Method for producing modified wheat having increased crossability
By modifying the Kr1 gene in wheat using CRISPR-Cas or RNAi, the cross-breeding ability with other grasses is enhanced, addressing the genetic diversity and trait introduction challenges in wheat breeding.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- TOTTORI UNIVERSITY
- Filing Date
- 2025-12-16
- Publication Date
- 2026-06-25
AI Technical Summary
Wheat varieties exhibit low genetic diversity and face challenges in cross-breeding with other species due to the presence of genes like Kr1, which inhibit crossing, limiting the introduction of beneficial traits from other grasses.
Identify and modify the Kr1 gene at the molecular level by genetic techniques such as CRISPR-Cas, TALEN, or RNAi to reduce its inhibitory effect, enhancing wheat's cross-breeding ability with other grass species.
Increased cross-breeding ability of wheat with species like rye and barley, potentially improving wheat varieties by introducing beneficial genetic material from other grasses, thus enhancing resistance and productivity.
Smart Images

Figure JP2025043999_25062026_PF_FP_ABST
Abstract
Description
A method for producing modified wheat with increased crossbreeding ability.
[0001] This disclosure relates to a technique for hybridizing wheat with other species.
[0002] Wheat, along with rice and maize, is one of the world's three major grains and a vital agricultural plant, produced and consumed worldwide. Improving wheat's resistance to disease and stress, enhancing grain quality, and modifying other cultivation characteristics are all beneficial. Furthermore, with wheat cultivation and yields increasingly affected by climate change and global warming, there is a continuing need for wheat breeding. However, current wheat varieties exhibit relatively low genetic diversity. The type and number of available useful trait-related genes are key to wheat breeding, but currently, the decreasing genetic diversity of wheat varieties risks a shortage or depletion of resources within the wheat population for further improvement.
[0003] Introducing genetic material from other grasses, such as barley and rye, as well as numerous wild species not commonly used as agricultural crops, into wheat is an important means of effectively improving wheat varieties. For example, Non-Patent Literature 1 shows that introducing a specific gene found in the grass genus Thinopyrum into the wheat background confers resistance to fungal diseases. Non-Patent Literature 2 shows that introducing a specific chromosomal region derived from the grass Leymus racemosus into wheat through crossbreeding improves the nitrogen metabolism of wheat, leading to more efficient use of nitrogen fertilizers and increased productivity.
[0004] When a specific target gene has already been identified, it may be possible to produce transgenic wheat into which the gene has been artificially inserted. However, the use of transgenic crops is subject to social constraints, and in fact, it is rare for a target gene that can confer useful traits on its own to have already been identified. Therefore, it is extremely useful to incorporate genetic material derived from a different species into the wheat background through crossing with that different species, which can promote the identification of new beneficial genes. By also using backcrossing, it is possible to obtain improved wheat varieties that possess genetic loci derived from a different species related to useful traits while having the genetic background of wheat as a whole.
[0005] However, most common wheat varieties are thought to have genes that prevent crossing with other species, which has become a major obstacle to attempts to improve wheat varieties using crossing. For example, Non-Patent Document 3 investigated the crossing ability with rye in 1400 wheat lines, and according to the data, 1079 lines (about 77%) of them had a crossing ability (crossing rate) of less than 10%. It is known that there is a correlation between the level of crossing ability with rye and the level of crossing ability with other Poaceae plants such as barley (for example, Non-Patent Document 4). It has been known since the mid-20th century that multiple crossing-inhibiting genes (called the Kreuz or Kr genes) may exist in wheat, and among them, the Kr1 gene has been shown to have a particularly high crossing-inhibiting effect compared to other genes (reviewed in Non-Patent Document 5). For example, Non-Patent Document 6 describes that the Chinese Spring line, which is considered to lack the dominant Kr1 gene and is represented by the genotype kr1 kr1 in classical genetics, showed a crossing rate of 74.31% with rye, whereas when chromosome 5B containing the Kr1 gene was introduced from the Hope line, the crossing rate was suppressed to 6.4%. Thus, based on classical genetics in the era before the development of molecular biology, the presence of the Kr1 gene on chromosome 5B was推定, and it was thought to cause crossing inhibition as a dominant gene, but its molecular entity has remained unknown to this day.
[0006] Wang et al. (2020) Science, 368, eaba5435Subbarao et al. (2021) PNAS, Vol. 118, e2106595118Zeven (1987) Euphytica, 36: 299-319Koba et al. (1992) Hereditas, 116: 187-192Laugerotte et al. al. (2022) Plant Biotechnology Journal, 20, pp. 812-832Riley et al. (1967)Genet. Res., Camb., 9, pp. 259-267
[0007] This disclosure provides a technology for increasing the crossbreeding ability of wheat.
[0008] The inventors have succeeded in identifying a gene corresponding to the above-mentioned Kr1 in wheat at the molecular level and have found that damaging this gene leads to a reduction in cross-breeding inhibition and, consequently, an increase in cross-breeding ability. Embodiments of this disclosure are based on these findings. This disclosure includes the following embodiments: [1] A method for producing modified wheat with increased cross-breeding ability, comprising reducing the cross-breeding inhibition in a target wheat having a target gene encoding a protein having 95% or more sequence identity with SEQ ID NO: 1, by performing genetic modification to damage or suppress the target gene. [2] The method according to [1], wherein the modified wheat in which the target gene is damaged or suppressed has increased cross-breeding ability with at least one other wheat-related plant compared to unmodified target wheat. [3] The method according to [2], wherein the at least one wheat-leaved plant is any of the plants belonging to the genera Secale, Hordeum, Aegilops, Thinopyrum, Leymus, Dasypyrum, Agropyron, Amblyopyrum, Anthosachne, Australopyrum, Connorochloa, Crithopsis, Douglasdeweya, Elymus, Eremopyrum, Festucopsis, Henrardia, Heteranthelium, Hordelymus, Kengyilia, Pascopyrum, Peridictyon, Psathyrostachys, Pseudoroegneria, Stenostachys, and Taeniatherum. [4] The method according to any one of [1] to [3], wherein the target gene is damaged or suppressed using CRISPR-Cas, TALEN, nucleic acid base editing, prime editing, tilling, or RNAi.[5] The method according to any one of [1] to [4], wherein damaging or suppressing the target gene in the target wheat is carried out by a genetic modification that alters the nucleic acid sequence of the coding sequence region or promoter region of the target gene, or by a genetic modification that introduces an RNAi construct or a virus-induced gene silencing (VIGS) vector or artificial miRNA construct specific to the target gene. [6] Wheat having a deficiency gene corresponding to a natural target gene encoding a protein having 95% or more sequence identity with SEQ ID NO: 1 at a genomic position corresponding to the target gene, wherein the deficiency gene, compared to the target gene, is unable to transcribe mRNA normally due to a nucleic acid sequence modification in the promoter region, or is unable to express a normal protein due to a nucleic acid sequence modification in the coding sequence region. [7] The wheat according to [6], wherein the wheat has increased hybridization ability with at least one other wheat species compared to a control wheat without the nucleic acid sequence modification. [8] A method for producing a wheat genus hybrid plant, comprising crossing modified wheat produced by the method described in any one of [1] to [5] or the wheat described in [6] or [7] with a wheat genus plant other than wheat by artificial pollination. [9] A kit for carrying out a method for producing a wheat genus hybrid plant by crossing wheat with a wheat genus plant other than wheat, the kit comprising modified wheat produced by the method described in any one of [1] to [5] or the wheat described in [6] or [7], and instructions for carrying out the method.
[0009] Figure 1(a), left half, provides a photograph of the ear of the highly cross-able wheat line Chinese Spring and a schematic diagram showing its chromosome number. Figure 1(a), right half, shows substitution lines based on the genetic background of Chinese Spring, in which only chromosome 5B is replaced with one derived from the Cheyenne, Hope, or Timstein line. Figure 1(b) shows a comparison of the cross rates of the Chinese Spring line and the 5B chromosome substitution lines against rye. Figure 2 shows the cross rates of EMS-induced mutants. Figure 3 is a chromosome map showing the location of crossability suppression genes narrowed down using the CAPS method. Figure 4 shows the amino acid sequence (SEQ ID NO: 1) of the polypeptide encoded by the identified target gene (Kr1). In the #2334 mutant, alanine (A), the 112th amino acid, shown in bold, was mutated to threonine (T). Figure 5 shows a comparison of the ability to cross rye with a group of lines that originally possess the identified target gene (Kr1) (left) and a group of lines that originally lack the gene (right). Figure 6(a) shows the alignment of the amino acid sequence of the polypeptide encoded by the target gene of the wild-type (WT) Fielder variety (SEQ ID NO: 1) with the amino acid sequence of the polypeptide encoded by the target gene of the mutant (Mutant) created by CRISPR-Cas genome editing. Figure 6(b) shows the cross rates with rye for a line that is homozygous for the wild-type target locus (WT), a line that has at least one copy of the wild-type target gene (hemi), and a line that is homozygous for the CRISPR-Cas genome-edited deletion target gene but lacks the wild-type target gene (Mutant). In Figure 6b, Lines 01 to 10 represent different sister lines with the same genotype for the target gene, which were generated in the T1 generation from the same crossing experiment. The data points in each box plot represent the cross rate obtained from biological replicas of the same line, and the symbols a and b attached to each plot indicate statistical significance according to the Tukey-Kramer test.Figure 7(a) shows stained microscopic images of the pistils of wheat lines (WT) possessing the identified target gene and mutant lines (Mutant) in which the target gene was mutated and became a knockout gene, after pollination with rye pollen. Figure 7(b) shows the quantitative results of the percentage of pollen tubes that reached the style, ovary, and ovule.
[0010] This disclosure provides a method for producing modified wheat in which a cross-repression gene is impaired or suppressed. In other words, this disclosure provides a method for producing modified wheat with increased cross-breeding ability. This method involves reducing cross-breeding ability in target wheat that has a gene encoding a protein represented by Sequence ID No. 1 (also referred to in this disclosure as the “target gene”) and that has cross-breeding ability suppression based on that gene, by damaging or suppressing that gene. It is understood that a reduction in cross-breeding ability suppression leads to an increase in cross-breeding ability. In research aimed at elucidating the molecular identity of the Kr1 gene, which has been considered to have a particularly strong cross-repressing effect among wheat cross-repressing genes, the inventors discovered that representative wheat lines with low cross-ability possess a gene encoding a protein with the amino acid sequence of Sequence ID No. 1 in the chromosomal region where the Kr1 locus is located, while representative wheat lines with high cross-ability lack this gene. Furthermore, they discovered that mutating this gene in wheat lines with low cross-ability released the cross-repression, increasing their cross-ability to a level comparable to wheat lines with inherently high cross-ability. They concluded that this gene is Kr1. In other words, this disclosure is based on the molecular identification of a gene corresponding to the Kr1 gene, which has been considered to have a particularly strong cross-repressing effect among wheat, and the above-mentioned "cross-repressing gene" refers to this gene. The target gene was located in the region between the known genes TraesLAC5B01G003900.1 and TraesLAC5B01G004000.1 on chromosome 5B. The above known gene name symbols were assigned in the annotation of the Lancer variety genome, but those skilled in the art can recognize the corresponding genes in other varieties.
[0011] More generally, a gene that suppresses wheat cross-pollination is a gene present in wheat whose presence suppresses the ability of wheat to cross-pollinate with other grass species (sometimes called cross-affinity), meaning that its deletion increases the cross-ability percentages (sometimes called cross-success rates). Kr1 was a representative and major example of such a gene. As is known to those skilled in the art, the cross-ability of wheat can be measured as a percentage representing the proportion of flowers that form F1 seeds when wheat flowers are pollinated with pollen from other grass species. This measurement can be easily performed by those skilled in the art. The cross-ability may be measured in relation to at least one species of the wheat family, such as rye. Reverse cross-pollination, i.e., pollination of flowers of other grass species with wheat pollen, is generally known to have a poor success rate. "High," "low," "increased," and "suppressed" cross-ability mean that this cross-ability is relatively high, low, increased, and reduced (i.e., compared to a reference standard), respectively.
[0012] In this disclosure, damaging a target gene means completely or partially eliminating the expression of a gene product having cross-repressing activity by performing a genetic modification operation on the nucleic acid sequence of that gene. A genetic modification operation means artificially altering DNA as genetic material in a cell (e.g., through genome editing, genetic engineering, or the use of physical or chemical mutagens), which may include partially deleting, changing, adding (e.g., inserting) nucleotide sequences of DNA, and combinations thereof. Damage to a gene may include the gene becoming untranscribed (e.g., through mutations in the promoter sequence), or the loss of normal protein expression due to the deletion, insertion, substitution, or combination thereof of one or more nucleotides in the coding sequence. The entire target gene may be deleted by the genetic modification operation. In this disclosure, repressing a target gene means selectively reducing the level of its transcript or translation product compared to a control without the above genetic modification by performing a genetic modification operation (e.g., introduction of an RNAi construct) on wheat at a location other than that gene, while maintaining the structure of the gene itself to transcribe the normal sequence.
[0013] Genetic modification may involve knockout or knockdown of the target gene. Typically, the genetic modification impairs or suppresses the target gene, reducing the normal protein product level or mRNA (messenger RNA) level of the target gene in the pistil to 10% or less, or even 0%, compared to a control without the genetic modification. As is known to those skilled in the art, protein product levels can be quantified by immunoblotting, quantitative peptide mass spectrometry, etc. As is known to those skilled in the art, mRNA levels can be quantified by quantitative RT-PCR (reverse transcription polymerase chain reaction), Northern blotting or other hybridization methods, nuclease protection assays, RNA-seq, etc. Genetic modification of the nucleic acid sequence of the target gene may be a mutation that eliminates the expression of the normal protein sequence, for example, by introducing an immature stop codon or a frameshift. Genetic modification of the nucleic acid sequence of the target gene is preferably a null mutation. A null mutation of the target gene can be defined as a mutation that results in a cross rate indistinguishable from that of complete deletion of the target gene.
[0014] Selecting and executing an appropriate genetic modification technique to damage or suppress a given target gene with a known sequence is within the ordinary skill of a person skilled in the art. Damaging or suppressing a target gene can be done using, for example, CRISPR-Cas, TALEN, base editing, prime editing, tilling, or RNAi. CRISPR-Cas is a technique that uses a guide polynucleotide, such as guide RNA, to specifically target a Cas nuclease, and has become frequently used in recent years. Cas includes Cas9 and Cas12. TALEN (Transcription activator-like effector nuclease) is a technique that utilizes a fusion protein of a DNA-binding domain of a bacterial TAL effector protein and a nuclease. Both CRISPR-Cas and TALEN can cleave DNA in a sequence-specific manner. Modifications can be introduced into nucleic acid sequences by repairing DNA breaks created by CRISPR-Cas or TALEN via homologous recombination or non-homologous end joining (NHEJ). Base editing and prime editing are new technologies developed from CRISPR-Cas. Similar to CRISPR-Cas, they utilize sequence specificity through guide polynucleotides such as guide RNA, and can introduce mutations into target nucleic acids using nucleic acid base deaminase and reverse transcriptase, respectively. Tilling is a technique for efficiently isolating individuals with mutations in the target gene after randomly introducing mutations into the genome using chemical mutagens such as EMS (ethyl methanesulfonate). RNAi (RNA interference) can induce degradation and / or translation inhibition of the target gene's transcript by producing a short RNA with a nucleic acid sequence that matches the target gene from an exogenous DNA construct.These genetic modification techniques are well known to those skilled in the art and are all known to be usable in wheat (Nigro et al., “Using Gene Editing Strategies for Wheat Improvement”, Chapter 12 in Ricroch et al. (Eds.), A Roadmap for Plant Genome Editing, 2024, Springer; Szurman-Zubrzycka et al., Front. Plant. Sci., 2023, 14:1160695). In various embodiments, damaging or suppressing a target gene in target wheat can be achieved by genetic modification that alters the nucleic acid sequence of the coding or promoter region of the target gene, or by genetic modification that introduces an RNAi construct or virus-induced gene silencing (VIGS) vector or artificial miRNA (microRNA) construct specific to the target gene. As is known to those skilled in the art, RNAi constructs typically produce a short hairpin RNA containing a nucleic acid sequence specific to the target gene. Artificial miRNA constructs are typically created by mimicking the structure of natural miRNA precursors while replacing the target sequence. VIGS is a technique that utilizes the plant's natural antiviral defense mechanisms to induce specific RNAi against a target gene by giving the virus a sequence specific to that gene.
[0015] In this disclosure, the term "target wheat" refers to wheat that has a target gene encoding the protein represented by Sequence ID No. 1 and exhibits repression of crossbreeding ability based on that target gene, and is subject to genetic modification to damage or repress the target gene. Wheat that can be targeted wheat in this disclosure is wheat having a genome with a 5B chromosome, and in particular includes what is known by the scientific name Triticum aestivum and called bread wheat or common wheat. Wild-type Triticum aestivum is a 2n = 6x = 42 allohexaploid (Figure 1a) and has the target gene encoding the protein represented by Sequence ID No. 1 on the long arm of its 5B chromosome. However, as mentioned above, there are also wheat lines that originally lack this gene. Those skilled in the art can clearly identify which of the genes found in a given wheat genome is the "target gene encoding the protein represented by Sequence ID No. 1" as described in this disclosure, based on its sequence identity and genomic location, and also on the increased crossbreeding ability when it is impaired (for example, in the Lancer variety, the target gene is found between the annotated TraesLAC5B01G003900.1 and TraesLAC5B01G004000.1), and wheat lines that originally lack the target gene encoding the protein represented by Sequence ID No. 1 can also be easily identified by conventional experimental methods. In a typical embodiment, the target gene encoding the protein represented by Sequence ID No. 1 is a natural or wild-type gene. The target gene encoding the protein represented by Sequence ID No. 1 is usually located on the long arm of chromosome 5B. A single chromosome 5B of a target wheat plant may have one target gene or multiple copies of the target gene (for example, repeated target genes within a locus). In this disclosure, the "protein represented by SEQ ID NO: 1" typically has 100% amino acid sequence identity with SEQ ID NO: 1, but is not limited thereto. For example, the protein represented by SEQ ID NO: 1 may have 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more amino acid sequence identity with SEQ ID NO: 1 (identity across the entire length of SEQ ID NO: 1).In one embodiment, the protein represented by SEQ ID NO: 1 has either threonine at position 48 of SEQ ID NO: 1 replaced with methionine, or asparagine at position 135 of SEQ ID NO: 1 replaced with serine, and the target gene encoding it may be a natural gene with cross-repression activity (examples of the former include target genes in low-crossability varieties such as Fukoku and Kitakamikomugi, and examples of the latter include target genes in low-crossability varieties such as Zenkojikomugi and Kitanokaori). In any case, cross-ability can be increased by performing genetic modification on an existing target gene encoding the protein in a target wheat that has cross-ability suppression, thereby damaging or suppressing that target gene.
[0016] Target wheat varieties that undergo genetic modification to impair or suppress the target gene may include, for example, ArinaLrFor, Cadenza, Claire, Fielder, Jagger, Julius, Landmark, Lancer, Mace, Spelt, Paragon, Robigus, SY Mattis, Stanley, Weebil, Cheyenne, Hope, Timstein, Fukoku, Kitakamikomugi, Zenkojikomugi, or Triticum aestivum of the Kitanokaori variety. The target gene may have the nucleic acid sequence represented by Sequence ID No. 2. In some embodiments, the target gene may be described as a gene encoding a transcript (with U bases instead of T bases) having the nucleic acid sequence represented by Sequence ID No. 2. Sequence ID No. 2 is the cDNA sequence determined in Cheyenne and CS5BC lines. Of Sequence ID No. 2, the first 81 bases are presumed to correspond to the 5'UTR, bases 82–501 are the coding sequence (start codon–stop codon), and the remaining 297 bases correspond to the 3'UTR. In one embodiment, the target gene can be rephrased as a gene containing the nucleic acid sequence of bases 82–501 of SEQ ID NO: 2. This target gene is typically considered to be intron-free. Genes encoding proteins with 99% or more, 98% or more, 97% or more, 96% or more, or 95% or more sequence identity to the amino acid sequence of SEQ ID NO: 1 were not found in any major wheat genome other than this target gene itself on chromosome 5B. Since the first to 19 amino acids at the N-terminus of SEQ ID NO: 1 are predicted to be a signal peptide, it will be understood by those skilled in the art that the mature protein may be expressed lacking these N-terminal amino acids. Therefore, the target gene encoding the protein represented by SEQ ID NO: 1 may be a gene that produces a protein containing the amino acid sequence of SEQ ID NO: 3. In this disclosure, the terms protein and polypeptide may be used interchangeably.
[0017] Those skilled in the art will understand that modified wheat in which a target gene, which is a cross-repressing gene, is impaired or suppressed can be obtained as an individual that has undergone genetic modification to impair or suppress the target gene, or as an individual of its offspring. For example, modified wheat in which the target gene is impaired or suppressed and its cross-ability is increased may be an individual in which the modified gene (i.e., the deletion gene) allele has become homozygous or hemizygous through self-pollination, or an individual in which different modified gene alleles have become heterozygous. The methods of various embodiments of this disclosure can also be described as methods for increasing the cross-ability of wheat. The methods of various embodiments of this disclosure can also be described as methods for producing modified wheat with increased cross-ability, or methods for producing modified wheat in which the cross-repressing gene is impaired or suppressed. Modified wheat in which the target gene is impaired or suppressed may consequently exhibit increased cross-ability with at least one other wheat-related plant compared to unmodified target wheat. In some embodiments, modified wheat can increase the cross-breeding rate with at least one wheat species by 10%, 20%, 30%, 40%, or 50% compared to unmodified target wheat (i.e., if unmodified target wheat shows a cross-breeding rate of 10%, modified wheat may show a cross-breeding rate of 20%, 30%, 40%, 50%, or 60% or higher). In some embodiments, while unmodified target wheat shows a cross-breeding rate of 20% or less or 10% or less with at least one wheat species (e.g., rye), modified wheat may show a cross-breeding rate of more than 20%, 30%, 40%, 50%, or 60% or higher with the same wheat species. It will be understood by those skilled in the art that these cross-breeding rates can be determined, for example, as the average value of multiple biological replicas.
[0018] The above-mentioned at least one species of wheat may, in non-limiting examples, include any of the genera Secale, Hordeum, Aegilops, Thinopyrum, Leymus, and Dasypyrum, and more specifically, for example, rye, which is a Secale species, or barley, which is a Hordeum species. Other examples of wheat-related plants may include one or more of the following genera: Agropyron; Amblyopyrum; Anthosachne; Australopyrum; Connorochloa; Crithopsis; Douglasdeweya; Elymus (syn. Campeiostachys, Elytrigia, Hystrix, Roegneria, Sitanion); Eremopyrum; Festucopsis; Henrardia; Heteranthelium; Hordelymus; Kengyilia; Pascopyrum; Peridictyon; Psathyrostachys; Pseudoroegneria; Stenostachys; Taeniatherum.
[0019] In another embodiment, the present disclosure provides wheat (e.g., wheat genetically modified by artificial manipulation such as CRISPR-Cas) having a deficiency gene corresponding to a natural target gene encoding the protein represented by Sequence ID No. 1 at a genomic location corresponding to the target gene, wherein the deficiency gene, compared to the target gene, is unable to transcribe mRNA (particularly mRNA encoding the protein represented by Sequence ID No. 1) normally due to a nucleic acid sequence modification in the promoter region, or is unable to express a normal protein (particularly the normal protein represented by Sequence ID No. 1) due to a nucleic acid sequence modification in the coding sequence region. The deficiency gene is a damaged target gene encoding the protein represented by Sequence ID No. 1. The protein represented by Sequence ID No. 1 is as described above. A deficiency gene that "corresponds" to the target gene encoding the protein represented by Sequence ID No. 1 means a gene that originates from the target gene and therefore lies at a genomic location corresponding to the target gene (which, as described above, is on chromosome 5B of a typical wheat variety), and shows partial 100% sequence identity with the target gene, but does not have a completely identical sequence as a whole to the target gene due to the nucleic acid sequence modification, and therefore has a deficiency in function. Such partially sequence-modified wheat, contrasted with Chinese Spring and other varieties in which the entire genomic region containing the target gene is deleted, is previously unknown. Based on this disclosure, it has become possible for those skilled in the art to produce such wheat (e.g., using the CRISPR-Cas method or TALEN method), and its unique utility has been discovered for the first time through this disclosure. Nucleic acid sequence modification may include, for example, partial deletion of a nucleic acid sequence, insertion of an abnormal nucleic acid sequence, or introduction of a missense or nonsense mutation. Partial nucleic acid sequence deletion in a coding sequence region may be, for example, one or more (e.g., 1 to 100) amino acid deletions, such as amino acid deletions in the middle of a polypeptide, frameshifts, or deletions resulting in immature stop codons. The wheat of this embodiment may be wheat representing a null mutation for the target gene.The wheat of this embodiment may be Triticum aestivum having a genomic background of any of the following varieties: ArinaLrFor, Cadenza, Claire, Fielder, Jagger, Julius, Landmark, Lancer, Mace, Spelt, Paragon, Robigus, SY Mattis, Stanley, Weebil, Cheyenne, Hope, Timstein, Fukoku, Kitakamikomugi, Zenkojikomugi, or Kitanokaori. The wheat of this embodiment may be provided in the form of plants or seeds. It is understood that the wheat of this embodiment may be obtained by the method described above for producing modified wheat in which the cross-repression gene is impaired or suppressed. The wheat of this embodiment may show increased cross-ability with at least one wheat species compared to control wheat without the above nucleic acid sequence modification, similar to the modified wheat in which the target gene is impaired or suppressed. Details regarding the increased cross-ability and at least one wheat species are as described above.
[0020] This disclosure further provides a method for producing wheat genus hybrid plants, comprising crossing a modified wheat produced by any embodiment of the method for producing modified wheat in which the cross-repression gene is impaired or suppressed, or a modified wheat in which the cross-repression gene is increased, or a wheat having the above-mentioned deficiency gene, with a wheat genus plant other than wheat. The cross-breeding may be carried out by artificial pollination. More specifically, a wheat genus hybrid plant can be produced by artificially pollinating the modified wheat or wheat having the above-mentioned deficiency gene with pollen from the wheat genus plant to obtain offspring, or by further backcrossing those offspring with wheat. Other wheat-related plants may, for example, preferably be any of the genera Secale, Hordeum, Aegilops, Thinopyrum, Leymus, and Dasypyrum, or the genera Secale, Hordeum, Aegilops, Thinopyrum, Leymus, Dasypyrum, Agropyron, Amblyopyrum, Anthosachne, Australopyrum, Connorochloa, Crithopsis, Douglasdeweya, Elymus, Eremopyrum, Festucopsis, Henrardia, Heteranthelium, Hordelymus, A wheat-tribe hybrid plant may be any of the genera Kengyilia, Pascopyrum, Peridictyon, Psathyrostachys, Pseudoroegneria, Stenostachys, or Taeniatherum, and more specifically, it may be, but is not limited to, rye (a Secale plant) or barley (a Hordeum plant). A wheat-tribe hybrid plant is a plant that, as a result of crossing wheat with a wheat-tribe plant other than wheat, has a genomic region derived from wheat in addition to a genomic region derived from one of the aforementioned wheat-tribe plants. Methods for producing wheat-tribe hybrid plants can also be described as methods for introducing a heterologous genome into wheat.In one embodiment, a kit is provided for a method of producing wheat-tribe hybrid plants by crossing wheat with a wheat-tribe plant other than wheat, as described in this disclosure, the kit including modified wheat produced by either embodiment of the above method for producing modified wheat in which the cross-suppressing gene is impaired or suppressed, or modified wheat in which the cross-repressing ability is increased, or wheat having the above-mentioned deficient gene. The kit may further include instructions for carrying out the above method. The instructions may include, for example, instructions for artificially pollinating the wheat included in the kit with pollen from a wheat-tribe plant.
[0021] This disclosure includes the following non-limiting embodiments: Embodiment 1. A method for producing modified wheat with increased crossbreeding ability, comprising reducing the crossbreeding ability suppression in a target wheat having a target gene encoding a protein having 95% or more sequence identity with SEQ ID NO: 1 by performing genetic modification to damage or suppress the target gene. Embodiment 2. The method according to Embodiment 1, wherein the modified wheat in which the target gene is damaged or suppressed has increased crossbreeding ability with at least one other wheat-related plant compared to unmodified target wheat. Embodiment 3. The method according to Embodiment 2, wherein the at least one wheat-tribe plant includes any of the following genera: Agropyron, Amblyopyrum, Anthosachne, Australopyrum, Connorochloa, Crithopsis, Douglasdeweya, Elymus, Eremopyrum, Festucopsis, Henrardia, Heteranthelium, Hordelymus, Kengyilia, Pascopyrum, Peridictyon, Psathyrostachys, Pseudoroegneria, Stenostachys, and Taeniatherum. Embodiment 4. The method according to any one of Embodiments 1 to 3, wherein damaging or repressing the target gene is performed using CRISPR-Cas, TALEN, nucleic acid base editing, prime editing, TILLING, or RNAi. Embodiment 5. The method according to any one of Embodiments 1 to 4, wherein damaging or suppressing the target gene in the target wheat is carried out by genetic modification that alters the nucleic acid sequence of the coding sequence region or promoter region of the target gene, or by genetic modification that introduces an RNAi construct, a virus-induced gene silencing (VIGS) vector, or an artificial miRNA construct specific to the target gene.Embodiment 6. Wheat having a deletion gene corresponding to a natural target gene encoding a protein having 95% or more sequence identity with SEQ ID NO: 1 at a genomic position corresponding to the target gene, wherein the deletion gene, compared to the target gene, is unable to transcribe mRNA normally due to a nucleic acid sequence modification in the promoter region, or is unable to express a normal protein due to a nucleic acid sequence modification in the coding region. Embodiment 7. The wheat according to Embodiment 6, wherein the wheat has increased hybridizability with at least one other wheat-related plant compared to a control wheat without the nucleic acid sequence modification. Embodiment 8. A method for producing a wheat-related hybrid plant, comprising crossing a modified wheat produced by the method of any one of Embodiments 1 to 5, or the wheat according to Embodiment 6 or 7, with a wheat-related plant other than wheat by artificial pollination. Embodiment 9. A kit for a method of producing a wheat-tribe hybrid plant by crossing wheat with a wheat-tribe plant other than wheat, or for a method of Embodiment 8, wherein the kit includes modified wheat produced by the method of any one of Embodiments 1 to 5 or wheat described in Embodiment 6 or 7, and instructions for carrying out the method. Embodiment 11. A method for producing modified wheat in which a cross-repression gene is impaired or suppressed, comprising damaging or suppressing a target gene in a target wheat having a target gene encoding a protein represented by Sequence ID No. 1. Embodiment 12. The method of Embodiment 11, wherein the modified wheat in which the target gene is impaired or suppressed has increased cross-pollination ability with at least one wheat-tribe plant other than wheat compared to unmodified target wheat.Embodiment 13. The method according to Embodiment 12, wherein the at least one wheat genus plant includes any of the following genera: Agropyron, Amblyopyrum, Anthosachne, Australopyrum, Connorochloa, Crithopsis, Douglasdeweya, Elymus, Eremopyrum, Festucopsis, Henrardia, Heteranthelium, Hordelymus, Kengyilia, Pascopyrum, Peridictyon, Psathyrostachys, Pseudoroegneria, Stenostachys, and Taeniatherum. Embodiment 14. The method according to any one of Embodiments 11 to 13, wherein damaging or repressing the target gene is performed using CRISPR-Cas, TALEN, nucleic acid base editing, prime editing, TILLING, or RNAi. Embodiment 15. Wheat having a deficiency gene corresponding to a target gene encoding the protein represented by Sequence ID No. 1 at a genomic position corresponding to the target gene, wherein the deficiency gene is unable to transcribe mRNA encoding the protein represented by Sequence ID No. 1 due to a nucleic acid sequence modification in the promoter region, or is unable to express the normal protein represented by Sequence ID No. 1 due to a nucleic acid sequence modification in the coding region. Embodiment 16. Wheat according to Embodiment 15, wherein the wheat has increased hybridization ability with at least one other wheat-related plant compared to a control wheat without the nucleic acid sequence modification. Embodiment 17. A method for producing a wheat-related hybrid plant, comprising crossing a modified wheat produced by the method of any one of Embodiments 11 to 14 or the wheat according to Embodiment 15 or 16 with a wheat-related plant other than wheat. Embodiment 18. A kit for a method of producing a wheat-tribe hybrid plant by crossing wheat with a wheat-tribe plant other than wheat, or for a method of Embodiment 17, wherein the kit includes modified wheat produced by the method of any one of Embodiments 11 to 14 or wheat as described in Embodiment 15 or 16, and instructions for carrying out the method.
[0022] [Establishment of Chinese Spring Strains with 5B Chromosome Replacement] While most bread wheat strains generally available to those skilled in the art exhibit a low cross-breeding rate of less than 10% with rye and other grains, Chinese Spring (CS) is an exceptional wheat strain with high cross-breeding ability. Classical genetics suggests that CS lacks the Kr1 allele on chromosome 5B. The inventors' research team crossed this CS strain with typical low-cross-breeding strains such as Cheyenne, Hope, or Timstein, and then repeatedly backcrossed with CS, thereby establishing 5B chromosome replacement CS strains (Figure 1a right) in which the CS strain as a whole has the genetic background of CS (Figure 1a left), but only the 5B chromosome is replaced with that of the Cheyenne, Hope, or Timstein strain. Strains with a 5B chromosome derived from the Cheyenne strain are called CS5BC, those with a 5B chromosome derived from the Hope strain are called CS5BH, and those with a 5B chromosome derived from the Timstein strain are called CS5BT. When these lines were pollinated with rye pollen and the cross-breeding rate was measured, the cross-breeding rate for CS was 58.4%, while the cross-breeding rates for CS5BC, CS5BH, and CS5BT were suppressed to 9.0%, 0.0%, and 2.2%, respectively (Figure 1b). These results are consistent with previous predictions that the cross-breeding suppressor Kr1 gene is located on chromosome 5B.
[0023] In these examples, the cross-pollination experiments were conducted as follows: Cuttings were used from wheat plants before flowering, with at least two nodes remaining on the spike. Immature spikelets were removed, and only spikelets with uniform developmental stages in the central part were used. The first and second florets of the spikelets were used for cross-pollination. All anthers were removed from each floret, and a pollination bag was placed over it. The cuttings were cultured in a 3% sucrose solution cooled with circulating water at approximately 5°C until the pistils reached a developmental stage suitable for pollination. The room temperature was 22°C, and continuous lighting was maintained for 24 hours. Anthers were removed from rye just before flowering, and fresh rye pollen was collected from the anthers and used to pollinate the wheat pistils. Three weeks after pollination, the cross-pollination success rate (number of seeds / number of florets pollinated × 100) was calculated.
[0024] [Muta Induction] The above-mentioned CS5BC strain, in which only the 5B chromosome of the Chinese Spring genome is replaced with that of Cheyenne, exhibiting cross-repression, was used as the parent plant for mutation introduction. A population in which mutations were induced was created by treating CS5BC with 50 mM chemical mutagens EMS. EMS is known to introduce multiple point mutations into the genome of each individual at once. Approximately 3,000 mutant individuals (M2 generation) were cultivated in the experimental field and used in cross-breeding experiments with rye. As shown in Figure 2, mutant strain #2334 with clearly improved cross-breeding ability was found. In Figure 2, each point represents one mutant individual, with mutant individuals lined up along the horizontal axis and the cross-breeding success rate plotted on the vertical axis.
[0025] To test for synlocacy, we created F1 individuals by crossing mutant #2334, which showed improved cross success rates, with Chinese Spring. We then measured the cross success rates between these F1 individuals and rye. The cross success rates of the F1 individuals were similar to those of Chinese Spring, confirming that the mutation causing the improved cross success rate is located at the same locus (located on chromosome 5B) as the one that suppressed crosses in CS5BC.
[0026] [Fine mapping of causative mutation and identification of target genes] Artificial pollination was performed using mutant #2334 (M3 generation) as the seed parent and CS5BC (referred to as "wild type" in comparison to the mutant) as the pollen parent to create F1 hybrids. An F2 population was then cultivated by self-pollinating these F1 individuals. The 5B chromosome of each F2 individual is a chimeric chromosome containing parts derived from both #2334 and CS5BC due to homologous recombination. Cross experiments with rye were conducted using approximately 500 individuals from the F2 population, and the success rate of each F2 individual was measured.
[0027] To identify mutations related to changes in hybridization ability among the numerous mutations present in F2 individuals, the following experiment was performed. First, whole-genome shotgun sequencing was performed on Cheyenne, CS5BC, and mutant #2334 to obtain approximately 20× nucleotide sequences. A phylogenetic tree was constructed using the obtained short-read sequences and the short-read sequences of 17 bread wheat strains (ArinaLrFor, Chinese Spring, Cadenza, Claire, Fielder, Jagger, Julius, Landmark, Lancer, Mace, Norin61, Spellt, Paragon, Robigus, SY Mattis, Stanley, Weebil) publicly available in the NCBI database. Based on the phylogenetic tree, the strain most closely related to CS5BC (Lancer) was selected, and its reference genome was used for mutation analysis of the mutant.
[0028] Short read sequences from Cheyenne, CS5BC, and #2334 were mapped to the Lancer reference genome using Bowtie2 software. Sequence variations were detected using BCFtools.
[0029] The genome sequences of CS5BC (wild type) and #2334 (mutant) were compared to extract base substitutions located on chromosome 5B. Restriction enzymes capable of distinguishing and recognizing sequence motifs containing base substitutions from their corresponding non-substituted wild-type sequence motifs were selected, and the genotype of the F2 individuals was determined using the CAPS (cleaved amplified polymorphic sequence) method. In other words, the recognition sites of each restriction enzyme provide positional markers on the chromosome, and the combination of the presence or absence of these markers provides the genotype. By examining the correlation between the markers and the success rate of crossing, the location of the crossability repression locus ("crossability" in Figure 3) (or the location of the mutation that releases crossability repression) could be narrowed down to a 7.39 Mb region on chromosome 5B (Figure 3).
[0030] RNA-seq analysis was also performed separately using CS5BC and #2334. Total RNA was extracted from wheat pistils before and after pollination with rye pollen using the RNeasy® Plant Mini Kit (QIAGEN). Genomic DNA contaminating the total RNA sample was removed with DNase I. Short reads were obtained by RNA-seq using the Illumina TruSeq® Stranded mRNA Library. Low-quality reads were removed using Trimmomatic software. Short reads were aligned to the Lancer reference genome using HISAT2. Newly discovered transcript locations were annotated using Stringtie. Transcript levels were measured using featureCounts from the Subread package. Differentially expressed genes were extracted using the edgeR library of the R program. Mutation sites in mutants compared to the wild type were identified using BCFtools, and the impact of amino acid mutations was estimated using SnpEff.
[0031] In the reference genome, 76 genes were predicted within the 7.39 Mb genomic region. RNA-seq analysis revealed that 23 of these 76 genes were expressed in the pistil. Of these 23 genes, only one was mutated in mutant #2334. Considering all results and findings comprehensively, it was concluded that this gene is a target gene representing the cross-repression dominant gene Kr1. This target gene is a novel gene identified for the first time in this study and encodes a protein with the amino acid sequence shown in SEQ ID NO: 1 (Figure 4). The nucleic acid sequence (cDNA sequence) of this target gene is shown in SEQ ID NO: 2. In strain #2334, the 112th amino acid of SEQ ID NO: 1, alanine, was mutated to threonine, resulting in a knockout gene. The first 1-19 amino acids at the N-terminus of SEQ ID NO: 1 are predicted to be a signal peptide. The portion from amino acids 121-133 is predicted to be a transmembrane helix, and therefore this protein is predicted to be a membrane-bound protein. The genome sequences of several low-crossability wheat lines other than CS5BC were also examined, and the presence of target genes encoding proteins with identical amino acid sequences was confirmed.
[0032] In the genome of the highly hybridizable Chinese Spring line, the nucleic acid sequence region containing the entire target gene was found to be originally deleted. Figure 5 shows the results of measuring the hybridization rate with rye for lines with a deleted target gene, such as Chinese Spring (-Kr1, n=25), and lines with the target gene, such as Cheyenne (+Kr1, n=129). This measurement included many wheat lines whose whole genome sequences were not yet read (separate lines that are independent of each other). For these, PCR was performed using primers that specifically amplify the target gene, and +Kr1 and -Kr1 were determined based on the presence or absence of amplification. From Figure 5, it can be clearly seen that this gene, identified at the molecular level, has a major influence on the hybridization ability of wheat.
[0033] [CRISPR-Cas Genome Editing] The wheat variety Fielder, known for being a cross-repressing line and relatively easy to perform transformation experiments on, was used as the target for genome editing. A binary vector was created containing a guide RNA that codes for the coding sequence of the target gene. Specifically, two guide RNAs (referred to as guide RNA1 and guide RNA2, respectively) with target-specific sequences, GGCCATCAACACCATCACCG (SEQ ID NO: 4) and GTGCTTGGCAAAGGACAAGG (SEQ ID NO: 5), were used in combination. SEQ ID NOs: 4 and 5 correspond to nucleotide positions 258-277 and 327-346 of SEQ ID NO: 2, respectively. Immature Fielder embryos were transformed using the Agrobacterium method, and the target gene was disrupted by conventional CRISPR-Cas genome editing. The resulting line exhibits damage to the target gene due to a 69 bp deletion in the target gene's coding sequence, which is originally present in the Fielder genome (corresponding to 23 amino acids corresponding to amino acid positions 65-87 of SEQ ID NO: 1; this does not overlap with the mutation site of mutant #2334; see Figure 6a). Fielder was thought to have multiple copies of the target gene with repeated identical sequences within the same locus, but this genome editing was able to destroy all copies. As a result, we were able to produce modified wheat with reduced cross-repression ability and improved cross-breeding rates with rye and other grains. The results of measuring the cross-breeding rate with rye are shown in Figure 6b. Wild-type (WT) wheat with a homozygous intact target locus had a low cross-breeding rate of less than 10% on average, and lines with at least one copy of the intact target gene (referred to here as "hemi") also had a similarly low cross-breeding rate. In contrast, lines with a homozygous deletion of the target gene damaged by CRISPR-Cas genome editing and lacking the intact target gene (mutant) showed a remarkably increased cross-breeding rate of at least 30% on average.
[0034] [Pollen Tube Observation] The target gene corresponding to Kr1 identified in this disclosure appears to suppress successful cross-pollination by inhibiting the elongation of pollen tubes from pollinated pollen until they reach the ovule. A pollen tube observation experiment demonstrating this is described below.
[0035] Wheat pistils were frozen in liquid nitrogen two hours after pollination with rye pollen and stored in a -80°C freezer until observation. For observation, the pistils were fixed using 600 μl of fixative (ethanol:acetic acid = 3:1) for 10 florets. After overnight fixation, the pistils were cut vertically. The cut pistil samples were placed in 600 μl of 70% ethanol solution. The solution was then replaced with 600 μl of 70% lactic acid and heated at 100°C for 2 minutes. After washing the samples twice with water, they were placed in 600 μl of 0.5 M tripotassium phosphate and left to stand at room temperature for 20 minutes. The solution was then replaced with 600 μl of pollen tube staining solution containing 0.1% aniline blue, 0.1 M tripotassium phosphate, and 20 μg / ml propidium iodide, and left to stand in the dark at room temperature for 1 day. Samples were prepared by mounting them under a coverslip in a mixture containing 0.4 M sorbitol, 0.1% aniline blue, and 0.1 M tripotassium phosphate. A fluorescence microscope (Olympus BX41) and a CCD camera (Olympus DP72) were used to capture images at 16.7 μm intervals in the depth direction of the sample. Depth stacking was performed using Photoshop® software.
[0036] The results are shown in Figure 7a. In the wild type (WT, in this case representing CS5BC before mutagenesis), the elongation of pollen tubes (thread-like structures stained blue-green with aniline blue) extending from pollen (granular structures stained red with propidium iodide, indicated by arrowheads in the figure) through the style stops midway and does not reach the ovule, which is located deep within the ovary and contains female germ cells. In contrast, in the mutant with a mutated target gene (Mutant, representing strain #2334), the bundle of pollen tubes is able to elongate to reach the ovule, which is understood to be a result of the loss of repression by the target gene. The quantitative results of the percentage of pollen tubes that reached the style, ovary, and ovule are shown in Figure 7b.
Claims
1. A method for producing modified wheat with increased crossbreeding ability, comprising reducing the suppression of crossbreeding ability in target wheat having a target gene encoding a protein having 95% or more sequence identity with SEQ ID NO: 1 by performing genetic modification to damage or suppress the target gene.
2. The method according to claim 1, wherein the modified wheat in which the target gene is impaired or suppressed has increased hybridization ability with at least one other wheat-related plant compared to the unmodified target wheat.
3. The method according to claim 2, wherein the at least one wheat-related plant includes any of the following genera: Secale, Hordeum, Aegilops, Thinopyrum, Leymus, Dasypyrum, Agropyron, Amblyopyrum, Anthosachne, Australopyrum, Connorochloa, Crithopsis, Douglasdeweya, Elymus, Eremopyrum, Festucopsis, Henrardia, Heteranthelium, Hordelymus, Kengyilia, Pascopyrum, Peridictyon, Psathyrostachys, Pseudoroegneria, Stenostachys, and Taeniatherum.
4. The method according to claim 1, wherein damaging or repressing the target gene is performed using CRISPR-Cas, TALEN, nucleic acid base editing, prime editing, tilling, or RNAi.
5. The method according to claim 1, wherein damaging or suppressing the target gene in the target wheat is carried out by genetic modification of altering the nucleic acid sequence of the coding sequence region or promoter region of the target gene, or by genetic modification of introducing an RNAi construct, a virus-induced gene silencing (VIGS) vector, or an artificial miRNA construct specific to the target gene.
6. Wheat having a deletion gene corresponding to a natural target gene that encodes a protein having 95% or more sequence identity with SEQ ID NO: 1, at a genomic position corresponding to the target gene, wherein the deletion gene, compared to the target gene, is unable to transcribe mRNA normally due to a nucleic acid sequence modification in the promoter region, or is unable to express a normal protein due to a nucleic acid sequence modification in the coding region.
7. The wheat according to claim 6, wherein the wheat has increased hybridization ability with at least one other wheat-related plant compared to the control wheat without the nucleic acid sequence modification.
8. A method for producing a wheat tribe hybrid plant, comprising crossing a modified wheat produced by the method described in any one of claims 1 to 5, or the wheat described in claim 6 or 7, with a wheat tribe plant other than wheat by artificial pollination.
9. A kit for producing a wheat-tribe hybrid plant by crossing wheat with a wheat-tribe plant other than wheat, the kit comprising modified wheat produced by the method of any one of claims 1 to 5 or wheat according to claim 6 or 7, and instructions for carrying out the method.