Extract of biological cells and method for producing same, and food additive, food, cosmetic, and pharmaceutical

Abstract

The present invention provides a highly safe substance having an activity of inhibiting interleukin-6 amplifier and an activity of promoting production of interleukin-33. The present invention pertains to an extract of biological cells having an activity of inhibiting interleukin-6 amplifier and / or an activity of promoting production of interleukin-33, the biological cells being Saccharomyces cerevisiae.

Description

Biological cell extracts and methods for producing the same, and food additives, foods, cosmetics, and pharmaceuticals.

[0001] This invention relates to biological cell extracts, methods for producing the same, and food additives, foods, cosmetics, and pharmaceuticals.

[0002] Interleukin-6 is a cytokine that regulates humoral immunity produced by cells such as T cells and macrophages.

[0003] The interleukin-6 amplifier is a mechanism for the overexpression of chemokines. It was discovered as a positive feedback mechanism for interleukin-6, in which interleukin-17 acts on type I collagen-positive cells in the presence of interleukin-6, leading to the re-expression of interleukin-6 in large quantities (Non-Patent Literature 1). Functionally, the interleukin-6 amplifier is a mechanism that induces local inflammation through the overexpression of chemokines. Molecularly, it has been proven to be important in inducing inflammation, including autoimmune diseases, through the simultaneous activation of NF-κB and STAT3 (Non-Patent Literature 2, 3).

[0004] Substances that inhibit the production of interleukin-6 include tocilizumab and sarilumab, which are used to treat rheumatoid arthritis, as well as chemically synthesized substances such as epinasti, an antihistamine effective against hay fever and allergic dermatitis. Thus, inhibiting the production of interleukin-6 leads to the healing of various inflammations.

[0005] Interleukin-33 is a cytokine belonging to the interleukin-1 family, cloned in 2005. It is constitutively expressed in epithelial barrier tissue and human blood vessels, and is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils, and natural killer cells. It acts as a chemotactic for Th2 cells and is suggested to function as an alarmin that enhances the immune response during tissue damage. It is known to be released from epidermal keratinocytes and maintain skin homeostasis by causing Treg infiltration and accumulation, thereby preventing inflammation (Non-Patent Literature 4). It has also been shown to stimulate dendritic cells and enhance antitumor immunity (Non-Patent Literature 5).

[0006] Thus, promoting the production of interleukin-33 is thought to contribute to the maintenance of homeostasis and the enhancement of immunity. It is known that interleukin-33 undergoes limited degradation by proteases released by neutrophils and other cells at the site of inflammation, and its activity is further increased.

[0007] Immunity, 29, 628-636 (2008) J. Exp. Med., 208, 103-114 (2011) J. Immunol., 189, 1928-1936 (2012) Nature, 513, 7519 J Immunol, 207, 1456-1467 (2021)

[0008] In addition to surgical procedures, various pharmaceuticals containing chemically synthesized substances are used to heal human injuries and burns, as well as to treat and prevent diseases. Pharmaceuticals act on human tissues through some kind of pharmacological action, but many also have secondary functions in addition to their intended function. On the other hand, if a substance with pharmacological action has a long history of being consumed by humans, it is expected to be highly safe.

[0009] The present invention aims to provide a substance that is highly safe and possesses inhibitory activity against interleukin-6 amplifiers and activity that promotes the production of interleukin-33.

[0010] As a result of diligent research, the inventors discovered that an extract of Saccharomyces cerevisiae possesses inhibitory activity against interleukin-6 amplifier and interleukin-33, thus completing the present invention.

[0011] The present invention specifically provides the following: [1] A biological cell extract having interleukin-6 amplifier inhibitory activity and / or interleukin-33 production promoting activity, wherein the biological cell is Saccharomyces cerevisiae. [2] The biological cell extract according to [1], wherein the Saccharomyces cerevisiae comprises natural yeast. [3] The biological cell extract according to [2], wherein the natural yeast comprises Shirakami Kodama Yeast (registered trademark). [4] A food additive comprising the biological cell extract according to any one of [1] to [3]. [5] A food comprising the biological cell extract according to any one of [1] to [3]. [6] A pharmaceutical product comprising the biological cell extract according to any one of [1] to [3]. [7] A cosmetic product comprising the biological cell extract according to any one of [1] to [3]. [8] A method for producing a biological cell extract having interleukin-6 amplifier inhibitory activity, wherein the biological cell is Saccharomyces cerevisiae, and the method includes the step of heat-treating the biological cell at a pH greater than 3.0 and less than 6.0 and at a temperature greater than 50°C for 1 hour or more. [9] A method for producing a biological cell extract having interleukin-33 production promoting activity, wherein the biological cell is Saccharomyces cerevisiae, and the method includes the step of heat-treating the biological cell at a pH greater than 3.0 and less than 6.0 and at a temperature of 50°C or higher for 1 hour or more.

[10] The method according to [8] or [9], further comprising the step of obtaining a fermentation product by fermentation of Saccharomyces cerevisiae before the heat-treating step.

[11] The method according to any one of [8] to

[10] , wherein the Saccharomyces cerevisiae includes natural yeast.

[12] The method according to

[11] , wherein the natural yeast includes Shirakami Kodama Yeast (registered trademark).

[0012] The present invention provides a biological cell extract having inhibitory activity on interleukin-6 amplifiers and / or activity on promoting the production of interleukin-33. Furthermore, food additives, foods, cosmetics, and pharmaceuticals containing this biological cell extract can also be provided.

[0013] This figure shows the inhibitory activity of the yeast fermentation emulsion supernatant on the interleukin-6 amplifier. This figure shows the interleukin-33 production promoting activity of the yeast fermentation emulsion supernatant. This figure shows the interleukin-6 amplifier inhibitory activity and interleukin-33 production promoting activity of Shirakami Kodama yeast fermentation liquid under different fermentation raw material conditions. This figure shows the changes in interleukin-6 amplifier inhibitory activity and interleukin-33 production promoting activity of Shirakami Kodama yeast fermentation emulsion due to differences in heating conditions after fermentation. This figure shows the interleukin-6 amplifier inhibitory activity due to differences in heat treatment conditions of the yeast fermentation liquid and the physiological state of the yeast. This figure shows the effect of the pH of the fermentation liquid during heat treatment on the interleukin-6 amplifier inhibitory activity.

[0014] <Biological Cell Extract> The biological cell extract of the present invention has interleukin-6 amplifier inhibitory activity and / or interleukin-33 production promoting activity. The biological cell in the biological cell extract of the present invention is Saccharomyces cerevisiae. The biological cell extract of the present invention is a substance derived from a biological cell, from which components constituting the biological cell have been eluted. The form of the above substance is not particularly limited and may be a solution or a solid, may or may not contain biological cells, and may also contain materials used when culturing or fermenting the biological cell.

[0015] The biological cell extract of the present invention can be obtained, for example, by heat-treating biological cells. Therefore, one preferred embodiment of the biological cell extract of the present invention is a heat-treated product of biological cells.

[0016] The biological cell extract of the present invention may be obtained by fermentation using biological cells. Therefore, one preferred embodiment of the biological cell extract of the present invention is a heat-treated product obtained by heat-treating a fermentation product containing biological cells obtained by fermenting biological cells.

[0017] The presence or absence of interleukin-6 amplifier inhibitory activity and interleukin-33 production promoting activity of the biological cell extract of the present invention can be confirmed, for example, by the relative gene expression level ΔΔCt method using real-time gene expression analysis. Specifically, it can be measured by the method described in the examples. Having interleukin-6 amplifier inhibitory activity means that the activity is suppressed compared to a control experiment in which the biological cell extract was not added, as measured by the relative gene expression level ΔΔCt method, etc. Having interleukin-33 production promoting activity means that the activity is increased compared to a control experiment in which the biological cell extract was not added, as measured by the relative gene expression level ΔΔCt method, etc.

[0018] From the viewpoint of sufficiently maintaining the inhibitory activity of interleukin-6 amplius or the activity of interleukin-33, the pH of the biological cell extract of the present invention is preferably greater than 3.0 and less than 6.0, more preferably between 3.5 and 5.9, and even more preferably between 3.7 and 5.7. Preferred embodiments of the method for producing the biological cell extract of the present invention will be described later in the section <Method for producing the biological cell extract>.

[0019] Examples of Saccharomyces cerevisiae used in this invention include natural yeast, genetically modified yeast, and highly fermentable strains selected to produce large amounts of specific fermentation products. These may be used individually or in combination of two or more. Among these, natural yeast is preferred.

[0020] Natural yeasts that can be used in this invention can be distinguished, for example, by their original use upon discovery, and include alcoholic yeasts such as baker's yeast, beer yeast, wine yeast, whiskey yeast, and shochu yeast. Yeast breaks down sugars into alcohol and carbon dioxide. Baker's yeast has the property that the carbon dioxide produced creates countless bubbles in the bread dough, making it preferable in bread making. Alcoholic yeast produces alcohol from the alcohol broken down by the yeast. These can be used individually or in combination of two or more, and among these, baker's yeast is preferred. Furthermore, each yeast may be genetically modified to suit its respective use. On the other hand, natural yeasts can also be distinguished, for example, by the place name where they were discovered, and Shirakami Kodama Yeast (registered trademark) can be suitably used. Shirakami Kodama Yeast (registered trademark) is a type of natural yeast discovered in the humus of the Shirakami Mountains, a World Natural Heritage site located on the border of Akita and Aomori prefectures, and is available commercially.

[0021] <Method for Producing Biological Cell Extracts> The biological cell extract having interleukin-6 amplifier inhibitory activity according to the present invention can be produced, for example, by heat-treating Saccharomyces cerevisiae at a pH greater than 3.0 and less than 6.0 and at a temperature greater than 50°C for one hour or more. Therefore, one aspect of the present invention is a method for producing a biological cell extract having interleukin-6 amplifier inhibitory activity, wherein the biological cell is Saccharomyces cerevisiae, and the method includes the step of heat-treating the biological cell at a pH greater than 3.0 and less than 6.0 and at a temperature greater than 50°C for one hour or more (hereinafter also referred to as Method I).

[0022] In the manufacturing method I of the present invention, the pH is preferably 3.5 to 5.9, and more preferably 3.7 to 5.7, from the viewpoint of further enhancing the interleukin-6 amplifier inhibitory activity.

[0023] In the manufacturing method I of the present invention, the temperature is preferably 55°C or higher, and more preferably 60°C or higher, from the viewpoint of further enhancing the interleukin-6 amplifier inhibitory activity. The upper limit of the temperature in the manufacturing method I of the present invention is not particularly limited and may be 100°C or lower, 90°C or lower, or 80°C or lower.

[0024] The heating time in manufacturing method I of the present invention is preferably 1.5 hours or more, more preferably 2 hours or more, and even more preferably 3 hours or more. The upper limit of the heating time in manufacturing method I of the present invention is not particularly limited and may be 10 days or less, 5 days or less, or 3 days or less.

[0025] Furthermore, one embodiment of the present invention is a biological cell extract comprising an extract of Saccharomyces cerevisiae, which includes a heat-treated product obtained by treating Saccharomyces cerevisiae at a pH greater than 3.0 and less than 6.0 and at a temperature greater than 50°C.

[0026] The biological cell extract having interleukin-33 production promoting activity according to the present invention can be produced, for example, by heat-treating Saccharomyces cerevisiae at a pH greater than 3.0 and less than 6.0 and at a temperature of 50°C or higher for one hour or more. Therefore, one aspect of the present invention is a method for producing a biological cell extract having interleukin-33 production promoting activity, wherein the biological cell is Saccharomyces cerevisiae, and the method includes the step of heat-treating the biological cell at a pH greater than 3.0 and less than 6.0 and at a temperature of 50°C or higher and less than 60°C for one hour or more (hereinafter also referred to as Method II).

[0027] The preferred pH in manufacturing method II of the present invention is the same as the preferred pH in manufacturing method I.

[0028] From the viewpoint of further enhancing the interleukin-33 production activity, the upper limit of the temperature in the manufacturing method II of the present invention is preferably 100°C or less, more preferably 90°C or less, even more preferably 80°C or less, even more preferably 70°C or less, and even more preferably 60°C or less.

[0029] The preferred mode of the heat treatment time in manufacturing method II of the present invention is the same as the preferred mode of time in manufacturing method I.

[0030] Furthermore, one embodiment of the present invention is a biological cell extract comprising an extract of Saccharomyces cerevisiae, which includes a heat-treated product obtained by treating Saccharomyces cerevisiae at a pH greater than 3.0 and less than 6.0, and at a temperature of 50°C or higher.

[0031] Both manufacturing methods I and II of the present invention may include a step of obtaining a fermentation product by fermenting Saccharomyces cerevisiae before the heat treatment step. In the fermentation step, the nutrients required by Saccharomyces cerevisiae include, for example, sugars such as glucose, fructose, and maltose; nitrogen sources such as amino acids and proteins; vitamins such as vitamin B1; minerals such as zinc, magnesium, calcium, and phosphorus; and lipids such as saturated or unsaturated fatty acids. These may be included individually or in combination of two or more.

[0032] The above nutrients may be obtained by combining each of the components mentioned above, or by using foods that naturally contain each component. Foods are not limited to bread or alcohol using the yeast mentioned above, and are not particularly restricted, but include, for example, animal products such as meat (beef, pork, chicken, etc.), fish, eggs, and dairy products; plant products such as bread, rice, corn and other grains, beans, vegetables, and fruits; fungi such as mushrooms, and fermented foods such as miso and soy sauce; and so on. Among these foods, grains are particularly preferred, and bread, rice, and corn are more preferred.

[0033] The form of Saccharomyces cerevisiae in the manufacturing methods I and II of the present invention is the same as the form described in the <biological cell extract> section above. In addition, in the manufacturing methods I and II of the present invention, after the heat treatment step, the cells and the solution may be separated by centrifugation or the like, and the supernatant may be used as the biological cell extract.

[0034] The biological cell extract of the present invention and the biological cell extract obtained by the manufacturing method of the present invention (hereinafter collectively referred to as the biological cell extract of the present invention) have inhibitory activity against interleukin-6 amplifier and activity that promotes the production of interleukin-33, and can therefore be used, for example, as a food additive with the aim of improving or preventing diseases of the immune system. In addition to being added to food, the biological cell extract of the present invention can also be used in pharmaceuticals and cosmetics. Herein, "food" is not limited to bread or alcohol using the yeast described above, but can include the same foods as those described for the above nutrients. Among these foods, grains are particularly preferred, and bread, rice, and corn are more preferred. Furthermore, when used as a food additive, the biological cell extract of the present invention may be used as a food ingredient or added directly to food products.

[0035] The present invention will be described in more detail below with reference to examples, but the present invention is not limited thereto.

[0036] [Example 1] Preparation of yeast-fermented milk solution 7L of commercially available milk was mixed with 700g of glucose, 300g of raw sake lees, and 350g of dried rice koji. 70g of dried cells of Shirakami Kodama yeast (registered trademark), a bread-making yeast belonging to Saccharomyces cerevisiae, was added and fermented at 30°C for 21 days. After sterilization by heating at 65°C for 3 hours, yeast-fermented milk solution was obtained as the fermentation product. The prepared sterilized yeast-fermented milk solution had a pH of 3.91 and was negative for both fungi and bacteria in microbiological tests. The supernatant of the yeast-fermented milk solution after centrifugation was found to be remarkably effective in healing lacerations even when diluted up to 360 times. Furthermore, it was confirmed that this yeast-fermented milk solution also had a high anti-itch effect. This suggested that this yeast-fermented milk solution may have interleukin-6 amp inhibitory activity and interleukin-33 production promoting activity. Therefore, the interleukin-6 amp inhibitory activity of the yeast-fermented milk solution was investigated.

[0037] [Example 2] Measurement of the inhibitory activity of yeast-fermented milk syrup on interleukin-6 amplifier. Human epidermal keratinocyte HaCaT cells were maintained in Dulbecco's modified Eagle medium containing 10% fetal bovine serum. 3.0 × 10 5 Cells were seeded in 24-well plates at a density of Cells / ml and cultured for 4 days in a CO2 incubator at 37°C. After confirming confluence, the cells were washed twice with serum-free Dulbecco's Modified Eagle Medium, and 10 μL of the yeast fermentation emulsion supernatant prepared in Example 1 was added per well using the same medium. The cells were incubated in a CO2 incubator at 37°C for 2 hours, and then BioLegend Recombinant Human IL-6 (final concentration 100 ng / ml) was added to all wells except the untreated well, and the cells were incubated for another 2 hours in a CO2 incubator at 37°C. All culture supernatant was removed, and total RNA was purified from the cell layer using the QIAGEN RNeasy Mini Kit and obtained using PrimeScript. TM After preparing cDNA using the RT reagent kit, use TB Green® Premix Ex Taq. TM Real-time gene expression analysis was performed using II and the IL-6 Primer described below. Relative gene expression levels were calculated using the ΔΔCt method.

[0038] GAPDH Primer Forward: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 1) Reverse: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 2) IL-6 Primer Forward: AGACAGCCACTCACCTCTTCAG (SEQ ID NO: 3) Reverse: TTCTGCCAGTGCCTCTTTGCTG (SEQ ID NO: 4)

[0039] Figure 1 shows a graph comparing the inhibitory activity of interleukin-6 amplifiers in the supernatant of yeast fermentation emulsion and in fractions obtained by molecular weight fractionation of this supernatant into 100K Daltons or higher, 10K to 100K Daltons, and 10K Daltons or lower. In Figure 1, Sup represents the supernatant without molecular weight fractionation, 100K on represents the fraction of 100K Daltons or higher, 10K on represents the fraction of 10K to 100K Daltons, and 10K pass represents the fraction of 10K Daltons or lower. As shown in Figure 1, yeast fermentation emulsion showed lower ΔΔCt values ​​and inhibitory activity of interleukin-6 amplifiers compared to the case without yeast fermentation emulsion, and it was revealed that its active components exhibit a broad molecular weight distribution.

[0040] [Example 3] Measurement of interleukin-33 production-promoting activity Human epidermal keratinocyte HaCaT cells were maintained in Dulbecco's modified Eagle medium containing 10% fetal bovine serum. 3.0 × 10 5 Cells were seeded in 24-well plates at a density of Cells / ml and cultured for 4 days in a CO2 incubator at 37°C. After confirming confluence, the plates were washed twice with serum-free Dulbecco's Modified Eagle Medium, and then 10 μL of the sample solution was added per well using the same medium. The plates were incubated in a CO2 incubator at 37°C for 2 hours, and then BioLegend Recombinant Human IL-6 (final concentration 100 ng / ml) was added to all wells except the untreated well, and the plates were incubated for another 2 hours in a CO2 incubator at 37°C. The culture supernatant was completely removed, and total RNA was purified from the cell layer using a QIAGEN RNeasy Mini Kit and extracted using PrimeScript. TMAfter preparing cDNA using the RT reagent Kit, real-time gene expression analysis was performed using TB Green (registered trademark) Premix Ex Taq TM II and the following IL-6 primers. The relative gene expression level was calculated by the ΔΔCt method.

[0041] GAPDH Primer Forward: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 1) Reverse: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 2) IL-33 Primer Forward: GCCTGTCAACAGCAGTCTACTG (SEQ ID NO: 5) Reverse: TGTGCTTAGAGAAGCAAGATACTC (SEQ ID NO: 6)

[0042] Figure 2 shows a graph comparing the interleukin-33 production-promoting activities of the yeast fermentation broth supernatant and fractions obtained by molecular weight fractionation of this supernatant into fractions of 100 kDa or more and 10 kDa to 100 kDa. In Figure 1, Sup represents the supernatant without molecular weight fractionation, 100K on represents the fraction of 100 kDa or more, and 10K on represents the fraction of 10 kDa to 100 kDa. As shown in Figure 2, the yeast fermentation broth had a higher ΔΔCt value compared to the case without the addition of the yeast fermentation broth, indicating a production-promoting activity for interleukin-33, and it was revealed that the active component, similar to the inhibitory activity of the interleukin-6 amplifier, showed a broad molecular weight distribution.

[0043] [Example 4] Measurement of the inhibitory activity of interleukin-6 amp and the promoting activity of interleukin-33 production in the fermented broth of Komagataella phaffii with different raw materials. It was examined whether the active ingredient was derived from either Komagataella phaffii, which is the fermentation raw material, or other raw material components. Specifically, except that the raw materials and heat sterilization conditions were the conditions shown in Table 1, the fermented broth was produced in the same manner as in Example 1. The measurement of the inhibitory activity of interleukin-6 amp was carried out under the same conditions as in Experimental Example 2, and the measurement of the promoting activity of interleukin-33 production was carried out under the same conditions as in Experimental Example 3. The inhibitory activity of interleukin-6 amp and the promoting activity of interleukin-33 production are shown in Figure 3. From Figure 3, since the inhibitory activity of interleukin-6 amp and the promoting activity of interleukin-33 production were expressed regardless of the fermentation raw material, it was suggested that they were derived from yeast cells.

[0044]

[0045] [Experimental Example 5] Measurement of activity under different heating conditions after fermentation of yeast fermentation liquid. A yeast fermentation emulsion fermented at 30°C for 18 days using the same formulation as in Experimental Example 1 was heated under the conditions shown in Table 2, and the inhibitory activity of interleukin-6 ampliosis and the production-promoting activity of interleukin-33 in the supernatant of the cooled yeast fermentation emulsion were measured. The measurement of the inhibitory activity of interleukin-6 ampliosis was performed using the same method as in Experimental Example 2, and the measurement of the production-promoting activity of interleukin-33 was performed using the same method as in Experimental Example 3. The results are shown in Figure 4. As shown in Figure 4, the inhibitory activity of interleukin-6 ampliosis in the centrifuged supernatant of the yeast fermentation emulsion after fermentation was not observed when heated at 50°C for 2 hours, but activity was observed when heated at 55°C for 2 hours or more, with the highest activity observed when heated at 70°C for 2 hours. In addition, the production-promoting activity of interleukin-33 was observed when heated at 50°C and 55°C for 2 hours, but no activity was observed under higher heating conditions. From this, it became clear that in order to obtain a fermentation liquid having interleukin-6 amplifier inhibitory activity, it is necessary to heat-treat the yeast cells at 50°C or higher. Furthermore, it became clear that in order to have interleukin-33 expression promoting activity, it is necessary to heat-treat the yeast cells at 50°C or higher but less than 60°C.

[0046]

[0047] [Example 6] Measurement of Interleukin-6 Amplifier Inhibitory Activity Based on Heat Treatment Conditions of Yeast Fermentation Liquid and Differences in Yeast Physiological State Previously, activity measurements were performed on yeast fermentation emulsion using dried yeast of Shirakami Kodama yeast that had undergone long-term fermentation. However, since it was confirmed that the active substance originated from Shirakami Kodama yeast cells, we investigated the differences in activity due to differences in the physiological state of the yeast. Yeast fermentation was carried out at 30°C in a 5% glucose solution. Extraction of the active component from the yeast was performed at 70°C for 1 to 24 hours, and then the supernatant was obtained by centrifugation and activity measurement was performed. Human epidermal keratinocyte HaCaT cells were maintained using Dulbecco's modified Eagle medium containing 10% fetal bovine serum. 3.0 x 10 5Cells were seeded in a 24-well plate at a density of cells / ml and cultured in a 37°C CO₂ incubator for 4 days. After confirming confluence, the cells were washed twice with serum-free Dulbecco's modified Eagle's medium, and then a sample solution was added at 10 μL per well using the same medium. The plate was incubated at 37°C in a CO₂ incubator for 2 hours. Then, BioLegend Recombinant Human IL-6 (final concentration 100 ng / ml) was added to all wells except the non-supplemented well, and the plate was further incubated at 37°C in a CO₂ incubator for 2 hours. All culture supernatants were removed, and total RNA was purified from the cell layer using the QIAGEN RNeasy Mini Kit, and TM cDNA was prepared using the PrimeScript TM RT reagent Kit. Real-time gene expression analysis was then performed using TB Green (registered trademark) Premix Ex Taq

[0048] II and the following IL-6 primers. The relative gene expression level was calculated by the ΔΔCt method. GAPDH Primer Forward: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 1) Reverse: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 2) IL-6 Primer Forward: AGACAGCCACTCACCTCTTCAG (SEQ ID NO: 3) Reverse: TTCTGCCAGTGCCTCTTTGCTG (SEQ ID NO: 4)

[0049] Table 3 shows the fermentation conditions for Shirakami Kodama yeast and the pH and treatment conditions of the fermented liquid after fermentation, while Figure 5 shows the interleukin-6 amplifier inhibitory activity. Watered brown rice was also measured simultaneously as plant cells. Figure 5 shows that interleukin-6 amplifier inhibitory activity was present in the heat-treated yeast fermentation liquid containing Shirakami Kodama yeast during long-term and short-term fermentation, and even in unfermented yeast. It was also detected in both live and dried yeast. Under heat treatment conditions, no activity was detected in Sample 1 after 45°C for 48 hours, but activity was detected from 1 hour to 24 hours at 70°C. Interleukin-6 amplifier inhibitory activity was detected in pH ranges from 3.92 to 5.54. Note that no activity was detected in Sample 9 (brown rice), which was a substitute for Shirakami Kodama yeast.

[0050]

[0051] [Example 7] p.33 Measurement of elution and stabilization of interleukin-6 amplifier inhibitory activity due to pH differences during heat treatment of pH-regulated yeast cells. The pH of the fermented liquid of Shirakami Kodama yeast in 5% glucose solution was adjusted to 2.0-4.0 and 6.0-9.0 before heat treatment, and then treated at 70°C for 2 hours. The inhibitory activity of the interleukin-6 amplifier in the supernatant after centrifugation was measured. The activity was measured in the same manner as in Example 6. In addition, to investigate whether the presence of cells is essential during heat treatment, the cell-free fermented liquid from which yeast cells were removed by centrifugation before heat treatment was also subjected to analysis. The pH of the fermentation-completed liquid before heat treatment was 4.95. The pH of the fermented liquid adjusted during heat treatment after the completion of fermentation and the treatment conditions are shown in Table 4, and the interleukin-6 amplifier inhibitory activity is shown in Figure 6. Figure 5 shows that substances with interleukin-6 amplifier inhibitory activity are eluted from yeast when the pH of the fermentation liquid during heat treatment is within a specific range. However, Figure 6 shows that interleukin-6 amplifier inhibitory activity was not observed in the pH ranges of 2.0 to 3.0 and 6.0 to 9.0, suggesting that the active substance is either not eluted from the yeast cells or, if eluted, is inactivated within this pH range. Furthermore, sample 4-1 was cell-free during heat treatment and had a pH of 3.95, but no interleukin-6 amplifier inhibitory activity was observed in this sample, indicating that the active substance is eluted from yeast cells during heat treatment.

[0052]

[0053] [Example 8] Prototype preparation of cosmetic liquid having interleukin-6 amplifier inhibitory activity and interleukin-33 production promoting activity (placenta extract) 65 g of dried Shirakami Kodama yeast and 585 g of glucose were added to 6500 ml of water and fermented at 30°C for 3 days with occasional slow stirring to prepare a fermentation liquid. 10.5 kg of frozen porcine placenta was added to this fermentation liquid and heated at 55°C for 16 hours to dissolve the placenta, and then sterilized at 85°C to prepare placenta extract. The prepared placenta extract was concentrated until the Bx. doubled to obtain concentrated placenta extract, which was used as a cosmetic liquid. After sterilization, the placenta extract had a pH of 5.91 and a Bx. of 4.8, and the Bx. of the cosmetic liquid was 9.8. When the interleukin-6 amplifier inhibitory activity and interleukin-33 production promoting activity of this cosmetic liquid were analyzed, strong interleukin-6 amplifier inhibitory activity and strong interleukin-33 production promoting activity were observed.

[0054] [Example 9] Prototype preparation of an active seasoning (fermented soy milk seasoning liquid) 500g of commercially available soy milk was mixed with 150g of commercially available raw rice koji, 19.5g of live Shirakami Kodama yeast, 29g of glucose, and 34g of salt, and fermented at 20-30°C for 20 days. After that, it was heated at 80°C for 10 minutes to obtain fermented soy milk seasoning liquid. The pH of the obtained fermented soy milk seasoning liquid was 4.53. Activity analysis of this seasoning liquid revealed strong interleukin-6 amplifier inhibitory activity.

Claims

1. A biological cell extract having interleukin-6 amplifier inhibitory activity and / or interleukin-33 production promoting activity, wherein the biological cell is Saccharomyces cerevisiae.

2. The biological cell extract according to claim 1, wherein the Saccharomyces cerevisiae includes natural yeast.

3. The biological cell extract according to claim 2, wherein the natural yeast comprises Shirakami Kodama Yeast (registered trademark).

4. A food additive comprising a biological cell extract according to any one of claims 1 to 3.

5. A food comprising a biological cell extract according to any one of claims 1 to 3.

6. A pharmaceutical product comprising a biological cell extract according to any one of claims 1 to 3.

7. A cosmetic comprising a biological cell extract according to any one of claims 1 to 3.

8. A method for producing a biological cell extract having interleukin-6 amplifier inhibitory activity, wherein the biological cell is Saccharomyces cerevisiae, and the method includes the step of heat-treating the biological cell at a pH greater than 3.0 and less than 6.0 and at a temperature greater than 50°C for 1 hour or more.

9. A method for producing a biological cell extract having interleukin-33 production promoting activity, wherein the biological cell is Saccharomyces cerevisiae, and the method includes the step of heat-treating the biological cell at a pH greater than 3.0 and less than 6.0 and at a temperature of 50°C or higher for 1 hour or more.

10. The manufacturing method according to claim 8 or 9, further comprising the step of obtaining a fermentation product by fermentation of Saccharomyces cerevisiae prior to the heat treatment step.

11. The method for producing the product according to claim 8 or 9, wherein the Saccharomyces cerevisiae includes natural yeast.

12. The method for producing the product according to claim 11, wherein the natural yeast includes Shirakami Kodama Yeast (registered trademark).

Images