Chiral cannabidiol derivative drug and use thereof

By developing chiral cannabidiol derivatives, the treatment challenges of opioid addiction and neuroinflammation have been solved, achieving highly effective and side-effect-free treatment results and enhancing the activity of cannabidiol in the central nervous system.

WO2026137641A1PCT designated stage Publication Date: 2026-07-02CHANGCHUN INSTITUTE OF APPLIED CHEMISTRY CHINESE ACADEMY OF SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/088211
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-25
Filing Date
2025-04-10
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Existing treatments for opioid addiction are addictive and have side effects, and the oral bioavailability of cannabidiol (CBD) is poor, resulting in limited effectiveness in treating opioid addiction and neuroinflammation.

Method used

Four chiral cannabidiol derivatives, (7S)-(-)-CIAC001, (7R)-(-)-CIAC001, (7S)-(+)-CIAC001, and (7R)-(+)-CIAC001, were developed. By introducing a substituent group at the C10 position, their affinity for cannabinoid receptors was enhanced, and their activity in the central nervous system was improved through different routes of administration.

Benefits of technology

These chiral cannabidiol derivatives significantly enhance the therapeutic effects on opioid addiction and neuroinflammation, are non-addictive and have no side effects, and can effectively regulate pyruvate kinase M2 (PKM2) activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025088211_02072026_PF_FP_ABST
    Figure CN2025088211_02072026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is a chiral cannabidiol (CBD) derivative drug, comprising four chiral derivatives, i.e., (7S)-(-)-CIAC001, (7R)-(-)-CIAC001, (7S)-(+)-CIAC001, and (7R)-(+)-CIAC001; and a use of the four chiral derivatives of CBD in the treatment of neuroinflammation and opioid addiction. Also disclosed are anti-neuroinflammation effects and the ability to regulate the activity of pyruvate kinase M2 (PKM2) of CBD analogs.
Need to check novelty before this filing date? Find Prior Art

Description

Chiral cannabidiol derivative drugs and their applications Technical Field

[0001] This invention belongs to the field of medicinal chemistry technology, specifically relating to the preparation method and application of chiral cannabidiol derivative drugs. Background Technology

[0002] Opioids, including morphine and its synthetic analogues extracted from poppy plants, are a class of drugs with potent analgesic effects. However, they are also highly addictive, making opioid addiction a chronic and relapsing disease that poses a serious challenge to global public health. According to the World Health Organization, approximately 69,000 people die each year from opioid overdoses, and about 15 million people worldwide suffer from opioid dependence. Currently, although various treatment strategies have been proposed, including drug maintenance therapy, withdrawal symptom management, comprehensive detoxification programs, and physical therapy, these methods have shown certain limitations in practical application and are insufficient to meet clinical treatment needs.

[0003] Maintenance therapy is a treatment approach for opioid addiction. Its core principle is to alleviate withdrawal symptoms, reduce opioid cravings, and ultimately achieve detoxification through the use of specific medications. Common medications include: weak opioid receptor agonists, such as methadone, which mimics the effects of morphine, reducing withdrawal symptoms and having a longer duration of action, thus helping to reduce drug-seeking behavior; and μ-opioid receptor (MOR) antagonists, such as naltrexone and naloxone, which reduce the effects of opioids by blocking their binding to receptors, helping patients avoid relapse. However, these treatments are not without drawbacks. They may have limited efficacy and significant side effects. For example, methadone itself is addictive and may lead to new dependence. Furthermore, long-term opioid use can cause neuroinflammation, releasing pro-inflammatory factors and affecting drug dependence and reward mechanisms.

[0004] Cannabidiol (CBD) is a non-psychoactive cannabinoid that is gaining increasing attention due to its anti-inflammatory effects in the central nervous system (CNS) and its potential therapeutic applications for substance use disorders. However, CBD's high lipophilicity leads to poor oral bioavailability and significant first-pass metabolism in the liver, requiring higher doses to achieve the desired CNS activity. Furthermore, CBD use may be accompanied by side effects such as drowsiness, sedation, and decreased appetite, which may limit the development of CBD-based drugs.

[0005] To overcome these challenges, researchers are exploring ways to modify cannabidiol (CBD) to treat neuroinflammation and opioid addiction, thereby overcoming the drawbacks of CBD.

[0006] The novel cannabinoid derivative CIAC001 shows potential for anti-neuroinflammatory activity and modulation of pyruvate kinase M2 (PKM2) activity, offering new hope for therapeutic applications. This derivative significantly enhances its anti-inflammatory activity and reduces cytotoxicity by shortening the side chain to two carbon atoms and introducing a triazole structure onto the side chain. CIAC001 is non-addictive, has no significant side effects, and its stronger ability to cross the blood-brain barrier makes it a promising lead compound for the development of drugs targeting the central nervous system. However, the carbon atom in which the triazole is attached to the CIAC001 side chain is a chiral carbon; previous studies have been conducted in the racemic form, failing to consider chiral recognition and exhibiting a short half-life.

[0007] Chiral recognition also plays a crucial role in the biological activity of cannabinoids. Naturally occurring cannabinoids, primarily in the negative conformation, can specifically bind to CB1 and CB2 receptors in the endocannabinoid system, exerting analgesic and anti-inflammatory effects. In contrast, synthetically produced positive conformation cannabinoids cannot effectively bind to cannabinoid receptors.

[0008] Furthermore, by introducing substituents at the C10 position of the CBD molecule, axially chiral cannabinoid derivatives axCBNs were successfully synthesized. Among them, axCBN3, with a hydroxyethyl substituent at the C10 position, showed significantly enhanced affinity for CB1 and CB2 receptors, reaching 66 pM and 93 pM, respectively, representing increases of 335-fold and 160-fold.

[0009] CP55940 and CP56667 are a pair of chiral isomers of noncannabinoid cyclohexylphenols, exhibiting mirror-symmetry in structure. The negative isomer CP55940 demonstrates a significant activity advantage in inhibiting the cannabinoid receptor CB1, with its inhibition constant Ki value being significantly lower than that of the positive isomer CP56667.

[0010] In current drug development, it is no longer permitted to use the racemic form of drugs. Therefore, there is an urgent need to develop CIAC001 derivatives with different chiralities to enhance its activity and improve its shortcomings. Summary of the Invention

[0011] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0012] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0013] To solve the above-mentioned technical problems, the present invention provides the following technical solution: a chiral cannabidiol derivative, wherein the general structural formula of the chiral cannabidiol derivative is shown in formula (I):

[0014] Among them, R 1 for

[0015] -H、 as well as One or more of the following;

[0016] R 2A and R 2B It is -H, C1-C4 alkyl, C2-C4 alkenyl, or C2-C4 alkynyl; R 3A and R 3B It can be one or more of -H, halogen, -COOH, and -NH2.

[0017] To solve the above-mentioned technical problems, the present invention provides the following technical solution: a chiral cannabidiol derivative, wherein the general structural formula of the chiral cannabidiol derivative is shown in formulas (Ia)-(Id):

[0018] Among them, R 1 for

[0019] -H、 as well as One or more of the following;

[0020] R 2A and R 2B It is -H, C1-C4 alkyl, C2-C4 alkenyl, or C2-C4 alkynyl; R 3A and R 3B It can be one or more of -H, halogen, -COOH, and -NH2.

[0021] In some implementation schemes, R 2A and R 2B Independently selected from -H, C1-C4 alkyl, C2-C4 terminal alkenyl, or C2-C4 terminal alkynyl; R 3A and R 3B It is independently selected from -H, halogen, -COOH or -NH2.

[0022] As a preferred embodiment of the chiral cannabidiol derivative of the present invention, wherein: formula (I) further includes

[0023] as well as One or more of them.

[0024] Another objective of this invention is to overcome the shortcomings of the prior art and provide a chiral cannabidiol derivative drug.

[0025] As a preferred embodiment of the drug of the present invention, it comprises chiral cannabidiol derivatives represented by formula (I) or formulas (Ia)-(Id).

[0026] In some embodiments, the present invention provides a pharmaceutical composition comprising a chiral cannabidiol derivative of formula (I) or formulas (Ia)-(Id) and a pharmacologically acceptable excipient.

[0027] Another object of the present invention is to overcome the shortcomings of the prior art and provide the use of chiral cannabidiol derivatives in the treatment or prevention of opioid addiction.

[0028] Another object of the present invention is to overcome the shortcomings of the prior art and provide the use of chiral cannabidiol derivatives in the treatment or prevention of opioid-induced neuroinflammation.

[0029] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for treating or preventing opioid addiction, the method comprising administering a chiral cannabidiol derivative.

[0030] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for treating or preventing opioid-induced neuroinflammation, the method comprising administering a chiral cannabidiol derivative.

[0031] Another object of the present invention is to overcome the shortcomings of the prior art and provide the application of chiral cannabidiol derivatives in the regulatory ability of pyruvate kinase M2 activity.

[0032] Another object of the present invention is to overcome the shortcomings of the prior art and provide a method for regulating the activity of pyruvate kinase M2, the method comprising administering a chiral cannabidiol derivative.

[0033] As a preferred embodiment of the application or method described in this invention, the formula (I) or formulas (Ia)-(Id) are administered at a dose of 0.5 to 100 mg / kg.

[0034] As a preferred embodiment of the application described in this invention, the opioid drugs include, but are not limited to, fentanyl, ibuprofen, codeine, diazepam, dihydrocodeine, enkephalin, heroin, oxycodone, oxymectin, meperidine, methadone, morphine, nicoridine, opium, Oscontin, and their derivatives, precursors, or pharmacologically acceptable salts or solvents of these drugs.

[0035] As a preferred embodiment of the application described in this invention, formula (I) or formulas (Ia)-(Id) may be used in conjunction with a pharmacologically acceptable excipient.

[0036] As a preferred embodiment of the application described in this invention, the administration methods include, but are not limited to, oral, subbuccal, sublingual, rectal, vaginal, intravenous, intra-arterial, intramedullary, intramuscular, intracerebral, intraventricular, intraspinal, subcutaneous, intraperitoneal, intraocular, intranasal, transdermal, epidural, intracranial, intrauterine, intravitreal, mucosal, and inhaler-mediated administration.

[0037] The beneficial effects of this invention are:

[0038] 1. This invention relates to the use of four chiral derivatives of cannabidiol (CBD), namely (7S)-(-)-CIAC001, (7R)-(-)-CIAC001, (7S)-(+)-CIAC001, and (7R)-(+)-CIAC001, in the treatment of neuroinflammation and opioid addiction. The absolute configuration of (7S)-(-)-CIAC001 significantly enhances its activity in treating morphine addiction and resisting neuroinflammation compared to racemic CIAC001.

[0039] 2 This invention focuses on the anti-neuroinflammatory effects of these CBD analogs and their ability to regulate the activity of pyruvate kinase M2 (PKM2). Attached Figure Description

[0040] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:

[0041] Figure 1 shows the synthetic routes of compounds 6a-6d in Example 1 of this invention.

[0042] Figure 2 shows the stereochemical recognition of (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 by PKM2 in Example 2 of the present invention. In the figure, A is the inhibition curve of PKM2 enzyme activity by the chiral isomer of CIAC001; B is the titration curve of PKM2 intrinsic fluorescence with (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001; C is the interaction between endogenous PKM2 and (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 characterized by CETSA technology; and D is the CETSA fitting curve of (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001.

[0043] Figure 3 shows that F26 in PKM2 is a key residue for stereochemical recognition in Example 3 of this invention. In Figure 3, A represents the optimal docking posture of (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 with tetramer PKM2 (PDB ID: 3ME3); key residues interacting with (7S)-(-)-CIAC001 are marked in (B) and 14b(C) and shown as bar graphs; D represents the enzyme activity curves of wild-type PKM2 and F26A PKM2 after administration of (7S)-(-)-CIAC001; E represents the intrinsic fluorescence of wild-type PKM2 and F26A PKM2 and the titration curves of (7S)-(-)-CIAC001; and F represents the optimal docking posture and key residues of (7S)-(-)-CIAC001 bound to F26APKM2.

[0044] Figure 4 shows that (7S)-(-)-CIAC001 exhibited superior anti-inflammatory activity compared to (7R)-(-)-CIAC001 in Example 4 of this invention. In the figure, A represents the expression of PKM2 in the nucleus and cytoplasm of BV-2 cells analyzed by Western blotting; B represents the IL-1β mRNA level after treatment with (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001; C represents the dose-dependent inhibitory effect of (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 on NO; DE represents the inhibition of LPS (200 ng / mL)-induced changes in microglial cell morphology in BV-2 cells by (7S)-(-)-CIAC001 (5 μM). Red arrows indicate that unactivated microglial cells are oval-shaped; blue arrows indicate that activated microglial cells are rod-shaped. The scale bar represents 20 μm. At least three hundred cells were analyzed.

[0045] Figure 5 illustrates how (7S)-(-)-CIAC001 inhibits morphine addiction by suppressing neuroinflammation in Example 5 of this invention. In the figure, A is a schematic diagram of the CPP experimental procedure; B represents the CPP scores of (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 in the experiment (n=6 per group); C represents the IL-1B mRNA level in the medial prefrontal cortex (mPFC) region of mice after the CPP experiments with (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 (n=3 per group). Detailed Implementation

[0046] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0047] Many specific details are set forth in the following description to provide a thorough understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below. Furthermore, the term "an embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that excludes other embodiments.

[0048] Unless otherwise specified, all raw materials and reagents used in this invention were purchased from Shanghai Anaiji Chemical Co., Ltd.

[0049] Thin-layer chromatography (TLC) and silica gel used in the analysis were sourced from Qingdao Shuoyuan Silica Gel Technology Co., Ltd. The medium-pressure separation chromatography system was provided by Biotage. The silica gel column was purchased from Changzhou Sante Technology Co., Ltd. Nuclear magnetic resonance (NMR) spectra were obtained on a Bruker gAV-300 spectrometer, with frequencies of [missing information]. 1 H's 300MHz and 13 The frequency of C was 75 MHz, and the solvent used was CDCl3 or CD3OD. Chemical shift (δ) is expressed in ppm, with the peak value of residual solvent used as an internal reference (CDCl3: 1 H was 7.26 ppm. 13 C 77.16ppm; CD3OD: 1 H was 3.31 ppm. 13(49.03 ppm of C). Signal splitting patterns were described by chemical shift, multiplicity (s for singlet, d for doublet, t for triplet, m for multipeak, br for broad peak), coupling constant (in Hertz, Hz), and integral. Low-resolution electrospray ionization (ES) mass spectra were recorded on a Waters QDa mass spectrometer operated in both positive and negative ion modes. Optical rotation of CBD analogs was measured at 20 °C using a Digipol-P610 polarimeter (Shanghai Jiahang Instrument Co., Ltd.). Enantiomer purity of CBD analogs was determined using an ODHOCE-AP039 OD-H chiral column from Daicel. The purity of all compounds exceeded 95%.

[0050] PKM2 kinase activity assay:

[0051] First, 100 μL of PKM2 protein solution at 100 pg / mL was added to a black 96-well plate. Then, 100 μM of FBP (fructose 1,6-bisphosphate) was introduced, and the plate was incubated at room temperature for 10 minutes. Next, 100 μL of reaction buffer containing 100 mM Tris (pH 7.4), 20 mM MgCl2, 200 mM KCl, 0.1% Tween, 1.8 mM ADP (adenosine diphosphate), 1.2 mM PEP (phosphoenolpyruvate), 0.24 mM β-NADH (β-nicotinamide adenine dinucleotide), and 16 U / mL LDH (lactate dehydrogenase) was added to the protein solution. Then, the drug was introduced at different concentrations, and the plate was incubated for another 40 minutes. Changes in NADH levels are measured by monitoring excitation light at 340 nm and emission light at 460 nm, i.e., by measuring changes in absorbance at these two wavelengths.

[0052] Fluorescent titration:

[0053] PKM2 protein (0.5 μM) was titrated stepwise with the CIAC001 chiral isomer. Fluorescence intensity was recorded at an excitation wavelength of 280 nm and an emission wavelength of 337 nm using an Agilent Technologies Cary Eclipse spectrophotometer. The data were corrected for reference spectra and fitted to a nonlinear least squares equation: F = F0 - F PL ×[LP2]=F0-F PL ×(L T ×P T -((K D 2 / 4+P T 2 / 4+L T ×P T ) 2 -(LT ×P T 2 ×(4×L T +4×P T )) / 4) 0.5 +K D 2 / 4+P T 2 / 4) / (2×L T +2×P T ); where F represents the measured fluorescence intensity; F0 represents the initial fluorescence intensity of PKM2 in the absence of the CIAC001 chiral isomer; F PL It is a parameter used to regulate the molar fluorescence of protein-ligand complexes; K D It is the dissociation constant; L T It is the total concentration of the chiral isomers of CIAC001; P T It is the total concentration of PKM2.

[0054] Cellular thermal displacement analysis:

[0055] BV-2 cells were administered at a rate of 4 × 10⁻⁶ cells / mL. 5 Cells were cultured at a density of 1000 g / cm³. After 24 hours of incubation, the culture medium was removed, and the cells were washed with 3 mL of cold PBS and scraped off for collection. Cells were centrifuged at 1000 g for 5 min at 4 °C, resuspended in cell lysis buffer containing a 1% protease inhibitor mixture, and incubated on ice. Lysates were centrifuged at 12000 g for 15 min at 4 °C, and the supernatant was retained. The supernatant was incubated with 100 μL of MCIAC001 chiral isomer or control solvent at room temperature for 2 h. The lysates were aliquoted into 60 μL portions and heated from 37 °C to 72 °C for 5 min, then cooled at 25 °C for 3 min. The samples were centrifuged at 12000 g for 20 min at 4 °C, and the supernatant was mixed with 2×Laemmli sample buffer and denatured at 100 °C for 8 min for Western blotting analysis using PKM2 antibody.

[0056] Immunoblotting:

[0057] Protein samples were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. After blocking in 5% skim milk powder for 1 hour, the membranes were incubated overnight with primary antibody at 4°C. Subsequently, the membranes were washed with TBST buffer for 5 minutes and then incubated with the secondary antibody-HRP (horseradish peroxidase) conjugate for 1 hour at room temperature. The membranes were developed using Super-Signal West Pico chemiluminescent substrates and visualized on a Tanon-5200Multi imaging system. Band density analysis was performed using ImageJ software.

[0058] Molecular dynamics simulation:

[0059] Chiral isomers of CIAC001 were plotted using GaussView 6 software and optimized using Gaussian 09 software with the B3LYP / 6-31G(d,p) basis set. The 3D structure of the PKM2 tetramer was extracted from the crystal structure (PDB ID: 3ME3), and the activator was removed from the structure before docking. Missing hydrogen atoms were added using Maestro software at pH 7.0. AutoDock Vina 1.1.2 was used for molecular docking, with a docking box size of [missing information]. The PKM2 tetramer was fully covered. During docking, the protein was treated as rigid and the ligand as semi-flexible. Based on their affinity for the PKM2 tetramer, the docking posture with the best binding affinity to PKM2 was selected from ten docking postures generated and ranked by AutoDock Vina. The interaction between PKM2 and the CIAC001 chiral isomer was analyzed using LigPlot+ and PyMol software.

[0060] The binding of the CIAC001 chiral isomer to the PKM2 tetramer was further investigated using molecular dynamics simulations. The optimal docking posture was selected as the initial structure. The complex, containing TIP3P water molecules and 150 mM KCl, was constructed using the CHARMM-GUI web server. Simulations were performed using the Gromacs 2021.2 program and the CHARMM36m force field. Equilibrium was established for 100 nanoseconds at a temperature of 310.15 K in a isothermal-barotropic (NPT) ensemble. The LINCS algorithm was applied to confine bonds involving hydrogen atoms. The particle mesh Ewald (PME) summation method was used to handle long-range electrostatic interactions. The temperature (310.15 K) and pressure (1 atm) were maintained using the Nose-Hoover Langevin piston method and the Parrinello-Rahman pressure controller.

[0061] Cell culture:

[0062] BV-2 cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The incubator was maintained at 37°C, 95% humidity, and 5% CO2.

[0063] Subcellular localization of PKM2:

[0064] BV-2 cells were treated with 200 ng / mL LPS and 10 μM CIAC001 chiral isomer for 6 hours. Cells were washed, harvested with ice-cold PBS, and centrifuged at 800 g at 4°C for 5 minutes. Cells were lysed on ice with a mixture of cytoplasmic lysis buffer (10 mM HEPES pH 7.6, 10 mM KCl, 0.5 mM β-mercaptoethanol, 1.5 mM MgCl2, and 1 mM DTT) and protease inhibitors for 20 minutes. NP40 was added to the lysis buffer to a final concentration of 0.5%, and the mixture was incubated on ice for 2 minutes. The lysis buffer was centrifuged at 2000 g at 4°C for 10 minutes, and the supernatant was used as the cytoplasmic lysis buffer. The precipitate was washed twice with ice-cold PBS. Nuclear precipitates were lysed on ice for 30 minutes using a mixture of nuclear lysis buffer (10 mM Tris-HCl pH 7.6, 450 mM NaCl, 2 mM MgCl2, 0.5% NP-40, and 1 mM DTT) and protease inhibitors. The lysis buffer was centrifuged at 12,000 g at 4 °C for 10 minutes, and the supernatant was used as the nuclear lysis buffer. The nuclear lysis buffer was diluted with low-salt buffer (10 mM Tris-HCl pH 7.6 and 2 mM MgCl2) to achieve a final salt concentration of 150 mM. Total protein concentrations in the nuclear and cytoplasmic extracts were determined by the BCA assay and then normalized. The lysis buffer supernatant was denatured in 2×Laemmli sample buffer at 100 °C for 8 minutes for Western blotting analysis using the appropriate antibodies.

[0065] Quantitative real-time polymerase chain reaction (qRT-PCR):

[0066] Total RNA was extracted from cells or mouse brains using the RNeasy Mini kit. Following the manufacturer's instructions, the isolated RNA was reverse transcribed into cDNA using the RT2Easy First Strand cDNA synthesis kit. Subsequent PCR amplification employed synthetic primers, SYBR Green assay, and the TOptical real-time qPCR thermal cycler from Analytick Jena in Jena, Thuringia, Germany. Data analysis was performed using the ΔΔCt method, with Rpl7l1 as an internal control gene. The primer sequences for qRT-PCR are as follows: Rpl7l1 (forward: ACGGTGGAGCCTTATGTGAC; reverse: TCCGTCAGAGGACTGTCTT), IL-1β (forward: CCACCTTTTGACAGTGATGA; reverse: GAGATTTTGAAGCTGGATGCT).

[0067] Nitric oxide (NO) detection:

[0068] BV-2 cells were used at a rate of 5 × 10⁶ cells per well. 4 Cells were seeded at a density of [number] cells per well in 96-well plates. After 24 hours, the medium was removed and replaced with DMEM medium free of FBS and penicillin-streptomycin. LPS (200 ng / mL) and a series of compound concentrations were added. After 24 hours of treatment, 100 μL of the medium was transferred to a flat-bottomed black 96-well microplate. 10 μL of 0.05 mg / mL 2,3-diaminonaphthalene was introduced, followed by incubation in the dark for 15 minutes. The reaction was terminated by adding 5 μL of 3M NaOH to each well. NO inhibition rate was measured using a SYNERGY H1 microplate reader (BioTek Instruments) at excitation and emission wavelengths of 360 nm and 430 nm, respectively. The fluorescence value of the group treated with LPS only was used as a 100% reference.

[0069] Cell morphology determination:

[0070] BV-2 cells were planted at 2.5 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells per well in 6-well plates and incubated for 12 hours. Subsequently, cells were treated with 5 μM CIAC001 chiral isomer, with or without LPS (200 ng / mL), for 24 hours. Microscopic images of BV-2 cells were taken using an inverted microscope (Ts2-FL, Nikon Corporation, Tokyo, Japan) and analyzed using ImageJ software. Statistical analysis was performed on at least three hundred cells.

[0071] Animal husbandry:

[0072] Male BALB / c mice aged 6-8 weeks and weighing 20-28g were housed in a temperature-controlled environment (21-24°C) following a 12-hour day-night cycle, with lights turned on at 08:00 AM. The mice had free access to standard rodent food and water and were acclimatized to the environment for at least one week before any experimental procedures were performed.

[0073] Conditional position preference (CPP) experiments:

[0074] The CPP experiment was conducted according to the classic 10-day procedure. On days 1 and 2, each mouse was placed in the CPP device for 15 minutes to acclimatize. On day 3 (pretreatment), the time spent in each compartment was recorded to determine preference for either compartment. Mice were divided into three groups: a control group, a 7.5 mg / kg morphine group, and a 7.5 mg / kg morphine + 0.2 mg / kg (7S)-(-)-CIAC001 or (7R)-(-)-CIAC001 group. During the conditioned phase, mice were isolated in compartments for 30 minutes each for 6 consecutive days. Morphine was administered to mice on days 4, 6, and 8, while the control (5 mL / kg) was administered on days 5, 7, and 9. The posttreatment phase was conducted 24 hours after the conditioned phase. Each mouse was placed in the device and allowed to explore freely, and the time spent in each compartment was recorded for 15 minutes. The CPP score is calculated by subtracting the time spent in the control drug pairing compartment from the time spent in the control drug pairing compartment.

[0075] Example 1: Synthetic route of compounds 6a-6d

[0076] 1. Synthesis of Compound 1 – 1-(3,5-bis(benzyloxy)phenyl)ethane-1-one

[0077] 1-(3,5-dihydroxycyclohexen-1-yl)ethane-1-one (15.2 g, 100.0 mmol) and benzyl bromide (34.2 g, 200.0 mmol, 2.0 equiv.) were added to 500 mL of DMF; NaOH (1.38 g, 300.0 mmol, 3.0 equiv.) was ground and added to the mixture; after reacting for 1 hour, the reaction mixture was diluted with cold water, the aqueous phase was extracted with ethyl acetate, the organic phase was washed with brine and dried over sodium sulfate; the organic phase was concentrated to give product 1:31.6 g, yield 95.1%. 1 H NMR (300MHz, CDCl3) δ = 7.53–7.35 (m, 10H), 7.24 (d, J = 2.3, 2H), 6.85 (t, J = 2.3, 1H), 5.10 (s, 4H), 2.59 (s, 3H).; 13C NMR (75MHz, CDCl3) δ = 197.8, 160.0, 139.1, 136.4, 128.7, 128.2, 127.7, 107.4, 106.9, 70.4, 26.8.MS (ESI + )calcd for:333.14[M+H]; found,332.88.

[0078] 2. Synthesis of compound (2a) – (S)-1-(3,5-bis(benzyloxy)phenyl)ethane-1-ol

[0079] Compound 1 (5.0 g, 15.0 mmol) and (S)-diphenylprolyl (380.0 mg, 1.5 mmol) were dissolved in 15 mL of dry tetrahydrofuran; 1 mol / L tetrahydrofuran borohydride (30 mL, 30.0 mmol, 2.0 equiv.) was slowly added dropwise to the reaction mixture; after 1 hour of reaction, the reaction was terminated with saturated NH4Cl solution at -20 °C. The aqueous phase was extracted with ethyl acetate, and the organic phase was washed with brine and dried over sodium sulfate. The organic phase was concentrated to give 2a: 4.8 g, yield 96.3%. 1 H NMR (300MHz, CDCl3) δ7.51–7.32(m,10H),6.68(d,J=2.2,2H),6.58(t,J=2.2,1H),5.07(s,4H),4.84(q,J=6.4,1H),1.50(d,J=6.5,3H). 13 C NMR (75MHz, CDCl3) δ160.1,148.6,136.8,128.7,128.1,127.6,104.5,100.9,70.4,70.1,25.2.[α] D 20 =+14.2(c=1.0,MeOH),MS(ESI) - calcd for C 22 H 22 O3-H + :333.42[MH]; found:333.17.

[0080] 3. Synthesis of compound (2b) – (R)-1-(3,5-bis(benzyloxy)phenyl)ethane-1-ol

[0081] Compound 1 (5.0 g, 15.0 mmol) and 1.5 mL of 1 M CBS catalyst were dissolved in 15 mL of dry tetrahydrofuran. 1 mol / L tetrahydrofuran borohydride (30 mL, 30.0 mmol, 2.0 equiv.) was slowly added dropwise to the reaction mixture. After 1 hour of reaction, the reaction was terminated with a saturated NH4Cl solution at -20 °C. The aqueous phase was extracted with ethyl acetate, and the organic phase was washed with brine and dried over sodium sulfate. The concentrated organic phase gave 2b: 4.7 g, yield 94.1%. 1 H NMR (300MHz, CDCl3) δ7.50–7.34(m,10H),6.68(d,J=2.2,2H),6.58(t,J=2.3,1H),5.07(s,4H),4.85(dd,J=12.0,5.5,1H),1.50(d,J=6.4,3H). 13 C NMR (75MHz, CDCl3) δ160.1,148.6,136.8,128.6,128.1,127.6,104.5,100.9,70.4,70.1,25.2.[α] D 20 =-9.2 (c=1.0, MeOH), MS(ESI) - calcd for C 22 H 22 O2-H + :333.42[MH]; found:333.02.

[0082] 4. Synthesis of compound (3a) — (R)-(((5-(1-bromoethyl)-1,3-phenyl)bis(oxy))bis(methylene))diphenyl

[0083] Compound 2a (3.0 g, 9 mmol) was dissolved in 100 mL of diethyl ether, and PBr3 (2.9 g, 10.8 mmol, 1.2 equiv.) and AlCl3 (60.0 mg, 0.5 mmol, 0.05 equiv.) were added. After reacting for 1 hour, the reaction was terminated with saturated NaHCO3 solution at -20 °C. The aqueous phase was extracted with ethyl acetate, and the organic phase was washed with brine and dried over sodium sulfate. The organic phase was concentrated to give 3a: 3.2 g, yield 90.2%. The crude product of compound 3a did not require purification and proceeded directly to the next reaction. [α] D 20 =-3.4(c=1.0,MeOH),MS(ESI+)calcd for C 22 H 21 BrO2+H + 398.31[M+H]; found:398.41.

[0084] (S)-(((5-(1-bromoethyl)-1,3-phenyl)bis(oxy))bis(methylene))diphenyl (3b). Compound 3b was prepared following step 3a using compound 2b (3.4 g, 10 mmol), PBr3 (3.2 g, 10.8 mmol, 1.2 equiv.), and AlCl3 (66.7 mg, 0.5 mmol, 0.05 equiv.). Yield 3a: 3.7 g, 92.7%. [α] D 20 =+8.7 (c=1.0, MeOH), MS (ESI) + calcd for C 22 H 21 BrO2+H + :398.31[M+H];found:398.24.

[0085] 5. Synthesis of compound (3b) — (S)-(((5-(1-bromoethyl)-1,3-phenyl)bis(oxy))bis(methylene))diphenyl

[0086] Compound 3b was prepared following step 3a using compound 2b (3.4 g, 10 mmol), PBr3 (3.2 g, 10.8 mmol, 1.2 equiv.), and AlCl3 (66.7 mg, 0.5 mmol, 0.05 equiv.). Yield 3a: 3.7 g, 92.7%. [α] D 20 =+8.7 (c=1.0, MeOH), MS (ESI) + calcd for C 22 H 21 BrO2+H + :398.31[M+H];found:398.24.

[0087] 6. Compound (4a) — (R)-2-(1-(3,5-bis(benzyloxy)phenyl)ethyl)- 2 Synthesis of H-1,2,3-triazole

[0088] 2H-1,2,3-triazole (880.6 mg, 12.8 mmol, 1.5 equiv.) and compound 3a (3.4 g, 8.5 mmol) were dissolved in 50 mL of DMF / H2O (9 / 1), and NaOH (680.0 g, 17.0 mmol, 2.0 equiv.) was added to the solution. The reaction mixture was stirred at room temperature for 3 hours. After the reaction was complete, the solution was diluted with saturated NH4Cl, the aqueous phase was extracted with diethyl ether, the organic matter was washed with brine and dried over sodium sulfate. The crude product was purified by silica gel column chromatography with petroleum ether / ethyl acetate as the eluent. Yield 4a: 479.4 mg, 27.5%. 1 H NMR (300MHz, CDCl3) δ7.66 (s, 2H), 7.48–7.36 (m, 10H), 6.57 (s, 3H), 5.84 (q, J = 7.1Hz, 1H), 5.02 (s, 4H), 2.01 (d, J = 7.1Hz, 3H). 13 C NMR (75MHz, CDCl3) δ160.1,143.2,136.7,134.1,128.6,128.1,127.7,105.6,101.3,70.1,64.3,21.2.[α] D 20 =-6.2 (c=1.0, MeOH), MS (ESI) + calcd for C 24 H 23 N3O2+H + 386.47[M+H]; found: 386.27.

[0089] 7. Compound (4b) — (S)-2-(1-(3,5-bis(benzyloxy)phenyl)ethyl)- 2 Synthesis of H-1,2,3-triazole

[0090] Compound 4b is used in accordance with step 4a. 2 H-1,2,3-triazole (928.8 mg, 13.5 mmol, 1.5 equiv.), compound 3b (3.6 g, 9.0 mmol) and NaOH (720.0 g, 18.0 mmol, 2.0 equiv.) were prepared. Yield 4b: 531.6 mg, 28.8%. 1 H NMR (300MHz, CDCl3) δ7.68 (s, 2H), 7.49–7.37 (m, 10H), 6.59 (s, 3H), 5.86 (q, J = 7.1Hz, 1H), 5.03 (s, 4H), 2.03 (d, J = 7.1Hz, 3H). 13C NMR (75MHz, CDCl3) δ160.2,143.3,136.7,134.1,128.7,128.1,127.7,105.6,101.4,70.1,64.3,21.2.[α] D 20 =+3.6 (c=1.0, MeOH), MS (ESI) + calcd for C 24 H 23 N3O2+H + 386.47[M+H]; found: 386.02.

[0091] 8. Synthesis of compound (5a) – (R)-5-(1-(2H-1,2,3-triazol-2-yl)ethyl)phenyl-1,3-diol

[0092] Compound 4a (462.2 mg, 1.2 mmol) and Pd(OH) were added to 40 mL of a 1 / 1 mixture of methanol and ethyl acetate. Hydrogen gas was introduced into the reaction mixture via a balloon at room temperature. The reaction was monitored by thin-layer chromatography (TLC). After the reaction was complete, the reaction mixture was filtered and concentrated to give a colorless oil. Yield 5a: 221.7 mg. 1 H NMR (300MHz, MeOD) δ7.71 (s, 2H), 6.17 (s, 3H), 5.73 (q, J = 7.1Hz, 1H), 1.90 (d, J = 7.1Hz, 3H). 13 C NMR(75MHz,MeOD)δ158.4,143.4,133.7,104.2,101.5,64.1,20.2.[α] D 20 =-12.0 (c=1.0, MeOH), MS(ESI) - calcd for C 10 H 11 N3O2-H - :204.22[MH]; found:204.23.

[0093] 9. Synthesis of compound (5b) – (S)-5-(1-(2H-1,2,3-triazol-2-yl)ethyl)phenyl-1,3-diol

[0094] Compound 5b was prepared using the same method as 5a, but with compound 4b (616.3 mg, 1.6 mmol) and Pd(OH). Yield of 5b: 289.75 mg, 88.3%. 1H NMR (300MHz, MeOD) δ7.71 (s, 2H), 6.17 (s, 3H), 5.73 (q, J = 7.1Hz, 1H), 4.95 (s, 4H), 1.90 (d, J = 7.1Hz, 3H). 13 C NMR(75MHz,MeOD)δ158.4,143.4,133.7,104.2,101.5,64.1,20.2.[α] D 20 = +9.8 (c = 1.0, MeOH), MS (ESI) - calcd for C 10 H 11 N3O2-H - :204.22[MH]; found:204.11.

[0095] 10. Synthesis of compound (6a)——(7R)-(-)-CIAC001

[0096] Compound 5a (188.7 mg, 0.9 mmol) and (1S,4R)-1-methyl-4-(prop-1-en-2-yl)cyclohex-2-enol (208.6 mg, 1.4 mmol, 1.5 equiv.) were dissolved in 20 mL of 1,2-dichloroethane. p-Toluenesulfonic acid (p-TsOH) (31.7 mg, 0.2 mmol, 0.2 equiv.) was added, and the reaction mixture was stirred at room temperature. After 2 hours, the reaction was terminated with H₂O. The aqueous phase was extracted with ethyl acetate, and the organic phase was washed with brine and dried over sodium sulfate. The crude product was purified by silica gel column chromatography using petroleum ether / ethyl acetate as the eluent. Yield 6a: 50.1 mg, 16.1%. 1 H NMR (300MHz, CDCl3) δ7.59(s,2H),6.86(s,1H),6.35(s,1H),6.08(d,J=23.3Hz,2H),5.71(q,J=7.3Hz,1H),5.51(s,1H),4.54(s, 1H), 4.46 (s, 1H), 3.95 (d, J = 9.4Hz, 1H), 2.51–2.37 (m, 1H), 2.31–2.02 (m, 2H), 1.96–1.86 (m, 3H), 1.85–1.72 (m, 5H), 1.66 (s, 3H). 13 C NMR (75MHz, CDCl3) δ148.0,140.3,139.9,133.9,123.9,116.4,111.2,64.0,46.2,36.2,30.3,28.2,23.7,20.9,19.5.Purity:97.95%,[α]D 20 =-98.1 (c=1.0, MeOH), MS(ESI) - calcd for C 20 H 25 N3O2-H - :338.44[M+H];found:338.38.

[0097] 11. Synthesis of compound (6b)——(7S)-(-)-CIAC001

[0098] Compound 6b was prepared according to the method described for 6a, using compound 5b (113.1 mg, 0.6 mmol) and (1S,4R)-1-methyl-4-(prop-1-en-2-yl)cyclohex-2-enol (125.6 mg, 0.8 mmol, 1.5 equiv.). Yield 6b: 36.2 mg, 17.7%. 1 H NMR (300MHz, CDCl3) δ7.67–7.53(m,2H),6.56–6.00(m,4H),5.81–5.64(m,1H),5.51(s,1H),4.55(s,1H),4.47(s,1 H),3.94(d,J=8.8Hz,1H),2.51–2.36(m,1H),2.34–1.99(m,2H),1.95–1.88(m,3H),1.85–1.72(m,5H),1.66(s,3H). 13 C NMR (75MHz, CDCl3) δ148.2,140.1,133.9,123.8,116.4,111.2,63.8,53.5,46.1,36.4,30.3,28.2,23.7,20.7,19.6.Purity:98.30%,[α] D 20 =-100.3(c=1.0,MeOH),MS(ESI+)calcd for MS(ESI - calcd for C 20 H 25 N3O2-H - :338.44[M+H];found:338.45.

[0099] 12. Synthesis of compound (6c)——(7R)-(+)-CIAC001

[0100] Compound 6c was prepared according to the method described for 6a, using compound 5a (188.7 mg, 0.9 mmol) and (1R,4S)-1-methyl-4-(prop-1-en-2-yl)cyclohex-2-enol (208.6 mg, 1.4 mmol, 1.5 equiv.). Yield of 6c: 53.6 mg, 17.6%. 1 H NMR (300MHz, CDCl3) δ7.66–7.53(m,2H),6.85(s,1H),6.48–5.96(m,3H),5.77–5.62(m,1H),5.50(s,1H),4.53(s,1H),4.4 5(s,1H),3.95(d,J=8.7Hz,1H),2.51–2.35(m,1H),2.31–2.02(m,2H),1.94–1.86(m,3H),1.84–1.72(m,5H),1.66(s,3H). 13 C NMR (75MHz, CDCl3) δ148.1,140.0,139.9,133.9,123.9,116.4,111.2,63.8,46.2,36.2,30.3,28.4,28.2,23.7,20.7,19.4.Purity:98.88%,[α]D 20 = +97.2 (c = 1.0, MeOH), MS (ESI) - calcd for C 20 H 25 N3O2-H - :338.44[M+H];found:338.51.

[0101] 13. Synthesis of compound (6d)——(7S)-(+)-CIAC001

[0102] Compound 6d was prepared using compound 5b (113.1 mg, 0.6 mmol) and (1R,4S)-1-methyl-4-(prop-1-en-2-yl)cyclohex-2-enol (125.6 mg, 0.8 mmol, 1.5 equiv.) according to the preparation method of 6a. Yield of 6d: 30.7 mg, 11.3%. 1H NMR(300MHz, CDCl3)δ7.60(s,2H),6.60(s,1H),6.46–5.99(m,3H),5.79–5.64(m,1H),5.51(s,1H),4.56(s,1H),4.47( s,1H),3.94(d,J=8.9Hz,1H),2.50–2.37(m,1H),2.31–2.00(m,2H),1.97–1.86(m,3H),1.85–1.73(m,5H),1.66(s,3H). 13 C NMR (75MHz, CDCl3) δ148.2,140.3,140.0,133.9,123.8,116.4,111.2,64.0,46.1,36. 3,30.3,28.2,23.7,20.9,19.6.Purity:98.88%,[α]D20=+99.1(c=1.0,MeOH),MS(ESI - calcd for C 20 H 25 N3O2-H - :338.44[M+H];found:338.28.

[0103] In summary, the synthetic routes for compounds 6a-6d are shown in Figure 1.

[0104] Example 2: In vitro binding experiment of chiral CIAC001

[0105] 1. Allosteric regulatory activity of CIAC001 chiral isomers

[0106] PKM2 was first activated by pre-incubation with FBP for 10 minutes; then, chiral isomers were introduced and their allosteric regulatory effects on PKM2 were assessed using a PKM2-lactate dehydrogenase (LDH) enzyme coupling assay.

[0107] As shown in Figure 2A, (7S)-(-)-CIAC001 exhibits dose-dependent inhibition of PKM2 enzyme activity, with an IC50 value of [missing information]. 50 The value was 13.3 ± 4.1 μM, and ΔE max The value was 50.7 ± 1.4%, while the enantiomer (7R)-(-)-CIAC001 showed a significantly reduced inhibitory activity against PKM2, with its ΔE... max Only 23.0 ± 3.8%. Both (7R)-(+)-CIAC001 and (7S)-(+)-CIAC001 showed a ΔE of less than 15.0%. maxThe values ​​indicate that they have poor inhibitory activity against PKM2. Therefore, PKM2 has a stereochemical recognition mechanism specific to the enantiomers (7R)-(-)-CIA C001 and (7S)-(-)-CIAC001.

[0108] 2. Measure the binding constant between the small molecule and the target protein.

[0109] Fluorescent titration measures the binding constant of a small molecule to a target protein by assessing the decrease in protein fluorescence during molecular interactions.

[0110] As shown in Figure 2B, the intrinsic fluorescence of recombinant PKM2 protein decreased in a dose-dependent manner with the addition of (7S)-(-)-CIAC001, yielding a dissociation constant KD of 2.4 ± 1.3 μM for the CIAC001-PKM2 interaction (Figure 2B). Conversely, the intrinsic fluorescence of PKM2 induced by (7R)-(-)-CIAC001 decreased by less than 10.0%, highlighting the selective interaction between (7S)-(-)-CIAC001 and PKM2. Furthermore, cellular thermal shift analysis (CETSA) was used to verify the different thermostability effects of (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 on PKM2. Briefly, the CETSA assay involved incubating cell lysates with or without enantiomers, followed by heating to induce protein denaturation and precipitation. Soluble proteins were then separated from fragments and aggregates. Residual protein was quantified using Western blotting. The combination of (7S)-(-)-CIAC001 reduces the thermal stability of PKM2, which is reflected in the shift in its melting temperature (Tm), ΔT m The value was 4.07 ± 1.10 °C (Figures 2C-2D). (7R)-(-)-CIAC001 failed to affect the phase transition temperature (ΔT) of PKM2. m =1.61±0.35℃), which indicates that PKM2 has different binding differences to the enantiomers of CIAC001 in vitro.

[0111] In summary, in vitro data consistently show that (7S)-(-)-CIAC001 binds to PKM2 better than (7R)-(-)-CIAC001.

[0112] Example 3: Study on the mechanism of chiral CIAC001 recognizing PKM2

[0113] To investigate the stereochemical recognition mechanism between (7S)-(-)-CIAC001 and PKM2, molecular docking experiments were conducted.

[0114] Both (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 bind to the tetrameric subunit interface of PKM2 (PDB ID: 3ME3, Figure 3A) and form hydrogen bonds with Y390 (Figure 3B). Due to its unique chirality, (7S)-(-)-CIAC001 undergoes π-π stacking with F26 in both subunits, while (7R)-(-)-CIAC001 forms this interaction with only one subunit (Figures 3B-2C). Consistent with the docking results, MM / PBSA binding free energy calculations confirm that (7S)-(-)-CIAC001 has a stronger binding affinity to the PKM2 tetramer, with its ΔG binding The effective value was -62.12 ± 0.41 kcal / mol, lower than its enantiomer's -40.95 ± 0.53 kcal / mol. The role of alanine mutation at the F26 position of PKM2 in the stereochemical recognition of CIAC001 enantiomers was determined. This mutation did not alter the activity level of the wild-type PKM2 (Fig. 3D), but prevented the allosteric inhibition of the mutant PKM2F26A by (7S)-(-)-CIAC001 (Fig. 3E). Furthermore, fluorescence titration data showed that (7S)-(-)-CIAC001 could not bind to the F26A-PKM2 mutant, resulting in no fluorescence quenching (Fig. 3F). (7S)-(-)-CIAC001 docked with the mutant PKM2 lost its binding ability to F26 and Y390, instead forming a hydrogen bond with D354.

[0115] In summary, amino acid F26 is a key residue for chiral recognition of PKM2 by (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001.

[0116] Example 4: In vitro anti-inflammatory activity of chiral CIAC001

[0117] In vivo, stereochemical recognition leads to different biological activities of drugs. In inflammatory responses, PKM2 is overexpressed and translocates to the nucleus, where it collaborates with HIF-1α to control the expression of inflammatory genes, particularly IL-1β.

[0118] As shown in Figure 4A, LPS treatment significantly increased the amount of PKM2 in the cell nucleus. (7S)-(-)-CIAC001 effectively counteracted LPS-induced PKM2 nuclear translocation, while the enantiomer (7R)-(-)-CIAC001 showed a weaker inhibitory effect. To assess the transcriptional effect, IL-1β mRNA levels were monitored 6 hours after treatment with (7S)-(-)-CIAC001 or (7R)-(-)-CIAC001. At a concentration of 10 μM, both isoforms reduced LPS-induced IL-1β mRNA upregulation to the same extent, but (7S)-(-)-CIAC001 showed stronger potency at a concentration of 1 μM (Figure 4B). The increased release of IL-1β led to the upregulation of nitric oxide production, which in turn triggered an inflammatory response. (7S)-(-)-CIAC001 inhibited LPS-induced NO production in a dose-dependent manner, with an IC50 value of 3.3 ± 0.4 μM (Fig. 4C). However, compared with (7S)-(-)-CIAC001, the anti-neuroinflammatory activity of (7R)-(-)-CIAC001 was reduced by 4-fold (IC50 = 13.2 ± 3.7). Microglia adjust their cellular morphology phenotype according to various stimuli. Untreated BV-2 cells are mainly small and round. Under LPS activation, the cell volume increases and transforms into an amoeboid morphology, and microglia activation is significantly increased (Fig. 4D-4E). (7S)-(-)-CIAC001 significantly counteracted the LPS-induced morphological changes and inhibited microglia activation, while (7R)-(-)-CIAC001 failed to completely reverse microglia activation.

[0119] These results indicate that (7S)-(-)-CIAC001 has superior anti-inflammatory activity compared to (7R)-(-)-CIAC001 due to the difference in stereochemical recognition by PKM2.

[0120] Example 5: Antimorphine Addiction Activity of Chiral CIAC001

[0121] Morphine activates TLR4 receptors in the central nervous system, inducing inflammation and enhancing its reward effect. To confirm the different stereochemical recognitions of (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 in vivo, the Pavlovian conditioned position preference (CPP) test, a commonly used model for assessing drug addiction, was employed. Mice were trained for six days by associating morphine with a black-and-white room (Fig. 5A). After morphine training, mice developed a significant preference for morphine, with a CPP score of 314 seconds, indicating psychological dependence on morphine (Fig. 5B). Treatment with (7S)-(-)-CIAC001 eliminated the preference for morphine in trained mice, while (7R)-(-)-CIAC001 failed to treat psychological dependence on morphine. Following the CPP test, medial prefrontal cortex (mPFC) samples were extracted from the mice to measure IL-1β mRNA levels. (7S)-(-)-CIAC001 alleviated the surge in IL-1β caused by morphine, while (7R)-(-)-CIAC001 had almost no effect (Figure 5C).

[0122] Therefore, the stereochemical recognition of CIAC001 is the reason for the difference in efficacy between (7S)-(-)-CIAC001 and (7R)-(-)-CIAC001 in the treatment of morphine addiction.

[0123] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A chiral cannabidiol derivative, characterized in that: The general structural formulas of the chiral cannabidiol derivatives are shown in formulas (Ia)-(Id): Among them, R 1 for -H、 as well as One or more of the following; R 2A and R 2B Independently -H, C1-C4 alkyl, C2-C4 alkenyl, or C2-C4 alkynyl; R 3A and R 3B It can be -H, halogen, -COOH or -NH2 independently.

2. The chiral cannabidiol derivative as described in claim 1, characterized in that: The formula (Ia)-(Id) also includes as well as One or more of them.

3. A pharmaceutical composition, characterized in that: Includes chiral cannabidiol derivatives represented by formulas (Ia)-(Id) and pharmacologically acceptable excipients.

4. The use of the chiral cannabidiol derivative as described in claim 1 or 2, or the pharmaceutical composition as described in claim 3, in the treatment or prevention of opioid addiction.

5. The use of the chiral cannabidiol derivative as described in claim 1 or 2, or the pharmaceutical composition as described in claim 3, in the treatment or prevention of opioid-induced neuroinflammation.

6. The use of the chiral cannabidiol derivative of claim 1 or 2 or the pharmaceutical composition of claim 3 in the ability to regulate pyruvate kinase M2 activity.

7. The application as described in any one of claims 4 to 6, characterized in that: The chiral cannabidiol derivatives represented by formulas (Ia)-(Id) are administered at doses of 0.5–100 mg / kg.

8. The application as described in any one of claims 4 to 6, characterized in that: The opioids include, but are not limited to, fentanyl, ibuprofen, codeine, diazepam, dihydrocodeine, enkephalin, heroin, oxycodone, oxymectin, meperidine, methadone, morphine, nicoridine, opium, Oscontin, and their derivatives and precursors.

9. The application as described in any one of claims 4 to 6, characterized in that: This includes, but is not limited to, oral, subbuccal, sublingual, rectal, vaginal, intravenous, intra-arterial, intramedullary, intramuscular, intracerebral, intraventricular, intraspinal, subcutaneous, intraperitoneal, intraocular, intranasal, transdermal, epidural, intracranial, intrauterine, intravitreal, mucosal, and inhaler-mediated administration.