RNA nanocages
RNA nanocages based on ROOL IncRNA address the limitations of existing RNA structures by enabling efficient assembly and delivery of cargos, achieving stable and functional delivery into target cells.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF MASSACHUSETTS
- Filing Date
- 2025-12-19
- Publication Date
- 2026-06-25
Smart Images

Figure US2025060769_25062026_PF_FP_ABST
Abstract
Description
Attorney Docket: 4904 / 1037WORNA NanocagesCross-Reference to Related Applications
[0001] The present application claims the benefit of U. S. Provisional Application No.63 / 737,548 filed December 20, 2024, and U. S. Provisional Application No. 63 / 737,997 filed December 23, 2024, the content of each of which is hereby incorporated by reference in its entirety for all purposes.Government Rights in Invention
[0002] This invention was made with Government support under Agreement No.GM150953, awarded by the National Institutes of Health. The Government has certain rights in the invention.Technical Field
[0003] The present invention relates to RNA nanocages, and more particularly to nanocage multimers comprising a ROOL (rumen-originating, ornate, large) IncRNA.Background Art
[0004] Long (>200 nucleotides) non-coding RNAs (IncRNAs) play important roles in diverse aspects of life. Over 20 classes of IncRNAs have been identified in bacteria and bacteriophages through comparative genomics analyses, but their biological functions remain largely unexplored1’3. Due to the large sizes, the structural determinants of most IncRNAs also remain uncharacterized. Most RNA nanostructures reported so far are based on artificial design, and are limited in size.Summary of the Embodiments
[0005] In accordance with one embodiment, the disclosure provides an RNA comprising ROOL (rumen-originating, ornate, large) IncRNA, the RNA having a cargo coupled to aterminus of the RNA selected from the group consisting of a 3’ terminus, a 5’ terminus, and combinations thereof. The ROOL IncRNA may be selected from the group consisting of ROOLEfaand ROOLFirm. The cargo may be a nucleic acid, a peptide, a protein, or a small molecule. The a nucleic acid may be selected from the group consisting of an aptamer, a pre-tRNA, a tRNA, a pri-miRNA, a microRNA, a pre-siRNA, a siRNA, an antisense oligonucleotide, a messenger RNA, a non-coding RNA, a nucleic acid segment having a sequence configured to anneal with a second nucleic acid sequence, and combinations thereof. In some embodiments, the cargo is coupled to the terminus of the RNA by a linker. The linker may be configured to be cleavable by an enzyme or a physiological condition / parameter. In some embodiments, the linker comprises a nucleic acid sequence, a peptide sequence, or a cleavable chemical moiety.
[0006] In accordance with another embodiment, the disclosure provides a nanocage multimer comprising: a set of RNA monomers, each RNA monomer of the nanocage multimer comprising a ROOL (rumen-originating, ornate, large) IncRNA, wherein the set of RNA monomers are configured to assemble into the nanocage multimer; and a cargo. The multimer may be an octamer. In some embodiments, the ROOL IncRNA is selected from the group consisting of ROOLEfa, ROOLFirm, and combinations thereof. The ROOL IncRNA may lack disordered regions. In some embodiments, the cargo is coupled to a terminus of at least one of the set of RNA monomers, the terminus being selected from the group consisting of a 3’ terminus, a 5’ terminus, and combinations thereof. The cargo may be selected from the group consisting of a nucleic acid, a protein, a small molecule, and combinations thereof. In some embodiments, the cargo is a nucleic acid selected from the group consisting of an aptamer, a pre-tRNA, a tRNA, a pri-miRNA, a microRNA, a pre-siRNA, a siRNA, an antisense oligonucleotide, a messenger RNA, a non-coding RNA, a nucleic acid segment having a sequence configured to anneal with a second nucleic acid sequence, and combinations thereof. The cargo may be coupled to the terminus of the at least one of the set of RNA monomers by a linker. In some embodiments, the linker is configured to be cleavable by an enzyme or a physiological condition / parameter. In some embodiments, the cargo is configured to be radially displayed (i.e., positioned) from the nanocage multimer. In other embodiments, the cargo may be encapsulated within the nanocage multimer. The nanocage multimer having the encapsulatedcargo may also comprise radially displayed (i.e., positioned) cargo, which may differ from the encapsulated cargo.
[0007] In accordance with yet another embodiment, the disclosure provides a nucleic acid construct encoding the RNA comprising ROOL IncRNA disclosed above. The nucleic acid construct may further encode the cargo, the encoded cargo comprising a sequence configured to be contiguous with the RNA comprising ROOL IncRNA upon transcription of the RNA comprising ROOL IncRNA. The nucleic acid construct may further encode the linker, the encoded linker comprising a sequence configured to be contiguous with the RNA comprising ROOL IncRNA upon transcription of the RNA comprising ROOL IncRNA.
[0008] In accordance with one embodiment, the disclosure provides a method of delivering a cargo into a target cell, the method comprising: introducing, into the target cell, the nucleic acid construct.
[0009] In accordance with another embodiment, the disclosure provides a method of delivering a cargo into a target cell, the method comprising: transcribing the nucleic acid construct in vitro, thereby producing a transcription product comprising the RNA comprising ROOL IncRNA; and delivering the transcription product into the target cell.
[0010] In accordance with yet another embodiment, the disclosure provides a method of delivering a cargo into a target cell, the method comprising: transcribing the nucleic acid construct in vitro, thereby producing a transcription product comprising the RNA comprising ROOL IncRNA; assembling the nanocage multimer comprising the set of RNA monomers; and delivering the assembled nanocage multimer into the target cell. The nanocage multimer may assemble automatically or spontaneously, or conditions may be provided to cause assembly. In some embodiments, upon the assembling of the nanocage multimer, the cargo is encapsulated within the nanocage multimer.Brief Description of the Drawings
[0011] The foregoing features of embodiments will be more readily understood by reference to the following detailed description, taken with reference to the accompanying drawings, in which:
[0012] Figs. 1A-D: Cryo-EM analyses of ROOLEfa(SEQ ID NO: 2) and ROOLFirm(SEQ ID NO: 1). Fig. 1A is a graphic showing ROOL-encoding bacteria associated with humandiseases. Circle sizes and shading indicate enrichment scores of each bacteria species or group for certain diseases available from the Human Gut Microbiome Atlas. The two ROOL RNA-bearing bacteria species or groups used in this study and their associated human diseases are indicated with asterisks, in accordance with embodiments of the present disclosure. Fig. IB shows cryo-EM maps of ROOLEfa (o = 2.88) determined at 2.9 A resolution (top, side, and bottom views, respectively), in accordance with embodiments of the present disclosure. Fig. 1C shows cryo-EM maps of ROOLFirm(o = 4.16) determined at 2.9 A resolution (top, side, and bottom views, respectively), in accordance with embodiments of the present disclosure. Fig. ID shows an alignment of ROOLEfa (o = 3.88) and ROOLFirm(o = 3.97) maps, demonstrating they share a similar architectures, in accordance with embodiments of the present disclosure.
[0013] Figs. 2A-H: Tertiary interactions stabilize each ROOLEfa monomer (SEQ ID NO: 2) in a nanocage. Fig. 2A is a molecular model of a ROOLEfa monomer within an octameric structure. Close-up views of examples of tertiary interactions stabilizing the monomer are shown in boxed panels, in accordance with embodiments of the present disclosure. Fig. 2B, Fig. 2C, Fig. 2D, Fig. 2E, Fig. 2F, and Fig. 2G-show zoomed in maps of the boxed panels of Fig. 2A (labeled B, C, D, E, F, and G, respectively) rendered as a transparent surface (o = 2.88), in accordance with embodiments of the present disclosure. Fig. 2H shows a secondary structure annotation of ROOLEfa within an octamer, in accordance with embodiments of the present disclosure. Figure discloses SEQ ID NOS 17-19, respectively, in order of appearance.
[0014] Figs. 3A-H: Quaternary interactions stabilize ROOLEfa octamer. Fig. 3A shows a top front view of an ROOLEfa tetramer looking down its four-fold axis, in accordance with embodiments of the present disclosure. Fig. 3B shows an inside view of a ROOLEfa tetramer (turned 180° with respect to Fig. 3 A), in accordance with embodiments of the present disclosure. This inside view was obtained by flipping the molecule Fig. 3 A. The ROOLEfa dimer is stabilized by four key interactions, the close-up views of which are shown in boxed panels C-F with map rendered as transparent surface (o = 2.88). Fig. 3C shows a close-up view of the interactions shown in boxed panel C of Figs. 3 A and 3B (with map rendered as transparent surface (o = 2.88)), in accordance with embodiments of the present disclosure. Fig. 3D shows a close-up view of the interactions shown in boxed panel D of Figs. 3 A and 3B (with map rendered as transparent surface (o = 2.88)), in accordance with embodiments of the present disclosure. Fig. 3E shows a close-up view of the interactions shown in boxed panel E of Fig. 3B (with maprendered as transparent surface (σ = 2.88)), in accordance with embodiments of the present disclosure. Fig. 3F shows a closc-up view of the interactions shown in boxed panel F of Fig. 3B (with map rendered as transparent surface (σ = 2.88)), in accordance with embodiments of the present disclosure. Fig. 3G is molecular model of a ROOLFirmmonomer within an octameric structure, in accordance with embodiments of the present disclosure. Fig. 3H shows an alignment of ROOLEfa and ROOLFirmstructures of monomers within the corresponding octamers shows highly similar architecture, in accordance with embodiments of the present disclosure.
[0015] Figs. 4A-E: Analyses of ROOLFirmvariants. Fig. 4A shows poorly resolved (disordered) regions located in the cavities of ROOLFirmand ROOLEfa nanocages, in accordance with embodiments of the present disclosure. These regions are labeled DI, D2 in ROOLFirmand D, D' in ROOLEfa. The Gaussian filter with width 1.64 for sharpened cryo-EM map is displayed at the following contours: 2.74 G for ROOLFirm, 2.49 G for ROOLEfa. Fig. 4B shows diagrams of ROOLFirmwild-type (WT) (SEQ ID NO: 1) and tested deletion mutants (SEQ ID NOS: 3-5 in order of appearance), in which disordered regions were removed, in accordance with embodiments of the present disclosure. Each rounded-comer box represents a helix scaled to length in the structure, in accordance with embodiments of the present disclosure. Fig. 4C shows a negative-stain analysis indicating that ROOLFirmdeletion mutants without disordered regions can form nanocages similar to those formed by WT ROOLFirm, in accordance with embodiments of the present disclosure. This experiment was performed once with two micrographs collected for each RNA. Fig. 4D shows a design of ROOL-cargo RNA fusions, in accordance with embodiments of the present disclosure. Fig. 4E shows that, when fused to a Mango-III aptamer, pre-tRNA (SEQ ID NO: 6), or primary microRNA (pri-miRNA) (SEQ ID NO: 7) at the 3' end, ROOLFirmforms stable nanocages with radially displayed cargos demonstrated by negative-stain EM (micrographs) and corresponding 2D averages (examples of 12 classes are shown for each construct), negative-stain EM (micrographs shown) and corresponding 2D averages (examples of 12 classes are shown for each construct), in accordance with embodiments of the present disclosure. This experiment was performed once with >70 micrographs collected for each RNA.
[0016] Figs. 5A-E: Structure of the individual ROOLEfa monomer. Fig. 5A is a cryo-EM map of ROOLEfamonomer at 3.25 Å resolution (σ = 12.02), in accordance with embodiments of the present disclosure. Fig. 5B shows a comparison of a ROOLEfa individual monomer with a monomer within the octameric assembly, in accordance with embodiments of the presentdisclosure. Fig. 5C shows a comparison of an individual monomer with a dimer within the octamcr detailing the rearrangements required to form two kissing-loop interactions shown in boxed panels D and E, in accordance with embodiments of the present disclosure. Fig. 5D shows boxed panel D of Fig. 3C, in accordance with embodiments of the present disclosure. Fig.5E shows boxed panel E of Fig. 3C, in accordance with embodiments of the present disclosure.
[0017] Fig. 6 is a chart showing ROOLFirm-pre-sup-tRNALysand tRNATyrsuppressor tRNA are effective at achieving readthrough of a premature stop codon in a GFP coding sequence in HEK293T cells, in accordance with embodiments of the present disclosure.
[0018] Fig. 7 shows microscopic images of HEK293T cells transfected with negative control (vector), a vector having Mango-III only (Mango-III), and a vector expressing ROOLFirm-Mango-III, in accordance with embodiments of the present disclosure.Detailed Description of Specific Embodiments
[0019] Definitions. As used in this description and the accompanying claims, the following terms shall have the meanings indicated, unless the context otherwise requires:
[0020] A “set” includes at least two members.
[0021] A “cargo” is a biologically active portion of an RNA comprising ROOL IncRNA, not including the ROOL IncRNA portion or a linker portion of the RNA comprising ROOL IncRNA, in accordance with embodiments of the present disclosure. For example, the cargo may include a nucleic acid, a peptide, a protein, or a small molecule having biological activity apart from a ROOL IncRNA and a linker contiguous.
[0022] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.
[0023] The terms “a” and “an” and “the” and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to coverboth the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
[0024]
[0025] Highly structured ncRNAs contribute to the most fundamental biological processes. Well-known examples include ribosomal and transfer RNAs (rRNAs and tRNAs) performing protein synthesis, group II introns mobilizing genetic elements4, and signal recognition particle RNAs that target secretory proteins to the membrane5. Comparative genomics analyses have identified hundreds of other structured ncRNAs in bacteria6,7, including ~20 classes of long ncRNAs whose functions remain unknown1’3. ROOL RNAs of ~600 nt, originally discovered in metagenomics data from cow rumen, have been identified in bacteriophage genomes and at least three phyla of bacteria2, many of which are opportunistic pathogens that inhabit the human mucosa and contribute to diseases (Fig. 1 A). An even larger, ~800-nt GOLLD (Giant, Ornate, Lake- and Lactobacillales-Derived) IncRNA is smaller only than 23 S and 16S rRNAs and proposed to be involved in bacteriophage lysis, but its exact role is still unknown1. Both ROOL and GOLLD RNAs often reside next to tRNAs (sometimes overlapping by a few nucleotides) in the genome and can be found in prophages, suggesting that they may have related biological functions2. ROOL RNA has unusually high expression, comparable to that of 16S rRNA, in some strains of Lactobacillus salivarius, though its deletion from L. salivarius caused no obvious phenotype in laboratory conditions8.
[0026] Here we have used single-particle cryo-EM analysis to determine the structures of two 580-nt long ROOL RNAs: ROOLj a from Enterococcus faecalis JH1 (2.94 A), and ROOLFirmfrom Firmicutes bacterium CAG:227 (2.93 A), both of which are gram-positive bacteria that belong to the Bacillota (Firmicutes) phylum. Enterococcus faecalis JH1 is an isolated clinical strain that can contribute to bacteremia, endocarditis, and urinary infection, while Firmicutes bacterium CAG:227 belongs to the Lachnospiraceae family, which is among the most abundant taxa in the human gut microbiota. We find that these ROOL RNAs form highly similar cage-like structures composed of eight ROOL monomers. In addition, we obtainedthe individual ROOLEfamonomer structure at ~3.2-Å resolution. Comparison of the monomer with the octamer suggests an assembly mechanism involving strand swapping. Furthermore, we explored the possibility of using ROOL RNA as a nanocarrier. Fusing various RNA cargos at the 3' end of a ROOL RNA does not disrupt the octameric structure, highlighting the potential of using ROOL to stabilize and deliver RNA or other cargos for research and therapeutics.
[0027] In accordance with some embodiments, the present disclosure provides an RNA comprising ROOL (rumen-originating, ornate, large) IncRNA (“ROOL”), the RNA having a cargo coupled to a 3’ terminus, a 5’ terminus, or both a 3’ terminus and a 5’ terminus of the ROOL. The ROOL, having the cargo, is configured for assembly into nanocage multimer. The nanocage multimer may be an octamer. The ROOL may, e.g., comprise ROOLEfaor ROOLFirm. ROOL IncRNAs share a conserved structure and ROOL IncRNAs other than ROOLEfaand ROOLFirmare also contemplated as part of the present disclosure.
[0028] In some embodiments, the cargo includes, but is not limited to, a nucleic acid such as an aptamer, a pre-tRNA, a tRNA, a pri-miRNA, a pre-miRNA, a micro RNA, a presiRNA, an siRNA, an antisense oligonucleotide, a messenger RNA (mRNA), a non-coding RNA, or a nucleic acid segment having a sequence configured to anneal with a second nucleic acid sequence, e.g., an RNA sequence. In other embodiments, the cargo may include, but is not limited to, a peptide, a protein, or a small molecule. The cargo may be coupled to the 3’ terminus, the 5’ terminus, or both the 3’ terminus and the 5’ terminus of the ROOL by a linker. The linker may be a cleavable linker configured to be cleaved by an enzyme, or other physiological condition / parameter (e.g., pH), as known to those of skill in the art now and in the future. The cleavable linker may be a nucleic acid sequence, a peptide sequence, or other chemical moiety known by one of ordinary skill in the art to be cleavable by an enzyme, or other physiological condition / parameter, now and in the future.
[0029] In accordance with other embodiments, the present disclosure provides a nanocage multimer comprising a set of RNA monomers and a cargo, each RNA monomer of the nanocage multimer comprising a ROOL, wherein the set of RNA monomers are configured to assemble into a nanocage multimer. The nanocage multimer may be an octamer. The ROOL may, e.g., comprise ROOLEfaor ROOLFirm. ROOL IncRNAs share a conserved structure and RNA monomers comprising ROOL IncRNAs other than ROOLEfaand ROOLFirmare also contemplated as part of the present disclosure. The cargo may be coupled to at least one RNAmonomer of the nanocage multimer. In some embodiments, the cargo may be encapsulated by the nanocage multimer. In some embodiments, the cargo includes, but is not limited to, a nucleic acid such as an aptamer, a pre-tRNA, a tRNA, a pri-miRNA, a pre-miRNA, a microRNA, a presiRNA, an siRNA, an antisense oligonucleotide, a messenger RNA (mRNA), a non-coding RNA, or a nucleic acid segment having a sequence configured to anneal with a second nucleic acid sequence, e.g., an RNA sequence. In other embodiments, the cargo may include, but is not limited to, a peptide, protein, or a small molecule. In some embodiments, the cargo is coupled to a 3 ’ terminus, a 5 ’ terminus, or both a 3 ’ terminus and a 5 ’ terminus of at least one of the RNA monomers. The cargo may be configured to be radially displayed from the nanocage multimer. The cargo may be coupled to the 3’ terminus, the 5’ terminus, or both the 3’ terminus and the 5’ terminus of the RNA monomer comprising ROOL by a linker. The linker may be a cleavable linker configured to be cleaved by an enzyme, or other physiological condition / parameter (e.g., pH), as known to those of skill in the art now and in the future. The cleavable linker may be a nucleic acid sequence, a peptide sequence, or other chemical moiety known by one of ordinary skill in the art to be cleavable by an enzyme, or other physiological condition / parameter, now and in the future. In some embodiments, the nanocage multimer comprises radially displayed cargo as well as encapsulated cargo. A given cargo may be the same as or different than any other given cargo.
[0030] In accordance with some embodiments, the present disclosure provides nucleic acid construct encoding an RNA comprising ROOL, disclosed above. The nucleic acid construct may encode the cargo and may encode the linker, such that the cargo and / or linker sequence is coupled to (i.e., contiguous with) the ROOL sequence upon transcription.
[0031] In accordance with some embodiments, the present disclosure provides a method for delivering a cargo into a target cell, the method comprising delivering the nucleic acid construct encoding the RNA comprising ROOL, disclosed above, into a target cell using methods known to those of skill in the art now and in the future. The nucleic acid construct may encode the cargo and may encode the linker, such that, when the encoded ROOL is transcribed, the cargo and / or linker sequence is coupled to (i.e., contiguous with) the ROOL sequence upon transcription. In some embodiments, the nucleic acid construct is transcribed in vitro, thereby producing a transcription product. The transcription product is then delivered into the target cell using methods known to those of skill in the art now and in the future. In some embodiments thetranscription product is assembled into a nanocage multimer (with or without an encapsulated cargo) and then delivered into the target cell using methods known to those of skill in the art now and in the future.
[0032] In accordance with some embodiments, the present disclosure provides a method for delivering a cargo into a target cell, the method comprising transcribing the nucleic acid construct encoding the RNA comprising ROOL, disclosed above, in vitro, thereby producing a transcription product, and coupling the cargo to a 3’ terminus, a 5’ terminus, or both a 3’ terminus and a 5 ’ terminus of the transcription product. The cargo-coupled transcription product may then be delivered into the target cell using methods known to those of skill in the art now and in the future. In some embodiments, the transcription product is assembled into a nanocage multimer (with or without an encapsulated cargo) and then delivered into the target cell using methods known to those of skill in the art now and in the future.
[0033] Example 1: Architecture of ROOL octamers
[0034] Both ROOLEfaand ROOLFirmform octameric cage-like structures with a 28-nm diameter and 20-nm axial length (Figs. 1B-D). The octamers consist of top and bottom halves, each containing four monomers (Fig. 1B-C). Each monomer consists of 16 helical regions (Hl-H16) forming extensive tertiary interactions to stabilize the slightly curved shape (Fig. 2A and 2H). These include kissing loops, triple-strand A-minor interactions, base stacking, Z-anchors, and base-triple-mediated 90° turns (Figs. 2A-H). We propose the term “A-minor staples” to describe the triple-strand A-minor interactions in keeping with the nomenclature of three-strand junctions9. Kissing loops and A-minor interactions form the majority of inter-helical interactions. In ROOLEfa, the most prominent are the kissing loops of Hl 1 and H12 at nucleotides 303-306 and 359-362 held together by four Watson-Crick base pairs (Fig. 2D). As discussed below, this interaction appears crucial for the octamer assembly. The A-rich loop of H6 also engages in a kissing-loop-like interaction with the A-rich internal loop of H8 (Fig. 2E), as the adenosines 148 and 149 form base triples with the U205-A336 and C204-G337 pairs. In addition, ROOLEfafeatures numerous intramolecular A-minor interactions, the most abundant tertiary interaction in most RNAs9. A-minor interactions usually involve two consecutive adenosines packed against a minor groove of an RNA helix, so that the riboses are placed next to each other to hydrogen bond. They play crucial roles in RNA stabilization and molecular recognition, including tetraloop-receptor recognition10-13, mRNA decoding by tRNA14-16, and transfer-messenger-RNA(tmRNA) stabilization within the ribosome17. In ROOLsfa, an intriguing A-minor staple involving A218 and A219, with A96 stacked on top, holds together three helical elements H4, H9 and H10 (Fig. 2F). This junction is buttressed by another A-minor staple involving stacked adenosines A295, A296 (H10) and A216 (H9) docked at H4 (Fig. 2G). In both A-minor staples, the non-consecutive adenosine provides the stacking platform for the consecutive adenosines but its ribose does not hydrogen bond with the corresponding minor groove. As discussed below, these interactions also enable the monomer to adopt the octamer-compatible conformation.
[0035] To probe the oligomerization states of ROOL RNAs in solution, we characterized ROOLEfa and ROOLFirmby mass photometry and size-exclusion chromatography (SEC). At a concentration of 50-100 nM, monomer and octamer were the two major molecular species detected by mass photometry. Nevertheless, dimer, tetramer, decamer, and octadecamer species were also detected, suggesting that ROOL can form additional types of oligomers (data not shown). Consistent with these results, octamers and monomers eluted in two major peaks from a SEC column (data not shown). Negative-stain EM and dynamic light scattering data further corroborate the SEC and mass photometry data (data not shown), underscoring the predominance of octameric and monomeric species discussed below.
[0036] Example 2: Intermolecular interactions in ROOLEfa
[0037] The radial array of ROOLEfa monomers that form each tetramer is stabilized primarily by kissing-loop and A-minor interactions (Figs. 3A-F). The four- fold axis is surrounded by the H9 helices of each monomer docked into each other. Here, the loop nucleotides G231 and U232 of one monomer pair with the intrahelical C224 and A223 of a neighboring monomer (Figs. 3A-C). Each tetramer contains four dimeric interfaces, in each of which the monomers are held together by four major interactions: the H9 docking described above, two kissing-loop contacts, and an A-minor interaction (Figs. 3B-F). H10 loop (at nucleotides 262-264) forms a kissing-loop interaction with the internal loop between H8 and H10 (at nucleotides 287-289), featuring three Watson-Crick pairs (Fig. 3D). Notably, this interaction is possible because the internal loop curves around H4, held in place by A-minor staple interactions described above (Figs. 2F-G). The other kissing-loop contact is formed by the loop of H2 of one monomer protruding into H12 of the second monomer to form four Watson-Crick pairs between nucleotides 42-45 and 420-423, respectively (Fig. 3E). This stem is coaxially stacked on the rest of Hl 2, whose backbone forms a ribose zipper with theintramolecular Hl 1-H12 kissing loop described above (Fig. 2D). This underscores the intricate dependence of the highcr-ordcr packing on the internal monomer conformation, implied in oligomerization described below. The A-minor interaction involving three consecutive adenosines A318-320 brings together Hl 1 of one monomer together with the sharply curved H3 of the neighboring monomer (Fig. 3F). Here, A318 stacks on the adenosine of the Hoogsteen-ribose A166-G65 pair, while A319 and A320 pack against the minor groove formed by G64 and G167-U63, respectively (Fig. 3F). Fig. 3H shows an alignment of ROOLi ia and ROOLFirmstructures of monomers within the corresponding octamers shows highly similar architecture.
[0038] The interactions between tetramers (to form an octamer) are less extensive than those between monomers within a tetramer. The interface between the monomers from two interacting tetramers is symmetrical, including three pairs of contacts (data not shown). First, the base of G443 at the tip of H13 is docked into H7 of the second monomer, sandwiched between A187 and A535 and forming a Hoogsteen pair with C186 (data not shown). Next, A502 from the internal loop of Hl 5 packs onto the ribose of A555 from the corresponding ROOLEfa partner (data not shown). Finally, at the periphery of the dimeric interface, two hairpin loops of Hl 5 approach each other, but the low map resolution in this region precludes detailed modeling and indicates a weak contact.
[0039] Example 3: Analyses of ROOLFirmand its variants
[0040] To corroborate our findings of the octameric ROOLEfa, we determined the structure of ROOLFirm, a ROOL family RNA from a Firmicutes bacterium. Despite substantially different primary sequences (Fig. 2H), the structure of ROOLFirmis almost identical to that of ROOLEfa (Figs. ID and 3H), highlighting a conservation of RNA quaternary structure. One notable difference is that ROOLFirmtetramers interact with each other via G-A base stacking, whereas ROOLEfa tetramers interact via Hoogsteen G-C base pairing (data not shown). Many differences in intra-tetramer interactions include distinct base-pairing or kissing-loop compositions, however their positions and secondary-structure patterns in ROOLFirmand ROOLEfa are alike. The high similarity of intra-tetramer interactions and the ability of ROOL octamers to adopt slight changes at the inter-tetramer interface underscore the importance of the conserved octameric quaternary structure for the cellular function(s) of ROOL RNAs.
[0041] 3D alignments showed that ROOLFirmand ROOLEfa octamers do not perfectly overlap due to a slight register shift in the tetrameric packing (Figs. ID and 3H). We noted thatthe shape of the octamers might be affected by the disordered linker regions within the nanocage (nucleotides 365-420 in ROOLEfa, nucleotides 67-96 and 385-413 in ROOLrinn) that form low-resolution density insufficient for detailed structural modeling (Fig. 4A). To test whether these regions are critical for octamer assembly, we generated ROOLFirmmutants lacking one or both of these regions (Fig. 4B). Negative-stain EM showed that the shapes of the particles are nearly identical to that of the wild-type ROOLFirm, further emphasizing that the octamers are held primarily by the tertiary and quaternary interactions resolved in our cryo-EM maps (Fig. 4C).
[0042] Conserved extensive interactions within the tetramers of both ROOLFirmand ROOL fa suggest that tetramers could form assembly intermediates of the octamer. To test whether isolated tetramers exist in our datasets, we performed data processing using a low-pass-filtered tetramer map (20 A) derived from the ROOLFirmor ROOLEfa octamers. In the ROOLFirmdataset, a small fraction of tetramer particles (~8% of the octamer particles) resulted in a higher resolution (3.59 A) reconstruction featuring the tetramer conformation nearly identical to that within the octamer (data not shown). ROOLEfa dataset did not yield a substantially improved reconstruction, likely due to an insufficient dataset size, which is approximately half that of ROOLFirm(data not shown). Nevertheless, this analysis indicates that tetramers can form independently of octamers, which was also observed by mass photometry analysis (data not shown), suggesting that they may act as assembly and / or disassembly intermediates.
[0043] In both ROOL octamers, the 5'- and 3 '-termini form Hl protruding away from the nanocage (Fig. 3A). We asked whether ROOL’s termini can be fused with another RNA without disrupting the nanocage, to test its potential utility as a nanocarrier for RNAs or other molecules. To this end, we created three constructs in which either of the three RNA cargos were fused to the 3' end of ROOLFirmvia in vitro transcription. These included the 51 -nt Mango-III aptamer18 19, which can be used for imaging ROOL RNA using fluorescence, a 163-nt suppressor tRNA precursor, and a 143-nt primary-miRNA containing human miR-1-1 (Fig. 4D). The suppressor tRNA (SEQ ID NO: 6) comprises tRNASermodified to achieve high stop-codon readthrough activity in human cells and mice to potentially be used in therapeutics20. Negativestain EM demonstrates that all three constructs retain the shape consistent with the octamers observed with the wild-type ROOL (Fig. 4E). Furthermore, additional densities radiating from ROOLFirmparticles in 2D classes indicate relatively ordered densities, likely restrained by thestiff helix Hl (Fig. 4E). In sum, perturbations of both the intra-cage sequences and the outer-end termini, including long 163 -nt fusions, do not disrupt ROOLpinn multimcrization.
[0044] Example 4: Structure of ROOLEfa monomer
[0045] Our 2D and 3D classifications of ROOLpfa cryo-EM datasets revealed the presence of unassembled ROOLEta monomers, whose structure was resolved to 3.25 A (Fig. 5A). The core shape of the isolated monomer is similar to that within the octameric nanocage (Fig. 5B), but two major differences suggest large restructuring of the helical regions involved in octamer formation. The first notable rearrangement involves helices 8, 9, and 10. In the octameric monomer, these helices pack against H4 via A-minor interactions to expose the internal loop between H8 and H10 (at nucleotides 286-292) for the intermolecular kissing-loop interaction (Figs. 3B and 3D). In the monomer, however, H8-H9 is shifted away from H4 by ~23 A, and the internal loop appears to form a continuation of H8, whereas helices 9 and 10 are disordered (Fig. 5A, 5C, and 5E). This region of the monomer, therefore, features a restructured strand required for intermolecular interactions in the octamer (Fig. 5C and 5E). The second notable difference involves H12. Instead of the compact intramolecular kissing-loop interaction (at nucleotides 359-362, Fig. 2D) connected by the poorly ordered linker at nucleotides 365-420 within the octamer, the monomer features a >100-A long helix comprising residues 346-433 of H12 (Figs. 5A-B). Although lower-resolution density does not allow the modeling of the whole helix, the stem of the helix is clearly visible near the core of ROOLEfa RNA (Fig. 5A). Here, residues 420-423, which in the octamer are exposed to form intermolecular base pairs (Fig. 3E), are paired within the helix and stabilized by intra-helical stacking interactions (Fig. 5D). Strand swapping, involving a~41-A movement, therefore is required in this region to engage in intermolecular interactions with the loop of H2 (Fig. 2D, 3E, and 5C-D).
[0046] To test the role of strand swapping in nanocage formation, we designed mutants (SEQ ID NOS: 9—13) that strengthen the pairing within the H12 helix in the monomer to disfavor new interactions with H2 and Hl 1 (data not shown). Introducing a G opposite to the bulged C423 or changing the bulged AAU (417-419) to a C to enable pairing with G360 decreases nanocage formation as assayed by negative-stain EM, SEC, and mass photometry (data not shown). The combination of these two mutations has an even stronger effect, consistent with the notion that flexibility within H12 allows for the strand swapping required for octamer assembly. By contrast, mutants that strengthen the pairing downstream of the regions involved in thekissing-loop formation are much less disruptive to nanocage formation (data not shown).Echoing our findings for the disordered regions in ROOLinm being disposable for nanocagc assembly, these results outline possible engineering avenues to control cargo binding and multimer assembly. The present disclosure also contemplates nanocage multimers comprising an RNA including ROOL IncRNA monomers that lack disordered regions, e.g., an RNA including a ROOLpirm lacking the disordered regions disclosed herein.
[0047] We next tested the effect of salt concentration on the monomer-octamer equilibrium. Consistent with the stabilization of RNA tertiary structure by monovalent and divalent cations21,22, negative-stain EM, SEC, and mass photometry demonstrate higher abundance of the octamer at 240 mM K+and 20 mM Mg2+(data not shown). At 100 mM K+and 10 mM Mg2+, which are closer to physiological concentrations in bacteria23, the equilibrium is shifted toward the monomer (data not shown). The sensitivity of the monomer-octamer equilibrium to buffer conditions suggests that oligomer assembly in cells is regulated by ions and / or additional molecules.
[0048] Example 5: Readthrough using ROOLFirm-pre-sup-tRNATyr
[0049] To test whether ROOLpimi is compatible with prc-tRN X processing and the delivery of tRNA, we used a previously published suppressor tRNA-mediated readthrough system (Wang et al. Nature 2022 Apr; 604 (7905):343-348. doi: 10.1038 / s41586-022-04533-3). Functional suppressor tRNA mediates readthrough of a premature stop codon in GFP coding sequence, resulting in GFP signal measured by flow cytometry. When the suppressor tRNA was fused to the 3 ’ end of ROOLfirm in its pre-tRNA form, only when it is processed from the ROOLpimi vehicle should we see readthrough (GFP signal).
[0050] For positive controls, we transfected the reporter plasmid expressing GFP with a premature stop codon (pmxl5) together with a plasmid expressing the suppressor-tRNA (pmx40) using Lipofectamine 3000. G418 as a pan-readthrough compound positive control.
[0051] For the test group, expressed ROOLri1-m-pre-suppressor-tRNATyr(SEQ ID NO: 14) (“pre-sup-tRNATyr”) or pre-suppressor-tRNATyralone (SEQ ID NO: 15) was made by in vitro transcription and refolding. ~ 6 hours after the initial transfection of pmxl5 using Lipofectamine 3000, the RNAs were transfected using MessengerMAX. Flow cytometry was performed the next day to quantify the number of cells with GFP signal.
[0052] We observed comparable readthrough when the pre-suppressor tRNA was transfected alone or when fused with ROOLi mn, both much higher than the negative control (no transfection or mCherry transfection), showing that pre-tRNA can be processed when fused with ROOLFITUI (Fig. 6).
[0053] Example 6: ROOLFirmis Compatible with Mango-III Cargo
[0054] To test whether ROOLFirmcan deliver aptamers, we tested fusing Mango-III, a fluorescent aptamer, at the 3’ end of ROOLrinn, and used a plasmid that expresses a T7 RNA polymerase to transcribe ROOLFirm-Mango-III (SEQ ID NO: 16) or Mango-III alone (same plasmid expressing SEQ ID NO: 8 alone) in HEK293T cells. We observed fluorescent signals from Mango-III when it is either transcribed alone or together fused with ROOLFirm, suggesting that ROOLFirmis compatible with Mango-III function in mammalian cells (Fig. 7).
[0055] Materials and Methods
[0056] RNA preparation. The ROOLEfa and ROOLFirmsequences were derived from Rfam (accession numbers URS0000D65 D6E _565648 and FR891 50. 1 ). The DNA templates for RNA synthesis were cloned into plasmids and amplified (gene and primer sequences are provided in Table 1).
[0057] Table 1: Gene and Primer SequencesSequence SEQ ID NO: ROOL Firm TATTTGAATCATACCTGCGATCAACTCGATGAATAAAGTACGCC 1AGTACTTCGAGGTGTGTGGTAAATCCAATAGACCCGGAAACGGG TGAGGGGCGCCCAGTCAACCAAATCAAGGATACTTCTTTTGGAA GGCTGCCGGGGTTTAGTGATAAATCCCGGGAAGACGGAAACCGT CAACGGAAACACATATCGCAGAAATGCCCGCATTTAAAAGCACG GAAC T T C T GGAT GCAGCAATAGAC GC C T AC GGT GTAGGAGT AAG CCTAAGGGGTATCAGTGTGGCAACTGATATGACAGAGGTAAAGC CAACAATGCATTCTGCCTTGATGACGGAGAAATCCGCCTATAAC AGAAGTCGCCGGTGAAAGTAGCCATATGGCAGATTGACAAAAAC TCGTTTATTAATCTGAATGGACGGTGAAATTTACAGGTAGCCAA TCCTGTGCAGGCTTGTGGCGTAAGCCAAGGGTAAGAAGTTAGGG GTCGCTCCCCGAAGCTCAGACTTATCTTCCTGGTGGCAGAATAT AAGTGAAGGGCACGGATTGTACGGCGAAGGCCGGATCGTAGGTA TGATTCAA ROOL_Efa AAT T GAAAAAT C AAT AGAT T T AAAC C T AG T GAAGAGC AT T T GAA 2CAATGTGCTAGGGTAGTATGGGATAAGTCGATAACTAAAATGAA TTGGGATACTGATTGATTTTAGTGGTGGATTTTACAGCAATGTA AAAAGGACTAATAGTAAAAGCTATTAATCGCAAAGTACTACGTG GAATTTGTGCAGGTGTAAGGTACGAAACTTTCGAGTGTGACAAT AGACGCTCCAGTGGAGAATAATCTAAGTTAGGTGGAAGTGTGAG AAGCTTGGCAGACCTTAGAAAACTCAAACCAAGCGCTTTGCAGAGAAAC T GAGAAAT CAGT GTT TAAC GAAAGAAGT C GGTAC GAGTAGCTTAATGCAGCAATTTATTTACAGATGACAAATAATAAAAATG GGACTCTTATGTAAATGCTGAATGTTCAAGTGAAAGTTATTAGC CAGTAGAGC TAGAT CATACAGAAAAAGC AAAGAGAAGCTAT T GG GTAGCGCCCGATAGTTCAGCCTCTTTGGGTATGTGACTGAATAA CACTGTAAACAAAGGAAGCAGGAAGAAAAGCCTAAATCTGTTGA TTTTTGAG ROOL Firm ADI T ATT T GAAT CAT AC C TGC GAT CAAC T C GAT GAATAAAGTAC GC C 3AGTACTTCGAGGTGTGTGGTAAGCCCAGTCAACCAAATCAAGGA TACTTCTTTTGGAAGGCTGCCGGGGTTTAGTGATAAATCCCGGG AAGAC GGAAAC C GT C AAC GGAAACACAT AT C GCAGAAAT GC C C G CATTTAAAAGCACGGAACTTCTGGATGCAGCAATAGACGCCTAC GGTGTAGGAGTAAGCCTAAGGGGTATCAGTGTGGCAACTGATAT GAC AGAG GT AAAG CCAACAATGCATTCTGCCTTGATGACGGAGA AATCCGCCTATAACAGAAGTCGCCGGTGAAAGTAGCCATATGGC AGATTGACAAAAACTCGTTTATTAATCTGAATGGACGGTGAAAT TTACAGGTAGCCAATCCTGTGCAGGCTTGTGGCGTAAGCCAAGG GTAAGAAGTTAGGGGTCGCTCCCCGAAGCTCAGACTTATCTTCC TGGTGGCAGAATATAAGTGAAGGGCACGGATTGTACGGCGAAGG CCGGATCGTAGGTATGATTCAA ROOL_Firm_AD2 T ATT T GAAT CAT AC C TGC GAT CAAC T C GAT GAAT AAAGTAC GC C 4AGTACTTCGAGGTGTGTGGTAAATCCAATAGACCCGGAAACGGG TGAGGGGCGCCCAGTCAACCAAATCAAGGATACTTCTTTTGGAA GGCTGCCGGGGTTTAGTGATAAATCCCGGGAAGACGGAAACCGT CAAC GGAAACACATATC GCAGAAAT GC C C GCAT T TAAAAGC AC G GAACTTCTGGATGCAGCAATAGACGCCTACGGTGTAGGAGTAAG CCTAAGGGGTATCAGTGTGGCAACTGATATGACAGAGGTAAAGC CAACAATGCATTCTGCCTTGATGACGGAGAAATCCGCCTATAAC AGAAGTCGCCGGTGAAAGTAGCCATATGGCAGTGGACGGTGAAA TTTACAGGTAGCCAATCCTGTGCAGGCTTGTGGCGTAAGCCAAG GGTAAGAAGTTAGGGGTCGCTCCCCGAAGCTCAGACTTATCTTC CTGGTGGCAGAATATAAGTGAAGGGCACGGATTGTACGGCGAAG GCCGGATCGTAGGTATGATTCAA ROOL_Firm_ADlD2 T AT T T GAAT CATACCTGCGATCAACTCGAT GAATAAAGTAC G C C 5AGTACTTCGAGGTGTGTGGTAAGCCCAGTCAACCAAATCAAGGA TACTTCTTTTGGAAGGCTGCCGGGGTTTAGTGATAAATCCCGGG AAGACGGAAACCGTCAACGGAAACACATATCGCAGAAATGCCCG C ATT TAAAAGCAC GGAAC TT C TGGAT GC AGC AATAGACGC C TAC GGTGTAGGAGTAAGCCTAAGGGGTATCAGTGTGGCAACTGATAT GACAGAGGTAAAGCCAACAATGCATTCTGCCTTGATGACGGAGA AATCCGCCTATAACAGAAGTCGCCGGTGAAAGTAGCCATATGGC AGTGGACGGTGAAATTTACAGGTAGCCAATCCTGTGCAGGCTTG TGGCGTAAGCCAAGGGTAAGAAGTTAGGGGTCGCTCCCCGAAGC TCAGACTTATCTTCCTGGTGGCAGAATATAAGTGAAGGGCACGG ATTGTACGGCGAAGGCCGGATCGTAGGTATGATTCAAPre-tRNA CATTATAAGTTCACCCCAGCCGTCAGCGATGGCGTAGGTAGGTA 6GTCGTGGCCGAGTGGTTAAGGCGATGGTCTTCAAAACCATTGGG GTTTCCCCGCACGGGTTCGAATCCCGTCGACTACGGTTTTACCA GGTGCAGTTCCCGCCTTTCCTCAAAACTTACPri-miR-1-1 TCCCGGGGTCTTGGAACTGCATGCAGACTGCCTGCTTGGGAAAC 7ATACTTCTTTATATGCCCATATGGACCTGCTAAGCTATGGAATG TAAAGAAGTATGTATCTCAGGCCGGGACCTCTCTCGCCGCACTG AGGGGCACTCCMango-I I I GGCACGTACGAAGGAAGGTTTGGTATGTGGTATATTCGTACGTG 8CGGATCC ROOD— Ef a_ mutl AAT T GAAAAAT C AAT AGAT T T AAAC C T AG T GAAGAGC AT T T GAA 9CAATGTGCTAGGGTAGTATGGGATAAGTCGATAACTAAAATGAATTGGGATACTGATTGATTTTAGTGGTGGATTTTACAGCAATGTA AAAAGGACTAATAGTAAAAGCTATTAATCGCAAAGTACTACGTG GAATTTGTGCAGGTGTAAGGTACGAAACTTTCGAGTGTGACAAT AGACGCTCCAGTGGAGAATAATCTAAGTTAGGTGGAAGTGTGAG AAGCTTGGCAGACCTTAGAAAACTCAAACCAAGCGCTTTGCAGA GAAAC T GAGAAAT CAGT GTT TAAC GAAAGAAGT C GGTAC GAGTA GC TT GAAT GCAGCAATT TAT T TACAGAT GAG AAATAATAAAAAT GGGACTCTTATGTAAATGCTGAATGTTCAAGTGAAAGTTATTAG C C AGTAGAGC TAGAT CAT ACAGAAAAAGCAAAGAGAAGC TAT T G GGTAGCGCCCGATAGTTCAGCCTCTTTGGGTATGTGACTGAATA ACAC T GTAAACAAAGGAAGCAGGAAGAAAAGCC TAAATC T GT T G ATTTTTGAG ROOL_Efa_mut2 AAT T GAAAAAT C AAT AGAT T T AAAC C T AG T GAAGAG C AT T T GAA 10CAATGTGCTAGGGTAGTATGGGATAAGTCGATAACTAAAATGAA TTGGGATACTGATTGATTTTAGTGGTGGATTTTACAGCAATGTA AAAAGGACTAATAGTAAAAGCTATTAATCGCAAAGTACTACGTG GAATTTGTGCAGGTGTAAGGTACGAAACTTTCGAGTGTGACAAT AGACGCTCCAGTGGAGAATAATCTAAGTTAGGTGGAAGTGTGAG AAGCTTGGCAGACCTTAGAAAACTCAAACCAAGCGCTTTGCAGA GAAAC T GAGAAAT CAGT GTT TAAC GAAAGAAGT C GGTAC GAGTA GCTTAATGCAGCAATTTATTTACAGAT GAC AAATAATAAAAAT G GGACTCTTATGTAAATGCTGCGTTCAAGTGAAAGTTATTAGCCA G TAGAGC TAGAT CATACAGAAAAAGCAAAGAGAAGC TAT T GGGT AGCGCCCGATAGTTCAGCCTCTTTGGGTATGTGACTGAATAACA CTGTAAACAAAGGAAGCAGGAAGAAAAGCCTAAATCTGTTGATT TTTGAG ROOL_Efa_mut3 AAT T GAAAAAT C AAT AGAT T T AAAC C T AGT GAAGAGC AT T T GAA 11CAATGTGCTAGGGTAGTATGGGATAAGTCGATAACTAAAATGAA TTGGGATACTGATTGATTTTAGTGGTGGATTTTACAGCAATGTA AAAAGGAC T AAT AGT AAAAGC TAT T AAT C GC AAAGTACTAC GT G GAATTTGTGCAGGTGTAAGGTACGAAACTTTCGAGTGTGACAAT AGACGCTCCAGTGGAGAATAATCTAAGTTAGGTGGAAGTGTGAG AAGCTTGGCAGACCTTAGAAAACTCAAACCAAGCGCTTTGCAGA GAAAC T GAGAAAT CAGT GTT TAAC GAAAGAAGT C GGTAC GAGTA GCTTAATGCAGCAGCCCAGCGCCTCGCCGAAAGGCGAGGCGCTG GGCTGCTGAATGTTCAAGTGAAAGTTATTAGCCAGTAGAGCTAG AT CATACAGAAAAAGCAAAGAGAAGC TAT T GGGT AGCGCCC GAT AGTTCAGCCTCTTTGGGTATGTGACTGAATAACACTGTAAACAA AGGAAGCAGGAAGAAAAGCCTAAATCTGTTGATTTTTGAG ROOL_Efa_iaut4 AAT T GAAAAAT C AAT AGAT T T AAAC C T AG T GAAGAGC AT T T GAA 12CAATGTGCTAGGGTAGTATGGGATAAGTCGATAACTAAAATGAA TTGGGATACTGATTGATTTTAGTGGTGGATTTTACAGCAATGTA AAAAGGAC T AAT AGT AAAAG C TAT T AAT C GC AAAGT AC T AC G T G GAATTTGTGCAGGTGTAAGGTACGAAACTTTCGAGTGTGACAAT AGACGCTCCAGTGGAGAATAATCTAAGTTAGGTGGAAGTGTGAG AAGCTTGGCAGACCTTAGAAAACTCAAACCAAGCGCTTTGCAGA GAAAC T GAGAAAT CAGT GTT TAAC GAAAGAAGT C GGTAC GAGTA G C T T GAAT GCAGC AAT TTATTTACAGAT GAC AAATAATAAAAAT GGGACTCTTATGTAAATGCTGCGTTCAAGTGAAAGTTATTAGCC AGTAGAGC TAGAT CATACAGAAAAAGCAAAGAGAAGC TAT T GGG TAGCGCCCGATAGTTCAGCCTCTTTGGGTATGTGACTGAATAAC AC TGT AAAC AAAGGAAGC AGGAAGAAAAGC C TAAAT C TGT T GAT TTTTGAG ROOL Efa mut5 AAT T GAAAAAT C AAT AGAT T T AAAC C T AGT GAAGAGC AT T T GAA 13CAATGTGCTAGGGTAGTATGGGATAAGTCGATAACTAAAATGAATTGGGATACTGATTGATTTTAGTGGTGGATTTTACAGCAATGTAAAAAGGACTAATAGTAAAAGCTATTAATCGCAAAGTACTACGTG GAATTTGTGCAGGTGTAAGGTACGAAACTTTCGAGTGTGACAAT AGACGCTCCAGTGGAGAATAATCTAAGTTAGGTGGAAGTGTGAG AAGCTTGGCAGACCTTAGAAAACTCAAACCAAGCGCTTTGCAGA GAAACTGAGAAATCAGTGTTTAACGAAAGAAGTCGGTACGAGTA GCTTGAATGCAGCATTTACAGATGACAAATAATAAAAATGGGAC T C TTAT GTAAAT GC T GC GTT CAAGT GAAAGT TAT TAGCCAGTAG AGCTAGATCATACAGAAAAAGCAAAGAGAAGCTATTGGGTAGCG CCCGATAGTTCAGCCTCTTTGGGTATGTGACTGAATAACACTGT AAACAAAGGAAGCAGGAAGAAAAGC C TAAAT CT GTT GAT T T T T GAG
[0058] In vitro transcription of all RNAs was carried out with purified recombinant T7 RNA polymerase, 0.3 pM DNA template, 5 mM NTPs and 1 U / pL RNase inhibitor in lx transcription buffer containing 50 mM Tris-HCl (pH 7.9), 0.01% TritonX-100, 20 mM MgCl₂, 2 mM spermidine, and 10 mM DTT at 37 °C for 3 h. The transcription products were mixed with 2x denaturing polyacrylamide gel-loading buffer containing 95% formamide, 0.025% SDS, 10 mM EDTA, 0.025% xylene cyanol, and 0.025% bromophenol blue, and loaded on an 8 M urea, 4% polyacrylamide (19:1 acrylamide:bis) gel. The gel was run at 15 W for 3 h and visualized briefly using a 254-nm UV lamp held far from the gel to minimize RNA damage. Then the RNA was eluted from the gel overnight in elution buffer containing 20 mM Tris-HCl (pH 7.5) and 300 mM NaCl on an active rotater at 4 °C. The resulting gel slurry was then filtered through 0.45 pm filters, RNA was precipitated by adding an equal volume of isopropanol, and RNA pellets were washed two or three times with 75% ethanol and air dried. Precipitated RNA was resuspended in RNase-free water. The RNA was quantified using NanoDrop spectrophotometer (Thermo Fisher Scientific) and stored at -80 °C.
[0059] RNA refolding. For all subsequent experiments, RNAs were refolded at 0.125 pM in a refolding buffer containing 40 mM HEPES (pH 7.5) and 240 mM KC1 or 100 mM KCL The RNAs were heated from 23 °C to 90 °C, incubated for 3 min, and cooled at 0.5 °C / s to 60 °C, MgCl₂ was added to a final concentration of 20 mM or 10 mM or 2 mM, and then samples were cooled to 25 °C for 30 min, incubated at 37 °C for 2 h and cooled to 4 °C before use. For cryo-EM, the sample was prepared in a buffer containing 40 mM HEPES (pH 7.5), 240 mM KC1 and 20 mM MgCl₂.
[0060] Size exclusion chromatography (SEC) analysis. RNA was folded as described above. A 50 pL refolded sample was separated on an S6 increase 3.2 / 300 column (Cytiva) with a total volume of 2.4 ml using a flow rate of 0.04 mL / min on an AKTA pure micro (Cytiva). 0.02ml fractions were collected, and the peak fractions were analyzed by 6% denaturing PAGE and negative-stain EM. Each sample was analyzed twice.
[0061] Mass photometry analysis. ROOL RNA samples were folded as described above, and the Millennium1MRNA Marker (Thermo Fisher Scientific) was used for calibration. Samples were applied to Marienfeld Superior™ Precision Cover Glass (Thickness No. 1.5H, Marienfeld 107172) coated with poly-L-lysine (Sigma P4832). On the stage, the samples were diluted two-fold to obtain a final concentration of 50-100 nM, producing counts around 5000-6000. Data were collected using a Refeyn TwoMP mass photometer with AcquireMP v2024-R2.1. The instrument was focused using droplet dilution. DiscoverMP v2024-R2.1 was used for Gaussian fitting and generating the distribution of molecular species.
[0062] Dynamic Light Scattering (DLS) analysis. DLS measurements were performed using Prometheus Panta. RNA samples were folded as above. Two technical replicates were collected using 10-pL capillaries (NanoTemper #PR-C002). Data acquisition was performed for 15 seconds per capillary at full (100%) laser power and a refractive index of 1.55, using PR. PantaControl software vl.7.4. The autocorrelation function was calculated, and size distribution data were derived using the default analysis settings in PR. PantaAnalysis vl.7.4. The size distribution figure was made using GraphPad Prism 9.0.
[0063] Cryo-EM sample preparation. The refolded reaction was mixed with ~25 pM total yeast tRNA (Invitrogen™, AM7120G) to obtain the datasets resulting in ROOLEfa and ROOLpimi octamers (data not shown). Omitting the tRNA resulted in the third dataset with an increased population of ROOLEfa monomers (data not shown). We hypothesize that the addition of tRNA can shift the equilibrium between the octamer and monomers by affecting the concentrations of cations chelated by RNA or by another mechanism. The mixture was then rapidly chilled on ice and concentrated to approximately 1 pM using an Amicon centrifugal column (MilliporeSigma). A total of 3 pl of the refolded RNA was applied onto glow-discharged (using 15 mA current with negative polarity for 10 s) 200-mesh Rl.2 / 1.3 +2 nm C Layer Quantifoil Cu grids. The grids were blotted for 1 s for ROOLi im, and ROOLEfa octamer datasets and 1.5 s for the ROOL|jamonomer dataset at 4 °C and 100% humidity with no blotting offset and rapidly frozen in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific).
[0064] Cryo-EM data collection and image processing. Cryo-EM data were acquired using a Titan Krios microscope and Krios G4 (Thermo Fisher Scientific) operating at 300 kV.The Titan Krios microscope at UMass Chan Medical School was equipped with a K3 summit direct detector (Gatan) and a GIF quantum energy filter (Gatan) set to a slit width of 20 eV. The Titan Krios G4 microscope at the Electron Microscopy Center at Fudan University was equipped with a Falcon 4i summit direct detector (Thermo Fisher Scientific). Automated data collection was performed using the EPU v3.8.135and SerialEM v3.636with the beam-image shift method37.
[0065] Micrograph series (movies) for ROOLEfa and ROOLFirmoctamers were captured in the super-resolution mode at a nominal magnification of 100,000* resulting in the physical pixel size of 0.83 A. Movies were collected using the defocus range from -0.8 pm to -1.8 pm. Movie stacks were dose-fractionated into 40 frames, with a total exposure dose of 51.23 eV A2. Movies for the ROOLEfa monomer were captured in the super-resolution mode at a nominal magnification of 96,000* resulting in the physical pixel size of 1.06 A. Movies were collected using the defocus range from -1.2 pm to -2.2 pm. Movie stacks were dose-fractionated into 40 frames, with a total exposure dose of 52 o / K1.
[0066] Cryo-EM datasets were processed using cryoSPARC v4.6.038(data not shown). Initial steps involved patch motion correction and patch contrast transfer function (CTF) estimation to rectify stage shift, beam-induced motion, and imaging distortions. High-quality images were selected for further processing based on ice thickness, defocus ranges, and estimated resolutions. Particles were picked using blob picking, followed by two rounds of reference-free 2D classification. Classes containing well-defined particles were re-extracted without binning. Subsequently, a subset of high-quality particles from well-resolved 2D classes underwent ab initio reconstruction and heterogeneous refinement, yielding initial references for both octamers and ROOLEfa monomer. To pick isolated tetrameric particles, 20- A low-pass-filtered tetramer maps obtained from the corresponding octamers were used as a reference.Through homogeneous refinement and reference-based motion correction, then non-uniform refinement and local / global refinement, high-resolution maps were obtained for the octamers and ROOLEfa monomer. ROOLFirmdataset yielded a 3.59-A map corresponding to the tetramer, whereas the ROOLEfa dataset did not result in a higher-resolution reconstruction, likely because the ROOLEfa dataset was smaller than that for ROOLFirm(data not shown). At the final refinement stages, D4 symmetry was applied to ROOLFirmand ROOLEfa octamers, C4 to ROOLFirmtetramer. Final refined maps were sharpened using EMReady 2.0 beta39. Visualizationand evaluation of 3D density maps were performed with UCSF Chimera 1.16 and ChimeraX 1.7.140.
[0067] Cryo-EM model building and refinement. We de novo modeled ROOLpirm using Alphafold329models of several helical elements clearly resolved in the map, and the rest of the structure was manually built with Coot 0.9.8.9541and secondary-structure Alphafold3 predictions. ROOLEta model was built using secondary-structure similarity with ROOLpirm. The monomers were expanded into the corresponding octamer maps. Ions were manually traced into the octamer maps of ROOLefa and ROOLpirm. Structural models were refined against cryoSPARC maps that were processed in EMready (without supplementing coordinates as input) and sharpened by applying the B-factor of -50 A2using bfactor.exe as implemented in the Frealign package42. All three models were initially refined using rigid-body refinement in Phenix.real_space_refine43vl.19.2. Coordinates were further refined with ISOLDE44as implemented in ChimeraX40with added hydrogens and with simulation runtime temperature set to 30. Final individual coordinate minimizations (NCS-restrained for both octamers) and ADP refinements were performed in Phenix. real space refine vl.19.2 for ROOLi raoctamer and ROOLEfa monomer and vl.20.1 for ROOLpirm octamer, yielding average model-map correlation coefficients (CCmask) from 0.78 to 0.90. Final models exhibit good stereochemistry validated by phenix and MolProbity45online server v4.5.2 (data not shown). Figures were prepared in PyMOL v3.1.3.146and ChimeraX 1.7.140. Secondary structure diagrams were drawn with RNArtist (github.com / fjossinet / RNArtist) and manually curated with Adobe Illustrator.
[0068] Negative-stain EM sample preparation and data collection. Three drops of 20 pL, 20 pL, and 60 pL 1% Uranyl Acetate (UA) stain solution were applied on a parafilm. 3 pL of the sample was applied on the glow-discharged (45 s) 300-mesh-Cu grids (Quantifoil) coated with a continuous carbon film and incubated for 60 s to allow sample adsorption. The grid was blotted from the side with a piece of filter paper and washed with 3 pL of washing buffer.Excessive washing buffer was blotted with filter paper and the grid was stained in the first two drops of UA followed by blotting with filter paper. Subsequently, the grid was stained in the third drop of UA for 40 s. Excessive UA was blotted and the grid was air-dried and stored until imaging. All images were acquired with a Talos L120C TEM microscope (FEI Thermo Fisher Scientific) at an accelerating voltage of 120 kV equipped with a Ceta CMOS 4k x 4k pixelcamera (FEI Thermo Fisher Scientific) under magnification of 96,000* (corresponding to a calibrated sampling of 1.613 A per physical pixel).
[0069] Disease association analysis. Bacterial species and groups encoding ROOL RNAs in the Rfam database47(rfam.org / family / RF03087#tabview=tab4) were searched on the Human Gut Microbiome Atlas website (www.microbiomeatlas.or, and their enrichment scores for each listed human disease were plotted in Fig. la.
[0070] Statistical Analysis. All experiments were independently repeated at least once, with no inconsistent results observed. GraphPad Prism 9.0, OriginLab 2025, and ImageJ v 1.54g were used to perform statistical analyses. Data are presented as mean ± SD.
[0071] References1 Weinberg, Z., Perreault, J., Meyer, M. M. & Breaker, R. R. Exceptional structured noncoding RNAs revealed by bacterial metagenome analysis. Nature 462, 656-659 (2009). doi.org: 10.1038 / nature085862 Weinberg, Z. et al. Detection of 224 candidate structured RNAs by comparative analysis of specific subsets of intergenic regions. Nucleic Acids Research 45, 10811-10823 (2017). doi.org: 10.1093 / nar / gkx6993 Harris, K. A. & Breaker, R. R. Large Noncoding RNAs in Bacteria. Microbiol Spectr 6 (2018). doi.org: 10.1128 / microbiolspec. RWR-0005-20174 Pyle, A. M. Group II Intron Self-Splicing. Annu Rev Biophys 45, 183-205 (2016).doi.org:10.1146 / annurev-biophys-062215-0111495 Keenan, R. J., Freymann, D. M., Stroud, R. M. & Walter, P. The signal recognition particle. Annu Rev Biochem 70, 755-775 (2001).doi.org: 10.1146 / annurev.biochem.70.1.7556 Stav, S., Atilho, R. M., Mirihana Arachchilage, G., Nguyen, G., Higgs, G. & Breaker, R.R. Genome-wide discovery of structured noncoding RNAs in bacteria. BMC Microbiology’ 19, 66 (2019). doi.org:10.1186 / sl2866-019-1433-77 Narunsky, A. et al. The discovery of novel noncoding RNAs in 50 bacterial genomes.Nucleic Acids Res 52, 5152-5165 (2024). doi.org: 10.1093 / nar / gkae2488 Cousin, F. J. et al. A long and abundant non-coding RNA in Lactobacillus salivarius.Microb Genom 3, e000126 (2017). doi.org: 10.1099 / mgen.0.000126Bohdan, D. R., Voronina, V. V., Bujnicki, J. M. & Baulin, E. F. A comprehensive survey of long-range tertiary interactions and motifs in non-coding RNA structures. Nucleic Acids Research 51, 8367-8382 (2023). doi.org: 10.1093 / nar / gkad605Cate, J. H. et al. Crystal Structure of a Group I Ribozyme Domain: Principles of RNA Packing. Science 273, 1678-1685 (1996). doi.org:doi:10.1126 / science.273.5282.1678 Doherty, E. A., Batey, R. T., Masquida, B. & Doudna, J. A. A universal mode of helix packing in RNA. Nature Structural Biology 8, 339-343 (2001). doi.org:10.1038 / 86221 Nissen, P., Ippolito, J. A., Ban, N., Moore, P. B. & Steitz, T. A. RNA tertiary interactions in the large ribosomal subunit: The A-minor motif. Proceedings of the National Academy of Sciences 98, 4899-4903 (2001). doi.org:doi:10.1073 / pnas.081082398Battle, D. J. & Doudna, J. A. Specificity of RNA-RNA helix recognition. Proceedings of the National Academy of Sciences 99, 11676-11681 (2002).doi.org:doi: 10.1073 / pnas.182221799Ogle, J. M., Brodersen, D. E., Clemons, W. M., Tarry, M. J., Carter, A. P. & Ramakrishnan, V. Recognition of Cognate Transfer RNA by the 30 S Ribosomal Subunit. Science 292, 897-902 (2001). doi.org:doi:10.1126 / science.1060612 Demeshkina, N., Jenner, L., Westhof, E„ Yusupov, M. & Yusupova, G. A new understanding of the decoding principle on the ribosome. Nature 484, 256-259 (2012). doi.org: 10.1038 / nature 10913Loveland, A. B., Demo, G., Grigorieff, N. & Korostelev, A. A. Ensemble cryo-EM elucidates the mechanism of translation fidelity. Nature 546, 113-117 (2017). doi.org: 10.1038 / nature22397Teran, D., Zhang, Y. & Korostelev, A. A. Endogenous trans-translation structure visualizes the decoding of the first tmRNA alanine codon. Frontiers in Microbiology 15 (2024). doi.org:10.3389 / fmicb.2024.1369760Autour, A. et al. Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells. Nat Commun 9, 656 (2018). doi.org:10.1038 / s41467-018-02993-8 Trachman, R. J. et al. Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nature Chemical Biology’ 15, 472-479 (2019). doi.org:10.1038 / s41589-019-0267-9Albers, S. et al. Engineered tRNAs suppress nonsense mutations in cells and in vivo. Nature 618, 842-848 (2023). doi.org:10.1038 / s41586-023-06133-lRecord, M. T., Jr., Zhang, W. & Anderson, C. F. Analysis of effects of salts and uncharged solutes on protein and nucleic acid equilibria and processes: a practical guide to recognizing and interpreting polyelectrolyte effects, Hofmeister effects, and osmotic effects of salts. Adv Protein Chem 51, 281-353 (1998). doi.org: 10.1016 / s0065-3233(08)60655-5Shiman, R. & Draper, D. E. Stabilization of RNA tertiary structure by monovalent cations 11 Edited by I. Tinoco. Journal of Molecular Biology 302, 79-91 (2000). doi.org:doi.org / 10.1006 / jmbi.2000.4031Szatmari, D. et al. Intracellular ion concentrations and cation-dependent remodelling of bacterial MreB assemblies. Scientific Reports 10, 12002 (2020). doi.org:10.1038 / s41598-020-68960-wGreening, C. & Lithgow, T. Formation and function of bacterial organelles. Nature Reviews Microbiology 18, 677-689 (2020). doi.org:10.1038 / s41579-020-0413-0 Chen, A. G. Functional Investigation of Ribozymes and Ribozyme Candidates in Viruses, Bacteria and Eukaryotes. PhD thesis, Yale University, (2015).Kretsch, R. C. et al. Naturally ornate RNA-only complexes revealed by cryo-EM. bioRxiv, 2024.2012.2008.627333 (2024). doi.org:10.1101 / 2024.12.08.627333 Patel, S. D. et al. Type II Cadherin Ectodomain Structures: Implications for Classical Cadherin Specificity. Cell 124, 1255-1268 (2006). doi.org: 10.1016 / j.cell.2005.12.046 Hage, F. R. et al. Strand-Swapped SH3 Domain Dimer with Superoxide Dismutase Activity. ACS Central Science 11, 157-166 (2025). doi.org:10.1021 / acscentsci.4c01347 Abramson, J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630, 493-500 (2024). doi.org: 10.1038 / s41586-024-07487-w Mitchell, M. J., Billingsley, M. M., Haley, R. M., Wechsler, M. E., Peppas, N. A. & Langer, R. Engineering precision nanoparticles for drug delivery. Nature Reviews Drug Discovery 20, 101-124 (2021). doi.org:10.1038 / s41573-020-0090-8Jasinski, D., Haque, F., Binzel, D. W. & Guo, P. Advancement of the Emerging Field of RNA Nanotechnology. ACS Nano 11, 1142-1164 (2017).doi.org: 10.102 l / acsnano.6b05737Shu, Y. et al. Fabrication of 14 different RNA nanoparticles for specific tumor targeting without accumulation in normal organs. Rna 19, 767-777 (2013). doi.org:10.1261 / ma.037002.112Hoiberg, H. C., Sparvath, S. M., Andersen, V. L., Kjems, J. & Andersen, E. S. An RNA Origami Octahedron with Intrinsic siRNAs for Potent Gene Knockdown. Biotechnol J 14, 61700634 (2019). doi.org: 10.1002 / biot.201700634Afonin, K. A., Dobrovolskaia, M. A., Ke, W., Grodzinski, P. & Bathe, M. Critical review of nucleic acid nanotechnology to identify gaps and inform a strategy for accelerated clinical translation. Adv Drug Deliv Rev 181, 114081 (2022).doi.org: 10.1016 / j.addr.2021.114081Thompson, R. F., ladanza, M. G., Hesketh, E. L., Rawson, S. & Ranson, N. A.Collection, pre-processing and on-the-fly analysis of data for high-resolution, singleparticle cryo-electron microscopy. Nature Protocols 14, 100-118, doi:10.1038 / s41596-018-0084-8 (2019).Mastronarde, D. N. Automated electron microscope tomography using robust prediction of specimen movements. Journal of Structural Biology 152, 36-51,doi.org / 10.1016 / j. jsb.2005.07.007 (2005).Wu, C., Huang, X., Cheng, J., Zhu, D. & Zhang, X. High-quality, high-throughput cryo-electron microscopy data collection via beam tilt and astigmatism-free beam-image shift. Journal of Structural Biology’ 208, 107396, doi.org / 10.1016 / j.jsb.2019.09.013 (2019). Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods 14, 290-296, doi:10.1038 / nmeth.4169 (2017).He, J., Li, T. & Huang, S.-Y. Improvement of cryo-EM maps by simultaneous local and non-local deep learning. Nature Communications 14, 3217, doi:10.1038 / s41467-023-39031-1 (2023).Meng, E. C. et al. UCSF ChimeraX: Tools for structure building and analysis. Protein Sci 32, e4792, doi:10.1002 / pro.4792 (2023).Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66, 486-501, doi:10.1107 / s0907444910007493 (2010).42 Grigorieff, N. Frealign: An Exploratory Tool for Single-Particle Cryo-EM. Methods Enzymol 579, 191-226, doi:10.1016 / bs.mic.2016.04.013 (2016).43 Afonine, P. V. et al. Real-space refinement in PHENIX for cryo-EM and crystallography.Acta Crystallogr D Struct Biol 74, 531-544, doi:10.1107 / s2059798318006551 (2018). 44 Croll, T. I. ISOLDE: a physically realistic environment for model building into low- resolution electron-density maps. Acta Crystallogr D Struct Biol 74, 519-530, doi: 10.1107 / s2059798318002425 (2018).45 Chen, V. B. et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr 66, 12-21,doi: 10.1107 / s0907444909042073 (2010).46 The PyMOL Molecular Graphics System, Version 3.1.3.1. Schrodinger, LLC.47 Ontiveros-Palacios, N. et al. Rfam 15: RNA families database in 2025. Nucleic Acids Research, doi:10.1093 / nar / gkael023 (2024).48 Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction.Nucleic Acids Research 31, 3406-3415, doi:10.1093 / nar / gkg595 (2003).
[0072] The publications (including patent publications), web sites, company names, books, manuals, treatise, and scientific literature referred to herein establish the knowledge that is available to those with skill in the art and are hereby incorporated by reference in their entirety to the same extent as if each was specifically and individually indicated to be incorporated by reference. Any conflict between any reference cited herein and the specific teachings of this specification shall be resolved in favor of the latter.
[0073] Various embodiments of the present invention may be characterized by the potential claims listed in the paragraphs following this paragraph (and before the actual claims provided at the end of this application). These potential claims form a part of the written description of this application. Accordingly, subject matter of the following potential claims may be presented as actual claims in later proceedings involving this application or any application claiming priority based on this application. Inclusion of such potential claims should not be construed to mean that the actual claims do not cover the subject matter of the potential claims. Thus, a decision to not present these potential claims in later proceedings should not be construed as a donation of the subject matter to the public.
[0074] Without limitation, potential subject matter that may be claimed (prefaced with the letter “P” so as to avoid confusion with the actual claims presented below) includes:P 1. An RNA comprising ROOL (rumen-originating, ornate, large) IncRNA, the RNA having a cargo coupled to a terminus of the RNA selected from the group consisting of a 3 ’ terminus, a 5’ terminus, and combinations thereof.P2. The RNA of potential claim Pl, wherein the ROOL IncRNA is selected from the group consisting of ROOLi ia and ROOLFirm.P3. The RNA according to any one of potential claims Pl-2, wherein the cargo is a nucleic acid, a peptide, a protein, or a small molecule.P4. The RNA according to any one of potential claims Pl -2 wherein the cargo is a nucleic acid selected from the group consisting of an aptamer, a pre-tRNA, a tRNA, a pri-miRNA, a pre-miRNA, a microRNA, a pre-siRNA, a siRNA, an antisense oligonucleotide, a messenger RNA, a non-coding RNA, a nucleic acid segment having a sequence configured to anneal with a second nucleic acid sequence, and combinations thereof.P5. The RNA according to any one of the preceding potential claims, wherein the cargo is coupled to the terminus of the RNA by a linker.P6. The RNA of potential claim P5, wherein the linker is configured to be cleavable by an enzyme or a physiological condition / parameter.P7. The RNA according to potential claim P6, wherein the linker comprises a nucleic acid sequence, a peptide sequence, or a cleavable chemical moiety.P8. A nanocage multimer comprising:a set of RNA monomers, each RNA monomer of the nanocage multimer comprising a ROOL (rumen-originating, ornate, large) IncRNA, wherein the set of RNA monomers arc configured to assemble into the nanocage multimer; anda cargo.P9. The nanocage multimer of potential claim P8, wherein the multimer is an octamer.PIO. The nanocage multimer according to any one of potential claims P8-9, wherein the ROOL IncRNA is selected from the group consisting of ROOLpfa, ROOLi m, and combinations thereof.Pl 1. The nanocage multimer according to any one of potential claims P8-10, wherein the cargo is coupled to a terminus of at least one of the set of RNA monomers, the terminus being selected from the group consisting of a 3’ terminus, a 5’ terminus, and combinations thereof.P12. The nanocage multimer according to any one of potential claims P8-11, wherein the cargo is selected from the group consisting of a nucleic acid, a protein, a small molecule, and combinations thereof.P13. The nanocage multimer according to any one of potential claims P8-11, wherein the cargo is a nucleic acid selected from the group consisting of an aptamer, a pre-tRNA, a tRNA, a pri-miRNA, a pre-miRNA, a micro RNA, a pre-siRNA, a siRNA, an antisense oligonucleotide, a messenger RNA, a non-coding RNA, a nucleic acid segment having a sequence configured to anneal with a second nucleic acid sequence, and combinations thereof.P14. The nanocage multimer according to any one of potential claims Pl 1-13, wherein the cargo is coupled to the terminus of the at least one of the set of RNA monomers by a linker.P15. The nanocage multimer of potential claim P14, wherein the linker is configured to be cleavable by an enzyme or a physiological condition / parameter.Pl 6. The nanocage multimer according to any one of potential claims P8-15, wherein the cargo is configured to be radially displayed from the nanocage multimer.Pl 7. The nanocage multimer according to any one of potential claims P8-16, wherein the cargo is encapsulated within the nanocage multimer.Pl 8. A nucleic acid construct encoding the RNA comprising ROOL IncRNA according to any one of the preceding potential claims.Pl 9. The nucleic acid construct of potential claim Pl 8, wherein the nucleic acid construct further encodes the cargo, the encoded cargo comprising a sequence configured to be contiguous with the RNA comprising ROOL IncRNA upon transcription of the RNA comprising ROOL IncRNA.P20. The nucleic acid construct according to any one of potential claims Pl 8-19, wherein the nucleic acid construct further encodes the linker, the encoded linker comprising a sequence configured to be contiguous with the RNA comprising ROOL IncRNA upon transcription of the RNA comprising ROOL IncRNA.P21. A method of delivering a cargo into a target cell, the method comprising: introducing, into the target cell, the nucleic acid construct according to any one of potential claims Pl 8-20.P22. A method of delivering a cargo into a target cell, the method comprising: transcribing the nucleic acid construct according to any one of potential claims Pl 8-20 in vitro, thereby producing a transcription product comprising the RNA comprising ROOL IncRNA; anddelivering the transcription product into the target cell.P23. A method of delivering a cargo into a target cell, the method comprising:transcribing the nucleic acid construct according to any one of potential claims Pl 8-20 in vitro, thereby producing a transcription product comprising the RNA comprising ROOL IncRNA;assembling the nanocage multimer comprising the set of RNA monomers; and delivering the assembled nanocage multimer into the target cell.P24. The method of potential claim P23, wherein, upon the assembling of the nanocage multimer, the cargo is encapsulated within the nanocage multimer.
[0075] The embodiments of the invention described above are intended to be merely exemplary; numerous variations and modifications will be apparent to those skilled in the art. All such variations and modifications are intended to be within the scope of the present invention as defined in any appended claims.
Claims
What is claimed is:
1. An RNA comprising ROOL (rumen-originating, ornate, large) IncRNA, the RNA having a cargo coupled to a terminus of the RNA selected from the group consisting of a 3’ terminus, a 5 ’ terminus, and combinations thereof.
2. The RNA of claim 1, wherein the ROOL IncRNA is selected from the group consisting of ROOLEfa and ROOLFirm.
3. The RNA according to any one of claims 1-2, wherein the cargo is a nucleic acid, a peptide, a protein, or a small molecule.
4. The RNA according to any one of claims 1-2 wherein the cargo is a nucleic acid selected from the group consisting of an aptamer, a pre-tRNA, a tRNA, a pri-miRNA, a pre-miRNA, a microRNA, a pre-siRNA, a siRNA, an antisense oligonucleotide, a messenger RNA, a noncoding RNA, a nucleic acid segment having a sequence configured to anneal with a second nucleic acid sequence, and combinations thereof.
5. The RNA according to any one of the preceding claims, wherein the cargo is coupled to the terminus of the RNA by a linker.
6. The RNA of claim 5, wherein the linker is configured to be cleavable by an enzyme or a physiological condition / parameter.
7. The RNA according to claim 6, wherein the linker comprises a nucleic acid sequence, a peptide sequence, or a cleavable chemical moiety.
8. A nanocage multimer comprising:a set of RNA monomers, each RNA monomer of the nanocage multimer comprising a ROOL (rumen-originating, ornate, large) IncRNA, wherein the set of RNA monomers are configured to assemble into the nanocage multimer; anda cargo.
9. The nanocage multimer of claim 8, wherein the multimer is an octamer.
10. The nanocage multimer according to any one of claims 8-9, wherein the ROOL IncRNA is selected from the group consisting of ROOLEfa, ROOLFirm, and combinations thereof.
11. The nanocage multimer according to any one of claims 8-10, wherein the cargo is coupled to a terminus of at least one of the set of RNA monomers, the terminus being selected from the group consisting of a 3 ’ terminus, a 5 ’ terminus, and combinations thereof.
12. The nanocage multimer according to any one of claims 8-11, wherein the cargo is selected from the group consisting of a nucleic acid, a protein, a small molecule, and combinations thereof.
13. The nanocage multimer according to any one of claims 8-11, wherein the cargo is a nucleic acid selected from the group consisting of an aptamer, a pre-tRNA, a tRNA, a pri-miRNA, a pre-miRNA, a microRNA, a pre-siRNA, a siRNA, an antisense oligonucleotide, a messenger RNA, a non-coding RNA, a nucleic acid segment having a sequence configured to anneal with a second nucleic acid sequence, and combinations thereof.
14. The nanocage multimer according to any one of claims 11-13, wherein the cargo is coupled to the terminus of the at least one of the set of RNA monomers by a linker.
15. The nanocage multimer of claim 14, wherein the linker is configured to be cleavable by an enzyme or a physiological condition / parameter.
16. The nanocage multimer according to any one of claims 8-15, wherein the cargo is configured to be radially displayed from the nanocage multimer.
17. The nanocage multimer according to any one of claims 8-16, wherein the cargo is encapsulated within the nanocage multimer.
18. A nucleic acid construct encoding the RNA comprising ROOL IncRNA according to any one of the preceding claims.
19. The nucleic acid construct of claim 18, wherein the nucleic acid construct further encodes the cargo, the encoded cargo comprising a sequence configured to be contiguous with the RNA comprising ROOL IncRNA upon transcription of the RNA comprising ROOL IncRNA.
20. The nucleic acid construct according to any one of claims 18-19, wherein the nucleic acid construct further encodes the linker, the encoded linker comprising a sequence configured to be contiguous with the RNA comprising ROOL IncRNA upon transcription of the RNA comprising ROOL IncRNA.
21. A method of delivering a cargo into a target cell, the method comprising:introducing, into the target cell, the nucleic acid construct according to any one of claims 18-20.
22. A method of delivering a cargo into a target cell, the method comprising:transcribing the nucleic acid construct according to any one of claims 18-20 in vitro, thereby producing a transcription product comprising the RNA comprising ROOL IncRNA; anddelivering the transcription product into the target cell.
23. A method of delivering a cargo into a target cell, the method comprising:transcribing the nucleic acid construct according to any one of claims 18-20 in vitro, thereby producing a transcription product comprising the RNA comprising ROOL IncRNA;assembling the nanocage multimer comprising the set of RNA monomers; and delivering the assembled nanocage multimer into the target cell.
24. The method of claim 23, wherein, upon the assembling of the nanocage multimer, the cargo is encapsulated within the nanocage multimer.