcarbamateEx.27.) benzyl {2-[({(1 E)-5-methoxy-1-[4-(trifluoromethyl)phenyl]pentylidene}amino)oxy] ethyl} carbamate

Images