Bioactive milk-derived rnas and associated methods

WO2026136258A2PCT designated stage Publication Date: 2026-06-25KRESKO RNATECH CORP
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
KRESKO RNATECH CORP
Filing Date
2025-12-15
Publication Date
2026-06-25

Smart Images

  • Figure US2025059684_25062026_PF_FP_ABST
    Figure US2025059684_25062026_PF_FP_ABST
Patent Text Reader

Abstract

A composition is disclosed. The composition comprises one or more RNAs at least 95% identical to a bioactive milk-derived RNA selected from the group consisting of SEQ ID NOs 1-18. The disclosure also describes a process to generate stable milk RNA-rich extracts comprising SEQ ID 1-18 using natural milk (e.g., Bovine, human, or others), wherein the extract further comprises biologically active compounds. (e.g., nucleic acids molecules, oligosaccharides, proteins, and lipids). In some embodiments, the composition comprises one or more RNAs at least 100% identical to an RNA selected from the group consisting of SEQ ID NOs 1-18. In some embodiments, the composition comprises one or more RNAs at least 95%, 96%, 97%, 98%, or 99% identical to an RNA selected from the group consisting of SEQ ID NOs 1-18. In some embodiments, the composition comprises multiple RNAs.
Need to check novelty before this filing date? Find Prior Art

Description

Docket No. 10968-11114-PCTBIOACTIVE MILK-DERIVED RNAs AND ASSOCIATED METHODSTECHNICAL FIELD

[0001] This disclosure relates to milk-derived bioactive RNAs and their uses for oral and topical applications.BACKGROUND

[0002] Evolution has played a role in selecting the components of biological fluids to ensure their proper function and particularly. Within biofluids, milk is one of the most highly complex and heterogeneous biological fluids. Milk is rich in macro- and micro-nutrients but also bioactive compounds, like antimicrobial molecules, growth factors, immune cells, and antibodies. Human milk remains the gold standard for infant nutrition and plays important roles in the child's first immune defense and gut health. Moreover, different lines of evidence indicate that human breast milk contains different types of RNA molecules. Most studies have focused on miRNAs, while other sRNA species have not been thoroughly characterized.

[0003] International patent application, publication No. WO 2014 / 036726 is directed to microRNA in human milk and use thereof.

[0004] Weber et al. (2010) demonstrated that breast milk contains the highest RNA concentration among 12 human biofluids analyzed, with an average concentration over seven times higher than the others (Clin Chem. 2010 Sep 16;56(11):1733-1741. doi: 10.1373 / clinchem.2010.147405).

[0005] Hulstaert et al. (2020) demonstrated that the distribution of small RNA biotypes varies distinctly across human biofluids. In breast milk and colostrum samples, reads mapping to miRNAs constitute less than 10%, while tRNA and rRNA fractions are notably high (Cell Rep. 2020 Dec 29;33(13):108552).

[0006] Extensive research shows that extracellular sRNAs can exist within extracellular vesicles, in protein-complexed forms, and / or as free molecules. Studies on milk to date have focused primarily on vesicular miRNAs, demonstrating that milk-derived miRNAs in exosomes can be absorbed by mammalian cells, where they regulate gene expression and host metabolism.

[0007] U.S. patent application, publication No. U.S. 2012093874 is directed to method for screening for diet providing production of milk having immunoregulatory action. U.S. patent application, publication No. U.S. 10874114B2 is directed to supplementation of milk formulas with microvesicles isolated from milk.Docket No. 10968-11114-PCT

[0008] Both breast and bovine milk contain many bioactive compounds that contribute to their functional properties. They support the various applications of milk beyond nutrition, such as enhancing immune function, promoting gut health, supporting tissue repair, and acting as antimicrobial agents. Additionally, milk-derived bioactive compounds are increasingly utilized in pharmaceuticals, skincare products, and as functional ingredients in food products. These bioactive compounds include immunoglobulins, lactoferrin, lysozyme, and growth factors, among others. Evidence from both miRNAs and the sequences described in this disclosure suggests that sRNA molecules also contribute to milk's beneficial properties. However, RNA's inherent instability limits its application potential, underscoring the need to develop preservation methods that stabilize RNA in milk. Such advancements would enable the development of more effective milk-based products to enhance health and well-being.SUMMARY

[0009] In a first aspect, the disclosure provides a composition comprising one or more RNAs at least 95% identical to a bioactive milk-derived RNA selected from the group consisting of SEQ ID NOs 1-18. Sequence ID numbers are as follows:

[0010] SEQ ID NO 1: RNA fragment from tRNA Gly:

[0011] GCAUUGGUGGUUCAGUGGUAGAAUUCUCGC

[0012] SEQ ID NO 2: RNA fragment from tRNA Glu (5'):

[0013] UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCG

[0014] SEQ ID NO 3: RNA fragment from yRNA4:

[0015] GGCUGGUCCGAUGGUAGUGGGUUAUCAGAACU

[0016] SEQ ID NO 4: RNA fragment from tRNA Vai:

[0017] GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCU

[0018] SEQ ID NO 5: RNA fragment from tRNA Lys:

[0019] GCCCGGCUAGCUCAGUCGGUAGAGCAUGGGAC

[0020] SEQ ID NO 6: RNA fragment from rRNA 28S (5'):

[0021] CGCGACCUCAGAUCAGACGUGGCGACCCGCUG

[0022] SEQ ID NO 7: RNA fragment from rRNA 5.8S(5'):

[0023] GACUCUUAGCGGUGGAUCACUCGGCUCGUGCGUDocket No. 10968-11114-PCT

[0024] SEQ ID NO 8: RNA fragment from rRNA 5.8S (3'):

[0025] CGGGGCUACGCCUGUCUGAGCGUCGCU

[0026] SEQ ID NO 9: RNA fragment from rRNA 28S (3'):

[0027] GCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUG

[0028] SEQ ID NO 10: RNA fragment from rRNA 18S (3'):

[0029] GCUGAGAAGACGGUCGAACUUGACUAUCUAGAGG

[0030] SEQ ID NO 11: RNA fragment from rRNA 18S (i-1120):

[0031] CAUGACCCGCCGGGCAGCUUCCGGGAAACCAAAGUCUUUGGGUUCCGG

[0032] SEQ ID NO 12: RNA fragment from tRNA Glu (3'):

[0033] CGCCGCGGCCCGGGUUCGUUUCCCGGUCAGGG

[0034] SEQ ID NO 13: RNA fragment from tRNA Arg (3'):

[0035] AGCUGGGGAUUGUGGGUUCGUGUCCCAUCUGGGUCGC

[0036] SEQ ID NO 14: RNA fragment from tRNA Pro (5')

[0037] GGCUCGUUGGUCUAGGGGUAUGAUUCUCGC

[0038] SEQ ID NO 15: RNA fragment from tRNA Pro (3')

[0039] GCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC

[0040] SEQ ID NO 16: RNA fragment from tRNA Arg (5')

[0041] GACCCAGUGGCCUAAUGGAUAAGGCAUCAGCCU

[0042] SEQ ID NO 17: RNA fragment from tRNA His

[0043] GCCGUGAUCGUAUAGUGGUUAGUACUCUGCG

[0044] SEQ ID NO 18: RNA fragment from tRNA Asp

[0045] GGGAGACCGGGGUUCGAUUCCCCGACGGGGAG

[0046] The disclosure also describes a process to generate stable milk RNA-rich extracts comprising SEQ ID 1-18 using natural milk (e.g., Bovine, human, or others), wherein the extract further comprises biologically active compounds, (e.g., nucleic acids molecules, oligosaccharides, proteins, and lipids). The extracts are obtained as follows: a) Fresh milk is aseptically collected in sterile containers, b) within the first hour post collection samples are supplemented with divalent cations in concentrations ranging between 0,01 and lOmM (Ca++, Mg++, among others -Docket No. 10968-11114-PCT concentration O.lmM,) and concomitantly adjusting the PH (range 3-6 at a pre-defined temperature (4-25, IOC), c) optional: samples are subjected to a treatment with an enzyme mix (e.g. pepsin or chymosin), suitable for coagulating milk proteins, d) a clear solution is obtained by performing at least one filtration of said sample or a centrifugation step (5000g-13000g- 10000g) to recover the supernatant containing RNA molecules, e) to obtain a sterile extract, said extracts are filtrated using sterile filters of typical pore sizes below 1 pm, preferably between 0.45 pm and 0.2 pm.

[0047] In some embodiments, the composition comprises one or more RNAs at least 100% identical to an RNA selected from the group consisting of SEQ ID NOs 1-18. In some embodiments, the composition comprises one or more RNAs at least 95%, 96%, 97%, 98%, or 99% identical to an RNA selected from the group consisting of SEQ ID NOs 1-18. In some embodiments, the composition comprises multiple RNAs, in some of these embodiments, the one or more RNAs comprises two or more of the RNAs. In some of these embodiments, the one or more RNAs comprises three or more of the RNAs. In further embodiments, the one or more RNAs comprises four or more of the RNAs. In some embodiments, the one or more RNAs comprises five or more of the RNAs. In other embodiments, the one or more RNAs comprises six or more of the RNAs. In yet other embodiments, the one or more RNAs comprises seven or more of the RNAs. In various embodiments, the composition comprises eight or more of the RNAs. In particular embodiments, the composition comprises nine or more of the RNAs. In further embodiments, the composition comprises ten or more of the RNAs. In other embodiments, the composition comprises eleven or more of the RNAs. In various embodiments, the composition comprises twelve or more of the RNAs. In certain embodiments, the composition comprises thirteen or more of the RNAs. In some embodiments, the composition comprises fourteen or more of the RNAs. In particular embodiments, the composition comprises fifteen or more of the RNAs. In various embodiments, the composition comprises sixteen or more of the RNAs. In certain embodiments, the composition comprises seventeen or more of the RNAs. In some embodiments, the composition comprises all of SEQ ID NOs 1-18.

[0048] In some embodiments, the RNA is chemically synthesized, isolated and / or purified. In some embodiments, the composition is dried (lyophilization or spray drying).

[0049] The composition has been found to be effective at various concentrations including concentrations that are low compared to the concentrations of typical additives. In some embodiments, the composition comprises the RNA at a concentration between about 1 ug / L and about 1 mg / L.

[0050] The composition in milk RNA-rich extracts is mainly non vesicular, but still resists in vitro digestion, making it suitable for oral administration. A convenient method of administration ofDocket No. 10968-11114-PCT the composition is a food, drink, dietary supplement, food supplement, or food additive. In some embodiments, the food, drink, dietary supplement, food supplement, or food additive is formulated in a tablet form or a pill form. Enabling the composition to reach further into the digestive tract is often desirable, therefore in some embodiments, the tablet or pill comprises an enteric coat. In alternative embodiments, the food, drink, dietary supplement, food supplement, or food additive is formulated in a liquid form, a solid form, a powder form, a dispersion form, or a suspension form. In some of these embodiments, the food, drink, dietary supplement, food supplement, or food additive comprises one or more sweeteners, stabilizers, binders, humectants, natural flavors, artificial flavors, natural colors, artificial colors, natural preservatives, artificial preservatives, or a combination thereof. In yet other embodiments, the food, drink, dietary supplement, food supplement, or food additive comprises a monosaccharide, disaccharide, polysaccharide, sucrose, dextrose, maltose, dextrin, xylose, ribose, mannose, galactose, sucromalt, fructose (levulose), invert sugar, corn syrup, maltodextrin, fructooligosaccharide syrup, partially hydrolyzed starch, corn syrup solids, polydextrose, soluble fiber, insoluble fiber, natural cane juice, gelatin, citric acid, lactic acid, natural colors, natural flavors, fractionated coconut oil, carnauba wax, or a combination thereof.

[0051] The composition in milk RNA-rich extracts is stable in liquid and powder form, making it suitable for topical administration. A convenient method of administration of the composition is a serum, cream, powder, ointment, spray, lotion, or gel.

[0052] According to some embodiments, the composition modulates metabolism in human cells and probiotics, stimulating tissue regeneration (promote vascular cell survival, accelerate wound closure in keratinocytes scratch assays and stimulates extracellular matrix component production in fibroblasts), reducing inflammation in stimulated macrophages, promoting gut health (restores intestinal barrier integrity, boosts gut serotonin production, lowers fat accumulation in liver cells and stimulates biofilm formation of lactic bacteria), and regulating stress response (lower cortisol production in adrenocortical cells and promote neuron cell survival).

[0053] In some embodiments, the composition showed the capacity to improve sleep quality in a subject when administered orally.

[0054] In some embodiments, the composition showed the capacity to stimulate skin reepithelization in a subject when administered topically.

[0055] Further aspects and embodiments are provided in the foregoing drawings, detailed description, and claims.Docket No. 10968-11114-PCTBRIEF DESCRIPTION OF THE DRAWINGS

[0056] The following drawings are provided to illustrate certain embodiments described herein. The drawings are merely illustrative and are not intended to limit the scope of claimed inventions and are not intended to show every potential feature or embodiment of the claimed inventions. The drawings are not necessarily drawn to scale; in some instances, certain elements of the drawing may be enlarged with respect to other elements of the drawing for purposes of illustration.

[0057] Figure 1 is a percentage distribution of sRNAs in human skim milk samples identified using complementary sRNA sequencing techniques (SMARTER and TRU SEQ).

[0058] Figure 2 is a percentage distribution of several abundant RNA fragments derived from tRNAs, rRNAs and yRNAs in skim milk.

[0059] Figure 3 are graphs of a coverage plots of reads aligned to source molecules from abundant RNA fractions. Shading indicates the kit: light for Truseq kits and dark for SMARTer kits. Lines represent the relative percentage of read coverage across nucleotide positions, normalized to the maximum observed alignment.

[0060] Figure 4 are graphs of sequence logos showing the identity of the sequences depicted in Fig 3 and their correspondence to SEQ ID NO 1-18.

[0061] Figure 5a is a graph showing the distribution of tRNAs, yRNAs, rRNAs and miRNAs in 7 different samples of bovine skim milk.

[0062] Figure 5b is a diagram showing the overlap of sRNAs in human breast milk and bovine milk.

[0063] Figure 6a is a graph showing the distribution of tRNAs, yRNAs, rRNAs and miRNAs in bovine milk and milk RNA-rich extracts using complementary sequencing methods.

[0064] Figure 6b is a table showing relative abundance of SEQ ID 1-18 in bovine skim milk and RNA-rich extracts.

[0065] Figure 7 are graphs comparing the amount of sRNAs in milk RNA-rich extracts (both liquid and powder form) and commercially processed milk (infant formula).

[0066] Figure 8 is a graph showing sRNAs detection in human skim milk, bovine skim milk and RNA extracts through northern blotting.Docket No. 10968-11114-PCT

[0067] Figure 9 are graphs displaying the relative levels of selected milk sRNAs in the vesicular and non-vesicular fractions of a milk RNA-rich extract, following separation by ultracentrifugation.

[0068] Figure 10 are graphs showing electrophoretic analysis of RNA cargo in RNA-Rich extracts at various stages of in-vitro digestion with selected sequence detection by northern blot assay, (a) Total RNA shown by SybrGreen staining, (b) Northern Blot analysis using specific probes

[0069] Figure 11 is a graph showing long-term stability of selected milk sRNAs in RNA-rich extracts under environmental conditions in liquid and powder forms.

[0070] Figure 12 are graphs showing no effect on cell viability over Vero cells of milk RNA- rich extracts and Synthetic RNA oligonucleotides identical to SEQ ID NO 1-13

[0071] Figures 13 are graphs showing no effect on cell viability over HEK293 cells of milk RNA-rich extracts and Synthetic RNA oligonucleotides identical to SEQ ID NO 1-13.

[0072] Figures 14 are graphs showing no effect on cell viability over THP1 cells of milk RNA- rich extracts and Synthetic RNA oligonucleotides identical to SEQ ID NO 1-13.

[0073] Figure 15 is a graph showing the effect on HaCaT cell migration after 24 h of RNA- rich extracts and milk-derived sRNA. Lower panel: representative image of the cell migration.

[0074] Figure 16 is a graph showing fibronectin production by BJ cells after treatment with RNA-rich extracts and milk-derived sRNA.

[0075] Figure 17 are graphs showing the effect of RNA-rich extracts and milk-derived sRNA over HUVEC cell proliferation with or without VEGF.

[0076] Figure 18 are graphs showing the effect of RNA-rich extracts and milk-derived sRNA over IL-ip and IL-6 production in LPS-stimulated THP1 cells.

[0077] Figure 19 are graphs depicting changes in the integrity of the Caco-2 cell barrier (evaluated by TEER measurements) following treatment with milk RNA-rich extract and milk sRNAs.

[0078] Figure 20 are graphs showing serotonin production by Rinl4B cells after the administration of either RNA ich extract or milk RNAs.

[0079] Figure 21 are graphs showing serotonin production by SH-SY5Y cells after the administration of either RNA rich extract or milk RNAs.

[0080] Figure 22 are graphs illustrating the effect of the RNA-rich extract and selected milk sRNA on the biofilm-forming capacity of Lactobacillus reuteri.Docket No. 10968-11114-PCT

[0081] Figure 23 are graphs showing lipid droplet formation in HepG2 cells, used to assess the effects of milk sRNA and RNA-rich extract on lipid accumulation in liver-derived cells.

[0082] Figure 24 are graphs showing cortisol production by adrenocortical cells cell after administration of either RNA rich extract or milk RNAs.

[0083] Figure 25 are graphs showing MTT assays of SH-SY5Y cells exposed to oxidative stress following administration of either milk RNA-rich extracts or a mix of sRNAs (SEQ. ID NO 1-13).

[0084] Figure 26 are graphs showing change in sleep parameters in volunteers taking milk RNA rich extracts (a) percentage change in deep, light and REM sleep stages post-treatment relative to pre-treatment, (b) PSQI scores and (c) GAD-7 scores.

[0085] Figure 27 are images showing the effect of a milk RNA-rich extract in promoting skin cell turnover and regeneration. Comparison of the control area (glycerol alone) and the treatment area (milk RNA-rich extract dissolved in glycerol) over time. The upper panel shows a graph of relative coloration (%) for the control and milk RNA-rich extract treatments on day 1 (baseline), day 3, and day 5. Two-way ANOVA, ** < 0.01. The lower panel displays images of the areas on (a) day 1 (baseline), (b) day 3, and (c) day 5, illustrating the progression of color fading in both the control (1) and treatment (2) areas.DETAILED DESCRIPTION

[0086] The following description recites various aspects and embodiments of the inventions disclosed herein. No particular embodiment is intended to define the scope of the invention. Rather, the embodiments provide non-limiting examples of various compositions, and methods that are included within the scope of the claimed inventions. The description is to be read from the perspective of one of ordinary skill in the art. Therefore, information that is well known to the ordinarily skilled artisan is not necessarily included.Definitions

[0087] The following terms and phrases have the meanings indicated below, unless otherwise provided herein. This disclosure may employ other terms and phrases not expressly defined herein. Such other terms and phrases shall have the meanings that they would possess within the context of this disclosure to those of ordinary skill in the art. In some instances, a term or phrase may be defined in the singular or plural. In such instances, it is understood that any term in the singular may include its plural counterpart and vice versa, unless expressly indicated to the contrary.Docket No. 10968-11114-PCT

[0088] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, reference to "a substituent" encompasses a single substituent as well as two or more substituents, and the like.

[0089] As used herein, "for example," "for instance," "such as," or "including" are meant to introduce examples that further clarify more general subject matter. Unless otherwise expressly indicated, such examples are provided only as an aid for understanding embodiments illustrated in the present disclosure and are not meant to be limiting in any fashion. Nor do these phrases indicate any kind of preference for the disclosed embodiment.

[0090] It has been established that RNA can be found outside of cells, and various types of small RNAs (sRNAs) have been identified in human circulation (Fritz et al. 2016) and may have other functions. These extracellular sRNAs (ex-sRNAs), which are typically between 18 and 200 nucleotides in length, are secreted by many different cells and are a special type of non-coding RNA (ncRNA) transcript that makes up more than 90% of the human genome (Dhamija and Menon 2018).Although ncRNA does not encode proteins, it indirectly controls a wide range of biological processes, generally by interfering with the translation of messenger RNA through RNA-RNA interactions, including cellular metabolism, development, proliferation, transcription, and post-transcriptional modification (Fritz et al. 2016).

[0091] Extracellular Fluids, including milk, are rich in various types of RNA molecules. Traditional bioinformatics analyses of sRNA sequencing data that focus on microRNAs (miRNAs) do not provide a complete picture of the sRNA content of human biofluids. In this sense, the goal of the Human Biofluid RNA Atlas of (Hulstaert et al. 2020) was to define the complete extracellular transcriptome across a wide range of human biofluids (amniotic fluid, aqueous humor, ascites, bile, bronchial lavage fluid, breast milk, cerebrospinal fluid (CSF), colostrum, gastric fluid, pancreatic cyst fluid, plasma, saliva, seminal fluid, serum, sputum, stool, synovial fluid, sweat, tear fluid and urine), using sRNA sequencing to quantify different sRNA species. It was demonstrated that it is technically feasible to generate extracellular transcriptome data from low-input biofluid samples and as a result, distribution of sRNA biotypes exhibits distinct patterns among the 20 different biofluids. A substantial proportion of these sRNAs originate from RNA polymerase I and III transcripts, transfer RNA (tRNA), yRNA, and ribosomal RNA (rRNA).

[0092] Although tRNAs are generally known as adapter molecules essential for translation, experimental evidence has led to a consensus that tRNAs are not always end products but can serve as a source of functional sRNAs (Honda et al. 2015; Shen et al. 2018). Various studies have shown that the expression of tRNA fragments is triggered by a variety of stress stimuli, such as oxidativeDocket No. 10968-11114-PCT stress, heat shock, and UV radiation (Thompson and Parker 2009; Tosar et al. 2020); however, they are also detected under non-stressed conditions (Yamasaki et al. 2009). It is important to highlight that stress stimuli accumulate tRNAs fragments not as degradation byproducts, but as functional molecules. In addition, altered levels of circulating tRNA fragments have been found to be associated with various pathologies such as cancer, neurodegenerative and infectious diseases (Anderson and Ivanov 2014; Balatti, Pekarsky, and Croce 2017; Zhang et al. 2014) and within cells tRNA fragments participate in various cellular responses, such as hypoxia, viral infection and modulation of the immune system (Tao et al. 2021; Shen et al. 2018; Dou et al. 2021). yRNA is a very conserved class of sncRNA ranging from 84 to 113 nucleotides long (Kowalski and Krude 2015). Four species of yRNA exist in humans: Yl, Y3, Y4 and Y5. These yRNA species are highly expressed in many tissues (Kohn, Pazaitis, and Huttelmaier 2013; Valkov and Das 2020; Christov, Trivier, and Krude 2008). yRNAs can be processed to yRNA fragments with distinct entities, often exhibiting modifications at the 5' end (Guglas et al. 2020). In this sense, a previous study reported abundant yRNA fragments in platelets and a potential role in their activation and function (El-Mogy et al. 2018). Also, yRNA fragments in extracellular vesicles confer cardio protection via modulation of IL-10 expression and secretion and alleviate hypertrophic cardiomyopathy in transgenic mice (Cambier et al. 2017; Huang et al. 2021). However, yRNAs and their biological functions have not been studied comprehensively and are little understood. Regarding rRNAs, while they have been extensively studied in the context of protein synthesis, they are not yet directly involved in the regulation of gene expression, and their derived fragments have typically been considered waste products. However, similarly to what has been shown for tRNA, rRNA-derived fragments may accumulate in the extracellular space and their extracellular concentration may increase in situations of abnormal cell death (Tosar et al. 2020).

[0093] To provide a comprehensive characterization of ex-sRNAs in human breast milk, sRNA sequencing was conducted on seven milk samples from healthy donors using SMARTer libraries. SMART RNA technology refers to a method for amplifying and detecting RNA targets, known as the "Simple Method for Amplifying RNA Targets" (SMART). This technology utilizes engineered single-stranded DNA (ssDNA) probes that hybridize to target RNA sequences. Three of these samples were additionally sequenced using the TRU-seq method to enhance the dataset, as multiple sources indicate that both methods provide complementary results (Tosar et al, 2024). The analysis employed a sequence-centric approach, focusing on sequences mapped to curated collections of known human sRNAs, such as tRNA, yRNA, rRNA, and miRNA. The results showed that the most abundant ex-sRNAs originated from RNA polymerase I and III transcripts, including tRNA, yRNA, and rRNA (Figure 1). However, significant biases were observed across libraries, with the tRNA fraction being more effectively detected in TRU-seq experiments. TruSeq RNA sequencing,Docket No. 10968-11114-PCT developed by Illumina, is a comprehensive solution for transcriptome analysis. TRU-seq provides a detailed view of the transcriptome, enabling the study of gene expression, alternative transcripts, and RNA variants. Interestingly, miRNA represents only a small proportion of the reads. This finding is consistent with the observations reported by Hulstaert et al., showing high levels of tRNA and rRNA in human biofluids (Hulstaert et al, 2020).

[0094] The composition of ex-sRNAs within each category were then analyzed to identify abundant transcripts and assess their consistency (Fig. 2). In the SMARTer experiments, most tRNA sequences aligned with tRNAGIu and tRNAAsp, whereas in the TRU-seq experiments, sequences predominantly aligned with tRNAGIy and tRNALys. Additionally, sequences aligning to tRNAPro, tRNAVal, and tRNAHis were overrepresented in certain samples. For rRNA, the SMARTer samples primarily contained fragments aligning with 28S and 18S rRNA, while the TRU-seq samples showed alignment with 5.8S rRNA. Nearly all yRNA-related sequences aligned with transcript 4.

[0095] To better characterize the diversity of ex-sRNAs in milk and identify consensus sequences, coverage plots were generated by aligning reads from abundant fractions to their corresponding source molecules. As shown in Figure 3, the detected molecules varied depending on the method used. For example, within the tRNA fraction, TRU-seq experiments primarily detected 5' tRNA halves, whereas SMARTer experiments predominantly captured 3' tRNA halves. Sequence logos for tRNA, rRNA, and yRNA fragments, along with the consensus sequences selected for further analysis, are displayed in Figure 3b.Milk RNA-rich extracts preserve bioactive RNAs, demonstrating long-term stability even under digestive conditions

[0096] To develop more effective milk-based products that preserve their natural RNA cargo, the feasibility of using bovine milk as a substitute for human milk was evaluated, focusing specifically on sRNA content. sRNA-seq experiments were performed on 7 samples from Holando- Argentino cows, with the bioinformatics pipeline adapted for bovine-specific sequences. The results, presented in Figure 5a, reveal an sRNA profile remarkably similar to that of human milk. Notably, both samples exhibit a high degree of sequence identity, likely reflecting the close phylogenetic relationship between the two species (Fig. 5b).

[0097] To evaluate the quality of RNA-rich extracts generated by the method described in this disclosure, the sRNA distribution between skim milk and extracts derived from the same milk samples were compared. sRNA-seq experiments were performed using both SMARTer and TruSeq library preparation protocols to capture a broader range of sequences. The findings indicate that the extracts retain a comparable sRNA distribution to the original skim milk, with a slight technical biasDocket No. 10968-11114-PCT favoring the retention of rRNAs over tRNAs (Fig. 6a). The relative abundances of SEQ ID NO 1-18 in the RNA-rich extracts are shown in Fig. 6b.

[0098] To validate these findings, selected sequences were quantified using stem-loop RT- qPCR, being able to detect all of them in RNA-rich extracts, both in liquid and powder form (Fig 7). These experiments also revealed that commercial milk products, such as infant formula, contain sRNA levels at least 100 times lower than those found in RNA-rich extracts. Additionally, Northern blot analysis was conducted on several of the selected sequences, further confirming the presence of these molecules in RNA-rich extracts (Fig. 8). To further characterize these molecules, ultracentrifugation experiments were conducted to separate vesicular and non-vesicular fractions. The results showed that these molecules are present in both fractions, with a predominance of tRNA-derived fragments in the non-vesicular fractions (Fig. 9).

[0099] For milk sRNAs to exert biological functions, they must resist the digestive process. To assess this, in vitro digestion experiments were conducted, showing that RNA in the extracts remains stable during the gastric phase but degrades upon the addition of digestive enzymes in the intestinal phase (Fig 10a). Northern blot assays indicated that degradation occurs in stages, with an initial increase in specific sRNAs observed in the first minutes (Fig 10b). This increase may facilitate their recognition and / or absorption by intestinal mucosal cells.[000100] Referring to Figure 11 which illustrates the stability of sRNAs in RNA-rich extracts over extended periods under environmental conditions. The left panels show examples of the relative stability of SEQ ID NO 1 in RNA-rich extracts compared to bovine milk after 24 hours at 37°C. Additionally, the figure presents data on the long-term stability of sRNAs in both liquid and powder RNA-rich extracts, demonstrating that RNA levels remain unchanged for up to 1 week in liquid form and up to 1 months in powder form.[000101] Milk RNA-rich extracts and chemically synthesized milk sRNAs are safe: Milk RNA- rich extracts and chemically synthesized milk sRNAs were tested across several cell lines to evaluate their safety. As shown in Figures 12, which depict the effects on cell viability in Caco-2 cells for both extracts and SEQ ID NO 1,3,5 and 6, neither the extracts nor the oligonucleotides had a significant impact on cell viability across a wide range of concentrations. Referring to Figures 13 which depict RNA-rich extracts and selected sRNA candidate effect on cell viability over HaCaT cells. Neither the extracts nor the oligonucleotides had a significant impact on cell viability across a wide range of concentrations. Referring to Figures 14, which depict RNA-rich extracts and selected sRNA candidate effect on cell viability over THP1 cells. Neither the extracts nor the oligonucleotides had a significant impact on cell viability across a wide range of concentrationsDocket No. 10968-11114-PCTMilk-derived sRNAs and RNA rich extracts modulate cell function to promote tissue regeneration[000102] Some milk-derived sRNAs enhance wound healing. Referring to Figures 15 which depict the effect of chemically synthesized oligonucleotides identical to SEQ ID NO 1, 2, 3, 4, and 7 on HaCaT cell migration after 24 h. The use of Milk RNA-rich extracts to enhance skin healing can be seen by examining their impact on wounds in keratinocyte cell cultures. Figure 15 also shows that milk RNA-rich extracts exhibited epithelial regenerative potential (more than 10%), whereas formulations from infant formula or commercial milk do not exhibit this effect. The figure also includes a representative image of cell migration.[000103] Referring to Figure 16 which shows the impact of RNA-rich extracts and selected milk-derived sRNAs on fibronectin secretion by fibroblasts, the cells responsible for producing extracellular matrix components. The data demonstrate that both the RNA-rich extract and isolated sRNAs significantly increased fibronectin secretion in BJ cells, further supporting their involvement in wound healing processes.[000104] Turning to figures 17 which illustrates the role of milk-derived sRNAs in supporting endothelial health, especially under challenging conditions such as nutritional deprivation. Vascular endothelial cells (HUVECs) were cultured in a nutrient-limited medium (0.1% FBS) with or without the addition of vascular endothelial growth factor (VEGF), an essential supplement for HUVEC culture. VEGF promotes vascular cell growth or the growth of new blood vessels, and the growth of blood vessels from the existing vasculature, also known as angiogenesis. This could come as revascularization after tissue damage. Treatment with milk sRNAs or the RNA-rich extract were shown to significantly enhance HUVEC survival compared to DNA oligonucleotides with similar sequence motifs. This effect was particularly striking, with most sRNAs promoting approximately a 100% increase in cell survival. Notably, this improvement was also observed in the presence of VEGF, suggesting that milk sRNAs help endothelial cells manage stress and act synergistically with VEGF to support cell function.Milk-derived sRNAs and RNA-rich extracts have anti-inflammatory properties[000105] Epithelial permeability facilitates fluid movement into the interstitium, a region inhabited by resident macrophages and fibroblast cells. The influence of milk sRNAs on the immune response was monitored using LPS-stimulated THP1 cells. Introducing SEQ ID NO 1 and SEQ ID NO 2 into the culture medium of activated cells substantially reduced the production of pro-inflammatory cytokines, including I LIB and IL-6 (Figures 18). A similar trend was observed when analyzing cytokine production in cells treated with SEQ ID NO 3, 4 and 5. Building on the results of the immune response of the selected milk sRNA molecules, led to the use of milk RNA-rich extracts on the sameDocket No. 10968-11114-PCT model, further demonstrating demonstrated the anti-inflammatory effect of this formulation. In contrast, formulations from infant formula or commercial milk not only lack anti-inflammatory effects in stimulated macrophages but also have the capacity to induce inflammation in quiescent cells.[000106] RNA-rich extracts and milk-derived sRNA modulate cell function to promote gut health The Caco-2 monolayer cell barrier model, derived from human colorectal adenocarcinoma cells, is frequently used to study barrier integrity and permeability in vitro, providing insights into gut epithelial function. When cultured to confluence on transwell inserts, Caco-2 cells form a tight monolayer that mimics the intestinal epithelium, allowing researchers to measure transepithelial electrical resistance (TEER), which reflects the integrity of the cell barrier. In this assay, TNF-a (tumor necrosis factor-alpha) is used to disrupt the monolayer's barrier integrity. TNF-a treatment typically leads to a reduction in TEER values, indicating an increase in paracellular permeability. This disruption results from the loosening or disassembly of tight junction proteins in the epithelial barrier, which can be observed through a decrease in TEER. Figure 19 shows that treatment of the cells with the milk RNA rich extracts and isolated sRNAs enhance TEER both under baseline conditions and during chronic TNF-a exposure.[000107] To evaluate the impact of milk RNA-rich extracts on serotonin production, enterochromaffin cells (Rinl4B cell line) were used, as these cells produce approximately 90% of the body's serotonin in the human gut. This neurotransmitter is crucial for gut health and for regulating mood and sleep-wake cycles, as it acts as a precursor to melatonin. Figure 20 shows that milk RNA- rich extracts significantly increased serotonin release in Rinl4B cells, achieving over three times the increase observed with tryptophan, a well-known inducer of serotonin production in enterochromaffin cells. This study acts as an analog of intestinal serotonin production. The same data indicates that commercial milk lacks these properties. Additional studies on specific milk- derived sRNAs further demonstrated their individual effects on serotonin production in Rinl4B cells. These results were validated in complementary studies using SH-SY5Y cells, a neuroblastoma cell line commonly used to model the enteric nervous system and also capable of producing serotonin (see Figure 21).[000108] Referring to Figure 22, which illustrates the effect of the RNA-rich extract and selected milk sRNA on the gut microbiota. Specifically, the study evaluated how these compositions influence the biofilm-forming capacity of Lactobacillus reuteri. Results show that both the extract and certain individual sRNAs can stimulate biofilm formation. This effect is linked to the protective role of these probiotics on the intestinal barrier, as biofilms contribute to the stability and resilience of the gut microbiota. Biofilms help maintain a balanced microbial environment, enhance resistanceDocket No. 10968-11114-PCT to pathogens, and support immune modulation, thereby strengthening the gut's natural defense mechanisms.[000109] Referring to Figure 23, which shows the lipid droplet formation assay in HepG2 cells used to evaluate the impact of milk sRNA and the RNA-rich extract on lipid accumulation within these liver-derived cells. Both treatments significantly decrease lipid accumulation, as evidenced by reductions in both the area and number of lipid droplets. This decrease in intracellular lipid storage suggests an improvement in liver cell function, as reduced lipid accumulation is often associated with enhanced cellular health and resilience against metabolic stress. sRNAs and RNA rich extracts modulate cell function to regulate the stress response[000110] Stress management and the regulation of cortisol levels are critical aspects of overall well-being. Cortisol, a stress hormone produced by the adrenal glands, plays a pivotal role in the body's response to stressors. Elevated cortisol levels have been linked to various health concerns, including inflammation and stress-related disorders. To assess the impact of milk RNA-rich extracts on cortisol production, a model of adrenal cells was used. An assay involving NCI-R295H cells stimulated with 10 uM forskolin, a trigger for enhanced production of cortisol, showed that both extracts and selected sRNA fragments lower cortisol production by these cells as can be seen in Figures 24. These tests act as analogs for production of cortisol from adrenocortical human cells.[000111] Referring to Figure 25, which illustrates the enhanced survival of SH-SY5Y cells exposed to oxidative stress following treatment with either milk RNA-rich extracts or a mix of sRNAs (SEQ. ID NO 1-13). These results further validate the role of these molecules in modulating the cellular stress response, indicating their potential protective effects under oxidative conditions.Milk RNA-rich are effective in signal-finding studies in human volunteers[000112] Figure 26 illustrates the results obtained on a study in human volunteers to evaluate the efficacy of milk RNA-rich extract in improving sleep quality. The study enrolled 10 healthy participants aged 30 to 50 years. Each participant was required to understand and voluntarily sign an informed consent document, adhere to the scheduled study visits, and demonstrate good health, as assessed through medical history and physical examination. This interventional trial spanned three weeks. During the first week, participants did not receive any treatment, allowing for the establishment of baseline sleep patterns. In the second and third weeks, participants took daily doses of milk RNA-rich extract capsules (0,8 mg daily dose). Throughout the study, sleep parameters were continuously monitored using actinography, ensuring accurate tracking of sleep quality and duration. Additionally, participants completed weekly questionnaires to evaluate aspects of anxiety levels, mood states, and overall quality of life, providing a comprehensive assessment of theDocket No. 10968-11114-PCT intervention's impact. The composition was well-tolerated, with no adverse effects reported, and participants expressed high levels of satisfaction with the treatment. Findings indicate that participants experienced a significative increase in REM sleep duration and improvements in their total Pittsburgh Sleep Quality Index (PSQI) scores, indicating enhanced sleep quality, as well as reductions in their Generalized Anxiety Disorder 7 (GAD-7) scores. All together, these results indicate a positive effect of milk RNA-rich extract on overall sleep quality.[000113] Figure 26 illustrates the effects of a milk RNA-rich extract in promoting skin cell turnover and regeneration. The study involved three healthy adult participants aged 35-50, all without known skin conditions. Skin cell renewal was tracked by documenting the fading of skin color, induced by a 7.5% DHA (dihydroxyacetone) lotion, through regular photographic assessments. Additionally, the safety profile of the extract was evaluated by monitoring for potential skin irritation or adverse reactions from its topical application. Analysis of the color-fading kinetics and skin responses demonstrated that the milk RNA-rich extract accelerates natural skin turnover without adverse effects.[000114] The milk RNA-rich extracts have been shown to be beneficial in various aspects of health and healing. The milk RNA-rich extracts are administered to a subject in any of a variety of ways. As the milk RNA-rich extracts are found in both human milk and bovine milk, an especially effective method of administration is to administer the milk RNA-rich extracts orally through the alimentary tract. In this way it is beneficial to formulate the milk RNA-rich extracts into a food, drink, dietary supplement, food supplement, or food additive. Methods for incorporating vitamins and nutrients into food, drink, dietary supplements, food supplements, or food additives are well known and any of these methods can be used to incorporate the milk RNA-rich extracts into these sources. In some embodiments, the food, drink, dietary supplement, food supplement, or food additive is formulated in a tablet form or a pill form. This provides for easy administration by individuals. Additionally, in many instances it is more convenient to prescribe or administer a tablet or pill. In some embodiments, the tablet or pill comprises an enteric coat. Enteric coats are well known and aid in keeping the composition from being released too quickly. In some embodiments, the food, drink, dietary supplement, food supplement, or food additive is formulated in a liquid form, a solid form, a powder form, a dispersion form, or a suspension form. Each of these forms is beneficial for different applications and enables a variety of administration methods. In some embodiments one or more sweeteners, stabilizers, binders, humectants, natural flavors, artificial flavors, natural colors, artificial colors, natural preservatives, artificial preservatives, or a combination thereof, are used to aid in taking the composition of milk RNA-rich extracts. In embodiments, where the composition of milk RNA-rich extracts is an additive in food, drink, dietary supplement, or a food additive, the food,Docket No. 10968-11114-PCT drink, dietary supplement, food supplement, or food additive comprises a monosaccharide, disaccharide, polysaccharide, sucrose, dextrose, maltose, dextrin, xylose, ribose, mannose, galactose, sucromalt, fructose (levulose), invert sugar, corn syrup, maltodextrin, fructooligosaccharide syrup, partially hydrolyzed starch, corn syrup solids, polydextrose, soluble fiber, insoluble fiber, natural cane juice, gelatin, citric acid, lactic acid, natural colors, natural flavors, fractionated coconut oil, carnauba wax, or a combination thereof.[000115] The milk RNA-rich extracts have been shown to be beneficial in various aspects of health and healing for uses outside of oral administration. The milk RNA-rich extracts are administered to a subject for treating any number of topical maladies.Experimental Procedure[000116] Bioinformatic Analysis: sRNA-seq data was processed using a custom pipeline built in Python (version). Fastq files corresponding to the dataset were downloaded from the European Genome-Phenome Archive (EGA) with permission from the corresponding authors. Files were quality-controlled following procedures. Briefly, sequencing adapters were trimmed using cutadapt and trimmgalore. Known contaminants were filtered out using bowtie2 (Langmead and Salzberg 2012) on the '--very-sensitive-local' preset with the UNIVEC database and FASTQC (Thrash, Arick, and Peterson 2018) was used for quality control. All sequences were then loaded to a MongoDB database (https: / / mongodb.com / ) from where further analysis took place. Sequences were first aligned to a series of reference datasets which included human tRNA (gtRNAdb (Chan and Lowe 2016)), rRNA (rFAM (Kalvari et al. 2021), RNA central), miRNA mirBASE (Kozomara, Birgaoanu, and Griffiths-Jones 2019)) and yRNA sequences among others, using bowtie2. All remaining unknown sequences were then aligned to the human genome (GRCh38) using HISAT2 (Kim et al. 2019).Sequences were assigned using the corresponding feature file (GFF) using bedtools. All statistics and visualizations related to sRNA-seq data were built by querying the database, building dataframes in Pandas and visualizing with Plotly. Sequence coverage and secondary structure graphs were constructed using bowtie2, Samtools (Danecek et al. 2021) and VARNA (Darty, Denise, and Ponty 2009). The Python modules pysamtools, pybedtools, pysamtools and varnapi were used. Pymongo and mongoengine were used to connect to the mongodb database.[000117] Cell culture: HaCaT cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 units / ml penicillin and streptomycin (Invitrogen). BJ cells were cultured in DMEM low glucose supplemented with non- essential amino acids (NEAA), 10% FBS and 100 units / ml penicillin and streptomycin (Invitrogen). THP1 cells were cultured in RPMI 1640 medium supplemented with 10% FBS and 100 units / mlDocket No. 10968-11114-PCT penicillin and streptomycin (Invitrogen). HUVEC cells were cultured in RPMI 1640 medium supplemented with 15% FBS, 10 ng / ml VEGF (293-VE-010, R&D system) and 100 units / ml penicillin and streptomycin (Invitrogen). Cell lines were purchased from ATCC, and authenticity was documented by STR analysis. Cells were cultured in a humidified incubator at 37 °C with 5% CO2 and tested periodically for mycoplasma by 4,6-diamidino-2-phenylindole staining and PCR.[000118] SRNA treatments and quantification: Synthetic RNA oligonucleotides were designed based on the most abundant sequence of the biofluid database and were purchased from Integrated DNA Technologies (IDT).[000119] RNA extraction from samples was performed using Trizol (Invitrogen, Thermo Fisher Scientific) according to manufacturer's instructions. sRNA levels were determined by stem-loop qRT- PCR as previously described (Spinelli et al. 2017). cDNA was synthesized using Superscript III reverse transcriptase (Thermo Fisher Scientific, MA, USA) and SLO specific primers (Thermo Fisher Scientific— Supplementary Table 2). PCR reactions were performed in a StepOne Real-Time PCR System (Thermo Fisher Scientific, MA, USA) using HOT FIREpol EvaGreen Plus master mix (Solys Biodyne, Estonia) and specific forward and universal reverse primers (Thermo Fisher Scientific).[000120] Transcript Name Primers[000121] SEQ ID NO 1 SLO[000122] 5'-GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCGCGAGA-3'[000123] Forward 5'-GGCGGAGCATTGGTGGTTCAGTGGTAGAAT-3'[000124] SEQ ID NO 4 SLO[000125] 5'-GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACGGCGAA-3'[000126] Forward 5'-GGGTTTCCGTAGTGTAGTGGTTATCACG-3'[000127] SEQ ID NO 2 SLO[000128] 5'GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCGTGCCG-3'[000129] Forward 5'-GGCGGTCCCTGGTGGTCTAGTGGTTAGGATT-3'[000130] SEQ ID NO 5 SLO[000131] 5'-GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCGTCTCA-3'[000132] Forward 5'-GGCGGGCCCGGCTAGCTCAGTCGGTAGAGCA-3'[000133] SEQ ID NO 3 SLODocket No. 10968-11114-PCT[000134] 5'-GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACAGTTCTG-3'[000135] Forward 5'-GGCTGGTCCGATGGTAGTGGG-3'[000136] SEQ ID NO 6 SLO[000137] 5'-GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCAGCGG-3'[000138] Forward 5'-CGCGACCTCAGATCAGACG-3'[000139] SEQ ID NO 7 SLO[000140] 5'-GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACACGCAC-3'[000141] Forward 5'-GACTCTTAGCGGTGGATCAC-3'[000142] SEQ. ID NO 8 SLO[000143] 5'- GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCAGCGA -3'[000144] Forward 5'- CCGGGGCTACGCCTGTCTGAG -3'[000145] SEQ ID NO 9 SLO[000146] 5'- GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCAAACC -3'[000147] Forward 5'- GCTGCGATCTATTGAAAGTCAGCC -3'[000148] SEQ ID NO 10 SLO[000149] 5'- GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCCTCTA -3'[000150] Forward 5'- GCTGAGAAGACGGTCGAACTTG -3'[000151] SEQ ID NO 11 SLO[000152] 5'- GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCCGGAA -3'[000153] Forward 5'- CATGACCCGCCGGGCAGCTT -3'[000154] SEQ ID NO 12 SLO[000155] 5'- GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCCCTGA -3'[000156] Forward 5'- CGGGTTCGTTTCCCGGTCAG -3'[000157] SEQ ID NO 13 SLO[000158] 5'- GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACGCGACC -3'[000159] Forward 5'- GGGGATTGTGGGTTCGTGTC -3'[000160] SEQ ID NO 15 SLODocket No. 10968-11114-PCT[000161] GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACGGGCTC[000162] Forward TGCGAGAGGTCCCGGGTTC[000163] SEQ ID NO 18 SLO[000164] 5'- GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCTCCCC -3'[000165] Forward 5'- GAACCCCGGTCTCCCGCGTG -3'[000166] Universal Reverse 5'-TGGTGCAGGGTCCGAGGTATT-3'[000167]

[93000] Northern blotting; RNA samples were run on 10% TBE-urea polyacrylamide gels, transferred to positively charged nylon membranes (Roche). The membranes were cross-linked by UV irradiation. After cross-linking, the membranes were hybridized overnight at 40°C with digoxigenin (DIG)-labeled DNA probes in DIG Easy Hyb solution (Roche). After low stringency washes (washing twice with 2x SSC / 0.1% SDS at room temperature) and a high stringency wash (lx SSC / 0.1% SDS at 40sC), the membranes were blocked in blocking reagent (Roche) for 30 min at room temperature, probed with alkaline phosphatase-labeled anti-digoxigenin antibody (Roche) for 30 min, and washed with lx TBS-T. Signals were visualized with CDP-Star ready-to-use (Roche) and detected using Amersham Imager 600 (GE Healthcare) according to the manufacturer's instructions. Oligonucleotide probes were synthesized by IDT. DIG-labeled probes were prepared using the DIG Oligonucleotide tailing kit (2nd generation; Roche) according to the manufacturer's instructions.[000168] Toxicity assay: Cell viability was analyzed using the MTT assay. Briefly, 24 h prior to treatment, cells were seeded in 96-well plates at a density of 5 x 103, 7 x 103 or 10 x 103 cells per well depending on cell line. The small RNAs were dissolved in medium 0,1 % FBS at 1 uM and then diluted in serial dilutions in medium 0,1 % FBS to achieve the final concentration for the different treatments (1 nM, 1 pM and 1 fM). Milk RNA-rich extract were dissolved in medium 0,1 % FBS at 1 / 10 and then diluted in serial dilutions in medium 0,1 % FBS to achieve the final concentration for the different treatments (1 / 100 and 1 / 1000). As controls, cells were incubated with medium 0,1 % FBS. After 24 h of treatment, cells were stained with 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H- tetrazolium bromide (MTT) (0.5 mg / mL; Sigma) for 4 h at 37 °C. After the removal of the culture medium, formazan crystals were dissolved in DMSO, and the absorbance was measured at 570 nm using a microplate reader.[000169] HUVEC survival assay: HUVEC cell viability was analyzed using the MTT assay. Briefly, 24 h prior to treatment, cells were seeded in 96-well plates at a density of 7 x 103 cells per well. sRNAs were dissolved at 100 nM or milk RNA-rich extract (1 / 100) in RPMI 0,1 % FBS or in RPMI 0,1 %Docket No. 10968-11114-PCTFBS plus 10 ng / ul VEGF. As controls, cells were incubated with RPMI 0,1 % FBS or RPMI 0,1 % FBS plus 20 ng / ul VEGF. After 24 h of treatment, cells were stained with 3-(4,5-dimethyl-2-thiazolyl)-2,5- diphenyl-2H-tetrazolium bromide (MTT) (0.5 mg / mL; Sigma) for 4 h at 37 °C. After the removal of the culture medium, formazan crystals were dissolved in DMSO, and the absorbance was measured at 570 nm using a microplate reader.[000170] Wound healing assay: HaCaT cells were plated at high density and the following day a scratch was mechanically performed. After scratching, the medium was changed by 100 nM sRNA in DMEM 0,1 % FBS, milk RNA-rich extract (1 / 100) or DMEM 0,1 % FBS as control. Wound closure was monitored and imaged at different timepoints by inverted microscopy.[000171] ECM components by ELISA: BJ cells were plated and the following day the medium was changed by 100 nM small RNAs or milk RNA-rich extract (1 / 100) in DMEM low glucose 0,1 % FBS or DMEM low glucose 0,1 % FBS as control. After 24 h of treatment, the culture medium was collected and centrifuged at 16,000g. Supernatant was stored at -80 C. Fibronectin level was determined using Human Fibronectin Colorimetric ELISA Kit (NBP1-83737, Novus Biologicals) according to the manufacturer's instructions.[000172] THP1 assay: THP-1 cell line was grown in suspension cultures in RPMI 1640 medium supplemented with 10% FBS and 100 units / ml penicillin and streptomycin (Invitrogen) at 37 °C in 5% CO2. For differentiation to macrophages, cells were plated in 12-well dishes (1x106 cells per well) on RPMI containing 10 ng / ml phorbol-12- myristate-13-acetate (PM A, Sigma Chemical Co). After 24 h, supernatants were removed and complete RPMI was added for 48h before treatment. Macrophages were then cultured in: 1. RPMI 0,1 % FBS, 2. RPMI 0,1 % FBS plus LPS (100 ng / ml, Sigma Chemical Co.), 3. 100 nM sRNA or milk RNA-rich extract (l / 100)or milk RNA-rich extract (1 / 100) in RPMI 0,1 % FBS plus LPS (100 ng / ml, Sigma Chemical Co.) for 24 hrs at 37 C in 5% CO2. After 24 hrs of treatment, the culture medium was collected and centrifuged at 16,000g. Supernatant was stored at -80 C (Spinelli et al. 2017). Cytokine level was determined using ELISA IL-6 kit (PH555220, BioSystem) and ELISA IL-1 B kit (PH557953, BioSystem) according to the manufacturer instructions.[000173] Cortisol levels assay: the assay utilizes NCI-R295H cells stimulated with forskolin (10 uM), which increases cortisol levels by activating adenylate cyclase (Cobb et al., 1996), given the inherently low basal levels, facilitating the study of cortisol production dynamics. NCI-H295R cells were plated and the following day the medium was changed by 100 nM small RNAs or milk RNA-rich extract (1 / 100) in DMEM-F-12K 0,1 % FBS / 10 uM forskolin, DMEM-F-12K 0,1 % FBS / 10 uM forskolin or DMEM-F-12K 0,1 % FBS as control. After 24 h of treatment, the culture medium was collected and centrifuged at 16,000g. Supernatant was stored at -80 C. Cortisol production was analyzed byDocket No. 10968-11114-PCT measuring its concentration in culture medium using a Chemiluminescent Enzyme Immunoassay Cortisol ELISA RUO (EIA1887R, Drg International Inc) according to the manufacturer instructions.[000174] Serotonin levels assay: Rinl4B or SHSY5Y cells were plated in DMEM with 10% FBS and, and the following day the medium was changed by 100 nM small RNAs or milk RNA-rich extract (1 / 100) in DMEM with 0.1% FBS. Following 24 hours of treatment, the culture medium was collected and centrifuged at 16,000g to remove cell debris, and supernatant was stored at -80°C. Serotonin concentration in the medium was measured using the Rocky Mountain Diagnostics Serotonin Research ELISA Kit (NC2022260) per manufacturer instructions.[000175] Caco-2 epithelial cell monolayers assay: Caco-2 cells were seeded at a density of 120,000 cells per well on permeable supports (6.5 mm diameter, 0.4 pm pore size, Corning) in 24- well plates and maintained in DMEM medium with 10% FBS, NEAA, NaPyr, penicillin, and streptomycin. Cells were cultured for 15 days to allow monolayer formation and differentiation. Following this period, monolayers were treated with TNF-a (0.2 pg / ml) on the basolateral side as a pro-inflammatory agent, while either synthetic RNA (100 nM) or a 1:100 dilution of milk RNA-rich extract was applied apically. Treatments were sustained for 5 days, with daily trans-epithelial electrical resistance (TEER) measurements to monitor barrier integrity. Apical and basolateral supernatants were collected daily to quantify IL-8 cytokine levels using ELISA.[000176] Oxidative stress assay in SH-SY5Y cells: SH-SY5Y cells were seeded at a density of 7,000 cells per well in 96-well plates and incubated for 24 hours in growth conditions to allow for initial cell adherence. Following this period, cells were treated with hydrogen peroxide (H2O2) at a final concentration of 25 pM to induce oxidative stress. Concurrently, wells were treated with either a synthetic RNA mix (100 nM), milk RNA-rich extract, or commercial milk (1:100 dilution), with untreated and only H2O2-treated wells serving as controls.[000177] Lipid droplet assay: HepG2 cells were plated in DMEM low glucose with 10% FBS, and the following day the medium was changed by 100 nM small RNAs or milk RNA-rich extract (1 / 100) in DMEM with 0.1% FBS. Following a 24-hour exposure, lipid droplets were stained with Oil Red O to bind neutral lipids, and intracellular lipid accumulation was visualized and quantified using fluorescent confocal microscopy. This approach allowed us to assess changes in LD number and size (area).[000178] Biofilm formation: Biofilm formation by Lactobacillus reuteri was performed by a crystal violet-stained microplate assay. In this quantitative assay, the adherence of bacteria to smooth surfaces was evaluated by measuring the optical densities of stained bacterial filmsDocket No. 10968-11114-PCT adherent to the floors of plastic tissue culture plates. The optical densities correlated with the biomass of the adherent bacterial film.[000179] Statistical Analysis: Data are expressed as the mean ± s.e.m. and are representative of at least three experiments. Results were analyzed using Student's T-test on two experimental groups, ANOVA on three or more experimental groups and Two Way ANOVA for two different categorical independent variables on one continuous dependent variable. In all cases, p values lower than 0.05 were considered statistically significant.[000180] The invention has been described with reference to various specific and preferred embodiments and techniques. Nevertheless, it is understood that many variations and modifications may be made while remaining within the spirit and scope of the invention.

Claims

Docket No. 10968-11114-PCTWHAT IS CLAIMED IS:

1. A composition comprising one or more RNAs at least 95% identical to an RNA selected from the group consisting of SEQ ID NOs 1-18.

2. A composition comprising one or more RNAs at least 100% identical to an RNA selected from the group consisting of SEQ ID NOs 1-18.

3. The composition of claim 1, wherein the one or more RNAs comprises two or more of the RNAs.

4. The composition of claim 1, wherein the one or more RNAs comprises three or more of the RNAs.

5. The composition of claim 1, wherein the one or more RNAs comprises four or more of the RNAs.

6. The composition of claim 1, wherein the one or more RNAs comprises five or more of the RNAs.

7. The composition of claim 1, wherein the one or more RNAs comprises six or more of the RNAs.

8. The composition of claim 1, wherein the one or more RNAs comprises seven or more of the RNAs.

9. The composition of any one of claims 1-8, wherein the composition comprises SEQ ID NOs 1-18.

10. The composition of any one of claims 1-9, wherein the RNA is isolated and / or purified.

11. The composition of any one of claims 1-10, wherein the RNA is lyophilized.

12. The composition of any one of claims 1-11, wherein the composition comprises the RNA at a concentration between about 0.5 ug / l and about 1.5 mg / l .

13. The composition of any one of claims 1-12, wherein the composition comprises the RNA at a concentration of about 0.05 % weight to weight.

14. The composition of any one of claims 1-13. wherein the composition has a pH of 6 or less.Docket No. 10968-11114-PCT15. The composition of claim 14, wherein the pH is between 4 and 5.

16. The composition of claim 1, further comprising a promoter of angiogenesis.

17. The composition of any one of claims 1-16, wherein the composition is a food, drink, dietary supplement, food supplement, or food additive.

18. The composition of claim 17, wherein the food, drink, dietary supplement, food supplement, or food additive is formulated in a tablet form or a pill form.

19. The composition of claim 18, wherein the tablet or pill comprises an enteric coat.

20. The composition of claim 17, wherein the food, drink, dietary supplement, food supplement, or food additive is formulated in a liquid form, a solid form, a powder form, a dispersion form, or a suspension form.

21. The composition of any one of claims 17-20, wherein the food, drink, dietary supplement, food supplement, or food additive comprises one or more sweeteners, stabilizers, binders, humectants, natural flavors, artificial flavors, natural colors, artificial colors, natural preservatives, artificial preservatives, or a combination thereof.

22. The composition of any one of claims 17-21, wherein the food, drink, dietary supplement, food supplement, or food additive comprises a monosaccharide, disaccharide, polysaccharide, sucrose, dextrose, maltose, dextrin, xylose, ribose, mannose, galactose, sucromalt, fructose (levulose), invert sugar, corn syrup, maltodextrin, fructooligosaccharide syrup, partially hydrolyzed starch, corn syrup solids, polydextrose, soluble fiber, insoluble fiber, natural cane juice, gelatin, citric acid, lactic acid, natural colors, natural flavors, fractionated coconut oil, carnauba wax, or a combination thereof.

23. A method of promoting vascular cell growth or re-vascularization, the method comprising administering to the vascular cells the composition of any one of claims 1-22.

24. The method according to claim 23, the method further comprising administering to a subject as a promoter of angiogenesis.Docket No. 10968-11114-PCT25. The method according to claim 24, wherein the promoter of angiogenesis is Vascular Endothelial Growth Factor.

26. A method of promoting wound healing, the method comprising administering to a wound the composition of any one of claims 1-22.

27. The method according to claim 26, wherein the composition is applied to a wound of a subject.

28. A method of reducing inflammation in a subject, the method comprising administering to the subject the composition of any one of claims 1-22.

29. The method according to claim 28, where the composition is administered to a site of the inflammation.

30. A method for modulating intestinal function in a subject, the method comprising administering to the subject the composition of any one of claims 1-22.

31. A method for modulating intestinal serotonin levels and physiological parameters associated with sleep in a subject, comprising administering to the subject the composition of any one of claims 1-22.