Heritable immunization for disease control
By embedding heritable antibodies in the germline of reservoir species, the method addresses the inefficiencies of repeated administration in conventional vaccination, achieving long-term resistance to infectious diseases like Lyme disease across generations.
Patent Information
- Application Number
- PCT/US2025/059924
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-17
- Filing Date
- 2025-12-16
- Publication Date
- 2026-06-25
AI Technical Summary
Current methods for preventing infectious diseases, such as Lyme disease, in rodent reservoirs require repeated administration and are inefficient and costly, lacking a practical solution for long-term protection across generations.
Inserting a sequence encoding a heritable antibody or its functional fragment into a preselected gene locus in a subject, allowing for the expression of heritable immunity, which confers resistance to infectious diseases, including vector-borne diseases, in both the subject and its descendants by embedding immune protection directly into the germline.
This approach provides continuous, systemic protection against pathogens across multiple generations, effectively disrupting disease transmission cycles by ensuring resistance is inherited and maintained in reservoir species.
Smart Images

Figure US2025059924_25062026_PF_FP_ABST
Abstract
Description
[0001] MML-082W001
[0002] HERITABLE IMMUNIZATION FOR DISEASE CONTROL
[0003] Government Support
[0004] This invention was made with government support under TB160101 W81XWH-17-1- 0669 awarded by the DOD’s Congressionally Directed Medical Research and R01 Al 152209 awarded by the National Institutes of Health. The government has certain rights in the invention.
[0005] Related Applications
[0006] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional application serial number 63 / 735,233 filed December 17, 2024, the disclosure of which is incorporated by reference herein in its entirety.
[0007] Field of the Invention
[0008] The invention relates, in part, to heritable immunization and a model for disease control.
[0009] Background
[0010] Rodents play a key role in the transmission of Lyme disease, and as a result many prior prevention strategies have attempted to target these hosts to disrupt the transmission cycle. For example, "tick control tubes" containing permethrin-treated cotton, used by mice for nesting, have been deployed to reduce tick populations and interrupt transmission (Deblinger, R.D. & Rimmer, D.W. Med. Entomol. 28, 708-711 1991; Stafford, K.C. Med. Entomol. 28, 611-617 1991). Several other strategies involving rodent reservoirs target Borrelia through the major outer surface protein A (OspA), a key protective antigen expressed by B. burgdorferi sensu lato (s.l .). Immunization with OspA induces an antibody response that provides protection by a unique mode of action: antibody ingested by an infecting tick is thought to incapacitate or destroy bacterial spirochetes prior to their attaining infectivity, thereby preventing transmission (Fikrig E. et al., Proc. Natl. Acad. Sci. U.S.A. 89, 5418-5421 1992). Parenteral immunization of wild white-footed mice with an OspA subunit vaccine in field studies demonstrated a reduction in the prevalence of infected ticks (Tsao, J. L. et al., Proc. Natl. Acad. Sci. U.S.A. 101, 18159-18164 2004). Oral vaccination with rOspA induces a protective response in mouse models (Fikrig, E. et al., Infect. Dis. 164, 1224-1227 1991) and a commercially available baited rOspA vaccine has been field tested
[0011] 1
[0012] #18756472vl MML-082W001 and may be effective in reducing B. burgdorferi transmission in wild mice (Richer, L. M., et al., Infect. Dis. 209, 1972-1980 2014). Conventional vaccination and other methods described above have been used to combat infectious diseases, but require repeated administration to each generation. Currently available methods are inefficient, costly, and impractical in many circumstances.
[0013] Summary of Aspects of the Invention
[0014] According to an aspect of the invention, a method of preparing a subject including heritable immunity to an infectious disease, the method including: (a) inserting a sequence encoding at least one independently selected heritable antibody or a functional fragment thereof at a preselected first target gene locus in the subject; and (b) expressing in the subject the encoded at least one heritable antibody or the functional fragment thereof, thereby producing in the subject resistance to the infectious disease, wherein breeding the subject with the produced resistance results in resistance to the infectious disease in one or more descendants of the subject. In some embodiments, the infectious disease is a vector-borne disease. In some embodiments, the at least one is one or a plurality including 2, 3, 4, 5, 6, or more. In certain embodiments, the infectious disease is viral disease, a bacterial disease, a fungal disease, or a parasitic disease. In certain embodiments, the infectious disease is an infectious disease for which rodents are a primary disease reservoir for the infectious disease. In some embodiments, the infectious disease is Lyme disease, a hantavirus disease, leptospirosis, Lassa fever, Lymphocytic choriomeningitis virus, South American hemorrhagic fever, Plague (Yersinia pestis), tick-borne encephalitis, Rat-bite fever (Streptobacillus moniliformis, Spirillum minus), Hard tick relapsing fever (Borrelia miyamotoi disease), Babesiosis, Ehrlichiosis, Anaplasmosis, or Powassan virus disease. In some embodiments, the hantavirus disease is Sin Nombre virus, Seoul virus, or Puumala virus. In some embodiments, the South American hemorrhagic fever virus is Junin virus, Machupo virus Guanarito virus, or Sabia virus. In certain embodiments, the preselected first target gene locus includes a Rosa26 locus, an Apoal locus, or an albumin locus. In certain embodiments, the preselected first target gene locus includes an Alpha- 1 antitrypsin locus or an Ornithine Transcarbamylase (OTC) locus. In some embodiments, the expressed heritable antibody or the expressed functional fragment thereof is fused to a protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof. In certain embodiments, the protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof is albumin or Fc domain. In some embodiments,
[0015] 2
[0016] #18756472vl MML-082W001 inserting the sequence encoding the heritable antibody or functional fragment thereof includes administering an expression cassette and CRISPR components to the subject. In certain embodiments, the CRISPR components include guide sequences and a DNA endonuclease, optionally wherein the DNA endonuclease includes a Cas9 sequence, and optionally wherein the Cas9 sequence includes a ScCas9 sequence or a SpCas9 sequence. In some embodiments, the administering to the subject occurs when the subject is an embryo, optionally using pronuclear injection. In some embodiments, the expression cassette includes a sequence encoding the heritable antibody or functional fragment thereof. In certain embodiments, the heritable functional fragment of the heritable antibody includes a singlechain variable fragment (scFv) of the heritable antibody. In some embodiments, the heritable functional fragment of the heritable antibody includes a light chain of the heritable antibody or a functional fragment thereof. In some embodiments, the heritable functional fragment of the heritable antibody includes a heavy chain of the heritable antibody or a functional fragment thereof. In certain embodiments, the expression cassette further includes a promoter and a preselected leader sequence. In some embodiments, the promoter includes an enhancer element. In some embodiments, the promoter does not include an enhancer element. In some embodiments, the inserted sequence includes a plurality of heritable antibodies or functional fragments thereof and the expression cassette includes a first promoter that drives expression of at least one of the plurality of heritable antibodies and a second promoter that drives expression of at least one different antibody of the plurality of antibodies. In certain embodiments, the inserted sequence includes sequences encoding a plurality of heritable antibodies or functional fragments thereof and the expression cassette includes a plurality of promoters that each drive expression of a different one of the plurality of heritable antibodies. In some embodiments, the inserted sequence encodes a plurality of heritable antibodies or functional fragments thereof, wherein the inserted sequence encodes a 2A peptide or IRES between each of the encoded heritable antibodies or functional fragments thereof. In certain embodiments, the inserted sequences include at least one multiformat heritable antibody or functional fragment thereof. In some embodiments, the preselected leader sequence is selected to direct the expressed heritable antibody or functional fragment thereof to the bloodstream of the subject after the subject’s birth. In some embodiments, the subject is a vertebrate or an invertebrate. In certain embodiments, the invertebrate is an insect, optionally a mosquito. In some embodiments, the subject is a mammal, optionally a rodent. In some embodiments, the subject is a member of the genus Peromyscus. In some embodiments, the vertebrate is a bird. In some embodiments, the antibody includes an OspA-targeting antibody.
[0017] 3
[0018] #18756472vl MML-082W001
[0019] In certain embodiments, the antibody includes an anti-Leptospira antibody, an anti-Lassa fever virus antibody, an anti-Y. pestis antibody, an anti-Hantavirus antibody, an anti-Tick- borne encephalitis antibody, an anti-Borrelia miyamotoi antibody, an anti-Babesia antibody, an anti-Powassan virus antibody, or an anti-Lymphocytic choriomeningitis virus antibody. In some embodiments, increasing resistance to the infectious disease includes a reducing a level risk of the subject contracting the disease compared to a control level of risk, optionally, wherein the control level of risk includes a level of risk in a subject not including the heritable immunity to the infectious disease. In some embodiments, increasing resistance of the infectious disease includes reducing severity of the infectious disease in the subject compared to a control severity of the infectious disease, optionally wherein the control severity includes severity of the infectious disease in a subject not including the heritable immunity to the infectious disease. In certain embodiments, the method also includes determining in at least a portion of the descendants of the subject, the presence of expression of the heritable antibody or the functional fragment thereof. In certain embodiments, the antibody is a recombinant antibody. In certain embodiments, the method also includes (a) inserting a sequence encoding at least one additional independently selected heritable antibody or a functional fragment thereof at a second preselected target gene locus in the subject; and (b) expressing in the subject the at least one additional independently selected heritable antibody or the functional fragment thereof encoded by the inserted sequence, thereby producing in the subject resistance to the infectious disease, wherein breeding the subject with the produced resistance results in resistance to the infectious disease in one or more descendants of the subject. In some embodiments, the sequence inserted at the second preselected target gene locus is different from the sequence inserted at the first preselected target gene locus. In some embodiments, the level of transmission of the infectious disease by the subject and the subject’s descendants is reduced compared to a control level of transmission, optionally wherein the control level of transmission includes the level of transmission of the infectious disease by a subject not including the heritable immunity to the infectious disease.
[0020] According to another aspect of the invention, a model subject is provided, the model subject including heritable immunity to an infectious disease, the model subject including: at least one heritable antibody or a functional fragment thereof that is an expression product of an independently selected sequence inserted at a preselected first target gene locus in the subject, wherein the at least one heritable antibody or functional fragment thereof produces resistance to the infectious disease in the model subject. In certain embodiments, one or more
[0021] 4
[0022] #18756472vl MML-082W001 descendants of the model subject are resistant to the infectious disease. In some embodiments, the resistance includes a reduced level risk of contracting the infectious disease and / or a reduced severity of the infectious disease compared to a control level of risk and / or a control severity, respectively. In some embodiments, the control level of risk includes the level of risk of the infectious disease in a subject not including the heritable immunity to the infectious disease. In certain embodiments, the control severity includes the severity of the infectious disease in a subject not including the heritable immunity to the infectious disease. In some embodiments, the infectious disease is a vector-borne disease. In certain embodiments, the infectious disease is viral disease, a bacterial disease, a fungal disease, or a parasitic disease. In certain embodiments, the infectious disease is Lyme disease, a hantavirus disease, leptospirosis, or Lassa fever. In some embodiments, the preselected first target gene locus includes a Rosa26 locus. In some embodiments, the heritable antibody or the functional fragment thereof is expressed from an expression cassette. In certain embodiments, the expressed the heritable antibody or the functional fragment thereof is fused to a protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof. In certain embodiments, the protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof is albumin. In some embodiments, the model subject also includes CRISPR components including a plurality of guide sequences and a DNA endonuclease, optionally wherein the DNA endonuclease includes a Cas9 sequence, and optionally wherein the Cas9 sequence includes a ScCas9 sequence or a SpCas9 sequence. In some embodiments, the heritable functional fragment of the heritable antibody includes a single-chain variable fragment (scFv) of the heritable antibody. In certain embodiments, the heritable functional fragment of the heritable antibody includes a light chain of the heritable antibody or a functional fragment thereof. In certain embodiments, the heritable functional fragment of the heritable antibody includes a heavy chain of the heritable antibody or a functional fragment thereof. In some embodiments, the expression cassette further includes a promoter and a preselected leader sequence. In some embodiments, the preselected leader sequence is selected to direct the expressed heritable antibody or functional fragment thereof to the bloodstream of the subject after the subject’s birth. In some embodiments, the subject is a vertebrate or an invertebrate. In certain embodiments, the invertebrate is a mosquito. In some embodiments, the vertebrate is a mammal, optionally a rodent. In some embodiments, the vertebrate is a bird. In certain embodiments, the antibody includes an OspA-targeting antibody. In some embodiments, increasing resistance to the infectious disease includes a reducing a level risk of the subject contracting the disease
[0023] 5
[0024] #18756472vl MML-082W001 compared to a control level of risk, optionally, wherein the control level of risk includes the level of risk in a subject not including the heritable immunity to the infectious disease. In some embodiments, increasing resistance of the infectious disease includes reducing severity of the infectious disease in the subject compared to a control severity of the infectious disease, optionally wherein the control severity includes severity of the infectious disease in a subject not including the heritable immunity to the infectious disease. In some embodiments, at least a portion of descendants of the model subject also include the heritable immunity. In certain embodiments, the model subject is in captivity. In some embodiments, the model subject is released into the wild. In some embodiments, the model subject is in the wild. In certain embodiments, the antibody is a recombinant antibody. In some embodiments, the model subject also includes at least one additional independently selected heritable antibody or a functional fragment thereof that is an expression product of an independently selected sequence inserted at a preselected second target gene locus in the subject, wherein the at least one additional independently selected heritable antibody or functional fragment thereof produces resistance to the infectious disease in the model subject. In some embodiments, the sequence inserted at the second target gene locus is different from the sequence inserted at the first target gene locus. In certain embodiments, the model subject and at least a portion of descendants of the model subject have a reduced level of transmission of the infectious disease compared to a control level of transmission, optionally wherein the control level of transmission includes the level of transmission of the infectious disease by a subject not including the heritable immunity to the infectious disease.
[0025] According to yet another aspect of the invention, a method of reducing an infectious disease in a population of organisms is provided, the method including releasing a model subject of any one of claims of the aforementioned embodiments of the model subject, into a population of the organisms. In certain embodiments, the population of the organisms is in captivity. In certain embodiments, the population of the organisms is in the wild. In some embodiments, at least a portion of descendants of the released model subject include heritable immunity to the infectious disease.
[0026] Brief Description of the Drawings
[0027] Figure 1 A-I provides diagrams, graphs, and a table showing results of optimization and validation of LA-2 antibody expression in Hepa 1-6 cells. Fig. 1A is a schematic representation of the CRISPR-modified Hepa 1-6 cell lines used for testing albumin expression machinery, incorporating the minimal albumin promoter with and without the
[0028] 6
[0029] #18756472vl MML-082W001 albumin enhancer. Fig. IB is a graph of results from RT-qPCR analysis showing relative mRNA levels of tdTomato and albumin in Hepa 1-6 cells transfected with the constructs described in Fig. 1 A. Fig. 1C shows leader sequences evaluated for their ability to direct LA- 2 antibody secretion, including sequences from mouse albumin (SEQ ID NO: 40), alphafetoprotein (SEQ ID NO: 41), and fibronectin (SEQ ID NO: 42), along with their predicted cleavage efficiency. The leader amino acid sequence of IGHV9-2-l*01 is SEQ ID NO: 15 and the leader amino acid sequence of IGHV9-3*02 is SEQ ID NO: 16. Fig. ID is a schematic of the LA-2 scFv-Fc expression construct under the control of a CMV promoter, including the leader sequences tested for secretion efficiency. Fig. IE shows ELISA results comparing LA-2 scFv-Fc concentrations in the supernatant of Hepa 1-6 cells transfected with constructs containing two different leader sequences, measured over a 48-hour period. Fig. IF is a graph showing OspA binding activity of LA-2 antibodies produced using different bicistronic elements, measured by ELISA at various concentrations. Fig. 1G is a schematic of CRISPR-modified Hepa 1-6 cell lines expressing the full-length LA-2 antibody. Fig. 1H shows results of RT-qPCR analysis showing fold change in LA-2 mRNA in engineered Hepa 1-6 cells with different CRISPR guides, normalized to P-actin and background Hepa 1-6 expression. Fig. II is a graph showing concentration of IgG2a in the supernatant of CRISPR- modified Hepa 1-6 cells, quantified by ELISA, demonstrating successful antibody secretion in cells engineered with guide 3.
[0030] Figure 2A-D provides schematic diagram and graphs illustrating generation, validation, and infection challenge of liver-specific full-length LA-2-expressing mice. Fig. 2A is a schematic diagram of the construct introduced into the mouse genome, 300 bp proximal to the native albumin enhancer. The minimal albumin promoter drives the expression of the full-length LA-2 monoclonal antibody. Fig. 2B is a graph showing quantification of LA-2 antibody concentration in the serum of heterozygous, homozygous, and wild-type mice across multiple generations (F0 through F4). Fig. 2C is a schematic diagram of the tick challenge. Uninfected engineered and control mice were exposed to Borrelia burgdorferi-mfected ticks, and postinfestation serum was evaluated for and-Borrelia antibodies to determine infection status. Fig. 2D is a graph of endpoint ELISA results from transgenic and wild-type mice 21 days post-infestation, detecting B. burgdorferi-specidc antibodies against C6, a sensitive marker of infection.
[0031] 7
[0032] #18756472vl MML-082W001
[0033] Figure 3A-B provides graphs of binding affinity data for LA-2 IgG2a (Fig. 3 A) and its scFv counterpart with a Vh-(G4S)3-Vl linker (Fig. 3B). Association rate constant (kon), dissociation rate constant (koff), and equilibrium dissociation constant (Kd) values are reported.
[0034] Figure 4A-B provides a schematic diagram and a graph of results from studies that evaluated linker sequences for optimizing LA-2 scFv-Fc Fig. 4A is a schematic representation of the expression construct used to evaluate different linker sequences between the LA-2 scFv heavy and light chains. The construct includes a CMV promoter driving the expression of the LA-2 scFv-Fc fusion protein, with various linkers designed to modulate flexibility and length. Fig. 4B is a graph of OspA binding data from ELISA assays comparing the performance of different linker sequences in Lenti-X 293T cells 72 hours post-transfection. The binding profiles of the top linker candidates were assessed against purified full-length LA-2 antibody (lines).
[0035] Figure 5A-E provides graphs and a schematic diagram from results demonstrating generation, validation, and infection challenge of LA-2 scFv-albumin expressing mice. Fig. 5 A is a schematic representation of the transgene inserted into the Rosa26 locus, encoding the LA-2 scFv fused to mouse albumin under the control of the CAG promoter. Fig. 5B is a graph showing serum concentrations of LA-2 scFv-albumin in heterozygous and homozygous mice across multiple generations, measured by ELISA. Fig. 5C is a schematic illustration of the tick challenge: Uninfected engineered and control mice were exposed to Borrelia burgdorferi-infected ticks. Post-infestation, serum was analyzed for signs of infection, and ticks were evaluated for infection status. Fig. 5D shows endpoint ELISA results from transgenic and wild-type mice 21 days post-infestation, detecting B. burgdorferi-specific antibodies against C6, a sensitive marker of infection. Fig. 5E is a graph showing the fraction of Barrel ia-infected ticks per individual mouse, comparing ticks that fed on transgenic versus wild-type mice. Engorged ticks were collected, stored, and assessed for the presence of Borrelia spirochetes using indirect immunofluorescence.
[0036] Figure 6A-B is a schematic illustration and a graph of results of xenodiagnostic challenge and infection analysis in LA-2 scFv-albumin expressing mice. Fig. 6A is a schematic of the xenodiagnostic challenge. Uninfected larval ticks were fed on previously challenged Rosa26- targeted LA-2 scFv-albumin mice 21 days post-challenge. Fig. 6B is a graph showing
[0037] 8
[0038] #18756472vl MML-082W001 fraction of infected ticks per mouse, assessed by indirect immunofluorescence of dissected tick guts post-molt. Detection of Borrelia burgdorferi spirochetes in any tick was considered evidence of an infected and infectious mouse.
[0039] Description of the Sequences
[0040] SEQ ID NO: 1 is gRNA 1 :
[0041] GAGCTAACCTTCTGTCCTAG.
[0042] SEQ ID NO :2 is gRNA 2:
[0043] GCCTTAGCCAGTGTTTGCAC.
[0044] SEQ ID NO: 3 is gRNA 3:
[0045] GCCTGTGCAAACACTGGCTA.
[0046] SEQ ID NO: 4 is gRNA 4:
[0047] GCTGGCTAAGGCATGAACTT.
[0048] SEQ ID NO: 5 is Albumin 1 forward primer, Alb-2-qPCR-F : GACGTGTGTTGCCGATGAGT.
[0049] SEQ ID NO: 6 is Albumin 1 reverse primer, Alb-2-qPCR-R: GTTTTCACGGAGGTTTGGAATG.
[0050] SEQ ID NO: 7 is Albumin 2 forward primer, Alb-3-qPCR-F: TCCAAACCTCCGTGAAAACTATG.
[0051] SEQ ID NO: 8 is Albumin 2 reverse primer, Alb-3-qPCR-R: TGTGTTGCAGGAAACATTCGT.
[0052] SEQ ID NO: 9 is tdTomato 1 forward primer, tdTomato-l-qPCR-F: CTTGTACAGCTCGTCCATGC.
[0053] SEQ ID NO: 10 is tdTomato 1 reverse primer, tdTomato- 1-qPCR-R: AACTGCCCGGCTACTACTAC.
[0054] SEQ ID NO: 11 is tdTomato 2 forward primer, tdTomato-3-qPCR-F: CGCGCATCTTCACCTTGTAG.
[0055] SEQ ID NO: 12 is tdTomato 2reverse primer, tdTomato-3-qPCR-R: GCGTGATGAACTTCGAGGAC .
[0056] SEQ ID NO: 13 is P-Actin: forward primer, Bact-l-qPCR-F: GGCTGTATTCCCCTCCATCG.
[0057] SEQ ID NO: 14 is P-Actin: reverse primer, Bact- 1-qPCR-R: CCAGTTGGTAACAATGCCATGT.
[0058] SEQ ID NO: 15 is IGHV9-2-l*01:
[0059] 9
[0060] #18756472vl MML-082W001
[0061] MAWVWTLLFLMAAAQIQA.
[0062] SEQ ID NO: 16 is IGHV9-3*02:
[0063] MDWLWNLLFLMAAAQIQA.
[0064] SEQ ID NO: 17 is LA-2 mAb 1 forward primer, LA-2-l-qPCR-F: CTCCCTGTGGGTCTGAGTTT.
[0065] SEQ ID NO: 18 is LA-2 mAb 1 reverse primer, LA-2-l-qPCR-R: CCCATTGTTACATGCGTCGT.
[0066] SEQ ID NO: 19 is LA-2 mAb 2 forward primer, LA-2-2-qPCR-F : TACCTGGTTGCAGGGTTGAT.
[0067] SEQ ID NO: 20 is LA-2 mAb 2 reverse primer, LA-2-2-qPCR-R TCTGGCTTCATGCTCAATGC.
[0068] SEQ ID NO: 21 is Albumin 1 forward primer, Alb-l-qPCR-F: CAAGAGTGAGATCGCCCATCG.
[0069] SEQ ID NO: 22 is Albumin 1 reverse primer Alb-l-qPCR-R: TTACTTCCTGCACTAATTTGGCA.
[0070] SEQ ID NO: 23 is Albumin 2 forward primer, Alb-2-qPCR-F : TGCTTTTTCCAGGGGTGTGTT.
[0071] SEQ ID NO: 24 is Albumin 2 reverse primer Alb-2-qPCR-R TTACTTCCTGCACTAATTTGGCA.
[0072] SEQ ID NO: 25 is Puromycin resistance forward primer, Puro-l-qPCR-F: CCACACCTTGCCGATGTC.
[0073] SEQ ID NO: 26 is Puromycin resistance reverse primer, Puro-l-qPCR-R: CACCGAGCTGCAAGAACTC.
[0074] SEQ ID NO: 27 is guide RNA 3 :
[0075] TCCTGTGCAAACACTGGCTA.
[0076] SEQ ID NO: 28 is LA-2 heavy chain forward primer, LA-2 -Heavy -F : CCCATTGTTACATGCGTCGT.
[0077] SEQ ID NO: 29 is LA-2 heavy chain reverse primer, and LA-2-Heavy-R: AGGCATGAAGTCGGTTACCA.
[0078] SEQ ID NO: 30 is wild-type Albumin locus forward primer, Alb-F: GCCTCTAATTCCCGTGTTCC.
[0079] SEQ ID NO: 31 is wild-type Albumin locus reverse primer, Alb-R: TTGAACAGCCCACGAGAGAC.
[0080] SEQ ID NO: 32 is linker:
[0081] 10
[0082] #18756472vl MML-082W001
[0083] GGGGS.
[0084] SEQ ID NO: 33 is a guide RNA:
[0085] ACTCCAGTCTTTCTAGAAGA.
[0086] SEQ ID NO: 34 is Rosa26 forward primer, Rosa26-F: CTCTGAGTTGTTATCAGTAAGGGAGCTG.
[0087] SEQ ID NO: 35 is a Rosa26 reverse primer, Rosa26-R: CCTCCCATTTTCCTTATTTGCCCCTATTA.
[0088] SEQ ID NO: 36 is LA-2 scFv transgene forward primer, LA-2-scFv-F: AAGGTCTCAAAAGAATGGGTTGGATCAAT.
[0089] SEQ ID NO: 37 is LA-2 scFv transgene reverse primer, LA-2-scFv-R: GGTTGAAGTGTGCTGGTGTAGTGTATAAG.
[0090] SEQ ID NO: 38 is a chosen leader sequence: MAWVWTLLFLMAAAQIQA.
[0091] SEQ ID NO: 39 is a linker sequence:
[0092] GGGGS GGGGS GGGGS GGGG.
[0093] SEQ ID NO: 40 is leader amino acid sequence for albumin: MKWVTFLLLLFVSGSAFS.
[0094] SEQ ID NO: 41 is leader amino acid sequence for a-fetoprotein: MKWITP ASLILLLHF AAS .
[0095] SEQ ID NO: 42 is leader amino acid sequence for fibronectin:
[0096] MLRGPGPGRLLLLAVLCLGTSVRCTEAGKSKR.
[0097] SEQ ID NO: 43 is a linker sequence:
[0098] GGS SRS S S SGGGGSGGG.
[0099] SEQ ID NO: 44 is a linker sequence:
[0100] GGSSRSSSSGGGSGG.
[0101] SEQ ID NO: 45 is a linker sequence:
[0102] GGGGSGGGGSGGGGSGGGGS .
[0103] SEQ ID NO: 46 is a linker sequence:
[0104] GGGGSGGGGSGGGGS .
[0105] SEQ ID NO: 47 is a linker sequence:
[0106] GGGGSGGGGSGGGGSGG.
[0107] SEQ ID NO: 48 is a linker sequence:
[0108] 11
[0109] #18756472vl MML-082W001
[0110] GGSSRSSSSGGGGSG.
[0111] SEQ ID NO: 49 is a linker sequence:
[0112] GGS SRS S S SGGGGSGGGGS .
[0113] Detailed Description
[0114] Methods compositions of the invention, in part, relate to heritable immunization, which provides a novel approach to controlling infectious diseases by embedding immune protection directly into the germline of reservoir species. This strategy enables the stable transmission of immunity across multiple generations, providing continuous, systemic protection against pathogens in reservoir hosts. By encoding antibody -based immunity within the genome, heritable immunization can be used to disrupt disease transmission cycles at their source, particularly in well-characterized host-pathogen systems with known neutralizing antibodies. Unlike conventional vaccination, which requires repeated administration to each generation of organisms (also referred to herein as “subjects”), methods of the invention comprise engineering reservoir species, which may be used alone or used in synergy with concomitant interventions by providing a perpetuating mode of reducing enzootic transmission of zoonotic infections, particularly those maintained by rodents.
[0115] Heritable immunization methods of the invention provide a promising new method for controlling infectious diseases by embedding immunity directly into the genomes of reservoir species. As a non-limiting examples, certain studies presented herein demonstrate that a transgenic Mus musculus can be successfully engineered to produce a neutralizing, protective LA-2 single-chain antibody against Borrelia burgdorferi, the causative agent of Lyme disease. An engineered mouse expressing an LA-2 scFv-albumin fusion protein from the Rosa26 locus was found to confer heritable resistance to infection across multiple generations. Findings presented herein demonstrate the feasibility of heritable immunization for preventing transmission in the environment. Methods of the invention comprising antibody-mediated reservoir immunity represent a generalizable approach to controlling vector-borne and zoonotic disease.
[0116] Studies presented herein demonstrate heritable immunization using the Lyme disease transmission cycle. Lyme disease, the most common vector-borne disease in the United States, is a multisystem infection with a global public health impact. The transmission cycle involves a complex interplay between tick vectors, reservoir hosts, and the environment (Radolf, J.D. et al., Nat. Rev. Microbiol. 10, 87-99 2012). Infection is not vertically
[0117] 12
[0118] #18756472vl MML-082W001 transmitted; rather, infections are transmitted between each new generation of reservoirs and tick vectors. On the East Coast of the United States, Peromyscus species, particularly the white-footed mouse (Peromyscus leucopus), serve as the primary reservoir for Borrelia burgdorferi (Bunikis, J. et al., J. Infect. Dis. 189, 1515-1523 2004). In Europe, the bank vole (Myodes glareolus) and the wood mouse (Apodemus sylvaticus) are key reservoirs for Borrelia afzelii (Lindso, L, K. et al., Parasit. Vectors 17, 23 2024), while in Asia, the striped field mouse (Apodemus agrarius) serves as a reservoir of Borrelia garinii (Zhang, F. et al., BMC Microbiol. 10, 157 2010). Additionally, Mus species, including Mus musculus, have been identified as potential reservoirs of Borrelia in Europe (Frandsen, F. et al., APMIS 103, 247-253 1995).
[0119] Studies have now been performed to examine the use of genetic engineering to alter the reservoir capacity of key hosts by encoding OspA-targeting antibodies in the mouse genome. This approach, introduces the novel concept of heritable immunization — embedding antibody-based immunity into the germline to achieve lasting resistance. Although previously mice have been engineered to produce human antibodies, such as the XenoMouse® (Abgenix, Inc., Fremont, CA) and HuMAb Mouse® (GenPharm-Medarex, San Jose, CA), these models are used for discovering and producing therapeutic monoclonal antibodies and do not confer lifelong resistance to a specific pathogen (Jakobovits, A. et al., Nat. Biotechnol. 25, 1134-1143 2007; Peterson, N.C., ILAR J. 46, 314-319 2005). Unlike prior research where engineered mouse mothers transferred disease resistance to their pups through antibodies in breast milk (Castilla, J. et al., Nat. Biotechnol. 16, 349-354 1998), the methods presented herein can be used to establish continuous systemic protection in the reservoir species, persisting throughout their lifespan, and lasting for many generations in the environment.
[0120] In one certain experiments presented herein, transgenic Mus musculus were engineered to express LA-2, a well-characterized protective monoclonal antibody derived from Mus that targets Borrelia burgdorferi (Schaible U.E. et al., Proc. Natl. Acad. Sci. U.S.A. 87, 3768-3772 1990), with the aim of disrupting Lyme disease transmission. Initial in vitro experiments were conducted to optimize genetic engineering efficiency, antibody design and stabilization via leader sequences, and bicistronic elements. One goal of this work was to achieve liver specific expression, but the initial full-length LA-2-expressing models exhibited insufficient immunity. Following those studies, experiments were performed and a new mouse model was developed in which the LA-2 antibody was reformatted into a single-chain variable fragment (scFv), fused to albumin for enhanced stability and constitutive, ubiquitous
[0121] 13
[0122] #18756472vl MML-082W001 expression from the Rosa26 locus. The newly engineered mice exhibited robust antibody production across multiple generations, and demonstrated strong immune protection, leading to a statistically significant reduction in the transmission of disease-causing bacteria. These results establish heritable immunization as a viable strategy for the prevention of diseases with mammalian reservoir species.
[0123] An aspect of the invention comprises methods of preparing a subject comprising heritable immunity to an infectious disease. The preparing comprising, inserting a sequence encoding at least one independently selected heritable antibody or a functional fragment thereof at a preselected first target gene locus in the subject; and expressing in the subject the encoded at least one heritable antibody or the functional fragment thereof, thereby producing in the subject resistance to the infectious disease, wherein breeding the subject with the produced resistance results in resistance to the infectious disease in one or more descendants of the subject.
[0124] Infectious Diseases
[0125] An infectious disease may be a viral, bacterial, fungal, or parasitic disease, meaning the cause of the disease in a subject is the presence of a disease causing pathogen in the subject. The term disease causing pathogen may be the virus, bacteria, fungus, or parasite. Methods of the invention may be used to produce heritable immunity against one or more infectious diseases. In some embodiments of methods of the invention, the infectious disease is a vector-borne disease. And in certain embodiments of methods of the invention, the infectious disease is not a vector-borne disease.
[0126] In the situation of a viral infectious disease, the pathogenic virus particles (virions) may attach to and enter one or more of the subject’s cells. A subject infected with a virus or other infectious disease-causing pathogen may also be referred to herein as a “host” subject. Numerous different viruses are known to infect subjects and cells. Categories of infective viruses include DNA viruses and RNA viruses, including single-stranded, double-stranded, and partly double-stranded viruses. Certain types of viruses are enveloped viruses, meaning they are encapsulated with a lipid membrane, which comes from an infected cell when new virus particles “bud off’ from the infected cell. The lipid membrane comprises material from the infected cell’s plasma membrane.
[0127] In some embodiments of methods and model subjects of the invention, the infectious disease is an infectious disease for which rodents are a primary disease reservoir for the infectious disease. Non-limiting examples of infectious diseases for which methods of the
[0128] 14
[0129] #18756472vl MML-082W001 invention can produce heritable immunity are Lyme disease, a hantavirus disease, leptospirosis, Lassa fever, Lymphocytic choriomeningitis virus, South American hemorrhagic fever, Plague (Yersinia pestis), tick-borne encephalitis, Rat-bite fever (Streptobacillus moniliformis, Spirillum minus), Hard tick relapsing fever (Borrelia miyamotoi disease), Babesiosis, Ehrlichiosis, Anaplasmosis, or Powassan virus disease. In some embodiments, the hantavirus disease is Sin Nombre virus, Seoul virus, or Puumala virus. In some embodiments, the South American hemorrhagic fever virus is Junin virus, Machupo virus Guanarito virus, or Sabia virus.
[0130] An infectious disease in a subject may be symptomatic or asymptomatic. A symptomatic infection may result in clinical symptoms in a subject infected with the diseasecausing pathogen that may be detected and assessed using standard diagnostic methods, including but not limited to blood tests, mucus tests, clinical symptom assessment, etc. Nonlimiting examples of clinical symptoms include, but are not limited to, fever, shortness of breath, difficulty breathing, loss of sense of taste and / or smell, low blood oxygenation saturation, chills, vomiting, diarrhea, headache, muscle aches / pain, weakness, loss of appetite, malaise, nasal congestion, body aches, cough, sore throat, runny nose, sneezing, etc. It will be understood that presence, absence, and / or severity of one or more symptoms of an infectious disease may be determined and / or assessed in an infected subject. Severity of an infectious disease varies with different disease-causing pathogens and in different subjects. As a non-limiting example, a first subject with a viral infection may exhibit one or more symptoms such as, fever, chills, cough, etc. and a second subject with a more severe infection with the virus may exhibit some or all of the symptoms of the first subject, and also one or more of symptoms such as but not limited to trouble breathing, confusion, inability to stay awake, bluish lips or face, pain or pressure in chest, and significantly low blood oxygen saturation. It will be understood that clinical symptoms in a subject with an infectious disease can be assessed and the symptoms identified by a health-care professional.
[0131] Anti-pathogen Antibodies and Additional Encoded Sequences
[0132] An essential property of infectious diseases is infectivity, which comprises transfer of the disease-causing pathogen from an infected subject to one or more other subjects. As used herein, “infectivity” refers to the ability of a first disease-causing pathogen to successfully infect a host cell and for the infectious disease to be transferred to a second subject. Methods of the invention can be used to produce heritable immunity against an infectious disease. As used herein, the term “heritable immunity” against a disease-causing pathogen means
[0133] 15
[0134] #18756472vl MML-082W001 immunity against the pathogen may be inherited from parent to offspring. Methods of the invention may be used to produce heritable immunity in a subject or model subject and the subject or model subject passes the heritable immunity to at least a portion of the descendants of the subject or model subject. As used herein, the phrase “at least a portion” means some, but not necessarily all. For example, some but not all offspring or descendants of a first model subject will inherit the heritable immunity from the first model subject. An offspring or descendant of the first subject or first model subject may pass the heritable immunity to a portion of their offspring or descendants. Thus, heritable immunity produced with a method of the invention may continue to be passed from parent to offspring for a plurality of generations. As used herein the term “plurality” means more than one, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.
[0135] Methods of the invention include inserting a sequence encoding a preselected antibody against a disease-causing pathogen. By inserting the sequence into a first subject at a preselected locus, the gene encoding the antibody is expressed in the first subject and is passed to offspring and descendants of the first subject who also express the antibody. In some embodiments, sequences encoding 1, 2, 3, 4, 5, 6, 7, 8 or more anti-pathogen antibodies may be inserted into a first subject. Non-limiting examples of sequences that may be inserted into a first subject, and may be expressed in the first subject and / or a model subject are sequences that encode an OspA-targeting antibody, an anti-Leptospira antibody, an anti- Lassa fever virus antibody, an anti-Y. pestis antibody, an anti-Hantavirus antibody, an anti- Tick-borne encephalitis antibody, an anti-Borrelia miyamotoi antibody, an anti-Babesia antibody, an anti-Powassan virus antibody, or an anti-Lymphocytic choriomeningitis virus antibody. It will be understood that art-known sequences that encode other antibodies against an infectious disease-causing pathogen may be used in methods of the invention and / or included model subjects of the invention.
[0136] In some embodiments of methods and model subjects of the invention, an inserted sequence is a sequence encoding a recombinant antibody.
[0137] Certain embodiments of methods and model subjects of the invention comprise inserted sequences encoding a plurality of heritable antibodies or functional fragments thereof.
[0138] In some embodiments of methods of the invention, inserting a sequence encoding at least one heritable antibody or functional fragment thereof comprises administering an expression cassette to the subject. In some embodiments and CRISPR components are also administered. In some embodiments, the expression cassette comprises a sequence encoding
[0139] 16
[0140] #18756472vl MML-082W001 the at least one heritable antibody or functional fragment thereof. The term “functional” used herein in the context of an antibody, means a portion of the antibody that has at least a portion of the function of the parent antibody. For example, a functional fragment of an antibody against a hantavirus comprises a fragment (less than all) of the parent hantavirus antibody and has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 100 percent of the function of the parent antibody against the hantavirus.
[0141] The following are non-limiting examples of types of heritable functional fragments that may be used in methods of the invention and may be included in model subjects of the invention. In some embodiments a heritable functional fragment of a heritable antibody comprises a single-chain variable fragment (scFv) of the parent heritable antibody. In some embodiments a heritable functional fragment of a heritable antibody comprises a light chain of the heritable antibody or a functional fragment of the light chain. In certain embodiments, a heritable functional fragment of a heritable antibody comprises a heavy chain of the heritable antibody or a functional fragment of the heavy chain.
[0142] An expression cassette administered to a subject in a method of the invention may also include one or both of a promoter and a preselected leader sequence. A promoter included in a cassette and administered to a subject may or may not include an enhancer element. In some embodiments of methods of the invention, the expression cassette comprises a first promoter that drives expression of at least one heritable antibody whose encoding sequence is administered to a subject and a second promoter that drives expression of at least one different heritable antibody whose encoding sequence is administered to a subject.
[0143] In some embodiments of methods of the invention, an inserted sequence comprises the encoding sequence for a single antibody or functional fragment thereof is administered to a subject and in other embodiments of methods of the invention, an inserted sequence comprises sequences encoding a plurality of heritable antibodies or functional fragments thereof, and the expression cassette comprises a plurality of promoters that each drive expression of a different one of the plurality of heritable antibodies. A method of the invention may also include inserting into a preselected first target gene locus in the subject a sequence that encodes a plurality of heritable antibodies or functional fragments thereof, wherein the inserted sequence encodes a 2A peptide or an Internal Ribosome Entry Site (IRES) between each of the encoded heritable antibodies or functional fragments thereof. Certain embodiments of methods of the invention include inserting into a preselected first
[0144] 17
[0145] #18756472vl MML-082W001 target gene locus in the subject a sequence encoding at least one multiformat heritable antibody or functional fragment thereof (see for example dotmatics.com / blog / three-must-dos- for-tracking-multiformat-antibody-r-and-d, the content of which is incorporated by reference herein).
[0146] In some embodiments of methods and model subjects of the invention an expression cassette inserted into a subject in an embodiment of a method of the invention also comprises a preselected leader sequence, which is selected in part, to direct the expressed heritable antibody or functional fragment thereof to the bloodstream of the subject. In some embodiments, the expressed antibody or functional fragment thereof against an infectious disease is directed to the bloodstream after the subject’s birth, and / or after the subject is exposed to the infectious disease.
[0147] Target Loci
[0148] Methods of the invention include inserting a sequence encoding at least one independently selected heritable antibody or a functional fragment thereof at a preselected target gene locus in the subject. Some methods of the invention include inserting more than one independently selected heritable antibody or a functional fragment thereof at 2, 3, 4, 5, 6, or more preselected target gene loci in the subject. Non-limiting examples of target gene loci at which an encoding sequence may be inserted are a Rosa26 locus, an Apoal locus, or an albumin locus. In some embodiments, a target gene locus may be an Alpha- 1 antitrypsin locus or an Ornithine Transcarbamylase (OTC) locus. The term “independently selected” used in reference to an antibody or functional fragment thereof, means each antibody or functional fragment thereof may be selected separately from other antibodies or functional fragments thereof selected. This means, for example, that if sequences encoding 2, 3, 4, or more antibodies or functional fragments thereof are inserted in a method of the invention, when the total is two, the two may be selected to be the same or different from each other; when the total is three, the three may be selected to be all the same, all different, or two the same and one different; when the total is four, the four may be selected to all be the same, all different, three the same and one different, two each of two different antibodies or functional fragments thereof, and so on. Similarly, a preselected target gene locus is independently selected for use in a method or model subject of the invention. In this instance the term “independently selected” means that each preselected target gene locus may be selected separately from other preselected target gene loci.
[0149] 18
[0150] #18756472vl MML-082W001
[0151] In addition to encoding one or more independently selected heritable antibody or functional fragment thereof, a sequence inserted at a preselected target gene locus of a subject may also include sequences encoding a protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof. For example, expression of an inserted sequence may result in a fusion protein comprising the heritable antibody or the expressed functional fragment thereof, and a protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof. Albumin and Fc domain are non-limiting examples of proteins that may be included in such a fusion protein and enhance stability of the expressed heritable antibody or the expressed functional fragment thereof.
[0152] Certain embodiments of methods of the invention include inserting at least one sequence encoding a heritable antibody or functional fragment thereof and also administering an expression cassette and CRISPR components to the subject. CRISPR methods and components are well known in the art, and non-limiting examples of components that may be included in methods of the invention are guide sequences and a DNA endonuclease, wherein the DNA endonuclease may include a Cas9 sequence. Non-limiting examples of Cas9 sequences that may be used in an embodiment of a method of the invention are a ScCas9 sequence and a SpCas9 sequence.
[0153] Infectivity Determination
[0154] As described elsewhere herein, methods of the invention are used to introduce heritable immunity against an infectious disease into a subject, at least a portion of the subject’s offspring and descendants, and / or at least a portion of a populations of the same type of organism as the subject into which the subject or a plurality of model subjects have been released. As indicated elsewhere herein, release of a subject into a population of organisms of the same species or type may mean release into a population that is in captivity or a population in the wild.
[0155] Certain embodiments of methods of the invention comprise methods of assessing the presence, absence, and / or level of immunity against an infectious disease in a subject that has been treated with a method of the invention, or that is an offspring or descendent of a subject that has been treated with a method of the invention. In some embodiments, an increase in resistance to an infectious disease that is conferred by a method of the invention comprises reducing a level of risk of a subject contracting the infectious disease compared to a control level of risk of contracting the infectious disease. In some embodiments, a control level of risk comprises a level of risk of a subject that does not comprise the heritable immunity to the
[0156] 19
[0157] #18756472vl MML-082W001 infectious disease. In some embodiments, a risk of a subject comprising heritable immunity against an infectious disease is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% lower than a control risk of a of a subject that does not comprise the heritable immunity to the infectious disease. In some embodiments, the risk of a subject comprising heritable immunity against an infectious disease is between 1% and 10% lower, between 10% and 25% lower, between 25% and 50% lower, between 50% and 75% lower, or between 70% and 100% lower than a control risk of a of a subject that does not comprise the heritable immunity to the infectious disease.
[0158] In some embodiments of methods of the invention an increase in resistance to an infectious disease that is conferred by a method of the invention comprises reducing severity of the infectious disease in the subject compared to a control severity of the infectious disease. In some embodiments, a control severity comprises severity of the infectious disease in a subject that does not comprise the heritable immunity to the infectious disease. Severity may be assessed based on clinical symptoms, likelihood of death, or other art-known characteristics.
[0159] In some embodiments, a method of the invention comprises assessing (also referred to herein as determining) the presence of heritable immunity against an infectious disease in a portion or all offspring of a subject and / or at least a portion of descendants of the subject wherein the subject was treated with a method of the invention and comprises heritable immunity against the infectious disease. In some embodiments, assessing the presence of heritable immunity against an infectious disease comprises determining in at least a portion of the offspring and / or descendants of the subject, the presence of the expressed heritable antibody or the functional fragment thereof, the encoding sequence for which was inserted into the parent or ancestor of the offspring or descendant.
[0160] Certain embodiments of methods of the invention that confer heritable immunity against an infectious disease in a subject, result in a level of transmission of the infectious disease by the subject and the subject’s descendants that is statistically significantly reduced compared to a control level of transmission. A level of transmission of the infectious disease by a subject comprising the heritable immunity to the infectious disease may be at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% lower than a level of transmission by a subject not comprising the heritable immunity to the infectious disease. In some embodiments, a control level of transmission comprises a level of transmission of the
[0161] 20
[0162] #18756472vl MML-082W001 infectious disease by a subject not comprising the heritable immunity to the infectious disease.
[0163] Treatments
[0164] In some embodiments of methods of the invention, treatment of a subject that comprises inserting a sequence encoding at least one independently selected heritable antibody or a functional fragment thereof at a preselected first target gene locus in the subject; and expressing in the subject the encoded at least one heritable antibody or the functional fragment thereof, thereby producing in the subject resistance to the infectious disease, wherein breeding the subject with the produced resistance results in resistance to the infectious disease in one or more descendants of the subject, also comprises inserting a sequence encoding at least one additional independently selected heritable antibody or a functional fragment thereof at a second preselected target gene locus in the subject; and expressing in the subject the at least one additional independently selected heritable antibody or the functional fragment thereof encoded by the inserted sequence, thereby producing in the subject resistance to the infectious disease, wherein breeding the subject with the produced resistance results in resistance to the infectious disease in one or more descendants of the subject. In some embodiments, the sequence inserted at the second preselected target gene locus is different from the sequence inserted at the first preselected target gene locus.
[0165] The terms “treat,” “treatment,” and “treated” may be used herein to refer to a method of the invention with which a subject comprising heritable immunity to an infectious disease is prepared. In certain instances, treatment may comprises inserting a sequence encoding at least one independently selected heritable antibody or a functional fragment thereof at a preselected first target gene locus in the subject; and expressing in the subject the encoded at least one heritable antibody or the functional fragment thereof, thereby producing in the subject resistance to the infectious disease, wherein breeding the subject with the produced resistance results in resistance to the infectious disease in one or more descendants of the subject.
[0166] In some embodiments, the presence of heritable immunity against an infectious disease in a subject may result in one or more of: preventing onset of the infectious disease in the subject, preventing progression of the infectious disease in the subject; reducing progression of the infectious disease in the subject; reducing transmissibility of the infectious disease by the subject; reducing severity of the infectious disease in the subject; reducing one or more clinical symptoms of the infectious disease in the subject; reducing spread of the
[0167] 21
[0168] #18756472vl MML-082W001 infectious disease between organisms, etc. It will be understood that treating or treatment of a subject using a method of the invention can but need not totally eliminate or prevent the subject comprising heritable immunity against an infectious disease from acquiring or transmitting the infectious disease. A statistically significant amelioration of one or more symptoms of an infectious disease in a subject comprising heritable immunity against an infectious disease may be at least 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% reduction compared to a control treatment, including all percentages within that range. As used herein, the term “amelioration” refers to improvement in severity of one or more symptoms of an infectious disease in a treated subject compared to a control. Non-limiting examples of amelioration also include a reduction in number and / or severity of one or more symptoms of the infectious disease in a subject; a reduction in overall duration of symptoms of the infectious disease in a subject; and a reduction in pathogenic load in a subject, for example reduction in viral load in a viral infectious disease. Amelioration of infectious disease symptoms may be evaluated and / or measured using art-known methods that will be familiar to those with ordinary skill in the art. In some aspects, treating an infectious disease refers to treating an infectious disease such that symptoms of the infectious disease in a subject are partially eliminated or completely eliminated. It will be understood that in certain instances, one or more symptoms of an infectious disease may be present in a subject comprising heritable immunity against the infectious disease.
[0169] Cells, Samples, and Subjects
[0170] As used herein, the term “subject” may refer to human or non-human animals, including mammals and non-mammals, vertebrates, and invertebrates, and may also refer to any genetically modified or engineered organism. Non-limiting examples of mammalian subjects include primates (including but not limited to humans and non-human primates), rodents (including but not limited to mice, rats, squirrels, chipmunks, prairie dogs), bats, lagomorphs, deer, canids, felids, bears, horses, cows, sheep, goats, and pigs. In some embodiments a subject is a vertebrate an example of which is a bird, such as but not limited to poultry such as but not limited to: chickens, ducks, turkeys, etc.. In some embodiments a subject is an invertebrate, including but not limited to insects, fish, etc. In some embodiments, a subject is a mosquito. In some embodiments, a subject is a fly. In some embodiments a subject is a nematode.
[0171] 22
[0172] #18756472vl MML-082W001
[0173] A subject may be considered to be a normal subject or may be a subject known to have or suspected of having an infectious disease. In some embodiments a subject is in captivity. In some embodiments, a subject is in the wild. In some embodiments, a subject or model subject may be prepared, bom raised, and / or bred in captivity and then released into the wild.
[0174] In some embodiments a method of the invention comprises inserting a sequence encoding at least one independently selected heritable antibody or a functional fragment thereof at a preselected first target gene locus in an embryonic subject. In some embodiments, the insertion comprises pronuclear injection.
[0175] Diagnostic evaluation of a subject for the presence of an infectious disease in a subject may include art-known testing of symptoms of a subject and / or a biological sample obtained from the subject. Diagnostic testing may be performed on a sample directly obtained from a subject and / or a sample indirectly obtained from a subject, meaning a biological sample obtained from the subject and tested after culturing the biological sample or parts thereof. Non-limiting examples of biological samples that may be used in diagnostic tests for an infectious disease are blood, tears, urine, saliva, cerebrospinal fluid, lymph, or another bodily material in which it is believed a disease-causing pathogen may be detected.
[0176] Controls
[0177] Certain embodiments of methods of the invention used to identify a status of heritable immunity against a disease-causing pathogen include comparing immunity against the disease-causing pathogen in a subject with heritable immunity conferred using a method of the invention or immunity against the disease-causing pathogen in a model subject of the invention, to results in a subject or plurality of subjects that did not undergo heritable immunity methods of the invention. It will be understood that the phrase “subject with heritable immunity conferred using a method of the invention” means not only the first subject but also offspring and descendants of a first subject, wherein the offspring and descendants possess the heritable immunity. A non-limiting example of a control subject is a subject that does not express the same heritable antibody as a subject or model subject of the invention. In some embodiments, immunity resulting from an embodiment of a method of the invention comprising inserting a sequence encoding one or more anti-pathogen antibodies into a locus of a gene of the subject may be compared to immunity in a subject or subjects resulting from an embodiment of a method of the invention comprising inserting a different sequence encoding one or more anti-pathogen antibodies into a locus of a gene of the subject
[0178] 23
[0179] #18756472vl MML-082W001 or subjects, respectively. In some embodiments of methods of the invention a control is used to assess efficacy of a method of the invention.
[0180] Examples
[0181] Example 1.
[0182] Material and Methods
[0183] Testing Albumin Expression Machinery.
[0184] Hepa 1-6 cells were co-transfected with two integration cassettes: one containing the minimal albumin promoter driving tdTomato expression and the other incorporating the rat albumin enhancer (Postic, C. et al., J. Biol. Chem. 274, 305-315 1999). Transfections were carried out using Lipofectamine 2000 (Thermo Fisher) and Opti-MEM (Gibco), following standard protocols. SpCas9 and one of four CRISPR guides, targeting sequences approximately 300 bp upstream of the albumin enhancer, were included in the transfection mix. The guide sequences used were as follows: gRNA 1 : GAGCTAACCTTCTGTCCTAG (SEQ ID NO: 1) gRNA 2: GCCTTAGCCAGTGTTTGCAC (SEQ ID NO: 2) gRNA 3: GCCTGTGCAAACACTGGCTA (SEQ ID NO: 3) gRNA 4: GCTGGCTAAGGCATGAACTT (SEQ ID NO: 4)
[0185] Following transfection, cells were cultured under hygromycin selection until only cells with integrated cassettes remained. After 3 weeks of selection, successful integration was confirmed by PCR. RNA was extracted using TRIzol Reagent (Thermo Fisher), and cDNA synthesis was performed using the Quantitect Reverse Transcription Kit (Qiagen). Expression levels of tdTomato and native albumin mRNA were quantified by RT-qPCR using the SensiFAST SYBR Hi-ROX Kit (Bioline), with mRNA levels normalized to P-actin. The following primer sets were used for amplification:
[0186] Albumin 1 :
[0187] Alb-2-qPCR-F : 5’-GACGTGTGTTGCCGATGAGT-3’ (SEQ ID NO: 5) Alb-2-qPCR-R: 5’-GTTTTCACGGAGGTTTGGAATG-3’ (SEQ ID NO: 6)
[0188] Albumin 2:
[0189] Alb-3-qPCR-F: 5’-TCCAAACCTCCGTGAAAACTATG-3’ (SEQ ID NO: 7) Alb-3-qPCR-R: 5’-TGTGTTGCAGGAAACATTCGT-3’ (SEQ ID NO: 8)
[0190] 24
[0191] #18756472vl MML-082W001 tdTomato 1 : tdTomato- 1-qPCR-F: 5’-CTTGTACAGCTCGTCCATGC-3’ (SEQ ID NO: 9) tdTomato- 1-qPCR-R: 5’-AACTGCCCGGCTACTACTAC-3’ (SEQ ID NO: 10) tdTomato 2: tdTomato-3-qPCR-F: 5’-CGCGCATCTTCACCTTGTAG-3’ (SEQ ID NO: 11) tdTomato-3-qPCR-R: 5’-GCGTGATGAACTTCGAGGAC-3’ (SEQ ID NO: 12)
[0192] P- Actin:
[0193] Bact-l-qPCR-F: 5’-GGCTGTATTCCCCTCCATCG-3’ (SEQ ID NO: 13)
[0194] Bact- 1-qPCR-R: 5’-CCAGTTGGTAACAATGCCATGT-3’ (SEQ ID NO: 14)
[0195] Leader Sequence Selection.
[0196] Leader sequences for efficient secretion of the anti-Bozre / za burgdorferi LA-2 antibody were selected through a combination of in silico analysis and in vitro validation. Candidate sequences were identified using IMGT’s V-Quest tool based on homology to the LA-2 heavy-chain variable domain. Leader sequences from mouse albumin, alphafetoprotein, and fibronectin were also evaluated. Cleavage efficiency was predicted using SignalP software.
[0197] Three expression vectors were constructed: two containing the selected leader sequences driving expression of the LA-2 single-chain variable fragment fused to the Fc region (scFv-Fc), and one control vector without a leader sequence. The following two leader sequences were tested:
[0198] IGHV9-2-l*01: MAWVWTLLFLMAAAQIQA (SEQ ID NO: 15)
[0199] IGHV9-3*02: MDWLWNLLFLMAAAQIQA (SEQ ID NO: 16)
[0200] Hepa 1-6 cells were transfected with these constructs using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer's protocol. Supernatants were collected at 0, 24, and 48 hours post-transfection. LA-2 scFv-Fc secretion was quantified using a mouse IgG2b ELISA kit (Bethyl Laboratories). ELISAs were performed on the collected supernatants following the manufacturer's instructions.
[0201] Bicistronic Element Selection.
[0202] 25
[0203] #18756472vl MML-082W001
[0204] To optimize the co-expression of the heavy and light chains of the full-length LA-2 antibody, five expression constructs were designed. Each construct contained a CMV promoter driving the LA-2 heavy chain, followed by either one of four 2A peptide sequences (F2A, E2A, P2A, or T2A) or an internal ribosome entry site (IRES CVEB) to facilitate coexpression of the light chain.
[0205] Hepa 1-6 cells were transfected with the constructs using polyethylenimine (PEI) in Opti-MEM (Gibco) following standard protocols. After 72 hours, the supernatants were collected for analysis. Antibody concentration was quantified using an IgG2a ELISA kit (Bethyl Laboratories, E99-107). For antigen-binding assessments, rOspA (produced by GenScript) was coated onto plates at a concentration of 5 pg / mL. Binding was detected using the IgG2a Bethyl Laboratories ELISA kit (E99-107). Full-length LA-2 (produced by GenScript) was used as a positive control in both assays, diluted to 100 pg in 100 pL.
[0206] Validation and Guide Testing for Full Length LA-2 Design.
[0207] Four CRISPR-modified Hepa 1-6 cell lines were generated to validate the full-length LA-2 antibody design and assess the efficiency of different CRISPR guide RNAs. Each cell line integrated the full-length LA-2 IgG2a construct along with a puromycin resistance marker to enable selection of LA-2-positive populations. Hepa 1-6 cells were co-transfected with the LA-2 IgG2a construct and one of four px330 plasmids encoding SpCas9 and the following guide RNAs, targeting a site approximately 300 bp proximal of the albumin enhancer: gRNA 1 : CAGCTAACCTTCTGTCCTAG (SEQ ID NO: 1) gRNA 2: GCCTTAGCCAGTGTTTGCAC (SEQ ID NO: 2) gRNA 3: TCCTGTGCAAACACTGGCTA (SEQ ID NO: 3) gRNA 4: ACTGGCTAAGGCATGAACTT (SEQ ID NO: 4)
[0208] Transfections were performed using Lipofectamine 2000 (Thermo Fisher) in Opti- MEM (Gibco), following standard protocols. Post-transfection, cells were selected with 2 pg / mL puromycin for three weeks to isolate stably integrated clones.
[0209] Total RNA was extracted from the CRISPR-modified Hepa 1-6 cells using the RNeasy Mini Kit (Qiagen), followed by cDNA synthesis with the Quantitect Reverse Transcription Kit (Qiagen). RT-qPCR was performed using the SensiFAST SYBR Hi-ROX Kit (Bioline), with mRNA levels normalized to P-actin and baseline expression in unmodified Hepa 1-6 cells. The following primer sets were used for amplification:
[0210] 26
[0211] #18756472vl MML-082W001
[0212] LA-2 mAb 1 :
[0213] LA-2-l-qPCR-F: 5’-CTCCCTGTGGGTCTGAGTTT-3’ (SEQ ID NO: 17)
[0214] LA-2-l-qPCR-R: 5’-CCCATTGTTACATGCGTCGT-3’ (SEQ ID NO: 18)
[0215] LA-2 mAb 2:
[0216] LA-2-2-qPCR-F: 5’-TACCTGGTTGCAGGGTTGAT-3’ (SEQ ID NO: 19) LA-2-2-qPCR-R: 5’-TCTGGCTTCATGCTCAATGC-3’ (SEQ ID NO: 20)
[0217] Albumin 1 :
[0218] Alb-l-qPCR-F: 5’-CAAGAGTGAGATCGCCCATCG-3’ (SEQ ID NO: 21) Alb-l-qPCR-R: 5’-TTACTTCCTGCACTAATTTGGCA-3’ (SEQ ID NO: 22)
[0219] Albumin 2:
[0220] Alb-2-qPCR-F: 5’-TGCTTTTTCCAGGGGTGTGTT-3’ (SEQ ID NO: 23)
[0221] Alb-2-qPCR-R: 5’-TTACTTCCTGCACTAATTTGGCA-3’ (SEQ ID NO: 24)
[0222] Puromycin resistance:
[0223] Puro-l-qPCR-F: 5’-CCACACCTTGCCGATGTC-3’ (SEQ ID NO: 25)
[0224] Puro-l-qPCR-R: 5’-CACCGAGCTGCAAGAACTC-3’ (SEQ ID NO: 26)
[0225] P- Actin:
[0226] Bact-l-qPCR-F: 5’-GGCTGTATTCCCCTCCATCG-3’( SEQ ID NO: 13)
[0227] Bact-l-qPCR-R: 5’-CCAGTTGGTAACAATGCCATGT-3’ (SEQ ID NO: 14)
[0228] Supernatants were collected 72 hours post-transfection, and IgG2a levels were measured using the IgG2a ELISA kit (Bethyl Laboratories, E99-107) to assess antibody secretion.
[0229] Generation of Full Length LA-2 expressing Mus musculus.
[0230] Pronuclear injections were performed by the Whitehead Institute GEM Core. A vector containing the LA-2 expression cassette, without a selectable marker, was microinjected into BDF1 mouse embryos along with SpCas9 and guide RNA 3 [gRNA 3 sequence: TCCTGTGCAAACACTGGCTA (SEQ ID NO: 27)], targeting a region 300 bp upstream of the albumin enhancer. Successfully injected embryos were implanted into pseudopregnant
[0231] 27
[0232] #18756472vl MML-082W001 females. Of the 45 pups bom, two carried the full-length LA-2 knock-in, and sequencing confirmed correct integration at the target locus in one of these mice.
[0233] Genotyping Full Length LA-2 expressing Mus musculus.
[0234] Genomic DNA was extracted from ear punches of LA-2-expressing Mus musculus using the GenElute Mammalian Genomic DNA Mini-prep Kit (Sigma- Aldrich) according to the manufacturer’s protocol. Genotyping was performed via PCR using PrimeSTAR® DNA Polymerase (Takara Bio) with two primer sets: one set amplifying the LA-2 heavy chain LA- 2 -Heavy -F 5’-CCCATTGTTACATGCGTCGT-3’ (SEQ ID NO: 28) and LA-2-Heavy-R 5’- AGGCATGAAGTCGGTTACCA-3’ (SEQ ID NO: 29), and the other set targeting the wildtype Albumin locus Alb-F 5’-GCCTCTAATTCCCGTGTTCC-3’ (SEQ ID NO: 30) and Alb- R 5’-TTGAACAGCCCACGAGAGAC-3’ (SEQ ID NO: 31). PCR products were analyzed by agarose gel electrophoresis to assess zygosity. Homozygous mice, with complete integration of the LA-2 construct at both alleles, exhibited no amplification with the Albumin primers due to the size of the PCR product. Heterozygous mice displayed amplification from both sets of primers.
[0235] Mus musculus husbandry.
[0236] Mus musculus (C57BL / 6) were maintained under 12: 12 LD cycle of -400 lux (light) to <1 lux red light (darkness), with lights on from 6am to 6pm. Food and water were available ad libitum.
[0237] Testing Mouse Serum for Full-Length LA-2.
[0238] Serum samples were obtained from mice by collecting blood in BD Microtainer serum separation tubes. ELISA plates were coated with rOspA at 5 pg / mL. Serum samples were applied to the coated plates, and LA-2 antibody levels were detected using the IgG ELISA detection kit (Bethyl Laboratories, E99-131). Purified LA-2 IgG2a (produced by GenScript) was used as a standard.
[0239] Bio-layer interferometry (BLI) assay.
[0240] Kinetic analysis was performed using an Octet Red96 instrument following manufacturer’s instructions. Briefly, biotinylated OspA proteins were immobilized to streptavidin (SA) biosensors. The antigen-immobilized SA biosensors were then dipped into wells containing serially diluted (3.7-300 nM) antibody samples for 180 s for association.
[0241] 28
[0242] #18756472vl MML-082W001
[0243] The sensors were then dipped into a kinetic buffer (PBST supplemented with 0.1% bovine serum albumin) for a 600 s dissociation step. Naked sensor was used as a non-specific binding control. Octet data analysis software (version 10.0.0.5) was used for kinetic curve fitting using the global fitting method.
[0244] Linker Sequence Testing.
[0245] Fifteen distinct linker sequences were evaluated to optimize expression, stability, and binding of the LA-2 scFv-Fc construct. Linkers were positioned between the heavy and light chains of the antibody. Three constructs utilized multimers of the GGGGS (SEQ ID NO: 32) pentapeptide, while the remaining linkers were designed to adjust flexibility and length by varying the ratio of glycine and serine residues.
[0246] Lenti-X 293T cells were transfected with the linker constructs using polyethylenimine (PEI) according to standard transfection protocols. Seventy-two hours post-transfection, supernatants were harvested for analysis. Antibody concentration was quantified using a mouse IgG2b ELISA kit (Bethyl Laboratories, E99-109). Antigen binding was assessed by coating plates with 5 pg / mL of rOspA (produced by GenScript), followed by detection using the same IgG2b ELISA kit. Full-length LA-2 IgG2b antibody (produced by GenScript) was used as a standard.
[0247] Generation of LA-2 scFv-Albumin expressing Mus musculus.
[0248] B6 mouse embryos were microinjected with SpCas9, guide RNA (sequence: ACTCCAGTCTTTCTAGAAGA SEQ ID NO: 33), and an LA-2 scFv-albumin expression cassette targeted to the Rosa26 locus. The expression cassette contained a CAG promoter driving the expression of LA-2 scFv fused to mouse albumin, with a C-terminal His-tag for detection and purification. Pronuclear injections were conducted at MIT's DCM Transgenics Core, and successfully injected embryos were implanted into pseudopregnant females. Out of 18 pups, sequencing analysis confirmed correct integration at the Rosa26 locus in one pup.
[0249] Genotyping LA-2 scFv-Albumin expressing Mus musculus.
[0250] Genomic DNA was extracted from ear punches of LA-2 scFv-albumin expressing Mus musculus using the GenElute Mammalian Genomic DNA Mini-prep Kit (Sigma- Aldrich) according to the manufacturer’s instructions. Genotyping was performed by PCR using PrimeSTAR® DNA Polymerase (Takara Bio) with two primer sets. The first set targeted the wild-type Rosa26 locus, utilizing Rosa26-F (5’-
[0251] 29
[0252] #18756472vl MML-082W001
[0253] CTCTGAGTTGTTATCAGTAAGGGAGCTG-3’ SEQ ID NO: 34) and Rosa26-R (5’- CCTCCCATTTTCCTTATTTGCCCCTATTA-3’ SEQ ID NO: 35). The second set amplified the LA-2 scFv transgene using LA-2-scFv-F (5’- AAGGTCTCAAAAGAATGGGTTGGATCAAT-3’ SEQ ID NO: 36) and LA-2-scFv-R (5’- GGTTGAAGTGTGCTGGTGTAGTGTATAAG-3’ SEQ ID NO: 37). PCR products were analyzed by agarose gel electrophoresis to assess zygosity. Heterozygous mice showed amplification from both the Rosa26 and LA-2 scFv primers, while homozygous mice displayed amplification only of the LA-2 scFv transgene.
[0254] Testing mouse serum for LA-2 scFv-Albumin.
[0255] Serum samples were collected from mice using BD Microtainer serum separation tubes. ELISA plates were coated with rOspA (produced by GenScript) at a concentration of 5 pg / mL. After applying the serum samples to the coated plates, LA-2 scFv-Albumin levels were detected using the Mouse Albumin ELISA Kit (Bethyl Laboratories, E99-134). As a standard, LA-2 scFv-Albumin-His (produced by GenScript) was used.
[0256] Tick challenges.
[0257] Borrelia burgdorferi infected nymphs used for challenging mice were prepared by feeding larval Ixodes dammini (Tufts colony) on mice (Peromyscus leucopus or Mus musculus') infected by lowpass strain N40 (wildtype), routinely maintained by tick-mouse- tick transfer, as described (Fikrig E. et al Proc. Natl. Acad. Sci. U.S.A. 89, 5418-5421 1992). At each challenge, all mice were infected from a single vial of infected nymphs with 70% infection rate. Mice were bled for serum prior to infestation. At infestation, mice were anesthetized with ketamine / xylazine and 10 nymphs applied to the ears and nape of the neck of each mouse, which was held with a wire restraining tube loosely wrapped with a paper towel. Mice were liberated into standard shoebox cages held within a larger cage containing an inch of water, and provided rodent chow and water ad libitum. Engorged nymphs were collected from the water at 4-6 days after infestation, and stored in standard tick vials at 21C and 95% RH for 14 days when they were analyzed for evidence of infection.
[0258] Tick infection assay.
[0259] Engorged nymphs were held 14 days as described (Fikrig, E. et al Proc. Natl. Acad. Sci. U.S.A. 89, 5418-5421 1992) and homogenized in 75uL of PBS in microfuge tubes. The tubes were briefly centrifuged to pellet gross debris, 7.5uL of the supernatant from each tick
[0260] 30
[0261] #18756472vl MML-082W001 was applied to slides (Cel-Line 30-968, HTC), and allowed to dry before fixation in 100% acetone for 10 minutes. Slides were stained by indirect immunofluorescence using a rabbit polyclonal immune serum against B. burgdorferi s.L bound antibody was detected by staining with Alexa Fluor 488 conjugated anti-rabbit IgG. All slides were examined using epifluorescence at X400, and individual ticks scored for intact morphology as well as relative density. A subjective scale of 0-4 was used, with 0 representing absence of spirochetes and 4 representing typical intact cells and dense infection. The mean of the scores for all ticks recovered from each mouse represented the overall intensity of infection.
[0262] Mouse infection assay.
[0263] Mice challenged with infected ticks were held for 21 days and bled for serum, which was analyzed for evidence of B. burgdorferi specific IgG antibody using the C6 peptide assay as described (Bacon, R.M. et al. J. Infect. Dis. 187, 1187-1199 2003), except that an endpoint EIA was used instead of kinetic EIA. Briefly, biotinylated C6 peptide was bound to avidin coated wells of a flat bottomed microplate (Immulon 2), blocked with 3% fish gelatin in TBS (TBS-G), and 1 : 100 dilutions of mouse sera in TBS-G were incubated in duplicate for 1 hour at 37C. Bound antibody was detected using AP-goat anti-mouse IgG (gamma chain specific, Sigma), with a p-nitrophenyl phosphate substrate. A minimum of 6 negative control sera (uninfected B6 or C3H sera) optical densities were analyzed and used to calculate a cutoff value (mean + 3 standard deviations of the negative controls). Antibody to C6 is a sensitive indicator of B. burgdorferi infection.
[0264] Xenodiagnosis.
[0265] To definitively determine mouse infection status after challenge, xenodiagnosis (Marques, A. Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America, 58(7), 937-945 2014) was performed. At day 21 after infected tick challenge, mice were infested with larval I. dammini ticks (Tufts colony), which were allowed to engorge. Engorged larvae were collected, placed into standard tick vials, and held at 21C and 95% RH until they molted 4-5 weeks later. After molting and hardening, samples from each vial were dissected and guts smeared onto slides. The slides were dried, fixed in acetone, and stained by indirect immunofluorescence using an immune rabbit polyclonal serum against B. burgdorferi s.l. with secondary antibody comprising AlexaFluor 488 goat anti-rabbit IgG. Slides were examined for a minimum of 50 fields (X320) before declaring a
[0266] 31
[0267] #18756472vl MML-082W001 negative. Any tick containing spirochetes (e.g., even 1 of 5 ticks) is evidence that the mouse is infected and is infectious.
[0268] Results
[0269] Testing Albumin Expression Machinery
[0270] To develop a heritable immunization strategy against Lyme disease, studies were performed to optimize the expression of the \ti-Borrelia burgdorferi antibody LA-2 in mouse hepatocytes. To achieve tissue-specific antibody release into the bloodstream, the expression machinery of the native albumin gene was co-opted and its ability to drive protein expression was evaluated. Specifically, studies were performed investigating whether the minimal albumin promoter was sufficient to support protein expression when inserted proximal and divergent to the endogenous bi-directional albumin enhancer or if an additional albumin enhancer was necessary (Pinkert, C.A. et al., Genes Dev. 1, 268-276 1987).
[0271] Two distinct CRISPR-modified Hepa 1-6 cell lines were generated: 1) the first, expressing tdTomato from the minimal promoter alone and 2) a second, which incorporated the albumin enhancer (Fig. 1 A). Both were integrated into Hepa 1-6 cells. Briefly, integration cassettes were co-transfected into Hepa 1-6 cells along with SpCas9 and guide RNA targeting sequences -300 bp proximal to the albumin enhancer. Following hygromycin selection, integration was confirmed by PCR. RT-qPCR analysis revealed comparable levels of tdTomato and native albumin mRNA expression in the first cell line without the additional enhancer (Fig. IB), leading to selection of this design for in vivo studies, as the minimal promoter alone appeared sufficient for robust mRNA expression equivalent to albumin while the second design posed a potential risk of antibody overexpression.
[0272] Leader Sequence Selection
[0273] A next aim was to identify a leader sequence that could efficiently direct the anti- Borrelia burgdorferi antibody LA-2 for secretion into the bloodstream. To optimize LA-2 secretion, potential leader sequences were evaluated using both in silico and in vitro approaches. Using IMGT’s V-Quest tool, candidate leader sequences were identified based on their homology to the LA-2 heavy chain variable domain, and additionally analyzed leader sequences from mouse albumin, mouse alpha-fetoprotein, and mouse fibronectin (Fig. 1C). Cleavage efficiency was assessed using SignalP software to predict the likelihood of proper cleavage between the leader and LA-2 antibody sequence (Fig. 1C). From these analyses, two leader sequences were selected for further testing. To assess antibody production from the
[0274] 32
[0275] #18756472vl MML-082W001 selected leaders, three expression vectors were designed containing 1) a reformatted version of LA-2 as an scFv-Fc fusion protein and 2) either one of the two selected leader sequences, or 3) no leader sequence (Fig. ID). These constructs were transfected into Hepa 1-6 cells, and LA-2 scFv-Fc secretion was quantified by ELISA over 48 hours, using a secondary antibody specific to IgG2b for detection. Both leader sequences resulted in expression, with one yielding slightly higher levels. This sequence was therefore selected for all transgenic mouse designs [chosen leader: MAWVWTLLFLMAAAQIQA (SEQ ID NO: 38)] (Fig. IE).
[0276] Bicistronic Element Selection
[0277] To achieve expression of the full-length LA-2 antibody, bicistronic elements commonly employed in antibody expression cassettes were utilized to produce both heavy and light chains without additional expression machinery. Several 2A peptides and internal ribosome entry sites (IRES) were evaluated to determine which element best facilitated the coordinated expression of both chains. Each construct featured a CMV promoter driving expression of the heavy chain, then a distinct 2A sequence or an IRES, and finally the light chain. These constructs were transfected into Hepa 1-6 cells and supernatant were collected 72 hours post-transfection for analysis. IgG2a ELISAs were performed to quantify antibody concentration, while OspA ELISAs assessed binding to the Borrelia surface protein. T2A was chosen from the elements tested (Fig. IF).
[0278] Design Validation and Guide Testing
[0279] To finalize the design and identify the optimal guide for targeting the albumin locus, four CRISPR-modified cell lines incorporating key design elements from previous constructs along with the full-length LA-2 antibody were generated. To quickly obtain near-clonal isolates, a puromycin marker was introduced to facilitate the isolation of LA-2-positive cell populations (Fig. 1G). Hepa 1-6 cells were co-transfected with the construct encoding full- length LA-2, SpCas9, and one of four guide RNAs targeting the region 300 bp proximal to the endogenous albumin enhancer. After three weeks of puromycin selection, four populations of LA-2-positive, puromycin-resistant Hepa 1-6 cells were established. RT-qPCR was performed to measure LA-2 mRNA levels, along with albumin and the selectable marker (puromycin), using five distinct qPCR primer pairs, with expression normalized to the housekeeping gene P-actin (Fig. 1H). All lines expressed LA-2 mRNA, with guide 3 yielding substantially higher levels, presumably due to more efficient homozygous insertion. Then antibody production was evaluated by performing an IgG2a ELISA on the supernatant from
[0280] 33
[0281] #18756472vl MML-082W001 the four LA-2 CRISPR cell lines. One line (from guide 3) measurably secreted IgG2a (Fig. II).
[0282] Generation and Validation of Liver-Specific Full-Length LA-2 Expressing Mice
[0283] To generate mice expressing the full-length LA-2 antibody, a vector containing the aforementioned components was constructed, but without a selection marker (Fig. 2A). Pronuclear injection was performed to introduce SpCas9, guide 3, and the full length LA-2 expression cassette into BDF1 mouse embryos. Of the 45 pups delivered, sequencing confirmed that two carried a complete LA-2 antibody knock-in, with one founder exhibiting the correct insertion at the target locus. Engineered mice were bred for multiple generations to assess both the heritability and stability of LA-2 antibody expression in homozygous and heterozygous mice. OspA ELIS As were then performed to quantify the concentration of LA- 2 antibodies that correctly bound the protective epitope on OspA (Fig. 2B). However, antibody levels showed major differences, with homozygous mice exhibiting the highest variability, ranging from negligible wild-type-equivalent levels to over 80 ng / mL.
[0284] Testing the Susceptibility of Liver-Specific Full-Length LA-2 Expressing Mice to Infection
[0285] To evaluate the efficacy of liver-specific full-length LA-2 antibodies in conferring heritable resistance to Borrelia burgdorferi infection, engineered mice from different filial generations and genotypes were challenged with Bozre / za-infected Ixodes dammini nymphs (Fig. 2C). Infected nymphs were prepared by feeding larval Ixodes dammini on Mus musculus infected with the low-passage N40 Borrelia burgdorferi strain (wildtype), which were maintain through tick-mouse-tick transfer (Fikrig, E. et al., Proc. Natl. Acad. Sci. U.S.A. 89, 5418-5421 1992). All infected nymphs were derived from a single vial with a 70% infection rate, as determined by indirect immunofluorescence (data not shown). During infestation, 10 nymphs were applied to the ears and nape of the neck of each anesthetized mouse. Nymphs were collected 4-6 days post-infestation. The number of engorged ticks recovered varied from 2 to 7 per mouse. Mice were held for 21 days post-infestation, after which serum was collected and analyzed using an endpoint ELISA to detect B. burgdorferi- specific antibodies against C6, a sensitive marker of infection (Bacon, R.M. et al., Infect. Dis. 187, 1187-1199 2003). Although some homozygous mice exhibited very low or undetectable C6 antibody levels, suggesting potential immunity, neither the homozygous nor heterozygous mice showed a statistically significant reduction in anti-C6 antibody levels compared to wildtype controls. As a result, this line was discontinued due to insufficient immunity (Fig. 2D).
[0286] 34
[0287] #18756472vl MML-082W001
[0288] Generation of Rosa26-Targeted LA-2 scFv-Albumin Mice
[0289] To develop a mouse model with enhanced antibody expression and improved resistance to infection, a mouse was generated with key modifications to the original design. First, the full-length LA-2 antibody was reformatted into a single-chain variable fragment (scFv) to address the expression challenges associated with bicistronic elements and to prevent the mispairing of the full length LA-2 heavy and light chains with endogenous antibodies. During reformatting, binding was tested and results indicated an almost one-log reduction in affinity when converting the full-length LA-2 IgG to an scFv with a Vh-(G4S)3- VI linker (Fig. 3A-B).
[0290] To optimize LA-2 scFv expression, stability, and binding, 15 different linker sequences were evaluated by generating expression constructs with a unique linker positioned between the LA-2 scFv-Fc heavy and light chains (Fig. 4A). Three constructs employed multimers of the commonly used GGGGS pentapeptide, while the remaining linkers were designed to modulate flexibility and length by varying the number of glycine and serine residues. To assess the various linkers, constructs were transfected into Lenti-X 293T cells, and 72 hours post-transfection, supernatant was collected for OspA and IgG2a ELISAs. The optimal linkers were identified by comparing binding data to that of purified full-length LA-2 antibody, with the top-performing linker demonstrating superior binding characteristics. This linker sequence, GGGGSGGGGSGGGGSGGGG (SEQ ID NO: 39), was selected for mouse model generation (Fig.4B).
[0291] Next, to generate engineered mice, a targeting construct was developed with modifications aimed at enhancing antibody expression and stability. Given the inherently short half-life of scFvs, the LA-2 scFv was fused to albumin, a strategy previously explored in therapeutic contexts to improve protein stability and extend half-life (Marsh, M.C. & Owen, S.C. AAPS J. 26, 3 2023; Tao, H. -Y. et al., nt. J. Biol. Macromol. 187, 24-34 2021). To ensure robust antibody production, the CAG enhancer / promoter was utilized. The CAG enhancer / promoter was known for driving high gene activity across various loci, including Rosa26 (Gu, B. et al., Nat. Biotechnol. 36, 632-637 2018). The LA-2 scFv-albumin was integrated into the Mus Rosa26 locus, a well-established safe harbor site known for stable and consistent transgene expression (Fig. 5A).
[0292] Pronuclear injection was performed to introduce SpCas9, guide RNA, and the LA-2 scFv-albumin expression cassette into embryos from B6 mice. Eighteen pups were produced and tested, with only one showing a complete antibody knock-in at the correct locus.
[0293] 35
[0294] #18756472vl MML-082W001
[0295] Testing Heritable Antibody Expression in Rosa26-Targeted LA-2 scFv-Albumin Mice
[0296] Engineered mice were bred for six generations, with each generation genotyped to ensure the presence of the LA-2 scFv-albumin antibody gene. Antibody expression was evaluated by testing serum samples from each generation for OspA-binding LA-2 antibody using a direct ELISA with an anti-albumin secondary antibody. Engineered mice produced at least 1000-fold more antibody compared to the previous design, with homozygous mice expressing roughly twice the amount seen in heterozygotes (Fig. 5B). Unlike the previous design, there was no variability in antibody production; animals with one copy of the gene consistently produced close to 0.25 mg / mL of antibody, while those with two copies produced approximately 0.5 mg / mL. Antibody expression remained consistent across successive generations, confirming stable, heritable expression. For context, total IgG concentrations typically range from 10-15mg / mL in Mus while all transgenes are likely to reduce fitness in the wild by default, these levels suggest that the scFv is unlikely to constitute a major burden. Antibody expression was consistent across successive generations, confirming stable, heritable expression.
[0297] Testing the Susceptibility of Rosa26-Targeted LA-2 scFv-Albumin Mice to Infection
[0298] To evaluate the resistance of newly engineered LA-2 scFv-albumin-expressing mice to Borrelia burgdorferi infection, and these mice were challenged alongside wild-type controls with B. burgdorferi-mfected nymphs (Fig. 5C). As in the previous challenge, ten nymphs were applied to each mouse and allowed to feed to repletion. Twenty-one days postchallenge, mice were bled, and serum was analyzed for B. burgdorferi-specific IgG antibodies against the C6 peptide (Fig. 5D). Both homozygous and heterozygous mice showed a statistically significant reduction in anti-C6 antibody production compared to wildtype controls. Homozygous mice, in particular, demonstrated robust protection from infection. Heterozygous mice also exhibited significant immunity (p=0.000179). The small subset showing reduced protection may reflect differences in infected tick o Borrelia burdens. Borrelia burdens. Notably, wild mice are seldom captured with more than a few nymphs attached (lii, S. R. T. & Goethert, H. K. Curr. Issues Mol. Biol. 42, 267-306 2021), most of which are not infected, suggesting that this infection challenge is quite stringent relative to what would be expected in the wild (Snow, A. A. et al. Insects 14, 628 2023). While further studies may be performed to fully characterize the full extent of protection in both heterozygous and homozygous mice, these results indicate a strong and heritable
[0299] 36
[0300] #18756472vl MML-082W001 immune response that guards against infection upon tick challenge, especially in homozygotes.
[0301] Evaluating Tick Infection Following the First Challenge with Rosa26-Targeted LA-2 scFv- Albumin Mice
[0302] Next, the nymphs from the previous challenge were assessed for infection to evaluate the borreliacidal activity of the scFv-albumin antibodies in the engineered mice, following a previously described protocol (Fikrig, E. et al., Proc. Natl. Acad. Sci. U.S.A. 89, 5418-5421 1992). To assess infection, engorged nymphs were collected 4-6 days post-infestation and stored for 14 days before analysis (Fikrig, E. et al., Proc. Natl. Acad. Sci. U.S.A. 89, 5418— 5421 1992). Ticks were homogenized, applied to slides, and stained by indirect immunofluorescence using a rabbit polyclonal serum against B. burgdorferi. Slides were examined at 400x magnification under epifluorescence, and the stained homogenates were scored for the relative density of B. burgdorferi and spirochetal morphology (intact vs. disrupted). For analysis, each tick was categorized based on the presence or absence of spirochetes, regardless of infection intensity (Fig. 5E). Intriguingly, while the scFv-albumin antibodies provided protection to the mice, they did not appear to reduce the spirochete load in the infected ticks used to challenge those mice, contrary to the previously reported mode of action for anti-OspA antibodies Fikrig, E. et al., Proc. Natl. Acad. Sci. U.S.A. 89, 5418-5421 1992).
[0303] Testing Borrelia Transmission to Uninfected Ticks Feeding on Previously Challenged Rosa26-Targeted LA-2 scFv-Albumin Mice
[0304] Even without Borrelia clearance, engineered mice may reduce or block transmission of the infection to the next generation of larvae. To assess the infection status of the mice post-challenge and determine whether anti-OspA antibodies impacted Borrelia transmission, xenodiagnosis was performed using uninfected larval ticks (Fig. 6A) (Marques, A. et al., Clin. Infect. Dis. 58, 937-945 2014). Twenty-one days after the challenge with infected ticks, mice were infested with uninfected larval Ixodes dammini ticks. Engorged larvae were collected and maintained until molting, approximately 4-5 weeks later. Post-molt, ticks were dissected and their gut contents smeared onto slides and stained via indirect immunofluorescence using a rabbit polyclonal serum specific to Borrelia burgdorferi. A minimum of 50 fields (X320) were examined per slide before a negative result was declared, and the infection rates per mouse were quantified (Fig. 6B). Detection of spirochetes in any
[0305] 37
[0306] #18756472vl MML-082W001 tick (e.g., 1 out of 5) was considered evidence of an infected and infectious mouse. A comparison of ticks feeding on wild-type versus engineered mice revealed a highly significant difference in infection status (p = 0.000685). Moreover, results indicate that 80% of the previously challenged engineered mice were completely free of infection.
[0307] Discussion
[0308] By introducing anti -Lyme antibody-encoded genes into the germline of Mus musculus, heritable resistance was conferred to Lyme disease. Antibody genes passed across multiple generations provided robust immunity to infection. The results of studies presented herein highlight the potential of heritable immunization as a strategy for controlling infectious diseases by genetically engineering reservoir species. These findings lay the groundwork for engineering Peromyscus leucopus , the main reservoir in North America, and have translational relevance in regions where Mus is thought to act as a reservoir, such as parts of Europe. The findings presented herein have immediate translational relevance, particularly in regions where mouse species are key reservoirs, such as Europe.
[0309] The same approach to engineering heritable immunity can be adapted to target a broad spectrum of vector-borne and zoonotic diseases by introducing specific antibodies or immune-modulating factors into the genomes of key wildlife species. Examples include carriers of hantaviruses (Mills, J.N. et al., Emerg. Infect. Dis. 5, 135-142 1999), leptospirosis (Gomes-Solecki, M. et al., Front. Immunol. 8, 58 2017), Lassa fever (Smither, A.R. et al., medRxiv doi: 10.1101 / 2023.03.17.23287380, 2023), and other emerging pathogens. Encoding immune protection directly into the germline could advance global efforts to prevent and control infectious diseases impacting animal and human health.
[0310] The results demonstrate effective immune protection, and the precise mechanism may be clarified with further study. Previous work suggested that anti-OspA antibodies neutralize Borrelia in the tick midgut via direct lysis or possibly complement activation (Fikrig, E. et al., Proc. Natl. Acad. Sci. U.S.A. 89, 5418-5421 1992). However, since the single-chain antibody that was employed did not clear Borrelia within the tick, another mechanism must be responsible for disrupting the transmission cycle. One plausible explanation, as proposed by Wang et al. Y. et al., J. Infect. Dis. 214, 205-211 2016, is that anti-OspA antibodies interfere with Borrelia" s gene switch from OspA to OspC, which is essential for spirochete infection of vertebrates (Wang, Y. et al., J. Infect. Dis. 214, 205-211 2016). This switch, regulated by environmental signals (temperature, pH, and spirochete density) within the tick during a blood meal, is crucial for the successful infection of a mammalian host (Schwan,
[0311] 38
[0312] #18756472vl MML-082W001
[0313] T.G. et al. Proc. Natl. Acad. Sci. U.S.A. 92, 2909-2913 1995). By binding to the surface of Borrelia, anti-OspA antibodies may prevent the bacteria from reaching the critical density required for the OspA / OspC gene switch, or alternatively, they may block interactions essential for transmission (de Silva, A.M. et al. Infect. Immun. 67, 30-35 1999). Although not wishing to be bound by a particular theory, by binding to the surface of Borrelia , anti- OspA antibodies may prevent the bacteria from reaching the critical density required for the OspA / OspC gene switch, or alternatively, they may block interactions essential for transmission (de Silva, A. M. et al. Infect. Immun. 67, 30-35 1999). Without Fc-mediated effector functions, the LA-2 scFv appears sufficient to prevent Borrelia from establishing infection in the mammalian host, highlighting that antibody binding alone, independent of Fc- driven immune mechanisms, could effectively disrupt the transmission cycle. Differences in affinity and avidity between the scFv and the full-length antibody may further contribute to these distinct findings. Future iterations incorporating new antibody formats designed to enhance affinity and avidity could be explored for increased efficacy, particularly in applications requiring bactericidal activity or targeting other pathogens.
[0314] This study represents an important advance in genetic immunization, demonstrating the feasibility and potential of heritable immunization strategies in reservoir species. Future research should focus on refining this approach, elucidating the mechanisms of immune protection, and conducting field trials to evaluate the real -world impact of heritable immunization strategies. The integration of such strategies into broader public health initiatives could transform infectious disease control, particularly in regions where vector- borne diseases threaten human and animal health.
[0315] Equivalents
[0316] Although several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the teachings of the present invention is / are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many
[0317] 39
[0318] #18756472vl MML-082W001 equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto; the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and / or methods, if such features, systems, articles, materials, and / or methods are not mutually inconsistent, is included within the scope of the present invention.
[0319] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.
[0320] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified, unless clearly indicated to the contrary.
[0321] All references, patents and patent applications and publications that are cited or referred to in this application are incorporated by reference in their entirety herein.
[0322] What is claimed is:
[0323] 40
[0324] #18756472vl
Claims
MML-082W001CLAIMS1. A method of preparing a subject comprising heritable immunity to an infectious disease, the method comprising:(a) inserting a sequence encoding at least one independently selected heritable antibody or a functional fragment thereof at a preselected first target gene locus in the subject; and(b) expressing in the subject the encoded at least one heritable antibody or the functional fragment thereof, thereby producing in the subject resistance to the infectious disease, wherein breeding the subject with the produced resistance results in resistance to the infectious disease in one or more descendants of the subject.
2. The method of claim 1, wherein the infectious disease is a vector-borne disease.
3. The method of claim 1, wherein the at least one is one or a plurality comprising 2, 3,4. 5, 6, or more.
4. The method of claim 1, wherein the infectious disease is viral disease, a bacterial disease, a fungal disease, or a parasitic disease.
5. The method of claim 1, wherein the infectious disease is an infectious disease for which rodents are a primary disease reservoir for the infectious disease.
6. The method of claim 1, wherein the infectious disease is Lyme disease, a hantavirus disease, leptospirosis, Lassa fever, Lymphocytic choriomeningitis virus, South American hemorrhagic fever, Plague (Yersinia pestis), tick-borne encephalitis, Rat-bite fever (Streptobacillus moniliformis, Spirillum minus), Hard tick relapsing fever (Borrelia miyamotoi disease), Babesiosis, Ehrlichiosis, Anaplasmosis, or Powassan virus disease.
7. The method of claim 6, wherein the hantavirus disease is Sin Nombre virus, Seoul virus, or Puumala virus.
8. The method of claim 7, wherein the South American hemorrhagic fever virus is Junin virus, Machupo virus Guanarito virus, or Sabia virus.41#18756472vlMML-082W0019. The method of claim 1, wherein the preselected first target gene locus comprises a Rosa26 locus, an Apoal locus, or an albumin locus.
10. The method of claim 1, wherein the preselected first target gene locus comprises an Alpha- 1 antitrypsin locus or an Ornithine Transcarbamylase (OTC) locus.
11. The method of claim 1, wherein the expressed heritable antibody or the expressed functional fragment thereof is fused to a protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof.
12. The method of claim 11, wherein the protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof is albumin or Fc domain.
13. The method of claim 1, wherein inserting the sequence encoding the heritable antibody or functional fragment thereof comprises administering an expression cassette and CRISPR components to the subject.
14. The method of claim 13, wherein the CRISPR components comprise guide sequences and a DNA endonuclease, optionally wherein the DNA endonuclease comprises a Cas9 sequence, and optionally wherein the Cas9 sequence comprises a ScCas9 sequence or a SpCas9 sequence.
15. The method of claim 13, wherein the administering to the subject occurs when the subject is an embryo, optionally using pronuclear injection.
16. The method of claim 13, wherein the expression cassette comprises a sequence encoding the heritable antibody or functional fragment thereof.
17. The method of claim 1, wherein the heritable functional fragment of the heritable antibody comprises a single-chain variable fragment (scFv) of the heritable antibody.
18. The method of claim 1, wherein the heritable functional fragment of the heritable antibody comprises a light chain of the heritable antibody or a functional fragment thereof.42#18756472vlMML-082W00119. The method of claim 1, wherein the heritable functional fragment of the heritable antibody comprises a heavy chain of the heritable antibody or a functional fragment thereof.
20. The method of claim 13, wherein the expression cassette further comprises a promoter and a preselected leader sequence.
21. The method of claim 20 wherein the promoter comprises an enhancer element.
22. The method of claim 20 wherein the promoter does not comprise an enhancer element.
23. The method of claim 20, wherein the inserted sequence comprises a plurality of heritable antibodies or functional fragments thereof and the expression cassette comprises a first promoter that drives expression of at least one of the plurality of heritable antibodies and a second promoter that drives expression of at least one different antibody of the plurality of antibodies.
24. The method of claim 20, wherein the inserted sequence comprises sequences encoding a plurality of heritable antibodies or functional fragments thereof and the expression cassette comprises a plurality of promoters that each drive expression of a different one of the plurality of heritable antibodies.
25. The method of claim 1, wherein the inserted sequence encodes a plurality of heritable antibodies or functional fragments thereof, wherein the inserted sequence encodes a 2A peptide or IRES between each of the encoded heritable antibodies or functional fragments thereof.
26. The method of claim 1, wherein the inserted sequences comprise at least one multiformat heritable antibody or functional fragment thereof.
27. The method of claim 20 wherein the preselected leader sequence is selected to direct the expressed heritable antibody or functional fragment thereof to the bloodstream of the subject after the subject’s birth.43#18756472vlMML-082W00128. The method of claim 1, wherein the subject is a vertebrate or an invertebrate.
29. The method of claim 28, wherein the invertebrate is an insect, optionally a mosquito.
30. The method of claim 1, wherein the subject is a mammal, optionally a rodent.
31. The method of claim 1, wherein the subject is a member of the genus Peromyscus.
32. The method of claim 28, wherein the vertebrate is a bird.
33. The method of claim 1, wherein the antibody comprises an OspA-targeting antibody.
34. The method of claim 1, wherein the antibody comprises an anti -Leptospira antibody, an anti-Lassa fever virus antibody, an anti-Y. pestis antibody, an anti-Hantavirus antibody, an anti-Tick-borne encephalitis antibody, an anti-Borrelia miyamotoi antibody, an anti-Babesia antibody, an anti-Powassan virus antibody, or an anti-Lymphocytic choriomeningitis virus antibody.
35. The method of claim 1, wherein increasing resistance to the infectious disease comprises a reducing a level risk of the subject contracting the disease compared to a control level of risk, optionally, wherein the control level of risk comprises a level of risk in a subject not comprising the heritable immunity to the infectious disease.
36. The method of claim 1, wherein increasing resistance of the infectious disease comprises reducing severity of the infectious disease in the subject compared to a control severity of the infectious disease, optionally wherein the control severity comprises severity of the infectious disease in a subject not comprising the heritable immunity to the infectious disease.
37. The method of claim 1, further comprising determining in at least a portion of the descendants of the subject, the presence of expression of the heritable antibody or the functional fragment thereof.
38. The method of claim 1, wherein the antibody is a recombinant antibody.44#18756472vlMML-082W00139. The method of claim 1, further comprising:(a) inserting a sequence encoding at least one additional independently selected heritable antibody or a functional fragment thereof at a second preselected target gene locus in the subject; and(b) expressing in the subject the at least one additional independently selected heritable antibody or the functional fragment thereof encoded by the inserted sequence, thereby producing in the subject resistance to the infectious disease, wherein breeding the subject with the produced resistance results in resistance to the infectious disease in one or more descendants of the subject.
40. The method of claim 39, wherein the sequence inserted at the second preselected target gene locus is different from the sequence inserted at the first preselected target gene locus.41 The method of claim 1, wherein the level of transmission of the infectious disease by the subject and the subject’s descendants is reduced compared to a control level of transmission, optionally wherein the control level of transmission comprises the level of transmission of the infectious disease by a subject not comprising the heritable immunity to the infectious disease.
42. A model subject comprising heritable immunity to an infectious disease, the model subject comprising: at least one heritable antibody or a functional fragment thereof that is an expression product of an independently selected sequence inserted at a preselected first target gene locus in the subject, wherein the at least one heritable antibody or functional fragment thereof produces resistance to the infectious disease in the model subject.
43. The model subject of claim 42, wherein one or more descendants of the model subject are resistant to the infectious disease.
44. The model subject of claim 42, wherein the resistance comprises a reduced level risk of contracting the infectious disease and / or a reduced severity of the infectious disease compared to a control level of risk and / or a control severity, respectively.45#18756472vlMML-082W00145. The model subject of claim 42, wherein the control level of risk comprises the level of risk of the infectious disease in a subject not comprising the heritable immunity to the infectious disease.
46. The model subject of claim 42, wherein the control severity comprises the severity of the infectious disease in a subject not comprising the heritable immunity to the infectious disease.
47. The model subject of claim 42, wherein the infectious disease is a vector-borne disease.
48. The model subject of claim 42, wherein the infectious disease is viral disease, a bacterial disease, a fungal disease, or a parasitic disease.
49. The model subject of claim 42, wherein the infectious disease is Lyme disease, a hantavirus disease, leptospirosis, or Lassa fever.
50. The model subject of claim 42, wherein the preselected first target gene locus comprises a Rosa26 locus.
51. The model subject of claim 42, wherein the heritable antibody or the functional fragment thereof is expressed from an expression cassette.
52. The model subject of claim 42, wherein the expressed the heritable antibody or the functional fragment thereof is fused to a protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof.
53. The model subject of claim 52, wherein the protein that enhances stability of the expressed heritable antibody or the expressed functional fragment thereof is albumin.
54. The model subject of claim 42, further comprising CRISPR components comprising a plurality of guide sequences and a DNA endonuclease, optionally wherein the DNA endonuclease comprises a Cas9 sequence, and optionally wherein the Cas9 sequence comprises a ScCas9 sequence or a SpCas9 sequence.46#18756472vlMML-082W00155. The model subject of claim 42, wherein the heritable functional fragment of the heritable antibody comprises a single-chain variable fragment (scFv) of the heritable antibody.
56. The model subject of claim 42, wherein the heritable functional fragment of the heritable antibody comprises a light chain of the heritable antibody or a functional fragment thereof.
57. The model subject of claim 42, wherein the heritable functional fragment of the heritable antibody comprises a heavy chain of the heritable antibody or a functional fragment thereof.
58. The model subject of claim 51, wherein the expression cassette further comprises a promoter and a preselected leader sequence.
59. The model subject of claim 58, wherein the preselected leader sequence is selected to direct the expressed heritable antibody or functional fragment thereof to the bloodstream of the subject after the subject’s birth.
60. The model subject of claim 42, wherein the subject is a vertebrate or an invertebrate.
61. The model subject of claim 60, wherein the invertebrate is a mosquito.
62. The model subject of claim 60, wherein the vertebrate is a mammal, optionally a rodent.
63. The model subject of claim 60, wherein the vertebrate is a bird.
64. The model subject of claim 42, wherein the antibody comprises an OspA-targeting antibody.
65. The model subject of claim 42, wherein increasing resistance to the infectious disease comprises a reducing a level risk of the subject contracting the disease compared to a control47#18756472vlMML-082W001 level of risk, optionally, wherein the control level of risk comprises the level of risk in a subject not comprising the heritable immunity to the infectious disease.
66. The model subject of claim 42, wherein increasing resistance of the infectious disease comprises reducing severity of the infectious disease in the subject compared to a control severity of the infectious disease, optionally wherein the control severity comprises severity of the infectious disease in a subject not comprising the heritable immunity to the infectious disease.
67. The model subject of claim 42, further comprising determining in at least a portion of the descendants of the subject, the presence of expression of the heritable antibody or the functional fragment thereof.
68. The model subject of claim 42, wherein the model subject is in captivity.
69. The model subject of claim 42, wherein the model subject is released into the wild.
70. The model subject of claim 42, wherein the model subject is in the wild.
71. The model subject of claim 42, wherein the antibody is a recombinant antibody.
72. The model subject of claim 42, further comprising: at least one additional independently selected heritable antibody or a functional fragment thereof that is an expression product of an independently selected sequence inserted at a preselected second target gene locus in the subject, wherein the at least one additional independently selected heritable antibody or functional fragment thereof produces resistance to the infectious disease in the model subject.
73. The model subject of claim 72, wherein the sequence inserted at the second target gene locus is different from the sequence inserted at the first target gene locus.
74. The model subject of claim 42, wherein model subject and at least a portion of descendants of the model subject have a reduced level of transmission of the infectious disease compared to a control level of transmission, optionally wherein the control level of48#18756472vlMML-082W001 transmission comprises the level of transmission of the infectious disease by a subject not comprising the heritable immunity to the infectious disease.
75. A method of reducing an infectious disease in a population of organisms, the method comprising releasing a model subject of claim 42, into a population of the organisms.
76. The method of claim 75, wherein the population of the organisms is in captivity.
77. The method of claim 75, wherein the population of the organisms is in the wild.
78. The method of claim 75, wherein at least a portion of descendants of the released model subject comprise heritable immunity to the infectious disease.49#18756472vl