Method for identifying the sex in fish belonging to acipenseridae

The in vitro method using the DNA nucleotide sequence SEQ ID NO: 1 accurately identifies the sex of sturgeons, addressing the limitations of current methods by enabling early and reliable differentiation between male and female sturgeons, thus optimizing caviar production.

WO2026139130A1PCT designated stage Publication Date: 2026-07-02FUNDACION AZTI AZTI FUNDAZIOA

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
FUNDACION AZTI AZTI FUNDAZIOA
Filing Date
2024-12-24
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Current methods for sex identification in sturgeons, particularly those belonging to the family Acipenseridae, lack accuracy and reproducibility, making it difficult to distinguish between males and females at an early age, which is crucial for optimizing caviar production as females take many years to reach reproductive maturity.

Method used

An in vitro method based on determining the levels of a specific DNA nucleotide sequence (SEQ ID NO: 1) is developed, where elevated levels indicate females, allowing accurate sex determination in sturgeons before sexual maturation.

Benefits of technology

Enables early and accurate sex identification of sturgeons, facilitating the selection of females for caviar production and optimizing feeding and maturation programs, thereby reducing production costs and improving efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000032_0001
    Figure IMGF000032_0001
  • Figure IMGF000048_0001
    Figure IMGF000048_0001
  • Figure IMGF000005_0001_TABLE
    Figure IMGF000005_0001_TABLE
Patent Text Reader

Abstract

The invention relates to in vitro methods to determine the sex of fish belonging to Acipenseridae by determining the levels of a DNA nucleotide sequence, comprising, or consisting of, SEQ ID NO: 1. Additionally, the present invention also refers to the use of the levels of the DNA nucleotide sequence, comprising, or consisting of, SEQ ID NO: 1 disclosed herein and a kit for the in vitro sex identification of Acipenseridae fish.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Method for identifying the sex in fish belonging to Acipenseridae

[0002] The invention relates to in vitro methods to determine the sex of fish belonging to Acipenseridae by determining the levels of a DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1. Additionally, the present invention also refers to the use of the specific levels of a DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1 disclosed herein and a kit for the in vitro identification of the sex of Acipenseridae fish. Therefore, the present invention falls within the field of molecular biology and aquaculture more particularly, fish sexing.

[0003] BACKGROUND ART

[0004] The sturgeon is known as a ‘living fossil’, estimated to have existed for more than 250 million years, and is known primarily for its eggs, which are used to produce caviar, although its meat is also eaten. The first record of sturgeon aquaculture dates back to 1984 with a production of 150 tonnes. Since then, production has gradually increased to 115,168 tonnes in 2018. Virtually all caviar marketed today can be considered to come from aquacultured sturgeon (EUMOFA. The caviar market. Production, trade, and consumption in and outside the EU: an update of the 2018-report. Publications Office of the European Union. 2021 May; 1-38). There are 25 sturgeon species belonging to the family Acipenseridae, among which the best known and most appreciated species belong to the genus Huso and Acipenser, the latter including the largest number of species.

[0005] At present, cytogenetical studies have not revealed any presence of sex heteromorphic chromosomes in sturgeons Milos Havelka, et al., "Sturgeon genetics and cytogenetics: a review related to ploidy levels and interspecific hybridization, " Folia Zoologica, 60(2), 93-103 (2011)). Due to their lack of secondary sexual characteristics, sturgeons’ sex cannot be directly distinguished by the appearance.

[0006] It is noteworthy that caviar results from the processing of sturgeon eggs, so therefore requires the rearing of female fish. Thus, exploitation of sturgeons is highly costly, as females take many years to reach reproductive maturity. In fact, the process of selecting females for caviar production can be done after an average of 8years of rearing, depending on the species, through an ultrasound examination to differentiate between male and female sturgeons. During this period, it is necessary to breed both males and females, with the consequent production costs Lu & Rasco. Sturgeon (Acipenser transmontanus) sexual maturation and caviar quality. Reviews in Aquaculture. 2014 June; 6(2): 89-99; EUMOFA. The caviar market. Production, trade, and consumption in and outside the EU: an update of the 2018-report. Publications Office of the European Union. 2021 May; 1-38).

[0007] In recent years, new sex identification methods of sturgeons are based on specific genes or molecular markers. For example, it has been reported the amplification by PCR of the specific molecular marker fragments SSM1 and SSM2 of sturgeon, and the subsequently detection of amplified fragments by gel agarose electrophoresis, for sex identification. However, this methodology cannot meet the needs of current gender identification of sturgeons for the lack of accuracy and reproducibility. For example, when the target band cannot be amplified due to operational reasons, false negative of male fish may arise. Therefore, it is still necessary the development of new identification methods / systems.

[0008] For this reason, the industry needs accurate and robust sexing systems for sturgeon at an early age (1-2 years) in order to adapt the feeding and needs of the animals as early as possible to optimise the maturation of the females and the final production of caviar.

[0009] DESCRIPTION OF THE INVENTION

[0010] The present invention fulfills this need in the art by providing a simple and accurate approach for identifying the sex of fish belonging to species of the family Acipenseridae with an accurate and specific classification of male and female. In this sense, the present invention provides in vitro methods to determine the sex of Acipenseridae fish based on the levels of a DNA sequence, SEQ ID NO: 1, which the inventors have identified as being different in females belonging to this fish family.In fact, the examples of the present description demonstrate that levels of SEQ ID NO: 1 are higher in females than in males fish belonging to family Acipenseridae, enabling accurate sex determination.

[0011] On this basis, the inventors have developed in vitro methods as well as kits and uses for said purpose, which will be described in detail below.

[0012] Methods of the invention

[0013] Based on the levels of a DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1, hereinafter also referred as “the sequence of the invention”, the inventors have developed an in vitro method for determining the sex of fish belonging to family Acipenseridae.

[0014] Thus, a first aspect of the present invention refers to an in vitro method for identifying the sex of a fish belonging to a species of the family Acipenseridae, hereinafter the “identification method of the invention”, said method comprising:

[0015] a) determining the levels of a DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1, in a biological sample previously isolated from a fish belonging to a species of the family Acipenseridae, and

[0016] b) comparing the levels determined in step a) with the levels of the DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1 of a male subject belonging to a species of the family Acipenseridae,

[0017] wherein elevated levels of the DNA nucleotide sequence, comprising, or consisting of, SEQ ID NO: 1, determined in step a), with respect to the levels of the same sequence in the male subject, indicates that the fish is a female.

[0018] In a preferred embodiment of the invention, alone or in combination with other preferred embodiments, the sex identification is an early sex identification. In the present invention, it is understood as “early sex identification” to sex identification which takes place at any age of the fish to be analysed prior to sexual maturation. Sexual maturation in fish belonging to the family Acipenseridae usually occurs, depending on the species, at an age of 5 to 18 years old. Thus, in a preferredembodiment of the invention, alone or in combination with other preferred embodiments, the fish belonging to a species of the family Acipenseridae has an age equal to or less than 2 years old. More preferably, the fish has an age ranging from 1 to 2 years old (including the end values).

[0019] As used herein, the term "biological sample" refers to any sample which can be obtained and isolated from the subject and comprises DNA. The term "isolated" means a substance in a form or in an environment that does not occur in nature. The present method can be applied to a biological sample from a fish belonging to a species of the family Acipenseridae, such as a biopsy sample or tissue. In a preferred embodiment, said sample is a tissue sample. In another more preferred embodiment, the sample is selected from the list consisting of blood, chin tissue and flap tissue. Even more preferably, the sample is blood. A tissue sample can be obtained by conventional methods, e.g., biopsy, by using methods well known to those of ordinary skill. Methods for obtaining the sample from the biopsy include gross apportioning of a mass, or microdissection or other art-known cell-separation methods. Other method that can be used for obtaining the sample is, without limitation to, blood extraction.

[0020] Once the biological sample has been obtained, the DNA has to be isolated. Methods for extracting and isolating DNA from a sample are widely known in the state of the art and are routine practice for the skilled person.

[0021] As used herein, the term “levels” relates to the concentration, amount of DNA in the biological sample. In the present invention, levels refer to the concentration, amount of the sequence of the invention, i.e. a DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1 DNA sequence.

[0022] SEQ ID NO: 1 TGCAGGGAAGGGCAGTAATGCATTGCTGTATCATGTCATCAGACTGTTGTGGTT CAGCAAGTGAAPreferably, the sequence of the invention is a DNA nucleotide sequence selected from the DNA nucleotide sequences shown in Table 1 (i.e a nucleotide sequence selected from SEQ ID NO: 1 to SEQ ID NO: 15).

[0023] Table 1. DNA nucleotide sequences and corresponding sequence length.

[0024]

[0025]

[0026] In a preferred embodiment, the sequence of the invention has a length ranging from 65pb to 237 pb (both ends included), more preferably 65pb to 71 pb (both ends included). In a more preferred embodiment of the method of the invention, the step (a) comprises determining the levels of the DNA nucleotide sequence SEQ ID NO: 1.

[0027] Sequence SEQ ID NO: 1 corresponds to a DNA nucleotide sequence present in fish belonging to species of the family Acipenseridae, both in male and female subjects. As previously mentioned, the inventors have discovered that the levels of SEQ ID NO: 1 in species belonging to the family Acipenseridae are higher in female than in male subjects. Thus, in the present invention, elevated levels of a sequence comprising, or consisting of, SEQ ID NO: 1 (levels of the sequence of the invention) with respect to the levels of the sequence of the invention of a male subject, indicates that the fish is a female.

[0028] Therefore, once the sequence of the invention levels are determined in step a), the method of the invention comprises comparing said levels with the levels of the same sequence present in a male subject belonging to a species of the family Acipenseridae. By detecting that the sequence of the invention levels determined in step a) are higher than the sequence of the invention levels in a male subject, it can be determined that the problem subject (i.e. the fish whose levels are determined in step a)) is a female. Thus, the present method of the invention is a method which allows the identification of female fish belonging to the family Acipenseridae. This facilitates the selection of the most interesting individuals, females, from a productive point of view (e.g. for caviar production). The early identification of females is therefore a valuable tool for the selection and subsequent feeding and maturation optimisation programmes for caviar production.

[0029] As it can be understood, the present method of the invention also allows the identification of male fish belonging to the family Acipenseridae: when the levels determined in step a) are not elevated with respect to the levels of the sequence ofthe invention in the male subject, it is indicative that the fish whose levels are determined in step a) is a male.

[0030] As previously mentioned, in step b) of the method defined herein, the levels determined in step a) are compared with the levels of such sequence in a male subject (whose sex should therefore be known in advance). Methods for sexing fish belonging to the family Acipenseridae are known in the art, although having several drawbacks. One method known in the state of the art for sexing fish belonging to the family Acipenseridae is based on ultrasounds, consisting of placing an ultrasound probe in the ventral area of the fish, visualising on the ultrasound screen the gonadal tissue of the animal, which, if sufficiently developed, allows distinguishing between testicular tissue (generally characterised by a medium and homogeneous echogenicity) or ovarian tissue (characterised by a lower echogenicity than ovarian tissue with the presence of small anechogenic spots corresponding to small eggs). This known method, however, cannot differentiate fish sex at an early age, being an important drawback.

[0031] In the present invention, levels are understood to be “elevated", “‘higher’ or “increased” when the value is greater than the value corresponding to the levels of the sequence of the invention in a male subject, preferably at least, 20 times, 21 times, 22 times, 23, times, 24 times, 25 times or more greater than the levels of the sequence of the invention of a male subject.

[0032] A way to assess whether the DNA levels are higher or not with respect to a control value (in the present invention, control value corresponds to levels of sequence of the invention in an Acipenseridae male subject) is by determining the cycle threshold. The “cycle threshold” (Ct, also named as Cp) can be defined as the cycle number at which the fluorescence generated within a reaction crosses the fluorescence threshold, a fluorescent signal significantly above the background fluorescence. At the threshold cycle, a detectable amount of amplicon product has been generated during the early exponential phase of the reaction.

[0033] In the present invention, it can be concluded that the levels determined in step a) are elevated, higher or increased, when the Cp obtained for the subject problem isat least 6 units, 7 units, 8 units, 9 units, 10 units or more, lower than the Cp determined in a biological sample of an Acipenseridae male subject.

[0034] Methods to determine the levels of a DNA nucleotide sequence in a biological sample are known in the state of the art, including DNA amplification (e.g. PCR), sequencing, and all other methods known to the person of skills in the art. In a preferred embodiment, the determination of the levels of the sequence of the invention is carried out by DNA amplification or sequencing.

[0035] As used herein, the term "sequencing" is used in a broad sense and refers to any technique known by the skilled person including but not limited to Sanger dideoxy termination sequencing, whole-genome sequencing, sequencing by hybridization, pyrosequencing, capillary electrophoresis, cycle sequencing, single-base extension sequencing, solid- phase sequencing, high-throughput sequencing, massively parallel signature sequencing (MPSS), sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, single-molecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse-terminator sequencing, nanopore sequencing, PacBio sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, SOLiD(R) sequencing, MS-PET sequencing, mass spectrometry, and combinations thereof.

[0036] In a preferred embodiment, alone or in combination with other preferred embodiments, the determination of the levels of the sequence of the invention is carried out by a DNA amplification technique.

[0037] Amplification techniques include, in particular, isothermal techniques and PCR-based techniques.

[0038] In a preferred embodiment, alone or in combination with other preferred embodiments, the DNA amplification is performed by a PCR or by an isothermal technique.Isothermal techniques include methods such as, but not limited to, nucleic acid sequence-based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), and strand displacement amplification (SDA), exponential amplification reaction (EXPAR), isothermal and chimeric primer-initiated amplification of nucleic acids (ICANs), signal-mediated amplification of RNA technology (SMART) and others (see e.g. Asiello and Baeumner. Miniaturized isothermal nucleic acid amplification, a review. Lab Chip.

[0039] 2011 April 21; 11(8): 1420-1430). In a particular embodiment, alone or in combination with other embodiments, the DNA amplification is performed by an isothermal technique selected from the list consisting of NASBA, RPA, LAMP, HDA, RCA, SDA, EXPAR, ICANs, and SMART.

[0040] In a preferred embodiment, alone or in combination with other preferred embodiments, the determination of the levels of the sequence of the invention is carried out by a PCR.

[0041] In the context of the present invention the term "PCR" relates to polymerase chain reaction which is a procedure of target amplification. The term "target amplification" relates to an enzyme-mediated procedure which is capable of producing a high amount (e.g. billions) of copies of nucleic acid target sequences. PCR as particular target amplification method is well known to those of ordinary skill in the art. In general, conducting PCR foresees that a sample of DNA is mixed in a solution with at least two oligonucleotide primers that are prepared to be complementary to each strand of the DNA duplex. A primer is a short sequence of nucleotides, complementary to one of the template DNA strands from which DNA polymerase will incorporate new deoxyribonucleotides for the synthesis of a new DNA strand. Nucleotide bases - dNTPs - and a DNA polymerase, such as Taq polymerase, are used to catalyze the formation of DNA from the oligonucleotide primers and the dNTPs. At least one of the primers is a so called forward primer binding in 5' to 3' direction to the 3' end of the first strand of the DNA; the so called reverse primer is binding in 3' to 5' direction to the 5' end of the second strand of the DNA. The general principle of the PCR procedure foresees that the solution is heated to denature the double-stranded DNA to single-stranded DNA. After cooling down ofthe solution to the so called annealing temperature, the primers are able to bind to the separated DNA strands and the DNA polymerase catalyzes the generation of a new strand by joining the dNTPs to the primers. This process is repeated in several cycles resulting in a respective amount of amplified PCR products.

[0042] Examples of PCR-based techniques according to the invention include techniques such as, but not limited to, quantitative PCR (Q-PCR), real-time PCR, digital PCR, PCR-Sequencing or PCR-electrophoresis. These techniques are well known and easily available technologies for those skilled in the art.

[0043] Thus, in a preferred embodiment, alone or in combination with other preferred embodiments the PCR is selected from the list consisting of real-time PCR, PCR digital, PCR-Sequencing and PCR-electrophoresis. In a still more preferred embodiment, the PCR is a real-time PCR.

[0044] Real-Time PCR refers to the fact that measurements are made in real time, during the amplification of the target DNA. qPCR introduces the idea that the data provides quantification of the target DNA. That said, the terms are often used interchangeably. Real-time PCR and qPCR reactions differ from regular PCR reactions with the addition of fluorescent based signal detection, either through the use of a double stranded DNA binding dye or a dual labeled fluorescent probe. The fluorescence increases during the amplification and the increase in fluorescence correlates to the amount of starting template copies. Since the number of copies theoretically doubles in each cycle, when comparing two amplifications, the primer / probe set with more copies of a template in a sample will amplify faster and release quantifiable fluorescence in an early cycle. In contrast, a lower amount of beginning template will take more cycles to reach the same fluorescence intensity.

[0045] Digital PCR involves multiple PCR analyses on extremely dilute nucleic acids such that most positive amplifications reflect the signal from a single template molecule. Digital PCR thereby permits the counting of individual template molecules. The proportion of positive amplifications among the total number of PCRs analyzed allows an estimation of the template concentration in the original or non-diluted sample.In a preferred embodiment, the DNA amplification comprises the use of at least one forward primer, and at least one reverse primer (i.e. a primer pair), capable of amplifying the sequence of the invention. In this particular embodiment, a reaction mixture comprising a primer pair that amplify the sequence of the invention is contacted with the isolated biological sample.

[0046] Given the DNA sequence to be amplified, a person skilled in the art knows how to determine which primers are capable of amplifying said sequence. The primer pair used in PCR is not particularly limited as long as it is capable of amplifying the sequence of the invention, and can be designed based on the nucleotide sequence to be amplifies with the basic rules of primer preparation. As mentioned above, primers are short sequences, having a nucleotide length normally of about 15 to 40 pb. In a preferred embodiment, alone or in combination with other preferred embodiments, the primers have a nucleotide sequence length of 20 to 30 nucleotides. More preferably, primers length is selected from the list consisting of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 nucleotides.

[0047] In a preferred embodiment of the invention, alone or in combination with other preferred embodiments, the forward primer has a nucleotide sequence selected from the list consisting of: TGCAGGGAAGGGCAGTAATG (SEQ ID NO: 16), ATGCAGGGAAGGGCAGTAATG (SEQ ID NO: 17), GATGCAGGGAAGGGCAGTAA (SEQ ID NO: 18) and GATGCAGGGAAGGGCAGTAAT (SEQ ID NO: 19).

[0048] In a preferred embodiment of the invention, alone or in combination with other preferred embodiments, including the preceding embodiment, the reverse primer has a nucleotide sequence selected from the list consisting of: TTCACTTGCTGAACCACAACAGT (SEQ ID NO: 20), TTTCACTTGCTGAACCACAACAG (SEQ ID NO: 21), TTTCACTTGCTGAACCACAACAGT (SEQ ID NO: 22), CTTTCACTTGCTGAACCACAACA (SEQ ID NO: 23), CTTTCACTTGCTGAACCACAACAG (SEQ ID NO: 24), TCTTTCACTTGCTGAACCACAAC (SEQ ID NO: 25),CTCTTTCACTTGCTGAACCACAA, (SEQ ID NO: 26) and CTCTTTCACTTGCTGAACCACAAC (SEQ ID NO: 27).

[0049] In a preferred embodiment of the invention, alone or in combination with other preferred embodiments, including the preceding embodiment, the probe has a nucleotide sequence selected from the list consisting of: ATTGCTGTATCATGTCATCA (SEQ ID NO: 28), ATTGCTGTATCATGTCATC (SEQ ID NO: 29), ATTGCTGTATCATGTCATCAG (SEQ ID NO: 30), TTGCTGTATCATGTCATCA (SEQ ID NO: 31), TTGCTGTATCATGTCATCAG (SEQ ID NO: 32), TGCTGTATCATGTCATCAG (SEQ ID NO: 33), TGCTGTATCATGTCATCAGA (SEQ ID NO: 34) and CTGTATCATGTCATCAGAC (SEQ ID NO: 35).

[0050] In a more preferred embodiment, alone or in combination with other preferred embodiments, the primer pair is selected from the primer pairs shown in Table 2.

[0051] Table 2. Each of the combinations or pairs of primers (forward primer and reverse primer) is referenced with a different identifying number (first column of the table). Thus, when the same combination / pair is repeated, the same identification number is assigned.

[0052] "

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068] In a more preferred embodiment, the primers are a forward primer comprising, preferably consisting of, SEQ ID NO: 16, and a reverse primer comprising, preferably consisting of, SEQ ID NO: 20.

[0069] As mentioned above, some DNA amplification techniques (e.g. real-time PCR) involve the use of probes, preferably dual labelled probes.

[0070] The term "probe" according to the present invention relates to an oligonucleotide that forms a hybrid structure with a target sequence contained in a molecule in a sample undergoing analysis, due to the complementarity of at least one sequence in the probe with the target sequence, therefore, capable of detecting said sequence. According to the present invention, oligonucleotide sequences of the probes are between 15 to 40 nucleotides, for example any range between 15 and 40 nucleotides, such as between 15 and 30 nucleotides, between 15 and 25 nucleotides, between 18 and 25 nucleotides, between 18 and 30 nucleotides, between 10 and 20 nucleotides, or between 15 and 20 nucleotides etc.The hybridizing probes may be labelled with a radioactive marker, a fluorescent marker, or a chemical marker.

[0071] A dual labelled probe has a fluorescence dye and a quencher moiety. Examples of commonly used probes are TaqMan probes.

[0072] TaqMan probes are linear probes that are dual-labeled with a reporter dye and a quencher dye. During the extension phase of the PCR, the TaqMan probe hybridizes to its target. Cleavage of the probe by the 5-exonuclease activity of the Taq polymerase separates the reporter fluorophore from the 3-quencher. The fluorescence of the reporter is then increased as it is released from the proximity of the quencher.

[0073] In a preferred embodiment, alone or in combination with other preferred embodiments, the DNA amplification further comprises the use of a probe. In this particular embodiment, the reaction mixture, in addition to primers that amplify the sequence of the invention, further comprises a probe capable of detecting said sequence.

[0074] More preferably, the probe has a nucleotide sequence selected from the list consisting of: ATTGCTGTATCATGTCATCA (SEQ ID NO: 28), ATTGCTGTATCATGTCATC (SEQ ID NO: 29), ATTGCTGTATCATGTCATCAG (SEQ ID NO: 30), TTGCTGTATCATGTCATCA (SEQ ID NO: 31), TTGCTGTATCATGTCATCAG (SEQ ID NO: 32), TGCTGTATCATGTCATCAG (SEQ ID NO: 33), TGCTGTATCATGTCATCAGA (SEQ ID NO: 34) and CTGTATCATGTCATCAGAC (SEQ ID NO: 35). Even more preferably, the primer pair and probe nucleotide sequence is any one of the combinations (primer pair and corresponding probe) shown in Table 2.

[0075] In an still more preferred embodiment, alone or in combination with other preferred embodiments, the DNA amplification further comprises the use of a probe with a nucleotide sequence which comprises, preferably consists of, SEQ ID NO: 29. In this particular embodiment, a reaction mixture, in addition to primers that amplify thesequence of the invention, further comprises a probe with a nucleotide sequence which comprises, preferably consists of, SEQ ID NO: 29.

[0076] In a more preferred embodiment, the probe is labelled with a fluorophore. The term “fluorophore”, as used herein, refers to a molecule with fluorescence properties. A fluorophore absorbs light energy of a specific wavelength and re-emits light at a longer wavelength. The absorbed wavelengths, energy transfer efficiency, and time before emission depend on both the fluorophore structure and its chemical environment, as the molecule in its excited state interacts with surrounding molecules. Examples of fluorophores known in the state of the art, that may be used in the present invention are, but not limited to, FAM, VIC, TET, NED, CAL Flour Gold 540, CIV-550, HEX and CAL Flour Orange 560. Preferably, the probe is labelled with FAM.

[0077] Examples of quenchers known in the state of the art, that may be used in the present invention are, but not limited to Eclipse Dark Quencer (EDO), NFQ, and QSY. Thus, in a preferred embodiment, the quencher is selected from the list consisting of EDO, NFQ or QSY.

[0078] In a preferred embodiment of the present invention, the probe is a TaqMan probe. Still more preferably, the probe is a Taqman MGB probe. TaqMan MGB probes include a MGB moiety at the 3' end that increases the melting temperature (Tm) of the probe and stabilises target / probe hybrids. This means that TaqMan MGB probes can be significantly shorter than traditional probes, providing better sequence discrimination and flexibility to adapt to more targets. TaqMan MGB probes incorporate a quencher to absorb (suppress) the signal from the fluorescent dye label at the other end of the probe. The properties of the quencher combined with the short length of the MGB probe produce a lower background signal than non-MGB quencher probes. Lower background means higher sensitivity and data accuracy.

[0079] The identification method of the invention can be applied to any fish belonging to a species of the family Acipenseridae, preferably, belonging to Acipenser genus or Huso genus. In a more preferred embodiment, alone or in combination with otherpreferred embodiments, the species of the family Acipenseridae is selected from the list consisting of: hybrid species Acipenser naccarii x A. baerii (ANB), A. baerii (ABA), A. guedenstaedtii (AGU), A. naccarii AAA), A. schrenckii, A. sinensis, A. dabryanus, Huso huso (H. huso), A. stellatus and A. ruthenus.

[0080] Based on the same concept (i.e. levels of a sequence comprising, or consisting of, SEQ ID NO: 1), the inventors have developed an in vitro method for classifying by sex a population of fish belonging to the family Acipenseridae, hereinafter the “classifying method of the invention”, wherein said method comprises:

[0081] a) determining the levels of the sequence of the invention, i.e. a DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1, in biological samples previously isolated from said population of fish, and b) observing the distribution pattern of the levels obtained, wherein if two significantly different sample populations appear, then the individuals in the same population with the highest levels are females, and the individuals in the sample population with the lowest level are males.

[0082] The phrase “classifying by sex a population of fish” means sexing or identifying in said population which fish are females, and which fish are males.

[0083] As it can be understood by a person skilled in the art, the typology of the biological sample wherein the levels of the sequence of the invention is preferably the same (e.g. the sample is from the same tissue) in each individual belonging to the population whose levels are determined in step a).

[0084] In the present invention, “distribution pattern” means the position of a set of values in relation to a parameter. In the context of the present invention, the distribution pattern refers to the position of each of the levels obtained in relation to the concentration of the molecule being measured, e.g. as a function of the concentration or quantity of the sequence of the invention. Once the distribution pattern of the levels has been obtained, if two same sample populations are significantly different from each other, then the individuals in the sample populationwith the highest levels are females and the individuals in the sample population with the lowest levels are males.

[0085] In the present invention, “sample population” means the set of values having a similar distribution pattern, i.e. the set of levels whose position in terms of concentration or quantity is similar or close to each other.

[0086] In the present invention, two sample populations (p1 and p2) are understood to be significantly different from each other, when each sample population has a distribution pattern whose median (ml and m2) is different, and when the distance between an element of one sample population (e.g. e1) and the median of the other sample population (m2) is greater than the distance between the element of the sample population (e1) and the median of the sample population to which it belongs (ml).

[0087] In this context, the median refers to the average levels value of all levels values belonging to the same sample population. As the person skilled in the art understands, there are statistical methods to find out whether two sample populations are significantly different from each other.

[0088] As in the previous method of the invention, preferably, the sequence of the invention levels are determined by PCR, more preferably RT-PCR. If this is the case, then the levels can be determined by the Ct or Cp. Therefore, in a particular embodiment of the classifying method of the invention, the Cp value of the population presenting the lowest average level is greater by at least 6 units, preferably by 7, more preferably by 8, even more preferably by 9 units or more, the Cp value of the population with the highest average level.

[0089] Some of the terms used to define the present aspect of the invention, such as “the sequence of the invention”, “biological sample”, methods to determine DNA nucleotide sequence levels, including preferred primers and / or probes, as well as preferred genus or species of the family Acipenseridae, have been explained in the previous method, applying, as well as their preferred embodiments, to the present classifying method of the invention.Uses of the invention

[0090] As explained above in the present description, the levels of the sequence of the invention are useful for identifying the sex of fish belonging to the family Acipenseridae. Accordingly, the present invention contemplates the use of the levels of said DNA nucleotide sequence as inventive aspects.

[0091] Thus, another aspect of the present invention refers to an in vitro use of the levels of the sequence of the invention (i.e. a DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1) in a sample, preferably a biological sample, for identifying the sex in species of the family Acipenseridae, hereinafter the identification use of the invention.

[0092] Another aspect of the present invention refers to an in vitro use of the levels of the sequence of the invention in a sample, preferably a biological sample, for identifying and / or selecting female fish in species of the family Acipenseridae.

[0093] Another aspect of the present invention refers to an in vitro use of the levels of sequence of the invention as a marker for identifying the sex of fish in species of the family Acipenseridae.

[0094] Another aspect of the present invention refers to an in vitro use of the levels of the sequence of the invention as a marker for identifying and / or selecting the female fish in species of the family Acipenseridae.

[0095] Another aspect of the present invention refers to an in vitro use of the levels of the sequence of the invention in a sample, preferably a biological sample, for classifying by sex a population of fish belonging to species of the family Acipenseridae.

[0096] As previously mentioned, the inventors have discovered that the levels of SEQ ID NO: 1 in species belonging to the family Acipenseridae are higher in female than in male subjects. Consequently, by comparing the levels of a DNA nucleotide sequence comprising, or consisting of, SEQ ID NO: 1 (the sequence of the invention) determined in biological samples previously isolated from fish belongingto the family Acipenseridae, it can be concluded the sex of the fish: elevated levels of the sequence of the invention with respect to the levels of the sequence of the invention of a male subject, indicates that the fish is a female.

[0097] In the present invention, levels are understood to be “elevated", “‘higher’ or “increased” when the value is greater than the value corresponding to the levels of the sequence of the invention in a male subject, preferably at least 20 times, 21 times, 22 times, 23 times, 24 times, 25 times or more greater than the levels of sequence of the invention of a male subject.

[0098] As explained previously explained in the identification method of the invention, A way to assess whether the DNA levels are higher or not with respect to a control value (in the present invention, control value corresponds to levels of the sequence of the invention in an Acipenseridae male subject) is by determining the cycle threshold (Ct or Cp, which been defined in previous inventive aspects and are applicable to the use of the invention). In the present invention, it can be concluded that the levels are elevated, higher or increased, when the Cp obtained is at least 6 units, 7 units, 8 units, 9 units, 10 units or more, lower than the Cp determined in a biological sample of an Acipenseridae male subject.

[0099] The terms used to define the present aspect of the invention have been explained in the previous inventive aspects, applying, as well as their preferred embodiments, to the present use of the invention.

[0100] As well as in the method of the invention described above, the uses of the invention can be applied to any fish belonging to a species of the family Acipenseridae, preferably, belonging to Acipenser genus or Huso genus. In a more preferred embodiment, alone or in combination with other preferred embodiments, the species of the family Acipenseridae is selected from the list consisting of: hybrid species

[0101]

[0102] In a preferred embodiment, alone or in combination with other preferred embodiments, the fish belonging to a species of the family Acipenseridae has an age equal to or less than 2 years old. More preferably, the fish has an age ranging from 1 to 2 years old (including the end values).

[0103] Kit of the invention and uses thereof

[0104] The uses and methods of the invention are put into practice based on determining the levels of a sequence comprising, or consisting of, SEQ ID NO: 1 (sequence of the invention). The means used for this sequence of the invention levels determination may be part of a kit.

[0105] Thus, another aspect of the present invention relates to a kit, hereinafter the “kit of the invention”, which comprises means for the in vitro determination of the levels of the sequence of the invention.

[0106] In a preferred embodiment, the kit of the present invention comprises, (i) at least, one primer pair, said primer pair comprising a forward primer and a reverse primer, and (ii) at least, one probe, capable of amplifying and detecting the sequence of the invention disclosed herein.

[0107] In a more preferred embodiment, the primer pair is selected from the primer pairs shown in Table 2. Even more preferably, the primers are a forward primer comprising, preferably consisting of, SEQ ID NO: 16, and a reverse primer comprising, preferably consisting of, SEQ ID NO: 20.

[0108] In another more preferred embodiment, alone or in combination with other preferred embodiments, the probe has a nucleotide sequence selected from the list consisting of: ATTGCTGTATCATGTCATCA (SEQ ID NO: 28), ATTGCTGTATCATGTCATC (SEQ ID NO: 29), ATTGCTGTATCATGTCATCAG (SEQ ID NO: 30), TTGCTGTATCATGTCATCA (SEQ ID NO: 31), TTGCTGTATCATGTCATCAG (SEQ ID NO: 32), TGCTGTATCATGTCATCAG (SEQ ID NO: 33), TGCTGTATCATGTCATCAGA (SEQ ID NO: 34) and CTGTATCATGTCATCAGAC (SEQ ID NO: 35). Even more preferably, the probe comprises, preferably consistsof, the nucleotide sequence SEQ ID NO 29. Preferably, the probe is a TaqMan probe.

[0109] In a still more preferred embodiment of the kit of the invention, the means comprises any of the set of primer pairs-probe shown in Table 2.

[0110] The materials and reagents required for observing or measuring the sequence of the invention of the present invention may be assembled together in such a kit. In addition to the primers and the probe, the kit may further comprises other reagents or components. For instance, available PCR Master Mix (e.g. without limitation to Master Mix and TaqMan™ Universal Master Mix (ThermoFisher)) may be part of the kit.

[0111] Furthermore, as understood by a person skilled in the art, the kit may comprise other components useful in putting the present invention into practice, such as buffering solutions, delivery vehicles, material supports, positive and / or negative control components, etc. In addition to the mentioned components, the kits may also include instructions for practicing the object of the invention. These instructions may be present in the mentioned kits in a variety of forms, one or more of which may be present in the kit. One way in which these instructions may be present is as information printed on a suitable medium or substrate, for example, a sheet or sheets of paper on which the information is printed, in the kit packaging, in a package insert, etc. Another medium would be a computer-readable medium, for example, a CD, a USB, etc., in which the information has been recorded. Another medium that may be present is a website address that can be used over the Internet to access information at a remote site. Any suitable means may be present in the kits.

[0112] In another aspect of the present invention refers to a use of the kit of the invention, for identifying the sex in species of the family Acipenseridae. In a preferred embodiment, the species of the family Acipenseridae, belong to Acipenser genus or Huso genus In a more preferred embodiment, the species of the family Acipenseridae is selected from the list consisting of: hybrid species Acipenser naccarii x A. baerii (ANB), A. baerii (ABA), A. guedenstaedtii (AGU), A. naccarii(AAA), A. schrenckii, A. sinensis, A. dabryanus, Huso huso (H. huso), A. stellatus and A. ruthenus,

[0113] The kit of the invention, which comprises means for determining the levels of SEQ ID NO:1 , is useful in identifying the sex of fish belonging to the family Acipenseridae. Thus, the kit of the invention can be used in any of the methods of the invention that have been described above.

[0114] Thus, in another aspect, the invention relates to the use of the kit of the invention in any of the methods of the invention.

[0115] In another aspect, the invention relates to the in vitro use of the kit of the invention for identifying the sex in species of the family Acipenseridae.

[0116] In another aspect, the invention relates to the in vitro use of the kit of the invention for classifying by sex a population of fish belonging to the family Acipenseridae.

[0117] The terms used to define the kit of the invention and related uses have been explained in the previous inventive aspects, applying, as well as their preferred embodiments, to these aspects of the invention.

[0118] DESCRIPTION OF THE DRAWINGS

[0119] Fig. 1. Amplification curves obtained from DNA of males and females of the ANB species in a Real-Time PCR system.

[0120] Fig. 2. Validation of the sturgeon sexing method with the ANB species. The x-axis shows the Cp values. The vertical line represents the reference value of 36.52. Each point is the mean of the triplicates.Examples

[0121] In the following, the invention will be illustrated by means of a validation assay carried out by the inventors, which demonstrate the effectiveness of the methods and uses of the invention.

[0122] Both the molecular method and its validation have been performed on the following sturgeon species: Acipenser naccarii x A. baerii (ANB), A. baerii, A. guedenstaedtii and A. naccarii.

[0123] DNA extraction is performed using Wizard® Genomic DNA Purification Kit, starting from 25-50 mg of tissue and following manufacturer’s instructions. Extracted DNA is eluted in sterile Milli Q water and quantified using a Spectrophotometer. DNA is stored at -20 °C until use.

[0124] All the primers and fluorogenic probes are designed using Primer Express™ v2.0 software (Applied Biosystems, Thermo Fisher Scientific, USA). The probes are labelled at the 5’-end with the fluorescent reporter dye 6-carboxyfluorescein (FAM) or VIC® whereas the 3’-end is labelled with a non-fluorescent quencher and a minor groove binder (MGB).

[0125] The amplification and detection of a 65 bp sex specific fragment (SEQ ID NO: 1) is carried out by real time PCR amplification. Amplification is performed in MicroAmp Optical 96-well reaction plate. Each reaction mixture contained 0.3 pM of each forward (5’-TGCAGGGAAGGGCAGTAATG-3’ (SEQ ID NO: 16)) and reverse primer (5’- TTCACTTGCTGAACCACAACAGT-3’ (SEQ ID NO: 20)), 2.5 pM of specific FAM labeled probe (5’-ATTGCTGTATCATGTCATC-3’ (SEQ ID NO: 29)) and 1-10 ng of template DNA. Amplification reactions are carried out employing TaqMan Universal Master Mix (Applied Biosystems, Thermo Fisher Scientific, USA). Amplification is performed on the LightCycler® 480 Real-Time PCR System (Roche Diagnostics, Switzerland) with the following thermal conditions: 50eC for 2 min, 95eC for 10 min followed by 40 cycles of 95eC for 15 s and 60eC for 1 min. The analysis was carried out using the fluorescent signal level during the initial cycles of PCR. This baseline is used to accurately determine crossing point (Cp). Everysample is analyzed by triplicates and the average Cp is calculated for each sample (Figure 1).

[0126] The validation of the sturgeon sexing method was carried out with the ANB, A. baerii, A. guedenstaedtii and A. naccarii species. The validation data for each of the species tested are shown below.

[0127] Table 3. Validation of the method of the ANB species.

[0128]

[0129]

[0130]

[0131]

[0132] After validation of the method with 116 reference samples of the ANB species (58 females and 58 males) a reference value of 36.52 was obtained. This reference value is the result of the average of the Cp value of each sample in triplicate minus the standard deviation multiplied by three (Table 3). A graphical representation of the Cp values with respect to the sex of the ANB species is detailed in Figure 2.

[0133] Data Analysis is summarized as follows:

[0134] If this average Cp value is greater than 36.52; the result is a male.

[0135] - If this average Cp value is less than 36.52; the result is a female.The method has a 97.41 % correct sex assignment.

[0136] Table 4. Validation of the method of the Acipenser baerii species.

[0137]

[0138]

[0139] Data Analysis is summarized as follows:

[0140] If this average Cp value is greater than 36.52; the result is a male.

[0141] If this average Cp value is less than 36.52; the result is a female.

[0142] All male samples were correctly identified as male. The method has a 100 % correct sex assignment.

[0143] Table 5. Validation of the method of the Acipenser guedenstaedtii species.

[0144]

[0145]

[0146]

[0147] Data Analysis is summarized as follows:

[0148] If this average Cp value is greater than 36.52; the result is a male. If this average Cp value is less than 36.52; the result is a female.All male samples were correctly identified as male. The method has a 100 % correct sex assignment.

[0149] Table 6. Validation of the method of the Acipenser naccarii species.

[0150]

[0151]

[0152] Data Analysis is summarized as follows:

[0153] If this average Cp value is greater than 36.52; the result is a male.

[0154] If this average Cp value is less than 36.52; the result is a female.

[0155] All male samples were correctly identified as male. The method has a 100 % correct sex assignment.

Claims

CLAIMS1. An in vitro method for identifying the sex of a fish belonging to a species of the family Acipenseridae, comprising:a) determining the levels of a DNA nucleotide sequence comprising SEQ ID NO: 1, in a biological sample previously isolated from a fish belonging to a species of the family Acipenseridae, andb) comparing the levels determined in step a) with the levels of the DNA nucleotide sequence comprising SEQ ID NO: 1 in a male subject belonging to a species of the family Acipenseridae,wherein elevated levels of the DNA nucleotide sequence comprising SEQ ID NO: 1 determined in step a), with respect to the levels of the DNA nucleotide sequence comprising SEQ ID NO: 1 in the male subject, indicates that the fish is a female.

2. An in vitro method for classifying by sex a population of fish belonging to species of the family Acipenseridae, comprising:a) determining the levels of a DNA nucleotide sequence comprising SEQ ID NO: 1 , in biological samples previously isolated from said population of fish, andb) observing the distribution pattern of the levels obtained, wherein if two significantly different sample populations appear, then the individuals in the same population with the highest levels are females, and the individuals in the sample population with the lowest level are males.

3. The method according to claim 1 or 2, wherein the determination of the levels of the DNA nucleotide sequence comprising SEQ ID NO: 1 is carried out by DNA amplification.

4. The method according to claim 3, wherein the DNA amplification comprises the use of, at least, one primer pair, said primer pair comprising a forward primer and a reverse primer, capable of amplifying the DNA nucleotide sequence comprising SEQ ID NO: 1.

5. The method according to claim 4, wherein the forward primer has a nucleotide sequence selected from the list consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO 18 and SEQ ID NO: 19; and wherein the reverse primer has a nucleotide sequence selected from the list consisting of: SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and SEQ ID NO: 27.

6. The method according to any claim 4 or 5, wherein the DNA amplification further comprises the use of a probe, preferably wherein the probe has a nucleotide sequence selected from the list consisting of: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 and SEQ ID NO: 35.

7. The method according to any one of claims 3 to 6, wherein the amplification is a PCR, preferably wherein the PCR is a real-time PCR.

8. The method according to any one of claims 1 to 7, wherein the species of the family Acipenseridae is selected from the list consisting of: hybrid species Acipenser9. In vitro use of the levels of DNA nucleotide sequence comprising SEQ ID NO: 1 in a sample, for identifying the sex in species of family Acipenseridae.

10. Use according to claim 9, wherein the species of the family Acipenseridae is selected from the list consisting of: hybrid species Acipenser naccarii x A. baerii (ANB), A. baerii (ABA), A. guedenstaedtii (AGU), A. naccarii (AAA), A. schrenckii, A. sinensis, A. dabryanus, Huso huso (H. huso), A. stellatus and A. ruthenus,11. A kit comprising means for determining in vitro levels of a DNA nucleotide sequence comprising SEQ ID NO: 1.

12. The kit according to claim 11, wherein the means comprises at least, one primer pair, said primer pair comprising a forward primer and a reverse primer, and at least, one probe, capable of amplifying and detecting a DNA nucleotide sequence comprising SEQ ID NO: 1.13 The kit according to claim 12, wherein the primer pair is selected from the primer pairs shown in Table 2, and wherein the probe has a nucleotide sequence selected from the list consisting of: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 and SEQ ID NO: 35.

14. Use of the kit according to any one of claims 11 to 13, for identifying the sex in species of the family Acipenseridae.

15. Use of the kit according to any one of claims 11 to 13, for classifying by sex a population of fish belonging to species of the family Acipenseridae.