Sirna targeting AZGP1 and use thereof in preparation of drug for tumor treatment
By designing siRNA molecules and their derivatives that target AZGP1, the problem of the lack of AZGP1-targeted therapy in existing technologies has been solved, achieving the inhibition of cancer cell proliferation, invasion and metastasis, and providing an effective cancer treatment method.
Patent Information
- Application Number
- PCT/CN2025/095070
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-25
- Filing Date
- 2025-05-15
- Publication Date
- 2026-07-02
AI Technical Summary
Currently, there are no drugs targeting AZGP1, resulting in poor prognosis for cancers such as triple-negative breast cancer. Existing technologies cannot effectively inhibit AZGP1 gene expression.
We design and provide siRNA molecules and their derivatives that target AZGP1, including sense and antisense strands, to form double-stranded regions by modifying and linking different nucleotides, for the purpose of inhibiting AZGP1 gene expression.
It effectively inhibits cancer cell proliferation, invasion and metastasis, weakens epithelial-mesenchymal transition, and provides therapeutic effects for cancers such as breast cancer.
Smart Images

Figure PCTCN2025095070-FTAPPB-I100001 
Figure PCTCN2025095070-FTAPPB-I100002 
Figure 00000014_0000
Abstract
Description
siRNAs targeting AZGP1 and their application in the preparation of tumor therapeutic drugs Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to siRNA targeting AZGP1 and its application in the preparation of tumor therapeutic drugs. Background Technology
[0002] AZGP1 (Zinc α-2 glycoprotein, or ZAG) is a protein with lipomobilization activity, and its expression is elevated in various cancers, including breast cancer. Increased AZGP1 expression can lead to a poorer prognosis in cancers such as triple-negative breast cancer. High AZGP1 expression is associated with the immunosuppressive microenvironment of breast cancer. Currently, there are no drugs targeting AZGP1. Therefore, the development of drugs targeting the AZGP1 gene is urgently needed.
[0003] Small interfering RNA (siRNA) is a class of double-stranded RNAs of 20 to 25 nucleotides. siRNA can bind to the coding region of a target gene, causing degradation at the mRNA level and leading to impaired protein translation. Numerous studies have shown that siRNA can act on a variety of target genes, thereby treating various diseases caused by those genes.
[0004] Invention disclosure
[0005] The technical problem to be solved by the present invention is to provide siRNA targeting AZGP1 and its application in the preparation of tumor therapeutic drugs.
[0006] This invention provides an siRNA molecule for inhibiting AZGP1 gene expression.
[0007] The siRNA molecule for inhibiting AZGP1 gene expression provided by the present invention may be AZGP1-1, AZGP1-2, AZGP1-3, AZGP1-4, AZGP1-5, AZGP1-6 or AZGP1-7; the siRNA molecule contains a sense strand and an antisense strand, wherein the sense strand is at least partially anticomplementary to the antisense strand to form a double-stranded region;
[0008] The positive chain of AZGP1-1 contains (or is) SEQ ID No. 1, and the negative chain of AZGP1-1 contains (or is) SEQ ID No. 2;
[0009] The positive chain of AZGP1-2 contains (or is) SEQ ID No. 3, and the negative chain of AZGP1-2 contains (or is) SEQ ID No. 4;
[0010] The positive chain of AZGP1-3 contains (or is) SEQ ID No. 5, and the negative chain of AZGP1-3 contains (or is) SEQ ID No. 6;
[0011] The positive chain of AZGP1-4 contains (or is) SEQ ID No. 7, and the negative chain of AZGP1-4 contains (or is) SEQ ID No. 8;
[0012] The positive chain of AZGP1-5 contains (or is) SEQ ID No. 9, and the negative chain of AZGP1-5 contains (or is) SEQ ID No. 10;
[0013] The positive chain of AZGP1-6 contains (or is) SEQ ID No. 11, and the negative chain of AZGP1-6 contains (or is) SEQ ID No. 12;
[0014] The positive chain of AZGP1-7 contains (or is) SEQ ID No. 13, and the negative chain of AZGP1-7 contains (or is) SEQ ID No. 14.
[0015] The present invention also provides derivatives of the siRNA molecule described above.
[0016] The derivatives provided by this invention may specifically be any of the following:
[0017] (A1) Deleting or adding one or more nucleotides to the siRNA molecule described above to obtain a derivative that has the same function as the siRNA molecule;
[0018] (A2) The siRNA molecule described above is replaced or modified with one or more nucleotides to obtain a derivative that has the same function as the siRNA molecule;
[0019] (A3) Modify the backbone of the siRNA molecule described above into a thiophosphate backbone to obtain a derivative with the same function as the siRNA molecule.
[0020] (A4) Connecting the siRNA molecule described above to a signaling molecule and / or an active molecule and / or a functional group to obtain a derivative having the same function as the siRNA molecule.
[0021] Further, in (A1), the deletion or addition of one or more nucleotides is the deletion or addition of no more than 5 nucleotides.
[0022] Further, in (A2), the modification may be selected from any one or more of the following: fluorination modification, methoxylation modification, deoxylation modification, and ligand modification. Specifically, the modification may be 2'-OME modification and / or 2'-F modification and / or lipid molecule modification and / or lipid molecule coupled albumin modification and / or N-acetylgalactosamine (GalNAc) modification.
[0023] Furthermore, in (A2), the fluorinated nucleotides are located in both the antisense and sense strands of the siRNA molecule, and, following the direction from the 5' end to the 3' end, at least the 7th, 9th, 10th, and 11th nucleotides of the sense strand are fluorinated nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated nucleotides; or, the fluorinated nucleotides are located in both the antisense and sense strands of the siRNA molecule, and, following the direction from the 5' end to the 3' end, at least the 1st, 3rd, 5th, 7th, 9th, 10th, 11th, 13th, 15th, 17th, and 19th nucleotides of the sense strand are fluorinated nucleotides, and at least the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, and 18th nucleotides of the antisense strand are fluorinated nucleotides. Herein, "fluorinated nucleotides" refers to nucleotides formed by replacing the hydroxyl group at the 2' position of the ribosome with fluorine.
[0024] Furthermore, in (A2), the methoxylated nucleotides are located in both the antisense and sense strands of the siRNA molecule, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, and 19 of the sense strand are methoxylated nucleotides, and at least the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, and 19 of the antisense strand are methoxylated nucleotides. The nucleotides are modified with methoxy groups; or, the methoxy-modified nucleotides are located in the antisense and sense strands of the siRNA molecule, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, and 18 of the sense strand are methoxy-modified nucleotides, and at least the nucleotides at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19 of the antisense strand are methoxy-modified nucleotides. Herein, "methoxy-modified nucleotides" refers to nucleotides modified with 2'-methoxy (2'-OMe).
[0025] Furthermore, in (A3), the nucleotides linked by thiophosphate groups are located in the antisense and sense strands of the siRNA molecule, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the sense strand are linked by thiophosphate groups, and at least the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand are linked by thiophosphate groups.
[0026] Furthermore, in (A2), the nucleotides at positions 20 and 21 of the sense strand and the antisense strand are deoxythymine.
[0027] Furthermore, in (A2), the 3' end of the positive strand of the siRNA molecule is coupled with a ligand, the ligand being GalNAc; or, the 3' or 5' end of the positive strand of the siRNA molecule is coupled with a ligand, which is in fact a lipid molecule; or, the 3' end of the positive strand of the siRNA molecule is coupled with a ligand, the ligand being a lipid molecule coupled with albumin.
[0028] The lipid molecules may include, but are not limited to, cholesterol, PEGylated lipids, triethylene glycol (TEG), and stearyl.
[0029] That is, in the siRNA molecule for inhibiting AZGP1 gene expression provided by the present invention, all nucleotides may be unmodified nucleotides, or at least one nucleotide in the sense strand or antisense strand may be a modified nucleotide as described above, or all or part of the nucleotides may be modified nucleotides as described above.
[0030] In one embodiment of the present invention, the derivative of the siRNA molecule is AZGP1-1 modified with fluorination, methoxylation, and a thiophosphate backbone. Specifically:
[0031] Chain of Justice: fG*mU*fUmAfCmUfCmUfCmUfGmAfCmCfUmAfUmAfU*T*T(SEQ ID No.17);
[0032] Antisense strand: mA*fU*mAfUmAfGmGfUmCfAmGfAmGfAmGfUmAfAmC*T*T (SEQ ID No. 18).
[0033] In this context, the four ribonucleotides are represented by A, U, C, and G, respectively; mA, mU, mC, and mG represent 2'-methoxy-modified ribonucleotides A, U, C, and G, respectively; fA, fU, fC, and fG represent fluorinated ribonucleotides A, U, C, and G, respectively; * indicates a phosphate thiophosphate backbone link.
[0034] This invention also provides the application of the siRNA molecule or its derivative described above in the preparation of products; the function of the products may be any of the following:
[0035] (B1) Inhibits cancer cell proliferation;
[0036] (B2) Inhibits cancer cell invasion and / or metastasis;
[0037] (B3) Inhibits epithelial-mesenchymal transition in cancer cells;
[0038] (B4) Cancer treatment;
[0039] (B5) Inhibits AZGP1 gene expression.
[0040] This invention also provides for the use of the siRNA molecule or its derivatives described above in any of the following:
[0041] (B1) Inhibits cancer cell proliferation;
[0042] (B2) Inhibits cancer cell invasion and / or metastasis;
[0043] (B3) Inhibits epithelial-mesenchymal transition in cancer cells;
[0044] (B4) Cancer treatment;
[0045] (B5) Inhibits AZGP1 gene expression.
[0046] Furthermore, the cancer cells may be cancer cells that highly express the AZGP1 gene; the cancer may be a cancer that highly expresses the AZGP1 gene.
[0047] The high expression of the AZGP1 gene refers to the upregulation of the expression level of the AZGP1 gene compared with that in normal cells or disease-free organisms.
[0048] Furthermore, the cancer cells may be breast cancer cells; the cancer may be breast cancer.
[0049] In one specific embodiment of the present invention, the breast cancer cells are triple-negative breast cancer cells, such as MDA-MB-231 cells; the breast cancer is triple-negative breast cancer.
[0050] The present invention also provides siRNA molecules for use as drugs, wherein the siRNA molecules are AZGP1-1, AZGP1-2, AZGP1-3, AZGP1-4, AZGP1-5, AZGP1-6 or AZGP1-7 as described above.
[0051] The present invention also provides siRNA molecules for at least one of the following uses, wherein the siRNA molecules are AZGP1-1, AZGP1-2, AZGP1-3, AZGP1-4, AZGP1-5, AZGP1-6 or AZGP1-7 as described above;
[0052] (B1) Inhibits cancer cell proliferation;
[0053] (B2) Inhibits cancer cell invasion and / or metastasis;
[0054] (B3) Inhibits epithelial-mesenchymal transition in cancer cells;
[0055] (B4) Cancer treatment;
[0056] (B5) Inhibits AZGP1 gene expression.
[0057] Furthermore, the cancer cells may be cancer cells that highly express the AZGP1 gene; the cancer may be a cancer that highly expresses the AZGP1 gene.
[0058] The high expression of the AZGP1 gene refers to the upregulation of the expression level of the AZGP1 gene compared with that in normal cells or disease-free organisms.
[0059] Furthermore, the cancer cells may be breast cancer cells; the cancer may be breast cancer.
[0060] In one specific embodiment of the present invention, the breast cancer cells are triple-negative breast cancer cells, such as MDA-MB-231 cells; the breast cancer is triple-negative breast cancer.
[0061] The present invention also provides a method for inhibiting the proliferation of cancer cells, which may include the following steps: introducing the siRNA molecule or the derivative described above into cancer cells, thereby inhibiting the proliferation of the cancer cells.
[0062] The present invention also provides a method for inhibiting cancer cell invasion and / or metastasis, which may include the following steps: introducing the siRNA molecule or the derivative described above into cancer cells, thereby inhibiting the invasion and / or metastasis of the cancer cells.
[0063] The present invention also provides a method for inhibiting epithelial-mesenchymal transition (EMT) of cancer cells, which may include the following steps: introducing the siRNA molecule or the derivative described above into cancer cells, thereby inhibiting EMT of the cancer cells.
[0064] The present invention also provides a method for treating cancer, which may include the following steps: administering the aforementioned siRNA molecule or its derivative to a cancer-affected organism to achieve cancer treatment.
[0065] Furthermore, the cancer cells may be cancer cells that highly express the AZGP1 gene; the cancer may be a cancer that highly expresses the AZGP1 gene.
[0066] The high expression of the AZGP1 gene refers to the upregulation of the expression level of the AZGP1 gene compared with that in normal cells or disease-free organisms.
[0067] Furthermore, the cancer cells may be breast cancer cells; the cancer may be breast cancer.
[0068] In one specific embodiment of the present invention, the breast cancer cells are triple-negative breast cancer cells, such as MDA-MB-231 cells; the breast cancer is triple-negative breast cancer.
[0069] This invention also provides the use of substances capable of inhibiting AZGP1 protein expression and / or activity in the preparation of products, wherein the function of the products may be any of the following:
[0070] (C1) Inhibits breast cancer cell proliferation;
[0071] (C2) Inhibits breast cancer cell invasion and / or metastasis;
[0072] (C3) Inhibits epithelial-mesenchymal transition in breast cancer cells;
[0073] (C4) Treatment of breast cancer.
[0074] This invention also provides the use of a substance capable of inhibiting AZGP1 protein expression and / or activity in any of the following:
[0075] (C1) Inhibits breast cancer cell proliferation;
[0076] (C2) Inhibits breast cancer cell invasion and / or metastasis;
[0077] (C3) Inhibits epithelial-mesenchymal transition in breast cancer cells;
[0078] (C4) Treatment of breast cancer.
[0079] The substance may be a substance that directly targets the AZGP1 gene and can inhibit the expression and / or activity of the AZGP1 protein, such as siRNA or shRNA or gene editing tools that target the AZGP1 gene.
[0080] In one embodiment of the present invention, the substance is siRNA targeting the AZGP1 gene, specifically the siRNA molecule or derivative described above.
[0081] Furthermore, the breast cancer cells may be triple-negative breast cancer cells, such as MDA-MB-231 cells; the breast cancer is triple-negative breast cancer.
[0082] In this invention, the nucleotide sequence of the AZGP1 gene is SEQ ID No. 15.
[0083] In this invention, the amino acid sequence of the AZGP1 protein is SEQ ID No. 16. Attached Figure Description
[0084] Figure 1 shows the effect of siRNA on the expression level of AZGP1 in breast cancer cells.
[0085] Figure 2 shows the effect of siRNA on the expression levels of genes related to epithelial-mesenchymal transition in breast cancer cells.
[0086] Figure 3 shows the effect of siRNA on the invasiveness of breast cancer cells.
[0087] Figure 4 shows the effect of siRNA on the proliferation of breast cancer cells.
[0088] Figure 5 shows the effect of modified siRNA on AZGP1 expression in breast cancer cells.
[0089] In each figure, * indicates a significant difference compared to the control (P<0.05), and ns indicates no significant difference.
[0090] The best way to implement an invention
[0091] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0092] Example 1: Design and synthesis of siRNA molecules targeting AZGP1
[0093] Based on the human AZGP1 gene (nucleotide sequence shown in SEQ ID No. 15, encoding the protein shown in SEQ ID No. 16), this invention designed and synthesized a total of 7 siRNA molecules targeting the AZGP1 gene. The siRNA molecules contain a sense strand and an antisense strand, and the sense strand can at least partially complement the antisense strand to form a double-stranded region, as shown in Table 1.
[0094] Table 1. siRNA molecules targeting the AZGP1 gene in this invention
[0095] In Table 1, U represents uracil nucleotide, T represents thymine deoxynucleotide, A represents adenine nucleotide, G represents guanine nucleotide, and C represents cytosine nucleotide.
[0096] Example 2: Effect of siRNA on AZGP1 expression in breast cancer cells
[0097] The specific steps are as follows:
[0098] (1) In a 6-well plate, add 1×10⁻⁶ mol / L to each well. 5 One breast cancer cell line, MDA-MB-231, was cultured overnight at 37°C.
[0099] (2) Dissolve the siRNA (i.e., the 7 siRNA molecules in Example 1) in DEPC water, and then further dilute it with 200 μL of serum-free cell culture medium. At the same time, dilute the transfection reagent with 200 μL of the same serum-free cell culture medium. Mix the two reagents and let them stand at room temperature for 20 minutes.
[0100] (3) Add the above mixture to the 6-well plate from step (1), with a siRNA concentration of 75 nM in each well. Incubate at 37°C for 36 hours.
[0101] (4) Cells were collected, total RNA was extracted, and cDNA was obtained by reverse transcription. The relative expression level of the AZGP1 gene in each cell was further analyzed by qPCR using cDNA as a template and GAPDH as an internal reference gene.
[0102] The primer sequence used to detect the internal reference gene GAPDH is (5'-3'):
[0103] F: GTCTCCTCTGACTTCAACAGCG (SEQ ID No. 19);
[0104] R: ACCACCCTTGTTGCTGTAGCCAA (SEQ ID No. 20).
[0105] The primer sequence used to detect the AZGP1 gene is (5'-3'):
[0106] F: TACAACGACAGTAACGGGTCT (SEQ ID No. 21);
[0107] R: TATTTCCAGAATGCTCCGCTG (SEQ ID No. 22).
[0108] Relative gene expression levels were calculated using the delta-CT method.
[0109] The experiment also included breast cancer cells that were not transfected with siRNA as a control.
[0110] As shown in Figure 1, all seven siRNAs of this invention inhibited the expression of the AZGP1 gene in cells.
[0111] Example 3: Effects of siRNA on epithelial-mesenchymal transition in breast cancer cells
[0112] Epithelial-mesenchymal transition (EMT) plays a crucial role in tumor metastasis, characterized by the loss of the epithelial phenotype and the acquisition of a higher mesenchymal phenotype by epithelial cells. This study selected epithelial characteristic-related genes CDH1 and OCLN, and mesenchymal characteristic-related genes VIM and FN1. The effects of siRNA on EMT in breast cancer cells were investigated by analyzing changes in the expression levels of these genes.
[0113] The specific steps are as follows:
[0114] (1) In a 6-well plate, add 1×10⁻⁶ mol / L to each well. 5 One breast cancer cell line, MDA-MB-231, was cultured overnight at 37°C.
[0115] (2) Dissolve the siRNA (i.e., the 7 siRNA molecules in Example 1) in DEPC water, and then further dilute it with 200 μL of serum-free cell culture medium. At the same time, dilute the transfection reagent with 200 μL of the same serum-free cell culture medium. Mix the two reagents and let them stand at room temperature for 20 minutes.
[0116] (3) Add the above mixture to the 6-well plate from step (1), with a siRNA concentration of 75 nM in each well. Incubate at 37°C for 36 hours.
[0117] (4) Collect cells, extract total RNA, and obtain cDNA through reverse transcription. Then, using cDNA as a template and GAPDH as an internal reference gene, analyze the relative expression levels of CDH1, OCLN, VIM, and FN1 genes in each cell using qPCR.
[0118] Primer sequences (5'-3') used to detect the GAPDH gene:
[0119] F: GTCTCCTCTGACTTCAACAGCG (SEQ ID No. 23);
[0120] R: ACCACCCTTGTTGCTGTAGCCAA (SEQ ID No. 24).
[0121] Primer sequences (5'-3') used to detect the CDH1 gene:
[0122] F:ATTTTTCCCTCGACACCCGAT (SEQ ID No. 25);
[0123] R: TCCCAGGCGTAGACCAAGA (SEQ ID No. 26).
[0124] Primer sequences (5'-3') used to detect the OCLN gene:
[0125] F:ACAAGCGGTTTTATCCAGAGTC (SEQ ID No. 27);
[0126] R: GTCATCCACAGGCGAAGTTAAT (SEQ ID No. 28).
[0127] Primer sequences (5'-3') used to detect the VIM gene:
[0128] F: GACGCCATCAACACCGAGTT (SEQ ID No. 29);
[0129] R: CTTTTGTCGTTGGTTAGCTGGT (SEQ ID No. 30).
[0130] Primer sequences (5'-3') used to detect the FN1 gene:
[0131] F: GGTGACACTTATGAGCGTCCTAAA (SEQ ID No. 31);
[0132] R: AACATGTAACCACCAGTCTCATGTG (SEQ ID No. 32).
[0133] Relative gene expression levels were calculated using the delta-CT method.
[0134] The experiment also included breast cancer cells that were not transfected with siRNA as a control.
[0135] As shown in Figure 2, siRNA treatment increased the expression levels of epithelial characteristic-related genes CDH1 and OCLN, while decreasing the expression levels of mesenchymal characteristic-related genes VIM and FN1. These results indicate that treatment with the seven siRNAs of this invention weakened the epithelial-mesenchymal transition characteristics of breast cancer cells.
[0136] Example 4: Effects of siRNA on the invasiveness of breast cancer cells
[0137] The specific steps are as follows:
[0138] (1) Dilute Matrigel 1:6 using serum-free cell culture medium. Coat the upper surface of the Transwell chamber with the diluted Matrigel and place at 37°C for several hours to allow it to gel.
[0139] (2) The breast cancer cells MDA-MB-231 containing the s iRNA molecule from Example 1 were digested and transformed using trypsin to obtain single cells. The cells were then resuspended in serum-free medium and added to the upper surface of each well of a 24-well plate, 20,000 cells per well. Serum-containing cell culture medium was added to the lower chamber. The cells were incubated at 37°C for 48 hours.
[0140] (3) Remove the chamber. Wipe away Matrigel and uninvaded cells from the upper surface of the chamber. Fix the cells on the lower surface of the chamber with paraformaldehyde and stain with crystal violet. Observe the number of cells on the lower surface of the chamber under a microscope.
[0141] The experiment also included breast cancer cells that were not transfected with siRNA as a control.
[0142] As shown in Figure 3, the seven siRNAs of this invention effectively inhibited the invasion and metastasis of breast cancer cells.
[0143] Example 5: Effects of siRNA on breast cancer cell proliferation
[0144] The specific steps are as follows:
[0145] (1) After the breast cancer cells MDA-MB-231 were digested into single cells with trypsin, the cells were added to a 96-well plate at a density of 3000 cells per well and cultured at 37°C for 12 hours.
[0146] (2) Dissolve the siRNA (i.e., the 7 siRNA molecules in Example 1) in DEPC water, and then further dilute it with serum-free cell culture medium. Simultaneously, dilute the transfection reagent with the same serum-free cell culture medium. Mix the two reagents, let stand at room temperature for 20 minutes, and then add the mixture to the 96-well plate from step (1), with 2, 20, or 200 pmol of siRNA per well. Incubate at 37°C for 72 hours.
[0147] (3) Add 10 μL of CCK8 reagent to each well, incubate in the dark for 2 hours, and measure the absorbance at 450 nm using an ELISA reader.
[0148] The experiment also included breast cancer cells that were not transfected with siRNA as a control.
[0149] Cell viability = [(As-Ab) / (Ac-Ab)] × 100%.
[0150] As: Absorbance of experimental wells (including cells, culture medium, CCK-8 solution and siRNA).
[0151] Ac: Absorbance of control wells (containing cells, culture medium, CCK-8 solution, but excluding siRNA).
[0152] Ab: Absorbance of blank wells (containing culture medium and CCK-8 solution, but excluding cells and drugs).
[0153] As shown in Figure 4, siRNA can inhibit the proliferation of breast cancer cells.
[0154] Example 6: Effect of modified siRNA on AZGP1 expression in breast cancer cells
[0155] The AZGP1-1 samples tested in this experiment, after fluorination modification, methoxylation modification, and thiophosphate skeleton modification, are as follows:
[0156] Chain of Justice: fG*mU*fUmAfCmUfCmUfCmUfGmAfCmCfUmAfUmAfU*T*T(SEQ ID No.17);
[0157] Antisense strand: mA*fU*mAfUmAfGmGfUmCfAmGfAmGfAmGfUmAfAmC*T*T (SEQ ID No. 18).
[0158] In this context, the four ribonucleotides are represented by A, U, C, and G, respectively; mA, mU, mC, and mG represent 2'-methoxy modified ribonucleotides A, U, C, and G (modified nucleotides in which the 2'-OH of the ribose is replaced by -OCH3); fA, fU, fC, and fG represent 2'-fluoro modified ribonucleotides A, U, C, and G (2'-fluoro A, U, C, or G); * indicates a thiophosphate backbone link, specifically indicating that the non-bridging oxygen atom on the phosphodiester bond between two adjacent bases is replaced by a sulfur atom (forming a thiophosphate group, the structural formula of which is formula (1); the nucleotide linked by the thiophosphate group is shown in formula (2).
[0159] The specific steps are as follows:
[0160] (1) In a 6-well plate, add 1×10⁻⁶ mol / L to each well. 5 One breast cancer cell line, MDA-MB-231, was cultured overnight at 37°C.
[0161] (2) Unmodified siRNA (i.e., AZGP1-1 in Example 1) and AZGP1-1 modified with fluorine, methoxy, and thiophosphate backbones were dissolved in DEPC water and then further diluted with 200 μL of serum-free cell culture medium. Simultaneously, the transfection reagent was diluted with 200 μL of the same serum-free cell culture medium. The diluted siRNA and transfection reagent were mixed and incubated at room temperature for 20 minutes.
[0162] (3) Add the above mixture to the 6-well plate from step (1), with a siRNA concentration of 75 nM in each well. Incubate at 37°C for 36 hours.
[0163] (4) Collect cells, extract total RNA, and obtain cDNA through reverse transcription. Using cDNA as a template and GAPDH as an internal reference gene, analyze the relative expression level of AZGP1 in each cell using qPCR. The primer sequences are the same as in Example 2.
[0164] The experiment also included breast cancer cells that were not transfected with siRNA as a control.
[0165] As shown in Figure 5, the modified siRNA had the same effect as the unmodified siRNA in inhibiting AZGP1 expression.
[0166] Cross-referencing of related applications:
[0167] This application claims priority to Chinese patent application No. 202411923504.0, filed on December 25, 2024, the entire contents of which are incorporated herein by reference.
[0168] Industrial applications
[0169] The siRNA molecule targeting the AZGP1 gene provided by this invention can inhibit the invasion and proliferation of breast cancer cells as well as epithelial-mesenchymal transition. It is foreseeable that the siRNA molecule targeting the AZGP1 gene provided by this invention will have a good therapeutic effect on cancer, especially breast cancer, laying the foundation for clinical cancer treatment and having significant application and promotion value.
Claims
1. A siRNA molecule for inhibiting AZGP1 gene expression, characterized in that: The siRNA molecule is AZGP1-1, AZGP1-2, AZGP1-3, AZGP1-4, AZGP1-5, AZGP1-6, or AZGP1-7; the siRNA molecule contains a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded region; The positive chain of AZGP1-1 contains SEQ ID No. 1, and the negative chain of AZGP1-1 contains SEQ ID No. 2; The positive chain of AZGP1-2 contains SEQ ID No. 3, and the negative chain of AZGP1-2 contains SEQ ID No. 4; The positive chain of AZGP1-3 contains SEQ ID No. 5, and the negative chain of AZGP1-3 contains SEQ ID No. 6; The positive chain of AZGP1-4 contains SEQ ID No. 7, and the negative chain of AZGP1-4 contains SEQ ID No. 8; The positive chain of AZGP1-5 contains SEQ ID No. 9, and the negative chain of AZGP1-5 contains SEQ ID No. 10; The positive chain of AZGP1-6 contains SEQ ID No. 11, and the negative chain of AZGP1-6 contains SEQ ID No. 12; The positive chain of AZGP1-7 contains SEQ ID No. 13, and the negative chain of AZGP1-7 contains SEQ ID No.
14.
2. The derivative of the siRNA molecule according to claim 1, characterized in that: The derivative is any one of the following: (A1) A derivative having the same function as the siRNA molecule by deleting or adding one or more nucleotides to the siRNA molecule of claim 1; (A2) A derivative having the same function as the siRNA molecule by substituting or modifying one or more nucleotides in the siRNA molecule of claim 1; (A3) Modify the backbone of the siRNA molecule according to claim 1 to a thiophosphate backbone to obtain a derivative having the same function as the siRNA molecule; (A4) Connecting the siRNA molecule of claim 1 to a signaling molecule and / or an active molecule and / or a functional group to obtain a derivative having the same function as the siRNA molecule.
3. The derivative according to claim 2, characterized in that: In (A2), the modification is selected from one or more of the following: fluorinated modification, methoxylated modification, deoxygenated modification, and ligand modification.
4. The derivative according to claim 2 or 3, characterized in that: In (A2), the fluorinated nucleotides are located in the antisense and sense strands of the siRNA molecule, and, in the direction from the 5' end to the 3' end, at least the 7th, 9th, 10th, and 11th nucleotides of the sense strand are fluorinated nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated nucleotides; or, the fluorinated nucleotides are located in the antisense and sense strands of the siRNA molecule, and, in the direction from the 5' end to the 3' end, at least the 1st, 3rd, 5th, 7th, 9th, 10th, 11th, 13th, 15th, 17th, and 19th nucleotides of the sense strand are fluorinated nucleotides, and at least the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, and 18th nucleotides of the antisense strand are fluorinated nucleotides.
5. The derivative according to claim 2 or 3, characterized in that: In (A2), the methoxylated nucleotides are located in both the antisense and sense strands of the siRNA molecule, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, and 19 of the sense strand are methoxylated nucleotides, and at least the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, and 19 of the antisense strand are methoxylated nucleotides. The nucleotide at position 9 is a methoxylated nucleotide; or, the methoxylated nucleotide is located in the antisense and sense strands of the siRNA molecule, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, and 18 of the sense strand are methoxylated nucleotides, and at least the nucleotides at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19 of the antisense strand are methoxylated nucleotides.
6. The derivative according to claim 2 or 3, characterized in that: In (A3), the nucleotides linked by thiophosphate groups are located in the antisense and sense strands of the siRNA molecule, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the sense strand are linked by thiophosphate groups, and at least the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand are linked by thiophosphate groups.
7. The derivative according to claim 2 or 3, characterized in that: In (A2), the nucleotides at positions 20 and 21 of the sense strand and the antisense strand are deoxythymine.
8. The derivative according to claim 2 or 3, characterized in that: In (A2), the 3' end of the positive strand of the siRNA molecule is coupled with a ligand, the ligand being N-acetylgalactosamine; or, the 3' end or 5' end of the positive strand of the siRNA molecule is coupled with a ligand, the ligand being a lipid molecule; or, the 3' end of the positive strand of the siRNA molecule is coupled with a ligand, the ligand being a lipid molecule coupled with albumin.
9. The derivative according to claim 2 or 3, characterized in that: The derivative of the siRNA molecule consists of a sense strand with the sequence SEQ ID No. 17 and an antisense strand with the sequence SEQ ID No.
18.
10. The use of the siRNA molecule of claim 1 or the derivative of claim 2 in the preparation of a product; wherein the product has any of the following functions: (B1) Inhibits cancer cell proliferation; (B2) Inhibits cancer cell invasion and / or metastasis; (B3) Inhibits epithelial-mesenchymal transition in cancer cells; (B4) Cancer treatment; (B5) Inhibits AZGP1 gene expression.
11. The application according to claim 10, characterized in that: The cancer cells are cancer cells that highly express the AZGP1 gene; the cancer is a cancer that highly expresses the AZGP1 gene.
12. The application according to claim 11, characterized in that: The cancer cells are breast cancer cells; the cancer is breast cancer.
13. The application according to claim 12, characterized in that: The breast cancer cells are triple-negative breast cancer cells; the breast cancer is triple-negative breast cancer.
14. The use of a substance capable of inhibiting AZGP1 protein expression and / or activity in the preparation of a product, wherein the product has any of the following functions: (C1) Inhibits breast cancer cell proliferation; (C2) Inhibits breast cancer cell invasion and / or metastasis; (C3) Inhibits epithelial-mesenchymal transition in breast cancer cells; (C4) Treatment of breast cancer.
15. The application according to claim 14, characterized in that: The substance is a substance that directly targets the AZGP1 gene and can inhibit the expression and / or activity of the AZGP1 protein.
16. The application according to claim 14, characterized in that: The breast cancer cells are triple-negative breast cancer cells; the breast cancer is triple-negative breast cancer.