Mouse hepatocyte gene regulated-type human liver model animal

Abstract

[Problem] To provide a chimeric non-human animal. [Solution] A chimeric non-human animal in which a portion of the liver of a non-human animal has been replaced with human hepatocytes, wherein the expression of a gene derived from the non-human animal and remaining in the liver is suppressed.

Description

Mouse hepatocyte gene-regulated human liver model animal

[0001] In one aspect, the present disclosure relates to a chimeric non-human animal in which a part of the liver has been replaced with human hepatocytes and the expression of non-human animal-derived genes remaining in the liver is suppressed.

[0002] Humanized liver chimeric mouse (HLCM) refers to a mouse in which most of the mouse liver has been replaced by human hepatocytes that have engrafted and proliferated after transplantation into the mouse liver. There are several strains of host mice used for the production of HLCM, but the common requirements for HLCM production include being immunodeficient and introducing a gene that causes host mouse hepatocyte damage, or having a deficiency of such a gene. These two factors enable the transplanted human hepatocytes to proliferate in the liver without being excluded by the host mouse's immune system and without competing with damaged mouse hepatocytes, gradually replacing the host mouse's liver. After about two months of transplantation, the mouse becomes one in which more than 70% of the host mouse liver area has been replaced by human hepatocytes. Therefore, in most HLCMs, about 10% - 30% of the host mouse hepatocytes remain.

[0003] Although HLCM is widely used as a model mouse with human-like metabolic activity, problems remain due to the presence of these remaining host mouse-derived hepatocytes. This includes cases where mouse / human genes compete or where genes unique to mice are the cause of the problem. In the former case, it includes situations where drugs are metabolized by mouse hepatocytes in drug metabolism tests and different metabolites from humans are detected, or where mouse metabolism is too fast to analyze human drug metabolism. In the latter case, genes that exist only in mice cause metabolism that does not occur in humans, and even when hepatocytes derived from patients with genetic diseases are transplanted, normal proteins are produced by mouse hepatocytes and the disease-specific pathologies are not reproduced.

[0004] Several efforts have been made to address these issues. For example, Kato et al. established mice lacking the P450 3A gene in uPA-SCID mice (PMID: 25979261 (Non-Patent Literature 1)), and Uehara et al. established mice lacking the POR gene, the master regulator of P450 in host mice, using TK-NOG mice as a background. They have created HLCMs with more human-like metabolic activity in which no mouse-specific drug metabolites are detected (PMID: 36050438 (Non-Patent Literature 2)). Furthermore, Sugahara et al. created mice highly replaced with OTCD human hepatocytes by repeatedly intercalating hepatocytes isolated from HLCM transplanted from patients with the genetic disorder OTCD and transplanting them into other mice, thereby reproducing the onset of hyperammonemia, a pathological condition of OTCD (Non-Patent Literature 3).

[0005] These methods require considerable effort and animal sacrifices associated with establishing new mouse strains, subculturing, and creating highly replaced mice. Furthermore, in establishing mouse strains, if the gene to be deleted is lethal, creating the host mouse itself becomes difficult. For example, while a model mouse for OTCD exists, the gene deletion is lethal, making it extremely difficult to create HLCM by introducing this gene deletion into an existing host mouse.

[0006] Touchette EK et al., Comparative Medicine, 01 Dec 2022, 72(6):355-363, PMID: 36744513Shotaro Uehara et al., Sci Rep. 2022 Sep 1;12(1):14907Go Sugahara et al., J Inherit Metab Dis. 2021 May;44(3):618-628, PMID:33336822

[0007] Based on the above, there has been a desire to develop chimeric non-human animals in which the influence of non-human animal-derived genes remaining in the liver is minimized, in non-human animals in which a portion of the liver has been replaced with human hepatocytes.

[0008] As a result of diligent research to solve the above problems, the inventors succeeded in suppressing the expression of non-human animal-derived genes remaining in the liver, and thus completed the present invention.

[0009] In other words, the contents of this disclosure are as follows: [1] A chimeric non-human animal in which a portion of the liver is replaced with human hepatocytes, wherein the expression of non-human animal-derived genes remaining in the liver is suppressed. [2] The chimeric non-human animal according to [1], wherein the suppression of the expression of non-human animal-derived genes remaining in the liver is suppressed by at least 1% compared to a control chimeric non-human animal. [2-2] The chimeric non-human animal according to [1], wherein the expression of non-human animal-derived genes is suppressed by at least 78% compared to a control wild-type non-human animal. [3] The chimeric non-human animal according to [1], wherein the gene is at least one selected from the group consisting of metabolic enzyme genes, receptor genes, transporter genes and plasma protein genes. [4] A chimeric non-human animal as described in [3], wherein the metabolic enzyme gene is at least one selected from the group consisting of the cytochrome P450 oxidoreductase (mPOR) gene, the glucuronosuccinate (UGT) gene, the uricase gene, the ornithine transcarbamylase (OTC) gene, the argininosuccinate synthase 1 (ASS1) gene, and the L-gulonolactone oxidase (GLO) gene. [5] A chimeric non-human animal as described in [3], wherein the receptor gene is at least one selected from the group consisting of the constitutive androstan receptor (CAR) gene, the aromatic hydrocarbon receptor (AhR) gene, the LDL receptor (LDLR) gene, the VLDL receptor (VLDLR) gene, the apoE receptor (apoER2) gene, and the LRP-1 gene. [6] A chimeric non-human animal as described in [3], wherein the transporter gene is at least one selected from the group consisting of the OATP1B1 gene, the OCT1 gene, the OAT2 gene, the ABCC1 gene, and the ABCB11 gene. [7] A chimeric non-human animal as described in [3], wherein the plasma protein gene is at least one selected from the group consisting of the fibrinogen gene, the factor VIII gene, the albumin (ALB) gene, the transthyretin (TTR) gene, and the transferrin gene.[8] A chimeric non-human animal as described in [1], wherein the gene is at least one selected from the group consisting of the cytochrome P450 oxidoreductase (mPOR) gene, glucuronosyltransferase (UGT) gene, constitutive androstan receptor (CAR) gene, pregnene X receptor (PXR) gene, aromatic hydrocarbon receptor (AhR) gene, uricase gene, L-gulonolactone oxidase (GLO) gene, ornithine transcarbamylase (OTC) gene, arginosuccinate synthase 1 (ASS1) gene, LDL receptor (LDLR) gene, and transthyretin (TTR) gene. [9] A chimeric non-human animal as described in [1], wherein the non-human animal is a rodent.

[10] A chimeric non-human animal as described in [9], wherein the rodent is a mouse.

[11] A chimeric non-human animal as described in [1], wherein the suppression of expression utilizes RNAi, siRNA, mRNA, antisense oligonucleotide, or plasmid.

[12] A chimeric non-human animal as described in [4], wherein the metabolic enzyme gene is the mPOR gene.

[13] A chimeric non-human animal as described in [4], wherein the metabolic enzyme gene is the uricase gene.

[14] A chimeric non-human animal as described in [4], wherein the metabolic enzyme gene is the GLO gene.

[15] A chimeric non-human animal as described in [4], wherein the metabolic enzyme gene is the OTC gene and / or the ASS1 gene.

[16] A chimeric non-human animal as described in [5], wherein the receptor gene is the LDLR gene.

[17] A chimeric non-human animal as described in [7], wherein the plasma protein gene is the TTR gene.

[18] A chimeric non-human animal as described in

[17] , wherein the expression of the human-derived TTR gene is further suppressed.

[19] An experimental animal for metabolite detection, comprising the chimeric non-human animals as described in

[12] . [19-2] A chimeric non-human animal as described in

[12] for metabolite detection.

[20] A hyperuricemia model animal consisting of the chimeric non-human animals as described in

[13] . [20-2] A chimeric non-human animal as described in

[13] that is a hyperuricemia model animal.

[21] A scurvy model animal consisting of the chimeric non-human animals as described in

[14] .[21-2] A chimeric non-human animal described in

[14] that is a scurvy model animal.

[22] A congenital metabolic disease model animal consisting of the chimeric non-human animals described in

[15] . [22-2] A chimeric non-human animal described in

[15] that is a congenital metabolic disease model animal.

[23] A model animal having humanized lipid transport control function consisting of the chimeric non-human animals described in

[16] . [23-2] A chimeric non-human animal described in

[16] that has humanized lipid transport control function.

[24] A chimeric non-human animal described in [1] in which human hepatocytes are derived from hepatocytes of a patient with familial hypercholesterolemia.

[25] A chimeric non-human animal described in

[23] in which the gene derived from a non-human animal is the LDL receptor (LDLR) gene.

[26] A model animal of familial hypercholesterolemia consisting of the chimeric non-human animals described in

[25] . [26-2] A chimeric non-human animal described in

[25] that is a model animal of familial hypercholesterolemia.

[27] A method for producing a chimeric non-human animal in which the expression of non-human animal-derived genes is suppressed, comprising the step of introducing nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver of a non-human animal in which a portion of the liver has been replaced with human hepatocytes. [27-2] The method according to

[27] , wherein the expression of non-human animal-derived genes remaining in the liver is suppressed by at least 1% compared to a control chimeric non-human animal. [27-3] The method according to

[27] , wherein the expression of non-human animal-derived genes is suppressed by at least 78% compared to a control wild-type non-human animal.

[28] The method according to

[27] , wherein the suppression of expression utilizes RNAi, siRNA, mRNA, antisense oligonucleotides, or plasmids.

[29] The method according to

[27] , wherein the introduction of nucleic acids uses lipid nanoparticles, transfection reagents, or recombinant viruses.

[30] The method according to

[27] , wherein the introduction of nucleic acids uses lipid nanoparticles.

[31] A kit for creating a chimeric non-human animal in which the expression of non-human animal-derived genes is suppressed, comprising the following combination of (a) or (b).(a) A combination of a non-human animal in which part of its liver has been replaced with human hepatocytes and lipid nanoparticles containing nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver. (b) A combination of a non-human animal in which part of its liver has been replaced with human hepatocytes, nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver, and lipid nanoparticles. [31-2] A recombinant virus containing nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver of a chimeric non-human animal in which part of its liver has been replaced with human hepatocytes. [31-3] A transfection reagent containing nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver of a chimeric non-human animal in which part of its liver has been replaced with human hepatocytes.

[32] A method for detecting human metabolites, comprising the step of administering a test substance to an experimental animal as described in

[19] or a chimeric non-human animal as described in [19-2], and then measuring human metabolites derived from the test substance from a biological sample taken from the experimental animal after administration.

[33] A screening method for a drug to treat hyperuricemia, comprising the step of contacting a model animal described in

[20] or a chimeric non-human animal described in [20-2], or a sample taken from said animal, with a candidate substance, and selecting the candidate substance as a drug to treat hyperuricemia using the results obtained as an indicator.

[34] A screening method for a drug to treat scurvy, comprising the step of contacting a model animal described in

[21] or a chimeric non-human animal described in [21-2], or a sample taken from said animal, with a candidate substance, and selecting the candidate substance as a drug to treat scurvy using the results obtained as an indicator.

[35] A screening method for a drug to treat a congenital metabolic disorder, comprising the step of contacting a model animal described in

[22] or a chimeric non-human animal described in [22-2], or a sample taken from said animal, with a candidate substance, and selecting the candidate substance as a drug to treat a congenital metabolic disorder using the results obtained as an indicator.

[36] The screening method according to

[35] , wherein the congenital metabolic disorder is OTC deficiency and / or citrulline 1 deficiency.

[37] A screening method for a familial hypercholesterolemia treatment, comprising the step of contacting a model animal described in

[26] or a chimeric non-human animal described in [26-2] or a sample taken from said animal with a candidate substance, and selecting the candidate substance as a familial hypercholesterolemia treatment using the results obtained as an indicator.

[38] A screening method for said substance, comprising the step of administering the candidate substance to a chimeric non-human animal described in [1] or a sample taken from said animal, and selecting the candidate substance as a substance that affects human liver function using the results obtained as an indicator.

[39] A screening method according to any one of

[33] to

[38] , wherein at least one selected from the group consisting of human albumin concentration, body weight curve, liver weight-to-body weight ratio, total albumin value, total protein value, ALT value, AST value, and total bilirubin value is used as an indicator.

[0010] This disclosure provides a chimeric non-human animal in which a portion of the liver is replaced with human hepatocytes, and in which the expression of residual non-human animal-derived genes in the liver is suppressed. The chimeric non-human animal in this disclosure can be used as an experimental model animal that is unaffected by residual non-human animal-derived genes.

[0011] This figure shows the results of ELISA-based detection of human TTR and mouse TTR in the plasma of animals administered si-TTR. This figure shows the results of RT-qPCR using liver tissue from animals administered si-TTR. This figure shows the results of ELISA-based detection of human TTR and mouse TTR in the plasma of animals administered si-TTR. This figure shows the results of RT-qPCR using liver tissue from animals administered si-TTR. This figure shows the results of RT-qPCR using liver tissue from animals administered si-mOtc. This figure shows the results of RT-qPCR using liver tissue from animals administered si-mPor. This figure shows the results of detection of metabolic activity of microsomes for Warfarin extracted from animals administered si-mPor. This figure shows the results of detection of Warfarin and metabolites in the blood after Warfarin administration to animals administered si-mPor. This figure shows the results of an AAV-shRNA administration test against ornithine transcarbamylase (OTC). This figure shows the effect of siRNA on transthyretin (TTR).

[0012] This disclosure relates, in one aspect, to a chimeric non-human animal in which a portion of the liver is replaced with human hepatocytes, and in which the expression of non-human animal-derived genes remaining in the liver is suppressed, and to a method for producing such a chimeric non-human animal.

[0013] 1. Overview As described above, in chimeric non-human animals (e.g., mice) in which a portion of the liver is replaced with human hepatocytes, hepatocytes derived from the host non-human animal remain. Because these remaining non-human animal-derived cells contain the same genes as human genes, competition occurs between the products of both genes, making it difficult to accurately analyze human genes. Furthermore, the presence of genes unique to non-human animals can lead to the production of normal non-human animal-derived proteins that are not found in humans, resulting in cases where disease-specific pathological conditions are not reproduced.

[0014] Therefore, in this disclosure, the above problem is solved by suppressing the expression of such remaining non-human animal-derived genes. "Suppressing gene expression" means that the expression is reduced or eliminated compared to the gene expression of wild-type non-human animals, and includes both disrupting or knocking out genes present in the liver of non-human animals, and reducing gene expression (knockdown). In this disclosure, knockout and knockdown are collectively referred to as "suppressing".

[0015] 2. Production of Chimeric Non-Human Animals in this Disclosure Chimeric non-human animals in this disclosure can be produced by suppressing the expression of genes in non-human animals. Specifically, a method for producing a chimeric non-human animal in which the expression of non-human animal-derived genes is suppressed includes the step of introducing nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver of a non-human animal in which a portion of the liver has been replaced with human hepatocytes.

[0016] (1) Animals subject to gene expression suppression In this disclosure, the animals subject to gene expression suppression are, in one embodiment, non-human animals in which a part of the liver has been replaced with human hepatocytes, i.e., human hepatocyte chimeric non-human animals. The "non-human animals" are preferably mammals, and include rodents (mice, rats, guinea pigs, squirrels, hamsters, etc.), domestic animals (cattle, horses, sheep, goats, pigs, etc.), companion animals (dogs, cats, etc.), monkeys, etc., but rodents are more preferred. As for rodents, mice or rats, which are commonly used as experimental animals, are preferred. Human hepatocyte chimeric non-human animals can be obtained by transplanting human hepatocytes into liver-damaged, immunodeficient non-human animals in accordance with known methods (for example, Japanese Patent Application Publication No. 2002-45087).

[0017] Typically, hepatic-damaged immunodeficient non-human animals can be created by inducing hepatic damage in genetically immunodeficient non-human animals, or by inducing immunodeficiency in animals that already have hepatic damage. Examples of genetically immunodeficient animals include SCID mice, NUDE mice, RAG2 knockout mice, NOD mice, NOG mice, etc. Examples of animals that already have hepatic damage include transgenic animals into which hepatic-damage-inducing protein genes (such as urokinase-type plasminogen activator (uPA) gene, tissue plasminogen activator (tPA) gene, thymidine kinase (TK) gene, etc.) linked under the control of enhancers and / or promoters of proteins specifically expressed in hepatocytes have been introduced, or animals in which fumarylacetoacetate hydrolase (FAH) has been knocked out.

[0018] In this disclosure, the "human hepatocytes" transplanted into non-human animals with hepatic damage or immunodeficiency may be any hepatocytes of human origin. For example, human hepatocytes isolated from human liver tissue using conventional methods such as collagenase perfusion can be used. The human liver tissue may be derived from a healthy individual or from a patient suffering from liver disease. The recovered human hepatocytes can be used as is, but they may also be purified using a monoclonal antibody that specifically recognizes human hepatocytes or hepatocytes from non-human animals. Furthermore, in this disclosure, hepatocytes that have been reprogrammed by gene editing, such as human iPS cells, and then differentiated can also be used. As reprogrammed cells, it is also possible to use chemically induced liver progenitor-like cells (CliPs) reprogrammed from hepatocytes using a cocktail of small molecule compounds such as ROCK inhibitors (e.g., Y-27632), TGFβ inhibitors (e.g., A83-01), and GSK3 inhibitors (e.g., CHIR99021). In addition, hepatocyte-derived organoids can also be used for transplantation.

[0019] Transplantation of human hepatocytes into non-human animals with hepatic damage and immunodeficiency is performed either by transplanting them into the liver via the spleen of the non-human animal, or directly via the portal vein. Non-human animals obtained by the above method are animals in which a portion of the liver has been replaced with human hepatocytes. "A portion of the liver" means, for example, that the replacement rate is less than 100%, and is 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more (for example, 30% or more but less than 100%). A commercially available product ("PXB mouse," PhoenixBio Co., Ltd.) can also be used as a mouse in which at least 70% of the liver has been replaced with human hepatocytes.

[0020] (2) Nucleic acids for suppressing gene expression For suppressing gene expression (knockdown), for example, RNA interference (RNAi), mRNA, antisense oligonucleotides, and plasmids can be used, but are not limited to these.

[0021] RNAi (RNAi) is a phenomenon in which dsRNA (double-strand RNA) specifically and selectively binds to a target gene and efficiently inhibits its expression by cleaving the target gene. In RNAi, two types of small RNAs, siRNA (small interfering RNA) and miRNA (microRNA), play a central role. For example, RNAi can be induced by designing and synthesizing siRNA for each gene, incorporating it into a vector, or supporting it on a non-viral carrier and introducing it into a non-human animal. Furthermore, this invention also allows the use of shRNA to produce the RNAi effect. shRNA, also known as short hairpin RNA, is an RNA molecule that has a stem-loop structure in which a portion of the single-stranded RNA forms a complementary strand with other regions. This RNA molecule with a stem-loop structure is processed by Dicer and other molecules in the body to produce siRNA.

[0022] mRNA (messenger RNA) is RNA that codes for protein sequence information, transcribed from genes (DNA) by RNA polymerase. In eukaryotes, mRNA is transcribed in the nucleus and then undergoes RNA processing such as RNA cap formation, polyadenylation, and splicing. After processing, the mRNA becomes mature mRNA, is transported out of the nucleus, and translated into protein. mRNA contains elements such as the ORF (Open Reading Frame) which codes for the amino acid sequence of the protein, as well as the 5' Cap, 5'-UTR (5'-Untranslated region), 3'-UTR (3'-Untranslated region), and polyA, each of which affects translation efficiency, stability, and immunogenicity when introduced into cells.

[0023] Antisense oligonucleotides (ASOs) are single-stranded DNA or RNA sequences having a sequence complementary to a target sequence. They bind to the target sequence to be repressed, forming a double helix and suppressing expression such as transcription or translation into proteins. ASOs can be modified with various chemical modifications to enhance stability and function. The length of the ASO sequence is at least 8 nucleotides, and in one aspect of the present invention, for example, it may be 8-100 nucleotides, 8-50 nucleotides, 8-30 nucleotides, or 8-20 nucleotides.

[0024] siRNA, dsRNA, and shRHA can be designed using known methods. When introducing mRNA, gene expression can be suppressed by expressing genome editing proteins such as CRISPR / Cas, TALEN, or Zinc finger. That is, mRNA encoding CRISPR / Cas, TALEN, or Zinc finger is introduced into cells containing the gene whose expression is to be suppressed.

[0025] Plasmids are extrachromosomal DNA molecules within cells that are physically separated from chromosomal DNA and can replicate independently. Generally, they are small, circular, double-stranded DNA molecules widely found in the cytoplasm of bacteria and archaea. Artificially produced plasmids are widely used in the field of genetic engineering as vectors for molecular cloning, and are used to perform genetic recombination in host organisms or to promote the replication of recombinant DNA sequences. In this invention, plasmids can also be used to repress gene expression. In the case of plasmids, their construction can induce RNA expression, leading to repression by RNAi or genome editing protein expression. That is, a plasmid ligated with a nucleic acid that induces RNAi, or a nucleic acid encoding a genome editing protein, is introduced into cells containing the gene to be repressed.

[0026] The efficiency of suppressing gene expression by a knocked-down gene means that, compared to the steady-state expression level of the wild-type gene, the gene expression of a chimeric non-human animal to which the suppressor nucleic acid has been introduced is reduced by 5% to 99% compared to a control chimeric non-human animal to which the suppressor nucleic acid has not been introduced. For example, the expression level of the knocked-down gene is 5% or more, and is reduced to 99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% or less. The suppression period is two, three, or four weeks, but the suppression period can be extended by repeated introduction. In one embodiment of this disclosure, the efficiency of suppressing gene expression in non-human animal hepatocytes in the liver is 78–88% (e.g., 78%).

[0027] Here, the efficiency of suppressing the expression of the aforementioned gene can be calculated in two ways: using a wild-type non-human animal as a control and using a chimeric non-human animal. If we consider the substitution rate in the chimeric non-human animal to be N% (where N is 30 or more and less than 100, for example, N represents 30 to 99), then the percentage of the remaining gene is (100 - N)%. If N is 99% or less, the expression of the remaining non-human animal in the liver only needs to be suppressed by at least 1% of the remaining gene. For example, if N is 70%, then the percentage of the remaining gene is 30%, so it is sufficient for at least 1% of that 30% to be suppressed.

[0028] In another embodiment, by considering the substitution rate (N%) as the suppression rate, it is possible to compare it with a wild-type non-human animal that is not a chimera. For example, if the substitution rate N in the chimeric non-human animal is 77%, the percentage of remaining genes is 100 - 77 = 23%. As mentioned above, it is sufficient for at least 1% of the remaining genes to be suppressed, so the sum of this 1% and the substitution rate of 77% considered as the suppression rate (1 + 77 = 78%) can be calculated as the suppression rate for a wild-type (non-chimeric) non-human animal. Therefore, in one embodiment of this disclosure, it is possible to provide a chimeric non-human animal in which the expression of human-derived genes is suppressed by at least 78% compared to a control wild-type non-human animal. The above 78% varies depending on the substitution rate and the suppression rate of the remaining genes in the non-human chimeric animal. A person skilled in the art can easily derive the sum of the substitution rate N% and the suppression rate of the remaining genes as the suppression rate for a wild-type non-human animal.

[0029] Furthermore, in this disclosure, gene editing technology using CRISPR / Cas can be used as a method for suppressing gene expression. Gene editing technology using CRISPR / Cas is well known, and there are methods such as introducing Cas mRNA and gRNA, or introducing Plasmid which contains both. Commercial product Guide-it TM The CRISPR / Cas System (Red) (Takara, Z2602N) can also be used. In the above genome editing knockout, gene expression throughout the liver is usually permanently suppressed.

[0030] In gene editing technology using CRISPR / Cas, genome editing is performed on somatic cells in liver tissue, so the efficiency of gene expression suppression depends on the genome editing efficiency of individual cells. In other words, for example, if 50% of non-human animal hepatocytes in the liver are knocked out by genome editing, the gene expression suppression efficiency will be 50%. Gene expression suppression efficiency means that, compared to the steady-state expression level of a wild-type gene, the gene expression of a chimeric non-human animal into which a repressor nucleic acid has been introduced is reduced to less than 0% to less than 99% compared to a control chimeric non-human animal into which the repressor nucleic acid has not been introduced. For example, it means that the expression level of a knocked-down gene is 5% or more, and is reduced to 99% or less, 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less.

[0031] (3) Genes to be Repressed In this disclosure, the genes to be repressed are not particularly limited as long as they are non-human animal-derived genes that remain in the liver of chimeric non-human animals. Examples of such genes include metabolic enzyme genes, receptor genes, transporter genes, and plasma protein genes.

[0032] Metabolic enzyme genes include genes related to phase I drug metabolizing enzymes and phase II drug metabolizing enzymes and their associated enzymes, urea and uric acid metabolizing enzymes, and vitamin C synthesis-related genes. These include cytochrome p450 (CYP), cytochrome p450 oxidoreductase (mPOR), glucuronosuccinate transferase (UGT), uricase, ornithine transcarbamylase (OTC), argininosuccinate synthase 1 (ASS1), and L-gulonolactone oxidase (GLO).

[0033] Receptor genes include nuclear receptors and LDL receptor genes, such as the constitutive androstan receptor (CAR) gene, pregnen X receptor (PXR) gene, aromatic hydrocarbon receptor (AhR) gene, LDL receptor (LDLR), VLDL receptor (VLDLR), apoE receptor (apoER2), and LRP-1.

[0034] Transporter genes include genes for ATP-binding cassette transporters and solute carrier transporters, such as OATP1B1, OCT1, OAT2, ABCC1, and ABCB11. Plasma protein genes include genes for blood coagulation factors and transporter proteins, such as fibrinogen, factor VIII, albumin (ALB), transthyretin (TTR), and transferrin.

[0035] In a preferred embodiment of the present invention, among the above genes, examples include the cytochrome P450 oxidoreductase (mPOR) gene, glucuronosyltransferase (UGT) gene, constitutive androstan receptor (CAR) gene, pregnene X receptor (PXR) gene, aromatic hydrocarbon receptor (AhR) gene, uricase gene, L-gulonolactone oxidase (GLO) gene, ornithine transcarbamylase (OTC) gene, arginosuccinate synthase 1 (ASS1) gene, LDL receptor (LDLR) gene, and transthyretin (TTR) gene, and one or more of these genes can be suppressed.

[0036] In RNAi-mediated knockdown, the target sequence is approximately 21-25 bases long and may be located in the 5'UTR, coding region, or 3'UTR of the target gene. The siRNA sequence should preferably satisfy one or more of the following conditions: (1) the 5' end of the antisense strand of the siRNA is A or U, (2) the 5' end of the sense strand is G or C, or (3) at least four of the seven bases at the 5' end of the antisense strand are A or U.

[0037] In CRISPR / Cas gene editing technology, the nuclease Cas cleaves the sequence-specific recognition site of gRNA, causing a mutation in the genome and resulting in gene knockout. While any location on the gene that gRNA can recognize can be targeted, it is usually most efficient to induce a mutation in an exon as high up in the coding region as possible to suppress the function of the target gene.

[0038] In one embodiment of the present invention, suppressing (e.g., knocking down) mPOR (mCYP) allows for the detection of metabolites, such as human-specific metabolites. Accordingly, this disclosure provides experimental animals for metabolite detection. Furthermore, suppressing mUrikcase allows for the creation of a hyperuricemia model by feeding the animals a purine-containing diet.

[0039] Suppressing mGLO (L-gulonolactone oxidase) can induce vitamin C deficiency when fed a vitamin C-deficient diet, creating a model animal for scurvy. Furthermore, suppressing target congenital metabolic disease genes (e.g., mOTC, mASS1) in hepatocytes of non-human animals transplanted with hepatocytes from patients with congenital metabolic diseases can create models for OTC deficiency and citrulline 1 deficiency.

[0040] Suppressing mLDLR can create a more humanized animal model in which lipid transport is regulated via lipoprotein recognition. Furthermore, suppressing mLDLR in hepatocytes of non-human animals transplanted with hepatocytes from patients with familial hypercholesterolemia, a congenital metabolic disorder caused by LDLR deficiency, can create a model of familial hypercholesterolemia.

[0041] Therefore, it is possible to screen for familial hypercholesterolemia treatments by contacting candidate substances with animal models of familial hypercholesterolemia created in this way, or with samples taken from such animals, and selecting candidate substances as therapeutic agents for familial hypercholesterolemia based on the results obtained.

[0042] Furthermore, in this disclosure, by suppressing mLDLR, it is possible to suppress the uptake of LNPs, which are nucleic acid delivery systems that normally undergo uptake via LDLR, into non-human animal hepatocytes, thereby enabling more efficient introduction of nucleic acids into human hepatocytes.

[0043] Therefore, in the present disclosure, non-human animals with suppressed mLDLR are provided for the purpose of LNP uptake into human hepatocytes. The non-human animals can be obtained by suppressing mLDLR in the hepatocytes of non-human animals.

[0044] On the other hand, si-TTR is known as a nucleic acid for treating diseases (e.g., familial amyloidosis) in which abnormal proteins accumulate due to mutations in TTR. In this case, since hTTR does not become a disease model by suppression, it serves as a model for determining the efficacy of nucleic acid medicine in that the effect of si-RNA can be evaluated by measuring the TTR concentration in serum and gene and protein expression in the liver. When the TTR concentration in serum reaches 50%, or when the gene and protein expression in the liver is 50%, it can be determined that the effect of si-RNA has been exerted.

[0045] In the present disclosure, when knockdown is performed to suppress gene expression, it becomes possible to perform knockdown for a limited period (e.g., only during the test period) after creating chimeric non-human animals. Furthermore, human disease model animals can be created by suppressing the genes of humans and non-human animals.

[0046] 2. Gene introduction method (1) Lipid nanoparticles (LNP) Lipid nanoparticles (LNP) are nanoparticles with a diameter of about 10 nm to 1000 nm mainly composed of lipids. LNP is composed of ionizable lipids, PEGylated lipids, cholesterol, and neutral phospholipids, and is used for the delivery of nucleic acid drugs as a non-viral drug delivery system (DDS).

[0047] To produce LNP containing RNA, the lipids in ethanol and the RNA in a low pH buffer may be mixed with a microfluidic mixer. The ionizable lipid is protonated and encapsulated when it binds to RNA. By gradually raising the pH to a neutral level and removing ethanol, LNP is formed. LNP can also be a commercially available product, such as Invivofectamine 3.0 Reagent (Thermo Fisher) or COATSOME SS-OP (NOF).

[0048] (2) Transfection In this disclosure, in chimeric non-human animals in which a portion of the liver has been replaced with human hepatocytes, nucleic acids that suppress the expression of non-human animal-derived genes remaining in the liver may be included in the transfection reagent. Transfection is a process of artificially introducing nucleic acids (DNA or RNA) into cells by means other than viral infection, and the technique is well known (see, for example, Sambrook J. et al., Molecular Cloning, A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press (2012)). Transfection reagents are also available commercially (Invivofectamine 3.0 Reagent (Thermo Fisher Scientific, IVF3001)).

[0049] (3) Recombinant Viruses Furthermore, the present disclosure provides recombinant viruses containing nucleic acids that suppress the expression of non-human animal-derived genes remaining in the liver of a chimeric non-human animal in which a portion of the liver has been replaced with human hepatocytes. For transfection with recombinant viruses, viral delivery systems such as lentiviruses, adenoviruses, adeno-associated viruses, retroviruses, and herpesviruses can be used.

[0050] Recombinant viruses are created by simultaneously introducing genes expressing RNAi mechanisms or genome editing systems, along with genes necessary for viral particle formation, into cultured cells. Viral reagents are also commercially available (e.g., those manufactured by Takara Bio). Alternatively, custom vector construction services can be used.

[0051] 3. Kits In one aspect, the present invention provides a kit for creating chimeric non-human animals in which the expression of non-human animal-derived genes is suppressed. In this disclosure, for example, kits consisting of the following combinations of (a) or (b) are provided: (a) A combination of a non-human animal in which a portion of the liver has been replaced with human hepatocytes and lipid nanoparticles containing nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver. (b) A combination of a non-human animal in which a portion of the liver has been replaced with human hepatocytes, nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver, and lipid nanoparticles.

[0052] In the combination described in (b) above, the lipid nanoparticles are used to encapsulate nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver.

[0053] (c) The present disclosure also provides a kit of a combination of a chimeric non-human animal in which a portion of the liver has been replaced with human hepatocytes, and a recombinant virus containing nucleic acid that suppresses the expression of non-human animal-derived genes remaining in the liver. (d) The present disclosure also provides a kit of a combination of a transfection reagent containing nucleic acid that suppresses the expression of non-human animal-derived genes remaining in the liver of a chimeric non-human animal in which a portion of the liver has been replaced with human hepatocytes, and the chimeric non-human animal.

[0054] In this disclosure, the kit includes a combination of (a) or (b) above, or a combination of (c) or (b) above, but may also include labeling substances, inhibitory detection reagents (e.g., immunohistochemical reagents such as STEM121), etc. Labeling substances mean enzymes, radioisotopes, fluorescent compounds, and chemiluminescent compounds, etc. In addition to the above components, the kit of the present invention may include other reagents for carrying out the method of the present invention, for example, if the labeling is enzyme-labeled, enzyme substrate (chromogenic substrate, etc.), enzyme substrate lysis solution, enzyme reaction stop solution, etc. Furthermore, in this disclosure, the kit may also include a diluent for the test compound, various buffers, sterile water, various cell culture vessels, various reaction vessels (Eppendorf tubes, etc.), washing agents, experimental operation manuals (instructions), etc.

[0055] Furthermore, in this disclosure, the reagents and recombinant viruses include a recombinant virus containing nucleic acid that suppresses the expression of non-human animal-derived genes remaining in the liver of a chimeric non-human animal in which a portion of the liver has been replaced with human hepatocytes, or a transfection reagent containing said nucleic acid (not necessarily limited to combination with the aforementioned chimeric non-human animal). In addition to the recombinant virus or transfection reagent, a kit can also be provided that combines the above-mentioned labeling substance, suppression detection reagent, etc.

[0056] 4. Screening Method and Detection Method This disclosure provides, in one aspect, a screening method for a substance, comprising the step of contacting a candidate substance with a chimeric non-human animal or cells or tissues taken from such animal, and selecting the candidate substance as a substance that affects human liver function based on the results obtained. This disclosure also provides, in one aspect, a screening method for a drug that treats hyperuricemia, comprising the step of contacting a candidate substance with the aforementioned animal model of hyperuricemia or a chimeric non-human animal, or cells or tissues taken from such animal, and selecting the candidate substance as a drug that treats hyperuricemia based on the results obtained.

[0057] Furthermore, the Disclosure provides, in one aspect, a screening method for scurvy treatments, comprising the step of contacting a candidate substance with a non-human animal model of scurvy or a chimeric non-human animal, or cells or tissues taken from such an animal, and selecting the candidate substance as a scurvy treatment using the results obtained as an indicator. Furthermore, the Disclosure provides, in one aspect, a screening method for congenital metabolic disease treatments, comprising the step of contacting a candidate substance with a model animal of a target congenital metabolic disease gene suppression or a chimeric non-human animal, or cells or tissues taken from such an animal, and selecting the candidate substance as a congenital metabolic disease treatment using the results obtained as an indicator.

[0058] Examples of congenital metabolic disorders include OTC deficiency and / or citrulline 1 deficiency. Furthermore, in one embodiment, this disclosure allows for the detection of human-derived metabolites, such as drug candidates, by suppressing drug-metabolizing enzyme genes such as mPOR. Drug candidates are metabolized into highly water-soluble substances by oxidation-reduction reactions by CYP in the liver. Since CYP activity differs among animal species, in previous human hepatocyte chimeric mice, residual metabolites derived from mouse hepatocytes have also been detected. This disclosure provides a method for detecting human metabolites, which includes the step of administering a test substance such as a drug candidate to the aforementioned animal model, collecting plasma over time, and measuring the metabolite concentration in the plasma using LC-MS or chromatography to measure human metabolites metabolized by CYP in human hepatocytes.

[0059] In this specification, the above-mentioned effects on liver function, hyperuricemia, scurvy, and congenital metabolic disorders are collectively referred to as "pathological conditions." "Contact" means placing the chimeric non-human animal or cells or tissues collected from such animal and the candidate substance (test substance) in the same environment, reaction system, or culture system. This includes, for example, adding the candidate substance to a culture vessel of cells or tissues collected from a chimeric non-human animal, mixing cells or tissues with the candidate substance, culturing cells or tissues in the presence of the candidate substance, or administering the candidate substance to the chimeric non-human animal of the present invention.

[0060] Candidate substances include, for example, nucleic acids, peptides, proteins (including antibodies), non-peptide compounds, synthetic compounds (high or low molecular weight compounds), fermentation products, cell extracts, cell culture supernatants, plant extracts, tissue extracts from mammals (e.g., mice, rats, pigs, cattle, sheep, monkeys, humans, etc.), and plasma. These compounds may be novel or known. These candidate substances may form salts, and the salts of candidate substances may be salts with physiologically acceptable acids (e.g., inorganic acids or organic acids) or bases (e.g., metallic acids). If results are obtained showing that administering a candidate substance improves the disease state, the candidate substance used can be selected as a substance that affects liver function or as a therapeutic agent for the disease state.

[0061] Indicators for the above confirmation include human albumin concentration, body weight curve, liver weight-to-body weight ratio, total albumin value, total protein value, ALT value, AST value, and total bilirubin value, which can be used individually or in appropriate combinations. For example, candidate drug substances can be screened by contacting a model non-human animal in this disclosure with a candidate drug substance, measuring indicators that correlate with the pathological condition in the model non-human animal in this disclosure that has been contacted with the candidate substance, comparing these indicators with indicators that correlate with the pathological condition in a control, and confirming the pharmacological effect based on the results of this comparison.

[0062] Methods for contacting model non-human animals or chimeric non-human animals with candidate substances in this disclosure include, for example, oral administration, intravenous injection, topical application, subcutaneous administration, intradermal administration, and intraperitoneal administration, which can be appropriately selected according to the symptoms of the test animals and the properties of the candidate substance. The dosage of the candidate substance can also be appropriately selected according to the administration method and the properties of the candidate substance.

[0063] A control for comparison means any of the following: a wild-type non-human animal or a chimeric non-human animal without gene suppression that has not been exposed to the test substance; a wild-type non-human animal or a chimeric non-human animal without gene suppression that has been exposed to the test substance; a wild-type non-human animal or a chimeric non-human animal exposed to a substance known to have a therapeutic effect on a disease (a known therapeutic agent); a disease-onset model non-human animal or a chimeric non-human animal in this disclosure that has not been exposed to the test substance; or a disease-onset model non-human animal or a chimeric non-human animal of the present invention that has been exposed to a known therapeutic agent. At least one control can be appropriately selected depending on the purpose.

[0064] "Wild-type non-human animal" means a non-human animal in which genes are normally expressed and functioning. For example, if the control is a disease-developing model non-human animal or a chimeric non-human animal that is not exposed to the test substance, an index that correlates with the disease state of the model non-human animal or chimeric non-human animal exposed to the candidate substance can be measured, and if the measured index is improved compared to the index in the control, the candidate substance can be selected as a candidate substance for a therapeutic agent for the disease state. In this case, "improvement" means that the behavior or symptoms related to the disease state in the model non-human animal in this disclosure are improved compared to the control (e.g., an improvement of 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, or 30% or more).

[0065] Alternatively, if the control is a wild-type non-human animal not exposed to the test substance, an index correlated with the pathological condition of a model non-human animal or chimeric non-human animal exposed to the candidate substance may be measured. If the measured index improves to the same level as or better than the index in the control, the candidate substance may be selected as a candidate substance for the treatment of the condition. In this case, "improvement" means that the behavior or symptoms of the model non-human animal or chimeric non-human animal are at the same level as or further improved compared to the control (for example, an improvement of 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, or 30% or more).

[0066]

[0067] An embodiment of the present invention will be described in more detail below with reference to examples. However, the scope of the present invention is not limited to these examples. [Example 1] Administration test of siRNA against Transthyretin (TTR) (1) Materials and methods Male cDNA-uPA+ / - / SCID (uPA+ / wt: B6;129SvEv-Plau, SCID: CB-17 / Icr-scid / scid Jcl) animals were used to prepare HLCM, and human hepatocytes HUM181001B (Lonza Walkersville, Inc., Walkersville, MD, USA) were used for transplantation. The expected replacement rate at the time of the experiment was 77% or more, and the age was 22 weeks.

[0068] Mouse TTR siRNA (double-stranded ID: siTTR(Mm)) Sense strand: U(M)GCUCUAUAAACCGUG(M)U(M)UAGC (Sequence ID 1) Antisense strand: UAACACG(M)GUUUAU(M)AGAG(M)CAAG (Sequence ID 2) N(M) = 2'-OMe RNA. Synthesized and annealed by Gene Design Inc. was used.

[0069] Human TTR siRNA (double-stranded ID: siTTR(Hs)) Sense strand: GU(M)AAC(M)C(M)AAGAGU(M)AU(M)U(M)C(M)C(M)AU(M)tt (Sequence ID 3) Antisense strand: AUGGAAU(M)ACUCUUGGUU(M)ACtt (Sequence ID 4) N(M) = 2'-OMe RNA. Lower Case = DNA. Synthesized and annealed by Gene Design Co., Ltd.

[0070] Preparation of Composition Each siRNA was dissolved in 10 mM sodium citrate buffer (pH 4.0) to prepare an siRNA solution. Cationic lipids D-Lin-MC3-DMA, DSPC, Cholesterol, and MPEG2000-DMG (NOF, SUNBRIGHT GM-020) were dissolved in ethanol in a molar ratio of approximately 50 / 10 / 38.5 / 1.5 to prepare a lipid ethanol solution. The siRNA solution and lipid ethanol solution were mixed at a flow rate of 3:1 to obtain a nucleic acid lipid complex solution, with the RNA / total lipid ratio of the final formulation being approximately 0.08 by weight. This was then replaced with neutral phosphate buffer (PBS) using a dialysis membrane (100 kDa). Subsequently, the solution was filtered and sterilized to obtain the LNP composition. Except for those used immediately, these were stored at 4°C until use. The average particle size and polydispersity index were measured by dynamic light scattering using a Zeta Sizer (Malvern Panalytical, Worcestershire, UK). siRNA concentration was measured using the Quant-iT RiboGreen RNA assay kit (Thermo Fisher Scientific, Waltham, MA). Encapsulation efficiency (EE, %) was calculated using the following formula: EE(%) = [(1 - free siRNA concentration) / (total siRNA concentration)] × 100. The physical properties of LNPs with siRNA encapsulation are shown in Table 1.

[0071]

[0072] In the administration experiment, physiological saline or prepared LNP was administered intravenously via the tail vein to HLCMs (n=3 per group) at doses of 0.01–3 mg / kg siRNA. Blood samples were collected before administration and 1, 3, and 7 days after administration, and plasma was used for ELISA analysis. Liver tissue was also collected 7 days later.

[0073] Human and mouse TTR concentrations in plasma were analyzed using the AssayMax Prealbumin ELISA Kit (Assaypro, St. Charles, MO, USA) and the Mouse Prealbumin ELISA (ALPCO, Salem, NH, USA), respectively.

[0074] cDNA was synthesized from hepatocyte lines using the qPCR Taqman Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific). For liver mRNA analysis, liver cells were collected, homogenized using TissueLyzser II (Qiagen), and total RNA was purified using the Maxwell RSC System (Promega). 100–500 ng of total RNA was used for reverse transcription using the PrimeScript RT Kit (TaKaRa). In RT-qPCR, each reaction mixture (total volume 10 μL) contained 0.5 μL of TaqMan probe, 5 μL of TaqMan Gene Expression Master Mix (Thermo Fisher Scientific), and cDNA.

[0075] The probes used in this embodiment are listed below: Human TTR: Hs00174914_m1 GAPDH: Hs99999905_m1 POR: Hs01016332_m1 Mouse Ttr: Mm00443267_m1 Gapdh: Mm99999915_g1 Por: Mm01208218_m1

[0076] All RT-qPCR reactions were performed using the ViiA7 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) and the QuantStudio7 Flex System (Thermo Fisher Scientific).

[0077] The reaction was incubated at 95°C for 10 minutes, followed by 45 cycles of 15 seconds at 95°C and 1 minute at 60°C. Quantified target gene expression levels were normalized to the expression levels of GAPDH or Gapdh in human and mouse genes, respectively.

[0078] (2) Results LNPs containing siTTR(Mm) were administered intravenously via the tail vein to HLCM at doses of 0.01, 0.1, and 1 mg / kg of siRNA. As a result, plasma mouse TTR was suppressed in a dose-dependent manner, and this effect lasted for one week (Figure 1). In addition, the expression of the mouse TTR gene in the liver was suppressed in a dose-dependent manner (Figure 2).

[0079] LNPs encapsulating siTTR(Hs) were administered intravenously via the tail vein to HLCM at doses of 1 and 3 mg / kg siRNA. As a result, plasma human TTR was suppressed in a dose-dependent manner, and this effect lasted for one week (Figure 3). Furthermore, the expression of the human TTR gene in the liver was suppressed in a dose-dependent manner (Figure 4).

[0080] [Example 2] Administration of siRNA to ornithine transcarbamylase (OTC) (1) Materials and methods Male cDNA-uPA+ / - / SCID animals (uPA+ / wt: B6;129SvEv-Plau, SCID: CB-17 / Icr-scid / scid Jcl) were used to prepare HLCM, and human hepatocytes HUM181001B (Lonza Walkersville, Inc., Walkersville, MD, USA) were used for transplantation. The expected replacement rate at the time of the experiment was 74-79%, and the age of the animals was 17-20 weeks.

[0081] Transfection, siRNA Invivofectamine 3.0 Reagent (Thermo Fisher Scientific, IVF3001) and mouse OTC-specific siRNA (Ambion, s71155) were mixed according to the product protocol. Negative control siRNA (Qiagen, 1022076) was used as the control.

[0082] In the administration experiment, the prepared siRNA solution was administered intravenously via the tail vein at a dose of 1 mg / kg siRNA. Liver tissue was collected 5 days after administration. For histological examination using immunohistochemistry, OCT-embedded frozen blocks were prepared from the obtained liver tissue, and immunohistochemistry was performed on 5 μm sections. For immunohistochemistry, human-specific anti-CK8 / 18 antibody (PROGEN, MAB1273) and mouse and human-reactive anti-OTC antibody (Genetex, GTX105140) were used as primary antibodies, and Goat anti-Rabbit Alexa488 and Donkey anti-mouse Alexa594 (Invitrogen A11034, A21203) were used as secondary antibodies, respectively. Nuclear staining was performed with Cellstain®-Hoechst 33258 solution (DOJINDO LABORATORIES, H341).

[0083] cDNA was synthesized from 1 μg of total RNA extracted from liver tissue using the qPCR Quick-RNA™ Microprep Kit (Zymo Research, Irvine, CA, USA) using qScript cDNA SuperMix (Quantabio, Beverly, MA). qPCR was performed using Applied Biosystems™ PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Foster City, CA, USA). The following sequences were used as primers.

[0084] Mouse OTC Forward: 5'- TGCTGCAAAATTCGGGATGC-3' (SEQ ID NO: 5) Reverse: 5'- ATACATTGCCTCCACGTGCT-3' (SEQ ID NO: 6) Human OTC Forward: 5'- CGGCCCGTGTATTGTCTAGC-3' (SEQ ID NO: 7) Reverse: 5'- TAGCCAGGGTGTCCAAATCTG-3' (SEQ ID NO: 8)

[0085] Mouse alb Forward: 5'- CTCCTTTAAGGAAAACCCAACCACC-3' (SEQ ID NO: 9) Reverse: 5'- ACAACACTGGGTCAGAATCTCATTG-3' (SEQ ID NO: 10) Human alb Forward: 5'- GGATGAAGGGAAGGCTTCGT-3' (SEQ ID NO: 11) Reverse: 5'- TGGGAAATCTCTGGCTCAGG-3' (SEQ ID NO: 12)

[0086] (2) Results: siRNA against ornithine transcarbamylase (OTC), which is expressed in hepatocytes and is responsible for ammonia metabolism, was designed specifically for mice. It was administered to HLCMs along with the commercially available in vivo transfection reagent, Invivofectamine™ 3.0, and liver tissue was collected after 5 days. Immunostaining revealed a decrease in OTC expression in the human CK8 / 18-negative mouse hepatocyte region. QPCR using human / mouse-specific primers confirmed a mouse OTC gene-specific decrease (Figure 5).

[0087] [Example 3] Administration of siRNA to P450 oxidoreductase (Por) (1) Materials and Methods Male cDNA-uPA+ / - / SCID (uPA+ / wt: B6;129SvEv-Plau, SCID: CB-17 / Icr-scid / scid Jcl) animals were used to prepare HLCM, and human hepatocytes HUM181001B (Lonza Walkersville, Inc., Walkersville, MD, USA) were used for transplantation. The expected replacement rate at the time of the experiment was 70-83%, and the age was 17-19 weeks. 7-8 week old SCID mice (Jackson Laboratory Japan) were used in the experiment.

[0088] Mouse POR siRNA (double-stranded ID: siPOR(Mm)) Sense strand: GGAC(M)AU(M)U(M)GU(M)U(M)C(M)U(M)GU(M)U(M)U(M)U(M)C(M)U(M)U(M)U(M) (Sequence ID 13) Antisense strand: AGAAAAC(M)AGAAC(M)AAUGUCCU(M)U(M) (Sequence ID 14) N(M) = 2'-OMe RNA. Synthesized and annealed by Gene Design Co., Ltd. was used.

[0089] Preparation of the composition: siPOR(Mm) was used as the siRNA. The LNPs were prepared in the same manner as described in Example 1. The physical properties of the siRNA-encapsulated LNPs are shown in Table 2.

[0090]

[0091] In the administration experiment, prepared LNPs were administered intravenously via the tail vein to HLCM (n=3 per group) or SCID mice (n=3 per group) at a dose of 1 mg / kg siRNA on days 0, 3, and 7. Liver tissue was collected on day 10.

[0092] For immunohistochemical examination, formalin-fixed paraffin-embedded blocks were prepared from the obtained liver tissue, and immunohistochemical staining was performed on 5 μm sections. For immunohistochemical staining, a POR antibody (ABclonal A5032) that reacts to human and mouse antigens and a mouse-specific ALDH1L1 antibody (Abcam, ab307696) were used as primary antibodies, and Envision anti mouse or Rabbit IgG (Dako, K4001, K4003) were used as secondary antibodies. After staining with DAB, counterstaining was performed with hematoxylin.

[0093] qPCR was performed in the same manner as described in Example 1.

[0094] In vitro metabolic studies were conducted using liver tissue samples, and liver microsomes were extracted by ultracentrifugation using methods similar to those known. Commercially available human liver microsomes (HLMs) (200 donor pool, Xenotech) and CD1 mouse liver microsomes (MLMs) (Xenotech) were used as controls. The reaction mixture consisted of 0.1 M phosphate buffer (pH 7.4) containing 10 μM S-Warfarin (Cayman, Ann Arbor, MI, USA), 0.5 mg / mL of each liver microsome, and 0.1 mM EDTA. The reaction mixture (n = 3) was pre-incubated at 37°C for 5 minutes, after which the metabolic reaction was initiated by adding an NADPH-producing system. The final concentrations were 0.33 mM β-NADP+, 8 mM glucose-6-phosphate, 0.1 units / mL glucose-6-phosphate dehydrogenase (Oriental Yeast), and 6 mM magnesium chloride. Subsequently, 20 μL of the reaction mixture was taken at 0, 15, 30, and 60 minutes and mixed with 200 μL of acetonitrile / methanol (7 / 3, v / v) containing 5 ng / mL of niflumic acid as an internal standard (IS). The samples were then centrifuged at 4°C for 10 minutes, and 1 μL of the resulting supernatant was injected into ultra-high-performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS) to determine the concentrations of S-warfarin (WF) and its metabolites (4'-Hydroxywarfarin (4'OH), 6-Hydroxywarfarin (6OH), and 7-Hydroxywarfarin (7OH)).

[0095] The metabolite formation rate was determined from the time profile of metabolite formation amount using simple linear regression analysis with GraphPad Prism 10.2.0 (GraphPad Software, San Diego, CA, USA). Using the determined metabolite formation rate, the intrinsic metabolic clearance (CLint) was calculated using Equation 2. Equation 2: CLint = (metabolite formation rate) / (substrate concentration)

[0096] (2) Results LNPs containing siPOR(Mm) were administered to HLCM mice or SCID mice. Immunostaining using antibodies that react to both human and mouse POR showed a decrease in POR expression in SCID and HLCM liver tissue only in the mouse region. qPCR using human / mouse specific primers showed mouse Por-specific gene expression repression (Figure 6). When the metabolic activity of Warfarin was examined using liver microsomes, the results from HLMs showed that metabolism to 7OH was dominant in humans, while the results from MLMs showed that metabolism to 4'OH was dominant in mice. Here, in SCID mice, metabolic activity (i.e., 4'OH) was significantly reduced by siRNA administration, and in HLCM mice, only mouse-specific metabolites were significantly reduced (Figure 7).

[0097] [Example 4] Warfarin administration test (1) Materials and methods Male cDNA-uPA+ / - / SCID (uPA+ / wt: B6;129SvEv-Plau, SCID: CB-17 / Icr-scid / scid Jcl) animals were used to prepare HLCM, and the transplanted human hepatocytes were HUM181001B (Lonza Walkersville, Inc., Walkersville, MD, USA). The expected replacement rate at the time of the experiment was 71-78%, and the age was 19 weeks. SCID mice (Jackson Laboratory Japan) were used in the experiment at 7-8 weeks of age.

[0098] The LNPs listed in Composition Preparation Table 2 were used.

[0099] In the administration experiment, prepared LNP was administered intravenously via the tail vein to HLCM (n=3 per group) or SCID mice (n=3 per group) at a dose of 1 mg / kg siRNA on days 0, 3, and 7. A control group received physiological saline in the same manner. On day 10, S-Warfarin was administered intravenously via the tail vein at a dose of 0.5 mg / kg. Blood samples were collected at 30 minutes, 1, 2, 4, 7, 24, and 48 hours, and the plasma was used for compound concentration measurement by LC-MS.

[0100] LC-MAS UPLC-MS / MS Analysis UPLC-MS / MS analysis was performed using the ACQUITY UPLC system in combination with XEVO TQ-XS (Waters, Milford, MA, USA). Chromatographic separation was performed using a YMC-Accura Triant C18 column (1.9 μm, 2.1 mm × 100 mm, YMC) at 40°C and a flow rate of 0.4 mL / min. Gradient elution was performed using mobile phases consisting of (A) water containing 0.02% formic acid and (B) acetonitrile containing 0.02% formic acid. Mobile phase B (%) was set to 20% for 0.5 minutes, linearly increased to 80% from 0.5 minutes to 12 minutes, and linearly increased to 95% from 12 minutes to 15 minutes. Subsequently, mobile phase B (%) was returned to 20% at 15.01 minutes and re-equilibrium was achieved by 17 minutes.

[0101] A multi-reaction monitoring mode employing positive ion detection via electrospray ionization was adopted.

[0102] (2) Results Warfarin (WF) was administered to animals that had received LNPs encapsulated in physiological saline or siPOR(Mm), and the concentrations of warfarin and its metabolites in plasma were measured over time (Figure 8). Plasma warfarin concentrations decreased over time in all groups. In SCID mice, the metabolic rate decreased in the siRNA-administered group compared to the physiological saline-administered group. 4'-Hydroxywarfarin (4'OH-WF), the major metabolite of mouse hepatocytes, was significantly reduced by siRNA administration in SCID mice and HLCM mice. 7-Hydroxywarfarin (7OH-WF), the major metabolite of human hepatocytes, was hardly detectable in SCID mice, but was detected in HLCM mice and increased by siRNA administration.

[0103] [Example 5] AAV-shRNA administration test against ornithine transcarbamylase (OTC) (1) Materials and methods Male cDNA-uPA+ / - / SCID animals (uPA+ / wt: B6;129SvEv-Plau, SCID: CB-17 / Icr-scid / scid Jcl) were used to prepare HLCM, and human hepatocytes HUM181001B (Lonza Walkersville, Inc., Walkersville, MD, USA) were used for transplantation. The expected replacement rate at the time of the experiment was 70-79%, and the age was 23-27 weeks.

[0104] The AAV-shRNAs pscAAV[shRNA]-EGFP-U6>mOtc[shRNA#4] and pscAAV[shRNA]-EGFPU6>Scramble_shRNA were produced by Vector Builder Inc. The target sequences for each are shown below.

[0105] Mouse otc GCCAGATCCTAATATAGTCAA (SEQ ID NO: 15) Scramble shRNA CCTAAGGTTAAGTCGCCCTCG (SEQ ID NO: 16)

[0106] In the administration experiment, the prepared AAV solution was intravenously administered via the tail vein at a dose of 5.0 GC x 10^11 / mouse. Liver tissue samples were collected 7 days after administration.

[0107] For immunohistochemical examination, FFPE blocks were prepared from the obtained liver tissue, and immunohistochemical staining was performed using serial sections of 5 μm thin sections. For immunohistochemical staining, human-specific anti-STEM121 (Takara Bio Inc., Y40410) and mouse and human-reactive anti-OTC antibody (Genetex, GTX105140) were used as primary antibodies, and Envision anti-mouse or Rabbit IgG (Dako Cat.#K4001, K4003) were used as secondary antibodies. After staining with DAB, counterstaining was performed with hematoxylin.

[0108] cDNA was synthesized from 1 μg of total RNA extracted from liver tissue using the qPCR Quick-RNA™ Microprep Kit (Zymo Research, Irvine, CA, USA) using qScript cDNA SuperMix (Quantabio, Beverly, MA). qPCR was performed using Applied Biosystems™ PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Foster City, XX CA, USA). The following sequences were used as primers.

[0109] Mouse OTC Forward: 5'- TGCTGCAAAATTCGGGATGC-3' (SEQ ID NO: 17) Reverse: 5'- ATACATTGCCTCCACGTGCT-3' (SEQ ID NO: 18) Human OTC Forward: 5'- CGGCCCGTGTATTGTCTAGC-3' (SEQ ID NO: 19) Reverse: 5'- TAGCCAGGGTGTCCAAATCTG-3' (SEQ ID NO: 20)

[0110] Mouse alb Forward: 5'- CTCCTTTAAGGAAAACCCAACCACC-3' (SEQ ID NO: 21) Reverse: 5'- ACAACACTGGGTCAGAATCTCATTG-3' (SEQ ID NO: 22) Human alb Forward: 5'- GGATGAAGGGAAGGCTTCGT-3' (SEQ ID NO: 23) Reverse: 5'- TGGGAAATCTCTGGCTCAGG-3' (SEQ ID NO: 24)

[0111] (2) Results AAV-shRNA targeting ornithine transcarbamylase (OTC), which is expressed in hepatocytes and is responsible for ammonia metabolism, was designed specifically for mice and inoculated, and liver tissue was collected 7 days later. Immunostaining revealed a decrease in OTC expression in the human STEM121-negative mouse hepatocyte region (Figure 9). Furthermore, qPCR using human / mouse specific primers confirmed mouse OTC gene-specific KD (Figure 9).

[0112] [Example 6] siRNA introduction using different LNPs (1) Materials and methods Male animals of the cDNA-uPA+ / - / SCID (uPA+ / wt: B6;129SvEv-Plau, SCID: CB-17 / Icr-scid / scid Jcl) were used to prepare HLCM, and human hepatocytes HUM181001B (Lonza Walkersville, Inc., Walkersville, MD, USA) were used for transplantation. The expected replacement rate at the time of the experiment was 88-95%, and the age was 25-27 weeks.

[0113] Preparation of Composition The siRNA used was siTTR(Mm). The preparation of LNPs was carried out in the same manner as in Example 1, except that the cationic lipid was changed. The cationic lipid used was bis(3-pentyloctyl)9-{[(1-methylpiperidine-4-carbonyl)oxy]methyl}heptadecanedioate (hereinafter, Lipid-A) or COATSOME SS-OP (NOF) (hereinafter, Lipid-B). The physical properties of the LNPs containing the siRNA are shown in Table 3.

[0114]

[0115] In the administration experiment, prepared LNP(Lipid-A) or LNP(Lipid-B) was administered intravenously via the tail vein to HLCMs (n=3 per group) at a dose of 1 mg / kg siRNA. Blood samples were collected before administration and 1, 3, and 7 days after administration, and the plasma was used for ELISA analysis.

[0116] Mouse TTR concentrations in plasma were analyzed using ELISA (ALPCO, Salem, NH, USA).

[0117] (2) Results LNPs were administered to HLCM mice. As a result, plasma mouse TTR was suppressed in all LNPs, and this effect lasted for one week (Figure 10).

Claims

1. A chimeric non-human animal in which a portion of the liver is replaced with human hepatocytes, wherein the expression of non-human animal-derived genes remaining in the liver is suppressed.

2. The chimeric non-human animal according to claim 1, wherein the expression of non-human animal-derived genes remaining in the liver is suppressed by at least 1% compared to a control chimeric non-human animal.

3. The chimeric non-human animal according to claim 1, wherein the expression of genes derived from a non-human animal is suppressed by at least 78% compared to a control wild-type non-human animal.

4. The chimeric non-human animal according to claim 1, wherein the gene is at least one selected from the group consisting of metabolic enzyme genes, receptor genes, transporter genes, and plasma protein genes.

5. The chimeric non-human animal according to claim 4, wherein the metabolic enzyme gene is at least one selected from the group consisting of the cytochrome P450 oxidoreductase (mPOR) gene, the glucuronosuccinate (UGT) gene, the uricase gene, the ornithine transcarbamylase (OTC) gene, the argininosuccinate synthase 1 (ASS1) gene, and the L-gulonolactone oxidase (GLO) gene.

6. The chimeric non-human animal according to claim 4, wherein the receptor gene is at least one selected from the group consisting of a constitutive androstan receptor (CAR) gene, an aromatic hydrocarbon receptor (AhR) gene, an LDL receptor (LDLR) gene, a very large LDL receptor (VLDLR) gene, an apoE receptor (apoER2) gene, and an LRP-1 gene.

7. The chimeric non-human animal according to claim 4, wherein the transporter gene is at least one selected from the group consisting of the OATP1B1 gene, the OCT1 gene, the OAT2 gene, the ABCC1 gene, and the ABCB11 gene.

8. The chimeric non-human animal according to claim 4, wherein the plasma protein gene is at least one selected from the group consisting of the fibrinogen gene, factor VIII gene, albumin (ALB) gene, transthyretin (TTR) gene, and transferrin gene.

9. The chimeric non-human animal according to claim 1, wherein the gene is at least one selected from the group consisting of the cytochrome P450 oxidoreductase (mPOR) gene, glucuronosyltransferase (UGT) gene, constitutive androstan receptor (CAR) gene, pregnene X receptor (PXR) gene, aromatic hydrocarbon receptor (AhR) gene, uricase gene, L-gulonolactone oxidase (GLO) gene, ornithine transcarbamylase (OTC) gene, arginosuccinate synthase 1 (ASS1) gene, LDL receptor (LDLR) gene, and transthyretin (TTR) gene.

10. The chimeric non-human animal according to claim 1, wherein the non-human animal is a rodent.

11. The chimeric non-human animal according to claim 10, wherein the rodent is a mouse.

12. The chimeric non-human animal according to claim 1, wherein the suppression of expression is achieved by utilizing RNAi, siRNA, mRNA, antisense oligonucleotide, or plasmid.

13. The chimeric non-human animal according to claim 4, wherein the metabolic enzyme gene is at least one selected from the group consisting of the mPOR gene, uricase gene, GLO gene, OTC gene, and ASS1 gene.

14. The chimeric non-human animal according to claim 6, wherein the receptor gene is the LDLR gene.

15. The chimeric non-human animal according to claim 8, wherein the plasma protein gene is the TTR gene.

16. The chimeric non-human animal according to claim 15, wherein the expression of the human-derived TTR gene is further suppressed.

17. The chimeric non-human animal according to claim 13 for metabolite detection.

18. A chimeric non-human animal according to claim 13, which is a model animal for hyperuricemia.

19. A chimeric non-human animal according to claim 13, which is a scurvy model animal.

20. A chimeric non-human animal according to claim 13, which is a model animal for congenital metabolic disorders.

21. The chimeric non-human animal according to claim 14, which is a model animal having a humanized lipid transport control function.

22. The chimeric non-human animal according to claim 1, wherein the human hepatocytes are hepatocytes derived from a patient with familial hypercholesterolemia.

23. The chimeric non-human animal according to claim 21, wherein the gene derived from a non-human animal is an LDL receptor (LDLR) gene.

24. The chimeric non-human animal according to claim 23, which is a model animal for familial hypercholesterolemia.

25. A method for producing a chimeric non-human animal in which the expression of non-human animal-derived genes is suppressed, comprising the step of introducing nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver of a chimeric non-human animal in which a portion of the liver has been replaced with human hepatocytes.

26. The method according to claim 25, wherein the suppression of expression is performed using RNAi, siRNA, antisense oligonucleotide, mRNA, or plasmid.

27. The method according to claim 25, wherein the introduction of nucleic acids is performed using lipid nanoparticles, transfection reagents, or recombinant viruses.

28. The method according to claim 25, wherein the introduction of nucleic acids is performed using lipid nanoparticles.

29. Kits for creating chimeric non-human animals in which the expression of non-human animal-derived genes is suppressed, comprising the following combinations of (a) or (b): (a) A combination of a non-human animal in which part of the liver has been replaced with human hepatocytes, and lipid nanoparticles containing nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver. (b) A combination of a non-human animal in which part of the liver has been replaced with human hepatocytes, nucleic acids to suppress the expression of non-human animal-derived genes remaining in the liver, and lipid nanoparticles.

30. Recombinant viruses containing nucleic acids that suppress the expression of non-human animal-derived genes remaining in the liver of chimeric non-human animals in which a portion of the liver has been replaced with human hepatocytes.

31. A transfection reagent containing nucleic acids that suppress the expression of non-human animal-derived genes remaining in the liver of a chimeric non-human animal in which a portion of the liver has been replaced with human hepatocytes.

32. A method for detecting human metabolites, comprising the step of administering a test substance to a chimeric non-human animal according to claim 17, and then measuring human metabolites derived from the test substance using a biological sample taken from the experimental animal after the administration.

33. A screening method for a drug for treating hyperuricemia, comprising the step of contacting a candidate substance with a chimeric non-human animal described in claim 18 or a sample taken from said animal, and selecting the candidate substance as a drug for treating hyperuricemia using the results obtained as an indicator.

34. A screening method for scurvy treatment, comprising the step of contacting a candidate substance with a chimeric non-human animal described in claim 19 or a sample taken from such animal, and selecting the candidate substance as a scurvy treatment using the results obtained as an indicator.

35. A screening method for a congenital metabolic disease treatment drug, comprising the step of contacting a candidate substance with a chimeric non-human animal described in claim 20 or a sample taken from said animal, and selecting the candidate substance as a treatment drug for a congenital metabolic disease using the results obtained as an indicator.

36. The screening method according to claim 33, wherein the congenital metabolic disorder is OTC deficiency and / or citrulline 1 deficiency.

37. A screening method for a familial hypercholesterolemia treatment drug, comprising the step of contacting a candidate substance with a chimeric non-human animal described in claim 24 or a sample taken from said animal, and selecting the candidate substance as a familial hypercholesterolemia treatment drug based on the results obtained.

38. A method for screening a substance, comprising the step of administering a candidate substance to a chimeric non-human animal described in claim 1 or a sample taken from such animal, and selecting the candidate substance as a substance that affects human liver function based on the results obtained.

39. A screening method according to any one of claims 33 to 38, wherein at least one selected from the group consisting of human albumin concentration, body weight curve, liver weight-to-body weight ratio, total albumin level, total protein level, ALT level, AST level, and total bilirubin level is used as an indicator.

Images