Pharmaceutical composition for treating or preventing bone diseases comprising platelets

The use of artificial platelets with elevated growth factors addresses the limitations of PRP by promoting tissue regeneration and structural recovery in osteoarthritis, enhancing extracellular matrix synthesis and reducing enzyme expression.

WO2026142341A1PCT designated stage Publication Date: 2026-07-02DEWCELL INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
DEWCELL INC
Filing Date
2025-12-24
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Current treatments for osteoarthritis and cartilage damage primarily focus on symptom relief and lack a fundamental cure, with platelet-rich plasma (PRP) exhibiting limitations such as inter-individual variability and non-uniformity in manufacturing.

Method used

A pharmaceutical composition using artificial platelets with enhanced concentrations of growth factors like PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF, and optionally GDF-15 and TIMP-1, produced through a method involving pluripotent stem cell culture and differentiation into megakaryocytes.

Benefits of technology

The composition promotes tissue regeneration by enhancing extracellular matrix synthesis, reducing enzyme expression, alleviating pain, and improving joint function, offering structural and functional recovery of bone and joint tissues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025022795_02072026_PF_FP_ABST
    Figure KR2025022795_02072026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a pharmaceutical composition for treating or preventing bone diseases, comprising platelets and, more specifically, to a pharmaceutical composition for treating or preventing bone diseases, comprising artificial platelets having an increased concentration of any one growth factor selected from the group consisting of PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF, thereby promoting the synthesis of chondrocytes, inhibiting inflammatory responses, and reducing the expression of extracellular matrix-degrading enzymes, thus enabling the recovery of bone and joint tissue.
Need to check novelty before this filing date? Find Prior Art

Description

Pharmaceutical composition for the treatment or prevention of bone diseases containing platelets

[0001] The present invention relates to a pharmaceutical composition for the treatment or prevention of bone disease comprising artificial platelets, and a method for treating bone disease using artificial platelets.

[0002] A joint is a structure where bones meet, and a cartilage layer exists on the joint surface. This cartilage layer is composed primarily of extracellular matrix, such as proteoglycans secreted by chondrocytes and type II collagen.

[0003] The cartilage layer plays a role in absorbing shock and reducing friction during joint movement; however, due to the limited proliferative capacity of chondrocytes, self-regeneration is very difficult upon damage. In particular, osteoarthritis is the most representative degenerative joint disease, characterized by the progressive destruction of the cartilage layer as the expression of extracellular matrix degrading enzymes increases alongside a decrease in the number of chondrocytes. This leads to joint pain, limited movement, and a decline in quality of life.

[0004] To date, no treatments that induce fundamental cartilage regeneration for osteoarthritis and cartilage damage have been commercialized. Clinically, treatments primarily involve pain relief using non-steroidal anti-inflammatory drugs (NSAIDs) or the intra-articular administration of hyaluronic acid for joint lubrication. Current treatments are limited to symptom relief and have limitations as a fundamental cure.

[0005] Although platelet-rich plasma (PRP) has been suggested to induce tissue regeneration by containing growth factors, limitations such as inter-individual variability, non-uniformity of the manufacturing process, and lack of reproducibility of effects have been pointed out. Accordingly, as an alternative to overcome the limitations of PRP and provide a more stable and efficient regenerative effect, there is a need to develop new therapeutic compositions for the treatment of osteoarthritis and cartilage damage using artificial platelets.

[0006] The present invention aims to provide a pharmaceutical composition for the treatment or prevention of bone diseases comprising novel artificial platelets.

[0007] The present invention aims to provide a tissue regeneration composition comprising novel artificial platelets.

[0008] 1. A pharmaceutical composition for the treatment or prevention of bone disease comprising, as an active ingredient, an artificial platelet having an increased concentration of any one growth factor selected from the group consisting of PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF compared to human-derived platelets.

[0009] 2. A pharmaceutical composition for the treatment or prevention of bone disease, wherein the artificial platelets of 1 above comprise PDGF-AA at a concentration of 10 to 20 ng / ml, PDGF-BB at a concentration of 4 to 8 ng / ml, EGF at a concentration of 0.1 to 0.5 ng / ml, TGF-β at a concentration of 0.7 to 1.3 ng / ml, bFGF at a concentration of 1.0 to 2.0 ng / ml, and VEGF at a concentration of 0.1 to 0.5 ng / ml.

[0010] 3. A pharmaceutical composition for the treatment or prevention of bone disease, wherein the artificial platelet in the above 1 has an additionally increased concentration of any one growth factor selected from the group consisting of GDF-15 and TIMP-1 compared to human-derived platelets.

[0011] 4. A pharmaceutical composition for the treatment or prevention of bone disease, wherein the artificial platelet in 1 above has a PAC-1 activity of 60% or more and a CD62P activity of 50% or more.

[0012] 5. A pharmaceutical composition for the treatment or prevention of a bone disease according to 1 above, wherein the bone disease is any one selected from the group consisting of osteoarthritis, traumatic arthritis, chondromalacia, cartilage defect, osteoporosis, and meniscal cartilage damage.

[0013] 6. In the above 1, the artificial platelet comprises: (S1) a step of culturing pluripotent stem cells to obtain a culture medium containing hematopoietic stem cells; (S2) among the cells contained in the culture medium, CD34 + A pharmaceutical composition for the treatment or prevention of bone disease, prepared by a method comprising the steps of: obtaining a population of suspended cells from a culture medium when the number of cells is at least 90% of the total number of cells; and (S3) differentiating the population of suspended cells into megakaryocytes in a first medium.

[0014] 7. A pharmaceutical composition for the treatment or prevention of bone disease, wherein the method of 6 further comprises the step (S4) of culturing and maturing the megakaryocytes in a second medium containing TPO and SCF.

[0015] 8. A pharmaceutical composition for the treatment or prevention of bone disease, wherein the step (S1) comprises: (S1a) culturing pluripotent stem cells in a third medium containing a GSK3 inhibitor; (S1b) culturing the cells cultured in the third medium in a fourth medium containing vascular endothelial growth factor and basal fibroblast growth factor; and (S1c) culturing the cells cultured in the fourth medium in a fifth medium containing vascular endothelial growth factor; basal fibroblast growth factor; and a transforming growth factor beta signaling inhibitor.

[0016] 9. In the above 6, the method comprises (S0) pluripotent stem cells at a density of 5,000 to 8,500 cells / cm² on the bottom of a culture vessel. 2 A pharmaceutical composition for the treatment or prevention of bone disease, further comprising a seeding step.

[0017] 10. A pharmaceutical composition for the treatment or prevention of bone disease, wherein the first medium comprises TPO and SCF and does not comprise interleukin-3 and interleukin-6.

[0018] 11. In the above 6, among the cells included in the culture medium in (S2), CD34 +The cell count is at least 90% of the total cell count, and CD41a + The cell count is 50% to 80% of the total cell count, and CD42b + A pharmaceutical composition for the treatment or prevention of bone disease, wherein a suspension cell population is obtained from the culture medium when the number of cells is 40% to 60% of the total number of cells.

[0019] 12. A pharmaceutical composition for the treatment or prevention of bone disease, wherein the second medium further comprises heparin sodium and a ROCK inhibitor.

[0020] 13. In 7 above, the megakaryocytes are 1.0 × 10⁶ in a culture vessel with baffles formed on the bottom surface or in a stirred bioreactor. 5 Up to 2×10 5 cells / cm 2 A pharmaceutical composition for the treatment or prevention of bone disease, which is administered and cultured.

[0021] 14. A composition for tissue regeneration comprising, as an active ingredient, an artificial platelet having an increased concentration of any one growth factor selected from the group consisting of PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF compared to human-derived platelets.

[0022] 15. The composition for tissue regeneration according to 14, wherein the artificial platelets comprise PDGF-AA at a concentration of 10 to 20 ng / ml, PDGF-BB at a concentration of 4 to 8 ng / ml, EGF at a concentration of 0.1 to 0.5 ng / ml, TGF-β at a concentration of 0.7 to 1.3 ng / ml, bFGF at a concentration of 1.0 to 2.0 ng / ml, and VEGF at a concentration of 0.1 to 0.5 ng / ml.

[0023] 16. A tissue regeneration composition according to 14, wherein the artificial platelet has an additionally increased concentration of any one growth factor selected from the group consisting of GDF-15 and TIMP-1 compared to human-derived platelets.

[0024] 17. The composition for tissue regeneration according to 14, wherein the artificial platelet has a PAC-1 activity of 60% or more and a CD62P activity of 50% or more.

[0025] 18. In the above 14, the artificial platelet comprises: (S1) a step of culturing pluripotent stem cells to obtain a culture medium containing hematopoietic stem cells; (S2) among the cells contained in the culture medium, CD34 + A tissue regeneration composition prepared by a method comprising: (S3) obtaining a suspension cell population from a culture medium when the number of cells is at least 90% of the total number of cells; and (S3) differentiating the suspension cell population into megakaryocytes in a first medium.

[0026] 19. The above composition for tissue regeneration, wherein the method further comprises the step (S4) of culturing megakaryocytes in a second medium containing TPO and SCF to mature them.

[0027] 20. A composition for tissue regeneration according to 18 above, wherein step (S1) comprises: (S1a) culturing the pluripotent stem cells in a third medium containing a GSK3 inhibitor; (S1b) culturing the cells cultured in the third medium in a fourth medium containing vascular endothelial growth factor and basal fibroblast growth factor; and (S1c) culturing the cells cultured in the fourth medium in a fifth medium containing vascular endothelial growth factor; basal fibroblast growth factor; and a transforming growth factor beta signaling inhibitor.

[0028] 21. In the above 18, the method comprises (S0) pluripotent stem cells at a density of 5,000 to 8,500 cells / cm² on the bottom of a culture vessel. 2 A composition for tissue regeneration comprising an additional step of seeding.

[0029] 22. A tissue regeneration composition according to 18, wherein the first medium comprises TPO and SCF and does not comprise interleukin-3 and interleukin-6.

[0030] 23. In the above 18, among the cells included in the culture medium in (S2), CD34 + The cell count is at least 90% of the total cell count, and CD41a + The cell count is 50% to 80% of the total cell count, and CD42b + A composition for tissue regeneration that obtains a suspension cell population from a culture medium when the number of cells is 40% to 60% of the total number of cells.

[0031] 24. The tissue regeneration composition of 19 above, wherein the second medium further comprises heparin sodium and a ROCK inhibitor.

[0032] 25. In 19 above, megakaryocytes are 1.0 × 10⁶ in a culture vessel with baffles formed on the bottom surface or in a stirred bioreactor. 5 Up to 2×10 5 cells / cm 2 A composition for tissue regeneration that is introduced and cultured.

[0033] 26. A composition for tissue regeneration according to 14, wherein the tissue is any one selected from the group consisting of bone, cartilage, ligaments, tendons, skin, and blood vessels.

[0034] The composition of the present invention has excellent therapeutic effects for bone diseases.

[0035] The composition of the present invention can induce tissue regeneration by promoting extracellular matrix synthesis in tissues such as damaged cartilage.

[0036] The composition of the present invention can inhibit the progression of related diseases by reducing the expression of extracellular matrix degrading enzymes and inflammatory cytokines in cartilage tissue.

[0037] The composition of the present invention has the effect of alleviating pain caused by osteoarthritis and improving walking function.

[0038] The composition of the present invention is useful for the treatment or prevention of bone diseases by simultaneously inducing structural and functional recovery of bone and joint tissues.

[0039] Figure 1a is an example of the culture process of human induced pluripotent stem cells.

[0040] Figure 1b shows photographs of the culture medium on days 1 and 3 for obtaining human induced pluripotent stem cells.

[0041] FIG. 2a is an example of a process for obtaining a culture medium containing hematopoietic stem cells by culturing the obtained human induced pluripotent stem cells.

[0042] Figure 2b is a photograph of the culture medium on days 2, 5, and 9 of culture to obtain the culture medium containing hematopoietic stem cells.

[0043] Figure 3 is a photograph of the culture medium containing the suspension cell population of Example 1.

[0044] Figure 4 is an example of a process for differentiating and maturing a floating cell population into megakaryocytes.

[0045] Figures 5a and 5b are the results of comparing the expression ratios of surface markers (CD34, CD45, CD41a, and CD42b) before and after freezing of the suspension cell population of Example 1.

[0046] Figure 6 is the result of confirming the number of chromosomes of a megakaryocyte obtained in step (S3) of Example 1.

[0047] Figure 7 is a micrograph of a megakaryocyte finally obtained in step (S4) of Example 1.

[0048] Figure 8 is the result of confirming the number of chromosomes of the megakaryocyte finally obtained in step (S4) of Example 1.

[0049] Figure 9 is a micrograph of a platelet from Example 1.

[0050] Figures 10a and 10b show the results of analyzing growth factors of the platelets of Example 1 and commercially available human blood-derived platelets (PLTGold®).

[0051] Figure 11 shows the results of quantitative analysis of major growth factors in platelets and human-derived platelets (hbPLT) of Example 1.

[0052] Figure 12 is a schematic diagram of the platelet purification process of Example 1.

[0053] Figures 13a to 13c show the results of analyzing mRNA expression of anabolic factors related to cartilage synthesis, catabolic factors related to cartilage degradation, and inflammatory cytokines when osteoarthritis-induced chondrocytes were treated with the platelets of Example 1.

[0054] Figure 14 shows the results of analyzing the expression of anabolic factors related to cartilage synthesis, catabolic factors related to cartilage degradation, ECM degrading enzyme inhibitors, and proteins related to the activation of these signaling pathways when osteoarthritis-induced chondrocytes were treated with the platelets of Example 1.

[0055] Figure 15 shows example photos of the von Frey test and weight-bearing test to evaluate the pain relief effect associated with osteoarthritis and the results thereof.

[0056] Figure 16 is the result of evaluating the regenerative effect of osteoarthritis tissue according to platelet treatment of Example 1.

[0057] Figures 17a and 17b are the results of gait analysis in an animal model of osteoarthritis following platelet administration of Example 1.

[0058] Figure 18 shows the results of the weight-bearing test and pain sensitivity evaluation in an animal model of osteoarthritis following platelet administration of Example 1.

[0059] Figure 19 shows the results of histological analysis of an animal model of osteoarthritis following platelet administration of Example 1.

[0060] Figures 20a to 20c show the results of analyzing the protective effect of the growth factor derived from platelets of Example 1 on chondrocytes.

[0061] Figure 21 shows the results of comparing and analyzing the protective effects of platelets of Example 1 and the control group on chondrocytes in an in vitro model of osteoarthritis.

[0062] Figures 22a and 22b are CT scan images and bone structure analysis results to confirm the bone disease improvement effect of platelets in Example 1.

[0063] Figures 23a and 23b show the results of analyzing the skin regeneration effect according to platelet treatment of Example 1.

[0064] Figure 24 is the result of evaluating the proliferative activity of vascular endothelial cells according to platelet treatment of Example 1.

[0065]

[0066] The present invention provides a pharmaceutical composition for the treatment or prevention of bone diseases comprising platelets.

[0067] The present invention provides a pharmaceutical composition capable of promoting the synthesis of chondrocytes, suppressing inflammatory responses, and improving bone and joint tissue damage by including artificial platelets in which the concentration of any one growth factor selected from the group consisting of PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF is increased compared to human-derived platelets.

[0068] The pharmaceutical composition of the present invention comprises platelets prepared according to a predetermined method as an active ingredient.

[0069] In one embodiment, the platelets of the present invention may be produced by a method comprising: (S1) culturing pluripotent stem cells to obtain a culture medium containing hematopoietic stem cells; (S2) obtaining a floating cell population from the culture medium when the number of cells expressing CD34 among the cells contained in the culture medium is at least 90% of the total number of cells; and (S3) differentiating the floating cell population into megakaryocytes in a first medium.

[0070] The method for producing platelets according to the present invention (S0) places pluripotent stem cells at a rate of 2,000 to 20,000 cells / cm² on the bottom of a culture vessel. 2 It may include additional seeding steps.

[0071] The platelet production method of the present invention may further include the step (S4) of maturing megakaryocytes by culturing them in a second medium containing TPO and SCF.

[0072] The platelet manufacturing method of the present invention may further include the step of obtaining platelets by separating and purifying the culture of (S5) (S4).

[0073] The platelet manufacturing process from (S0) to (S5) is described below.

[0074]

[0075] (S0) Step

[0076] (S0) is pluripotent stem cells at a density of 2,000 to 20,000 cells / cm² on the bottom of the culture vessel. 2 This is the seeding stage.

[0077] Pluripotent stem cells include induced pluripotent stem cells (iPSCs) or embryonic stem cells (ESCs).

[0078] Induced pluripotent stem cells (iPSCs) refer to differentiated cells that originally lacked pluripotency but have acquired this ability through an artificial dedifferentiation process.

[0079] Induced pluripotent stem cells (iPSCs) may be derived from individuals selected from a group including humans, non-human primates, rodents (mice, rats), ungulates (cattle, sheep, etc.), dogs (pet and wild dogs), cats (pet and wild cats such as lions, tigers, and cheetahs), rabbits, hamsters, goats, elephants, pandas (including giant pandas), pigs, raccoons, horses, zebras, and marine mammals (dolphins, whales, etc.).

[0080] Induced pluripotent stem cells can be human induced pluripotent stem cells (hiPSCs).

[0081] Induced pluripotent stem cells may be generated using mouse and / or human cells. For example, induced pluripotent stem cells may be generated using embryonic, fetal, neonatal, and adult tissues.

[0082] Induced pluripotent stem cells may utilize any somatic cell of substantially any developmental stage as a starting point. The somatic cell may be derived from, but is not limited to, embryos, fetuses, newborns, children, or adult donors. The somatic cell may be, but is not limited to, fibroblasts, such as skin fibroblasts obtained from a skin sample or biopsy, synoviocytes from synovial tissue, ball cells, or lung fibroblasts.

[0083] Pluripotent stem cells are seeded onto the bottom of the culture vessel and then cultured in attachment.

[0084] The bioreactor may be used without restriction as long as it is used for cell culture in the industry. For example, it may be large, medium, or small bioreactors. It may also be cell culture flasks such as the T25, T75, T175, or T225.

[0085] It is desirable to seed pluripotent stem cells at a density of 5,000 to 8,500 cells / cm² in terms of promoting cell growth and differentiation. Pluripotent stem cells must be seeded at an appropriate density on the bottom of the culture vessel so that they can be converted into suspension cells after sufficient culture and differentiation, and the number of cells expressing CD34 among the cells in the culture medium containing hematopoietic stem cells can reach 90% of the total number of cells, thereby ensuring the quality of the platelets produced.

[0086] When pluripotent stem cells are seeded at a low density of 5,000 cells / cm² or less on the bottom of the culture medium, insufficient cell-to-cell interaction occurs, resulting in poor growth and early differentiation, and consequently, insufficient conversion to floating cells may occur. Conversely, when pluripotent stem cells are seeded at a high density exceeding 8,500 cells / cm² on the bottom of the culture medium, the relative concentration of factors added to the culture medium becomes insufficient, preventing smooth cell-to-cell signaling, and consequently, differentiation may not proceed efficiently.

[0087] Pluripotent stem cells can be seeded at 5,000 to 8,500 cells / cm², for example, 5,000 to 8,500 cells / cm², 5,000 to 8,300 cells / cm², 5,000 to 8,000 cells / cm², 5,000 to 7,800 cells / cm², 5,000 to 7,500 cells / cm², 5,000 to 7,200 cells / cm², 5,000 to 7,000 cells / cm², 5,100 to 7,000 cells / cm², 5,100 to 6,800 cells / cm², 5,100 to 6,600 cells / cm², 5,100 to 6,400 cells / cm², 5,100 to 6,300 It may be cells / cm², 5,200 to 6,100 cells / cm², 5,000 to 6,000 cells / cm², 5,300 to 6,000 cells / cm², 5,100 to 6,000 cells / cm², 5,100 to 5,900 cells / cm², 5,200 to 5,800 cells / cm², 5,300 to 5,700 cells / cm², or 5,400 to 5,600 cells / cm².

[0088]

[0089] (S1) Step

[0090] Step (S1) is a step of culturing pluripotent stem cells to obtain a culture medium containing hematopoietic stem cells. This step is a step of culturing the pluripotent stem cells seeded in Step (S0) to obtain a floating cell population capable of differentiating into megakaryocytes.

[0091] (S1) Step may be configured to include the following detailed steps:

[0092] (S1a) A step of culturing pluripotent stem cells in a third medium containing a GSK3 (Glycogen Synthase Kinase 3) inhibitor;

[0093] (S1b) A step of culturing cells cultured in a third medium in a fourth medium containing vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF); and

[0094] (S1c) A step of culturing cells cultured in a fourth medium in a fifth medium containing vascular endothelial growth factor; basic fibroblast growth factor; and a transforming growth factor beta signaling inhibitor.

[0095] The third, fourth, and fifth media used in this step are media having different compositions and purposes.

[0096] The third medium contains at least a GSK3 inhibitor. The GSK3 inhibitor may be, but is not limited to, CHIR99021, BIO(6-bromoindirubin-30-oxime), SB216763, CHIR-98014, CT98014, CT98023, CT99021, TWS119, SB41528, AR-A014418, AZD-1080, Alsterpaullone, Cazpaullone, or Kenpaullone. CHIR99021 is a GSK3 inhibitor and a Wnt signaling agonist, and may be represented as aminopyrimidine.

[0097] The GSK3 inhibitor (e.g., CHIR99021) is not limited to a specific concentration as long as it is in an amount sufficient to culture pluripotent stem cells. The GSK3 inhibitor may be included in the third medium at concentrations such as 2 to 10 μM, 2.5 to 9.5 μM, 3 to 9 μM, 3.5 to 8.5 μM, 4 to 8 μM, 4.5 to 7.5 μM, 5 to 7 μM, 5.5 to 6.5 μM, or 6 μM.

[0098] The third medium is a basal medium. The third medium may include RPMI1640 medium or other types of basal medium. The third medium may further include an antioxidant and / or B-27 along with the basal medium.

[0099] Antioxidants include 6-hydroxymelatonin, acetyl-L-carnitine (ALCAR), alpha-lipoic acid (ALA), ascorbic acid (e.g., AA2P (L-Ascorbic acid 2-phosphate), AA2G (L-Ascorbic acid 2-glucoside)), carotenoids (vitamin A), curcumin, edaravone, polyphenols, glutathione, hydroxytyrosol, L-carnitine, radostigil, melatonin, mofegiline, and N-acetylcysteine ​​(NAC). It can be selected from the group consisting of N-acetylserotonin (N-Acetylserotonin, NAS), oleocanthal, oleuropein, rasagiline, resveratrol, selegiline, selenium, tocopherols (vitamin E), tocotrienols, tyrosol, ubiquinone (coenzyme Q), and uric acid.

[0100] The fourth medium is a growth medium. The fourth medium contains at least growth factors such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF). The fourth medium may further contain other growth factors to culture pluripotent stem cells.

[0101] Vascular Endothelial Growth Factor (VEGF) is a member of the Epidermal Growth Factor Receptor (EGFR / ErbB). VEGF plays an essential role in regulating cell proliferation and differentiation, and induces apoptosis, survival, or cell proliferation by causing the activation of various forms of signaling pathways. Vascular Endothelial Growth Factor includes, for example, VEGF from humans and non-human animals (such as mice).

[0102] Vascular endothelial growth factor is included at a concentration that allows for the appropriate culture of pluripotent stem cells. Vascular endothelial growth factor may be included in the fourth medium at a concentration of, for example, 5 to 95 ng / ml, 10 to 90 ng / ml, 15 to 85 ng / ml, 20 to 80 ng / ml, 25 to 75 ng / ml, 30 to 70 ng / ml, 35 to 65 ng / ml, 40 to 60 ng / ml, 45 to 55 ng / ml, or 50 ng / ml.

[0103] Basic Fibroblast Growth Factor (bFGF) is a protein belonging to the FGF family that functions as a cell proliferation and differentiation factor, as well as a division-promoting factor, angiogenesis factor, bone formation factor, and nerve growth factor. Also known as FGF2, bFGF primarily activates receptor proteins including FGFR1b, FGFR1c, FGFR2c, FGFR3c, and FGFR4c, and particularly potently activates FGFR1c and FGFR3c.

[0104] Basic fibroblast growth factor is included in a concentration that allows for the proper culture of pluripotent stem cells together with other components. Basic fibroblast growth factor may be included in the fourth medium at a concentration of, for example, 1 to 40 ng / ml, 5 to 35 ng / ml, 10 to 30 ng / ml, 15 to 25 ng / ml, or 20 ng / ml.

[0105] Medium 4 may not contain a transforming growth factor beta (TGFβ) signaling inhibitor. If Medium 4 contains a TGFβ signaling inhibitor, differentiation may occur before sufficient cell proliferation has taken place.

[0106] Medium 5 is a growth medium. Like Medium 4, it contains at least growth factors such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF). Medium 5 may further contain other growth factors for culturing pluripotent stem cells.

[0107] The provisions regarding vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) in the 5th medium shall be in accordance with the provisions regarding vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) in the 4th medium.

[0108] Medium 5 contains a transforming growth factor beta (TGFβ) signaling inhibitor.

[0109] Transforming growth factor beta (TGFβ) signaling inhibitors refer to substances that inhibit TGFβ signaling. TGFβ is a substance that regulates various physiological processes in vivo, including cell proliferation, differentiation, apoptosis, migration, extracellular matrix (ECM) production, angiogenesis, and development.

[0110] TGFβ signaling inhibitors may be used without restriction as long as they are substances capable of inhibiting TGFβ signaling, for example, they may be Activin Receptor-like Kinase (ALK) receptor inhibitors.

[0111] Activin receptor-like kinase receptor inhibitors may be, but are not limited to, ALK5, ALK4, and ALK7 receptor inhibitors. For example, an ALK receptor inhibitor may be SB431542. SB431542 may be represented by the following compound name: 4-[4-(2H-1,3-benzodioxol-5-yl)-5-(pyridine-2-yl)-1H-imidazole-2-yl]benzamide.

[0112] Transforming growth factor beta (TGFβ) signaling inhibitors are included at a concentration that allows pluripotent stem cells to be cultured together with other components. Transforming growth factor beta (TGFβ) signaling inhibitors may be included at a concentration of, for example, 1 to 20 μM, 5 to 15 μM, or 10 μM.

[0113] (S1) The culture medium obtained through the culture of step (S1) contains hematopoietic stem cells (HSC). The culture medium may further contain hematopoietic progenitor cells (HPC) and megakaryocyte progenitor cells (MK-P).

[0114]

[0115] (S2) Step

[0116] Step (S2) involves cells expressing CD34 among the cells included in the culture medium of (S1) (CD34 + This is a step of obtaining a suspension cell population from the culture medium when the number of cells is at least 90% of the total number of cells.

[0117] A suspension cell population refers to cells and / or a population of cells suspended within a culture medium. Suspension cell populations contain a large number of cells capable of differentiating into megakaryocytes, such as hematopoietic stem cells, hematopoietic progenitor cells, and megakaryocytes; they may also contain cells that, while not directly differentiating into megakaryocytes, help hematopoietic stem cells, hematopoietic progenitor cells, and megakaryocytes differentiate more effectively than when they are present alone.

[0118] This step determines the optimal time to obtain a suspension cell population from the culture medium of (S1). By obtaining an optimal suspension cell population for differentiation into megakaryocytes through this step, the efficiency of differentiation into megakaryocytes and / or matured megakaryocytes and the efficiency of platelet production can be increased.

[0119] The point in time to obtain the floating cell population is CD34 + It is when the number of cells is at least 90% of the total number of cells. That is, cells that do not express CD34 (CD34 - The number of cells is less than 10% at most. CD34 + When the number of cells is 90% or more, the differentiation efficiency into megakaryocytes and platelet production efficiency are excellent.

[0120] CD34 + The number of cells is, for example, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more of the total number of cells.

[0121] The timing for obtaining the suspension cell population can be determined by considering the number of cells expressing CD41a, along with whether the cells in the culture medium express CD34.

[0122] CD41a + A suspension cell population can be obtained from the culture medium when the number of cells is, for example, 50% or more, 51% or more, 52% or more, 53% or more, 54% or more, 55% or more, 56% or more, 57% or more, 58% or more, 59% or more, 60% or more, 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 68% or more, 69% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, or 79% or more of the total number of cells.

[0123] CD41a +A suspension cell population can be obtained from the culture medium when the number of cells is, for example, 80% or less, 79% or less, 78% or less, 77% or less, 76% or less, 75% or less, 74% or less, 73% or less, 72% or less, 71% or less, 70% or less, 69% or less, 68% or less, 67% or less, 66% or less, 65% or less, 64% or less, 63% or less, 62% or less, 61% or less, 60% or less, 59% or less, 58% or less, 57% or less, 56% or less, 55% or less, 54% or less, 53% or less, 52% or less, or 51% or less of the total number of cells.

[0124] In addition, the timing for obtaining the suspension cell population can be determined by considering the number of cells expressing CD42b, along with whether the cells in the culture medium express CD34.

[0125] CD42b + A suspension cell population can be obtained from the culture medium when the number of cells is, for example, 40% or more, 41% or more, 42% or more, 43% or more, 44% or more, 45% or more, 46% or more, 47% or more, 48% or more, 49% or more, 50% or more, 51% or more, 52% or more, 53% or more, 54% or more, 55% or more, 56% or more, 57% or more, 58% or more, or 59% or more of the total number of cells.

[0126] CD42b + A suspension cell population can be obtained from the culture medium when the number of cells is, for example, 60% or less, 59% or less, 58% or less, 57% or less, 56% or less, 55% or less, 54% or less, 53% or less, 52% or less, 51% or less, 50% or less, 49% or less, 48% or less, 47% or less, 46% or less, 45% or less, 44% or less, 43% or less, 42% or less, or 41% or less of the total number of cells.

[0127] In one embodiment, among the cells contained in the culture medium, CD34 +The cell count is at least 90% of the total cell count, and CD41a + A suspension cell population can be obtained from the culture medium when the number of cells is 50% to 80% of the total number of cells.

[0128] In one embodiment, among the cells contained in the culture medium, CD34 + The cell count is at least 90% of the total cell count, and CD42b + A suspension cell population can be obtained from the culture medium when the number of cells is 40% to 60% of the total number of cells.

[0129] By confirming whether the cells in the culture medium express CD34, and additionally CD41a and / or CD42b, there is no need to separately isolate or purify only the cells with the potential to differentiate into megakaryocytes from the entire cell population.

[0130] Methods for counting the number of cells may utilize conventional techniques in the industry without limitation. For example, antibody-based sorting methods or sorter machines may be used. Antibody-based sorting methods may, for example, utilize micro beads.

[0131]

[0132] (S2.5) Step

[0133] The manufacturing method of the present invention may further include the step of freezing and then thawing the suspension cell population obtained in step (S2).

[0134] Cryopreservation refers to the long-term storage of a suspension cell population in a cryogenic state (-80°C or liquid nitrogen -196°C, etc.). A suspension cell population can be placed in a cryoprotective composition and cooled slowly (e.g., at a rate of about -1°C / min) so that the suspension cells are preserved without damage and their metabolic activity is stopped.

[0135] The cryoprotective composition may include cryoprotective agents such as DMSO and glycerol.

[0136] The floating cell population contains megakaryocytes. Temporal synchronization of megakaryocytes is possible through cryopreservation. Based on the temporal synchronization of megakaryocytes, high-quality platelets can be produced with high efficiency through step (S3) described below.

[0137] Cryopreserved floating cell populations can be stored in a cell bank.

[0138] Cryopreserved suspension cell populations can be thawed. Thawing refers to the process of converting a suspension cell population, for example, stored in a liquid nitrogen tank (-196°C, gas / liquid phase), from a frozen state to a liquid state.

[0139] In one embodiment, a cryopreserved suspension cell population can be transferred to, for example, a 37°C water bath and rapidly thawed to make it ready for re-culturing.

[0140]

[0141] (S3) Step

[0142] Step (S3) is the step of differentiating the suspension cell population obtained in Step (S2) into megakaryocytes in the first medium.

[0143] The first medium plays the role of differentiating the floating cell population into megakaryocytes.

[0144] The first medium may include additives, such as cytokines, growth factors, signaling pathway inhibitors, or antioxidants. The first medium may include one or more selected from the group consisting of TPO, SCF, FLT-3L, SR1, and AA2P. Depending on the type of additive included in the first medium, differentiation of megakaryocytes in the first medium may be further promoted, and the quality of the platelets produced accordingly may be improved.

[0145] In one embodiment, the first medium includes a basic medium, TPO, and SCF.

[0146] In one embodiment, the first medium may further include SR1 and AA2P, thereby promoting the growth and differentiation of megakaryocytes while improving the quality of the platelets produced.

[0147] In one embodiment, the first medium does not contain interleukins. Interleukins include interleukin-3 (IL-3) and interleukin-6 (IL-6).

[0148] In one embodiment, the platelet production method of the present invention can efficiently differentiate a floating cell population into megakaryocytes using a first medium that does not contain interleukin-3 and interleukin-6.

[0149] In one embodiment, the platelet production method of the present invention may increase the expression ratio of CD41a and CD42b by using a first medium that does not contain interleukin-3 and interleukin-6, compared to when a floating cell population or megakaryocytes are cultured in a medium containing the corresponding cytokines. Accordingly, the differentiation of floating cells into megakaryocytes may be promoted more effectively.

[0150] Thrombopoietin is a major growth factor that regulates megakaryocyte and platelet hematopoiesis, and is mainly synthesized and secreted by hepatocytes.

[0151] Thrombopoietin may be included in the first medium at a concentration that allows the suspension cell population to be cultured together with other components, and it does not have to be included at a specific concentration. Thrombopoietin may be included at a concentration of, for example, 1 to 100 ng / ml, 5 to 90 ng / ml, 10 to 80 ng / ml, 20 to 70 ng / ml, or 30 to 60 ng / ml.

[0152] Stem cell factor (SCF) is a stromal cell-derived cytokine synthesized by fibroblasts and other cell types. Stem cell factor may be included in the first medium at a concentration that allows the suspension cell population to be cultured together with other components, and it does not have to be included at a specific concentration. Stem cell factor may be included at a concentration of, for example, 1 to 100 ng / ml, 5 to 90 ng / ml, 10 to 80 ng / ml, 20 to 70 ng / ml, or 30 to 60 ng / ml.

[0153] The first medium is not limited to a specific medium. The first medium may include IMDM (Iscove's Modified Dulbecco's Medium) or a conventional medium used for megakaryocyte differentiation as the basal medium. As the basal medium, serum-containing media, serum-free media, non-animal (synthetic) media, animal media, or multi-component media may be used. The basal medium may further include cytokines, growth factors, signaling pathway inhibitors, or antioxidants.

[0154] In one embodiment, the first medium may be a medium mixed with a CHO cell culture medium and an HSC proliferation medium. For example, the CHO cell culture medium and the HSC proliferation medium may be mixed in a volume ratio of 10:1 to 1:10.

[0155] In one embodiment, the first medium may further include SR1 and AA2P, thereby promoting the growth and differentiation of megakaryocytes while improving the quality of the platelets produced.

[0156] If the suspension cell population obtained in step (S2) undergoes cryopreservation and thawing steps according to step (S2.5), the thawed suspension cell population (S3') can differentiate into megakaryocytes in the first medium. Since the suspension cell population maintains the same characteristics despite cryopreservation and thawing, it can differentiate into megakaryocytes in the first medium just like the suspension cell population that did not undergo step (S2.5).

[0157] The megakaryocyte obtained in this step may have a polyploid number of chromosomes. The megakaryocyte may be tetraploid (4n), octaploid (8n), hexaploid (16n), thirtopaploid (32n), sixtopaploid (64n), or twelfthopaploid (128n).

[0158] Polyploid megakaryocytes are advantageous for mass production of platelets because they are rich in cytoplasm and can synthesize large amounts of proteins and membrane components.

[0159]

[0160] (S4) Step

[0161] Step (S4) is the step of maturing the megakaryocytes of (S3) by culturing them in a second medium containing TPO and SCF.

[0162] Thrombopoietin (TPO) may be included in the second medium at concentrations of, for example, 100 to 300 ng / ml, 110 to 290 ng / ml, 120 to 280 ng / ml, 130 to 270 ng / ml, 140 to 260 ng / ml, 150 to 250 ng / ml, 160 to 240 ng / ml, 170 to 230 ng / ml, 180 to 220 ng / ml, 190 to 210 ng / ml, or 200 ng / ml, but is not limited thereto.

[0163] Stem cell factor (SCF) may be included in the second medium at concentrations of, for example, 10 to 100 ng / ml, 20 to 90 ng / ml, 30 to 80 ng / ml, 30 to 70 ng / ml, 40 to 60 ng / ml, or 50 ng / ml, but is not limited thereto.

[0164] The second medium may contain additional factors necessary for maturing megakaryocytes.

[0165] In one embodiment, the second medium may further include heparin sodium. Heparin sodium may be included in an amount of 15 to 35 unit / ml, for example, 15 to 35 unit / ml, 16 to 34 unit / ml, 17 to 33 unit / ml, 18 to 32 unit / ml, 19 to 31 unit / ml, 20 to 30 unit / ml, 21 to 29 unit / ml, 22 to 28 unit / ml, 23 to 27 unit / ml, or 24 to 26 unit / ml.

[0166] In one embodiment, the second medium may further include a ROCK inhibitor. The ROCK inhibitor may be any one selected from the group consisting of Y-27632, Y-39983, Thiazovivin, and HA-1077.

[0167] In one embodiment, the ROCK inhibitor may be included in an amount of 0.5 to 3 μM, 0.5 to 2.8 μM, 0.5 to 2.6 μM, 0.5 to 2.4 μM, 0.5 to 2.2 μM, 0.5 to 2 μM, 0.5 to 1.8 μM, 0.5 to 1.6 μM, 0.5 to 1.5 μM, 0.5 to 1.4 μM, 0.5 to 1.3 μM, 0.5 to 1.2 μM, or 0.5 to 1.1 μM.

[0168] The second medium is not limited to a specific medium. The second medium may include IMDM (Iscove's Modified Dulbecco's Medium) medium as the basal medium. The IMDM medium may further include an antioxidant (e.g., Ascorbic Acid 2-Phosphate, AA2P, etc.), SR1 and / or B-27.

[0169] In one embodiment, megakaryocytes may be cultured in a general culture vessel or bioreactor while being stirred. In one embodiment, the stirring speed in the culture vessel or bioreactor may be 20 rpm to 300 rpm, 50 rpm to 250 rpm, 50 rpm to 250 rpm, or 100 to 200 rpm.

[0170] In one embodiment, megakaryocytes can be cultured in a culture vessel or bioreactor having baffles formed on the bottom surface.

[0171] A baffle is a protruding structure fixed to the inner wall (bottom, side, etc.) of a culture medium. Megakaryocytes can be promoted to mature and release platelets by receiving appropriate shear stress from baffles formed in a culture medium or bioreactor.

[0172] Baffles can perform functions such as inhibiting vortex formation during stirring in the culture medium, increasing the mixing efficiency of the culture medium, maintaining a uniform distribution of oxygen and nutrients, and preventing cells from settling or clumping in specific locations.

[0173] In one embodiment, the baffle is installed on the bottom surface of an incubator or bioreactor. It may be structurally installed in the incubator or bioreactor, or the baffle structure may be additionally installed in a standard incubator or bioreactor.

[0174] In one embodiment, the stirring speed in a culture vessel (such as a triangular flask) or bioreactor having baffles formed therein may be 20 rpm to 200 rpm, 50 rpm to 200 rpm, 50 rpm to 150 rpm, or 100 to 150 rpm.

[0175] In one embodiment, the megakaryocyte is 1.0 × 10 5 Up to 2×10 5 cells / cm 2 It can be administered to promote maturation and platelet release.

[0176] What is obtained in this step may be mature megakaryocytes, or a culture medium containing megakaryocytes and / or mature megakaryocytes.

[0177] The (mature) megakaryocyte obtained at this stage may have a polyploid number of chromosomes. The (mature) megakaryocyte may be tetraploid (4n), octaploid (8n), hexaploid (16n), thirtopaploid (32n), sixtopaploid (64n), or twelfthopaploid (128n).

[0178] Polyploid (mature) megakaryocytes are rich in cytoplasm and can synthesize large amounts of proteins and membrane components, which is advantageous for mass production of platelets.

[0179]

[0180] (S5) Step

[0181] Step (S5) is the step of obtaining platelets from the culture medium obtained in (S4).

[0182] This step may involve further differentiating the culture medium of (S4) and then isolating and / or purifying platelets from the culture medium, or isolating and / or purifying platelets from the culture medium without further differentiating the culture medium of (S4).

[0183] The separation and / or purification of platelets may be performed by known separation and / or purification methods. For example, it may be performed by centrifuging the culture medium or passing the culture medium through a column.

[0184] When the culture medium is centrifuged, megakaryocytes may be separated as a precipitate and platelets as a suspended solid.

[0185] Platelets obtained according to the method of the present invention have a high content of growth factors (SCF-R, TIMP-1, GDF-15, IGFBP-2, EGF, bFGF, etc.). Platelets obtained according to the method of the present invention contain not only growth factors secreted from natural platelets, but also various growth factors and cytokines involved in cell proliferation, angiogenesis, tissue regeneration, etc., at generally high levels.

[0186] Platelets obtained according to the method of the present invention have significantly higher content of BDNF, PDGF-AA, bFGF, EGF, GDF-15, IGFBP-2, SCF R, PDGF-BB, IL-8, MCSF, or TIMP-1 compared to human blood-derived platelets.

[0187] The present invention provides an artificial platelet having an increased concentration of any one growth factor selected from the group consisting of BDNF, PDGF-AA, bFGF, EGF, GDF-15, IGFBP-2, SCF R, PDGF-BB, IL-8, MCSF, and TIMP-1 compared to human-derived platelets.

[0188] Human-derived platelets, or human blood-derived platelets, refer to natural platelets obtained from human blood. They refer to platelets separated and purified from whole blood or platelet concentrate collected from a healthy donor.

[0189] In one embodiment, the human-derived platelet, or human blood-derived platelet, is a normal platelet without special manipulation or pathological abnormalities.

[0190] In one embodiment, human-derived platelets, or human blood-derived platelets, may have platelet characteristics within a clinically normal range.

[0191] The artificial platelet of the present invention comprises various growth factors, and includes at least one selected from the group consisting of, for example, BDNF, PDGF-AA, bFGF, EGF, GDF-15, IGFBP-2, SCF R, PDGF-BB, IL-8, MCSF, and TIMP-1.

[0192] The artificial platelet of the present invention may contain PDGF-AA at a concentration of 10 to 20 ng / ml. PDGF-AA may be contained in the artificial platelet, for example, at 10 to 20 ng / ml, 10 to 19 ng / ml, 10 to 18 ng / ml, 11 to 18 ng / ml, 11 to 17 ng / ml, 12 to 17 ng / ml, 13 to 17 ng / ml, 13 to 16 ng / ml, or 13 to 15 ng / ml.

[0193] The artificial platelets of the present invention may contain about 20 to about 50 times more PDGF-AA than human-derived platelets.

[0194] The artificial platelet of the present invention may contain PDGF-BB at a concentration of 4 to 8 ng / ml. PDGF-BB may be contained in the artificial platelet at, for example, 4 to 8 ng / ml, 4 to 7 ng / ml, 5 to 7 ng / ml, 5 to 6 ng / ml, or 5.5 to 6.5 ng / ml.

[0195] The artificial platelets of the present invention may contain about 1.5 to about 20 times more PDGF-BB compared to human-derived platelets.

[0196] The artificial platelet of the present invention may contain TGF-β at a concentration of 0.7 to 1.3 ng / ml. TGF-β may be contained in the artificial platelet at, for example, 0.7 to 1.3 ng / ml, 0.7 to 1.2 ng / ml, 0.8 to 1.2 ng / ml, 0.8 to 1.1 ng / ml, or 0.9 to 1.1 ng / ml.

[0197] The artificial platelets of the present invention may contain about 10 to about 30 times more TGF-β than human-derived platelets.

[0198] The artificial platelet of the present invention may contain bFGF at a concentration of 1.0 to 2.0 ng / ml. bFGF may be contained in the artificial platelet at, for example, 1.0 to 2.0 ng / ml, 1.0 to 1.9 ng / ml, 1.0 to 1.8 ng / ml, 1.1 to 1.8 ng / ml, 1.2 to 1.8 ng / ml, 1.3 to 1.8 ng / ml, 1.4 to 1.7 ng / ml, or 1.5 to 1.7 ng / ml.

[0199] The artificial platelets of the present invention may contain bFGF at a concentration of about 20 to about 40 times that of human-derived platelets.

[0200] Artificial platelets may contain EGF at a concentration of 0.1 to 0.5 ng / ml. EGF may be contained in artificial platelets at, for example, 0.1 to 0.5 ng / ml, 0.1 to 0.4 ng / ml, 0.15 to 0.4 ng / ml, 0.2 to 0.35 ng / ml, or 0.2 to 0.3 ng / ml.

[0201] In one embodiment, the artificial platelet of the present invention may contain EGF at an amount of about 1.0 to about 3.0 times that of human-derived platelets.

[0202] Artificial platelets may contain VEGF at a concentration of 0.1 to 0.5 ng / ml. TGF-β may be contained in artificial platelets at, for example, 0.1 to 0.5 ng / ml, 0.1 to 0.4 ng / ml, 0.15 to 0.4 ng / ml, 0.15 to 0.35 ng / ml, or 0.15 to 0.3 ng / ml.

[0203] In one embodiment, the artificial platelet of the present invention may contain VEGF at a level of about 1.0 to about 3.0 times compared to human-derived platelets.

[0204] In one embodiment, the artificial platelet of the present invention may be manufactured according to the manufacturing method described above.

[0205] The present invention provides a pharmaceutical composition for the treatment or prevention of bone diseases comprising the aforementioned artificial platelets.

[0206] The artificial platelet of the present invention has an increased concentration of any one growth factor selected from the group consisting of BDNF, PDGF-AA, bFGF, EGF, GDF-15, IGFBP-2, SCF R, PDGF-BB, IL-8, MCSF, and TIMP-1 compared to human-derived platelets.

[0207] The artificial platelet of the present invention contains various growth factors in high concentrations and includes at least one selected from the group consisting of, for example, BDNF, PDGF-AA, bFGF, EGF, GDF-15, IGFBP-2, SCF R, PDGF-BB, IL-8, MCSF, and TIMP-1.

[0208] Artificial platelets may contain GDF-15 at a concentration of about 2 to 5 times that of human-derived platelets.

[0209] Artificial platelets may contain about 2 to 4 times more TIMP-1 than human-derived platelets.

[0210] The artificial platelets of the present invention have excellent platelet activity.

[0211] Artificial platelets have excellent PAC-1 activity, which refers to platelet aggregation ability and functional activity status, and PAC-1 activity can be 60% or higher. When PAC-1 activity is high, the platelet activation ability and aggregation induction ability of the artificial platelets are excellent, so growth factor release is effectively achieved and the regeneration-promoting effect in damaged tissues is enhanced.

[0212] The PAC-1 activity of the artificial platelet of the present invention may be, for example, 60% or more, 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 68% or more, 69% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, or 90% or more.

[0213] The artificial platelet of the present invention has excellent CD62P activity, which indicates platelet activation and the ability to secrete physiologically active substances.

[0214] When CD62P activity is high, platelets are properly activated and can effectively secrete growth factors and cytokines.

[0215] The CD62P activity of the artificial platelets of the present invention is, for example, 50% or more, 51% or more, 52% or more, 53% or more, 54% or more, 55% or more, 56% or more, 57% or more, 58% or more, 59% or more, 60% or more, 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 68% or more, 69% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, It may be 88% or more, 89% or more, or 90% or more.

[0216] The artificial platelets of the present invention can increase the expression of anabolic factors that promote cartilage synthesis.

[0217] In one embodiment, the artificial platelet increases the expression of one or more selected from the group consisting of ACAN, COL2, and SOX9.

[0218] The artificial platelets of the present invention can reduce the expression of catabolic factors that induce cartilage degradation.

[0219] In one embodiment, the artificial platelet reduces the expression of one or more selected from the group consisting of MMP1, MMP3, and ADAMTS5.

[0220] The artificial platelets of the present invention can reduce the expression of inflammatory cytokines.

[0221] In one embodiment, the artificial platelet reduces the expression of any one or more selected from the group consisting of IL-6, IL-8, and IL-1β.

[0222] The artificial platelets of the present invention are rich in growth factors and have excellent platelet activity, so they can promote the regeneration of damaged bone, cartilage, and joint tissues and alleviate inflammatory responses, thereby enhancing the therapeutic effect of bone diseases.

[0223] In this specification, "bone disease" refers to a disease involving structural damage, degeneration, inflammation, impaired regeneration, or functional abnormalities occurring in bones, joints, cartilage, or tissues functionally associated with them. A bone disease may be one or more selected from the group consisting of, for example, osteoarthritis, traumatic arthritis, chondromalacia, chondrodysplasia, osteoporosis, and meniscal cartilage damage.

[0224] The composition according to the present invention promotes the anabolic activity of the extracellular matrix, inhibits catabolism and inflammatory responses, and provides a therapeutic effect in bone diseases requiring cartilage regeneration or restoration of function.

[0225] The pharmaceutical composition of the present invention may be prepared using pharmaceutically suitable and physiologically acceptable adjuvants in addition to artificial platelets, which are the active ingredient, or administered to a target individual.

[0226] As auxiliary agents, excipients, disintegrants, sweeteners, binders, coatings, leavening agents, lubricants, lubricants, or flavoring agents may be used.

[0227] The pharmaceutical composition of the present invention can preferably be formulated into a pharmaceutical composition by including one or more pharmaceutically acceptable carriers in addition to an amount of active ingredient that is pharmaceutically effective for administration.

[0228] "Pharmacologically effective dose" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors known in the medical field.

[0229] The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses.

[0230] The effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, gender, condition, body weight, absorption rate, inactivation rate, and excretion rate of the active ingredient in the body, the type of disease, and concomitant drugs. Generally, 0.001 to 150 mg, preferably 0.01 to 100 mg per kg of body weight, may be administered daily or every other day, or divided into 1 to 3 doses per day. Since the dosage may increase or decrease depending on the route of administration, severity of obesity, gender, body weight, age, etc., the dosage does not limit the scope of the present invention in any way.

[0231] In addition, "pharmaceuticalally acceptable" refers to a composition that is physiologically acceptable and, when administered to humans, does not typically cause allergic reactions or similar reactions such as gastrointestinal disturbances or dizziness.

[0232] Examples of carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. Additionally, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be further included.

[0233] The pharmaceutical composition of the present invention may be formulated using methods known in the art so as to provide rapid, sustained, or delayed release of the active ingredient after administration to an individual including humans. The formulation may be a powder, granule, tablet, emulsion, syrup, aerosol, soft or hard gelatin capsule, sterile injectable solution, or sterile powder.

[0234] The term 'individual' may be a vertebrate, preferably a mammal. The individual may be, for example, a human, monkey, pig, cow, horse, dog, cat, sheep, or mouse.

[0235] The pharmaceutical composition of the present invention may be administered orally or parenterally. When administered parenterally, it may be administered via external application to the skin or by intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or thoracic injection, but is not limited thereto.

[0236] The present invention provides a composition for tissue regeneration comprising the aforementioned artificial platelets. The 'tissue' may be any one selected from the group consisting of bone, cartilage, ligaments, tendons, skin, and blood vessels.

[0237] The tissue regeneration composition of the present invention can be used as a composition for a medical device that is directly applied to the human body to induce tissue regeneration, protection, or functional recovery. Specifically, the composition of the present invention can be manufactured in the form of an injectable, gel, patch, scaffold, implant coating, or support impregnated therein, and can be implemented as a medical device that is injected into an joint cavity, administered locally to a lesion site, or applied directly to a damaged tissue site.

[0238] The medical device of the present invention is characterized by inducing recovery of a tissue-damaged area through a physical and biological mechanism that promotes tissue regeneration by growth factors derived from artificial platelets and biocompatible materials, without relying on pharmacological, immunological, or metabolic action.

[0239] In one embodiment, the composition of the present invention may be classified as a medical device for regenerative purposes under the Medical Devices Act.

[0240] The present invention will be explained in more detail below with reference to examples.

[0241]

[0242] Examples

[0243] 1. Example 1

[0244] A. Preparation of Platelets

[0245] (1) Seeding of human induced pluripotent stem cells (S0)

[0246] Human induced pluripotent stem cells were seeded according to Fig. 1a to obtain a cell population capable of differentiating into megakaryocytes.

[0247] mTeSR plus culture medium was added to a T75 flask along with 10 µg / ml of ROCK inhibitor (Y-27632), and human induced pluripotent stem cells (hiPSCs) were placed at 5,500 cells / cm² on the bottom of the T75 flask. 2The cells were seeded at a density of and cultured at 37°C under 5% CO2 conditions. After 24 hours of culture, the cells were washed once with PBS to remove Y-27632 and replaced with fresh mTeSR plus culture medium. Human induced pluripotent stem cells were attached to the bottom of the flask by culturing for 3 days while changing the culture medium daily. Photographs of the culture medium on day 1 and day 3 are shown in Figure 1b.

[0248]

[0249] (2) Preparation of a culture medium containing human hematopoietic stem cells (S1)

[0250] A culture medium containing human hematopoietic stem cells (hHSC) was prepared according to the process and conditions of Fig. 2a.

[0251] First, attached human induced pluripotent stem cells (hiPSCs) were cultured in medium 3 for 2 days at 37°C under 5% CO2 conditions. Medium 3 was prepared by adding 6 μM of the GSK3 inhibitor CHIR99021 to RPMI1640 basal medium (containing 300 μM AA2P and 2% B-27). The medium was changed daily.

[0252] Subsequently, the third medium was replaced with the fourth medium, and culture was continued for 3 days at 37°C under 5% CO2 conditions. The fourth medium used was RPMI1640 basic medium (containing 300 μM AA2P and 2% B-27) supplemented with 50 ng / ml VEGF and 20 ng / ml bFGF. The medium was changed daily. After 3 days of culture, the cell confluence was approximately 70%. Subsequently, the cells were cultured for an additional 4 days in the fourth medium supplemented with 10 μM SB431542 (the fifth medium) to prepare a culture medium containing human hematopoietic stem cells (hHSCs). Photographs of the culture medium on days 2, 5, and 9 are shown in Figure 2b.

[0253]

[0254] (3) Obtaining a floating cell population (S2)

[0255] On the 9th day from the start of culture, the ratio of cells expressing specific surface markers (CD34, CD41a, CD42, and CD45) to the total number of suspension cells was determined through flow cytometry.

[0256] Flow cytometry analysis is BD's BD FACSLyric TM The analysis was performed using a flow cytometer. Anti-CD34-APC, anti-CD41a-FITC, anti-CD42b-PE, and anti-CD45-PE-Cy7 antibodies provided by BD were used for the analysis. Each antibody was incubated for 30 minutes in PBS (FACS buffer) containing 1% BSA, after which the expression of cell surface markers was confirmed. Through this, the proportion of cells expressing CD34 and CD45, and CD41a and CD42b alone or simultaneously, was measured, respectively.

[0257] As a result, CD34 relative to total cells + It was confirmed that the cell ratio was 97.36%, and at this point, a floating cell population was obtained from the culture medium (Fig. 3).

[0258] The proportion of cells expressing each surface marker in the obtained suspension cell population was as follows: CD45 + 58.22%; CD41a + 62.36%; and CD42b + 59.54%.

[0259]

[0260] (4) Differentiation into megakaryocytes and maturation (S3 and S4)

[0261] As shown in Fig. 4, the floating cell population is 1×10 5 They were added to the first medium at a density of 1 / ml and cultured at 37°C and 5% CO2 for 4 days to differentiate into megakaryocytes (S3).

[0262] Subsequently, the T75 flask was replaced with an Erlenmeyer flask having a baffle on the bottom, and the medium was changed from Medium 1 to Medium 2. In the changed Erlenmeyer flask, the initial megakaryocyte seeding concentration was 1.5 × 10⁶ 5 Megakaryocytes were matured by setting the cell / mL level and stirring at 120 rpm for 6 additional days at 37℃ and 5% CO2 (S4).

[0263] For the first medium, 50 ng / ml of TPO and 50 ng / ml of SCF were added to the commercial IMDM basic medium, and for the second medium, 50 ng / ml of TPO, 50 ng / ml of SCF, 25 unit / ml of heparin sodium and 1 μM of ROCK inhibitor (Y39983) were added to the IMDM basic medium with 15% FBS.

[0264]

[0265] (5) Platelet acquisition (S5)

[0266] The cell culture medium was collected and centrifuged at 300 xg for 3 minutes. The precipitate was separated into megakaryocytes, and the suspended matter into platelets. The platelets of the present invention were obtained from the suspended matter.

[0267] The platelet purification process of this embodiment is as shown in FIG. 12.

[0268]

[0269] B. Evaluation of megakaryocytes

[0270] The results of the analysis of surface markers of megakaryocytes obtained in step (S3) are shown in Table 1 below. Surface marker analysis was performed using the method described above.

[0271] (S3) Megakaryocyte surface marker cell ratio (%) CD41a + CD42b + CD45 + Example 189.3388.7536.77

[0272] Megakaryocytes from step (S3) were fixed in 70% ethanol at -20°C for 24 hours to perform cell membrane permeability treatment, then treated with RNase and reacted at 4°C for 30 minutes. Afterward, DNA was stained with PI (propidium iodide) staining reagent (4°C, 10 minutes), and the multinucleity (chromosome number) of the cells was analyzed using a flow cytometer. As a result of the analysis, a peak was observed in which the DNA content within the megakaryocytes increased from 2N to 16N, confirming that the chromosome number of the megakaryocytes in Example 1 increased to a maximum of 16-ploidy (Fig. 6).

[0273] The characteristics of the megakaryocytes obtained in step (S4) were analyzed. Electron microscopy of the cells confirmed structures present in megakaryocytes, such as a multilobed nucleus, alpha granules, and a demarcation membrane system (Fig. 7). When the chromosome number of mature megakaryocytes was determined using the same method, a peak was observed in which the intracellular DNA content increased from 2N to 128N, confirming the formation of high-double mature megakaryocytes (Fig. 8).

[0274]

[0275] C. Evaluation of Platelets

[0276] (1) Structural analysis of platelets

[0277] The structure of the cells obtained in step (S5) was observed using an electron microscope. The cells in step (S5) had structures present in platelets, such as microtubules, alpha granules, compact tubules, open tubular systems, and delta granules (Fig. 9).

[0278]

[0279] (2) Analysis of platelet count and surface markers

[0280] The expression of surface markers obtained from cells in step (S5) was confirmed by flow cytometry. Flow cytometry was performed using a BD FACSLyric™ Flow Cytometer, and BD's anti-CD41a-FITC, anti-CD61-PE, and anti-CD42b-APC antibodies were used. The antibodies were diluted 1:20 in PBS (FACS buffer) containing 1% BSA, reacted at room temperature for 30 minutes, and surface marker expression was confirmed.

[0281] (S5) The results of the analysis of the number of cells and their surface markers in step (S5) are as shown in Table 2 below.

[0282] Differentiated platelet count (x10 6 PLT / mL) Cell Ratio (%) CD41a + CD42b + CD61 + Example 19.791.392.296.2

[0283]

[0284] (3) Confirmation of platelet activity

[0285] The activity of the platelets obtained in step (S5) was confirmed. Platelet activity was confirmed through the expression levels of PAC-1 and CD62P. PAC-1 is a monoclonal antibody formed by the complex of CD41 and CD61 when platelets are activated, and CD62P is a cell surface adhesion molecule whose expression increases when platelets are activated, providing a site for leukocytes to bind to platelets.

[0286] Cells were treated with 400 ng / mL of PMA and incubated at room temperature for 15 minutes, after which BD’s anti-PAC-1-FITC and anti-CD62p-PE antibodies were incubated for 30 minutes. Subsequently, flow cytometry was performed on the reacted cells.

[0287] The expression levels of PAC-1 and CD62p in the platelets obtained in step (S5) are as shown in Table 3 below.

[0288] Platelet activity (%) PAC-1CD62P Example 180.972.9

[0289] (S5) The platelets at stage had very high expression levels of PAC-1 and CD62p. This indicated that the platelets of Example 1 were high-quality platelets with excellent activity as platelets.

[0290]

[0291] D. Analysis of characteristics of the suspension cell population after freezing and thawing

[0292] (S2) It was confirmed whether high-quality platelets could be produced even after freezing and thawing the suspension cell population obtained in step (S2).

[0293] The suspension cell population obtained in step (S2) was passed through a 70 µm mesh to remove clumped adhered cells. The resulting cell culture medium was centrifuged at 500xg for 5 minutes to precipitate the cells. The supernatant was removed, and the cells were washed with a small amount of PBS and centrifuged again. Subsequently, the supernatant was removed, and the cells were placed in CS10 cryopreservation medium at a rate of 2 x 10⁶ 7 1 mL was dispensed into 1.8 mL cryovials to achieve a cell / mL ratio. The cryovials were placed in freezing containers and stored in a -70°C ultra-low temperature freezer; after 24 hours, they were transferred to a -180°C liquid nitrogen storage container for frozen storage.

[0294] Frozen cells were thawed in a 37°C water bath, a small amount of cell proliferation medium was added, and the cells were centrifuged. The precipitated cells were recirculated using cell proliferation medium and transferred to a flask for culture. Using the same method as above, the ratio of cells expressing a specific surface marker to the total number of flow cells was determined.

[0295] As a result, the floating cell population CD34 even after freezing and thawing + Cell ratio 94.30%, CD45 + Cell ratio 44.89%, CD41a+ Cell ratio 57.82%, CD42b + It was confirmed that the characteristics were substantially the same as the cell ratio was maintained at 53.8% (Figs. 5a and 5b).

[0296]

[0297] 2. Examples 2-4 and Comparative Examples 1-2

[0298] Seeding density of human induced pluripotent stem cells CD34 of the floating cell population + To determine the effect on the cell ratio, the seeding density of human induced pluripotent stem cells in step (S0) of Example 1 was set to 6,000 to 10,000 cells / cm² as shown in Table 1 below. 2 Platelets of Examples 2-4 and Comparative Examples 1-2 were prepared by changing the method.

[0299] For the platelets of Examples 2-4 and Comparative Examples 1-2, the remaining steps (S1) to (S5) were performed in the same manner as in Example 1, except that the seeding density of human induced pluripotent stem cells in step (S0) was changed.

[0300] The ratio of cells expressing each surface marker in the suspension cell population at the 9th day from the start of culture in each (S2) step of Examples 2-4 and Comparative Examples 1-2 was as shown in Table 4 below.

[0301] Classification Example 2 Example 3 Example 4 Comparative Example 1 Comparative Example 2 Cell density (cells / cm²) 2 )6,000 7,000 8,000 9,000 10,000 (S2) Cell ratio of floating cell population (%) CD34 + 97.3393.9893.4588.6179.47CD45 + 33.2934.0827.9522.7924.17CD41a + 64.9360.7363.1960.4349.09CD42b + 53.7147.9443.5542.1628.95

[0302] Accordingly, CD34 of the floating cell population +To maintain a cell ratio of over 90%, 9,000 cells / cm² of (S0) stage human induced pluripotent stem cells 2 It was possible to see that seeding had to be done at a level below.

[0303]

[0304] 3. Examples 5-11 and Comparative Examples 3-6

[0305] To determine the effect of the composition of the first medium on differentiation ability into megakaryocytes, the composition of the first medium in step (S3) of Example 1 was changed as shown in Table 5 below, and platelets of Examples 5-11 and Comparative Examples 3-6 were prepared. The remaining processes and conditions were performed in the same manner as in Example 1.

[0306] First Medium Preliminary Comparative Example 5678910113456 Basic Medium IMDMTPO(ng / ml)505050505050505050505050SCF(ng / ml)505050505050505050505050FLT-3L(ng / ml)101010-10---101010SR1(μmol)11-1-1-1111AA2P(μmol)300-300300--300300300300-G-CSF(ng / ml)-------10-1010IL-3(ng / ml)-------1010-10IL-6(ng / ml)-------1010-10

[0307] The results of analyzing the surface markers of megakaryocytes obtained in each (S3) step of Examples 5-11 and Comparative Examples 3-6 are as shown in Table 6 below.

[0308] (S3) Megakaryocyte surface marker cell ratio (%) CD41a + CD42b + CD45 +Example 583.9282.9040.90 Example 683.0783.2339.29 Example 789.1288.3739.32 Example 883.1682.1941.69 Example 988.7087.8537.97 Example 1084.0283.6638.70 Example 1190.2889.6636.76 Comparative Example 345.4050.3075.66 Comparative Example 452.3956.6474.47 Comparative Example 563.2366.6363.35 Comparative Example 651.8755.8769.71

[0309] The examples compared to the comparative examples CD41a + and CD42b + Megakaryocytes with a high cell ratio were produced, and accordingly, it was confirmed that megakaryocytes with excellent differentiation ability into platelets were produced when the first medium of the examples was used.

[0310] Based on the surface marker analysis results for the comparative example, it is determined that the addition of G-CSF, IL3, and IL6 actually inhibits differentiation into megakaryocytes.

[0311] The number of platelets and surface markers of Examples 5-11 were analyzed using the same method as in Example 1. The results of the analysis of the number of platelets and surface markers of Examples 5-11 are shown in Table 7 below.

[0312] Differentiated platelet count (x10 6 PLT / mL) Cell Ratio (%) CD41a + CD42b + CD61 + Example 5 13.679.183.590 Example 69.983.486.492 Example 7 10.481.583.991.5 Example 8 12.190.491.795.5 Example 9 12.489.790.495.3 Example 10 11.590.591.895.7 Example 11 11.689.390.895.4

[0313] All platelets in Examples 5-11 were of excellent quality. It was confirmed that cell growth was promoted when FLT-3L, SR1, AA2P, etc. were additionally added to the first medium.

[0314]

[0315] 4. Examples 12-16

[0316] To determine the effect of the composition of the second medium on platelet production, platelets were produced by changing the density of megakaryocytes introduced into the second medium of Example 1 and the concentration of Y39983 included in the second medium as shown in Table 8 below.

[0317] Classification Example 1 2 1 3 1 4 1 5 1 6 Megakaryocyte input density (cell / mL) 1.5 × 10⁻⁶ 5 2.0×10 5 1.5×10 5 2.0×10 5 2.0×10 5 Y39983(μmol)0.51235

[0318] The results of analyzing the number of platelets, surface markers, and their cellular activity in Examples 12-16 are as shown in Table 9 below.

[0319] Differentiated platelet count (x10 6 PLT / mL) Cell Ratio (%) Cell Activity (%) CD41a + CD42b + CD61 + PAC-1 Example 1 25.091.392.296.258.0 Example 1 38.979.183.59060.3 Example 1 45.883.486.49253.9 Example 1513.290.491.795.551.7 Example 1611.990.591.895.749.6

[0320] All platelets of Examples 12-16 had abundant expression of platelet surface markers and were of excellent platelet quality.

[0321]

[0322] 5. Examples 17-22

[0323] To evaluate the effect of the type of culture vessel and stirring speed used in step (S4) on platelet production, the bottom baffle structured triangular flask used in Example 1 was replaced with a Bioreactor. Subsequently, platelets were produced by changing the stirring speed according to the conditions presented in Table 10, and mechanical stress (shear force) was applied to the cells in step (S4) by gradually increasing the stirring speed.

[0324]

[0325] The results of analyzing the number of platelets and surface markers of Examples 17 to 22 are as shown in Table 11 below.

[0326] Cell Ratio (%) Cell Activity (%) CD41a+ CD42b+ CD61+ PAC-1 Example 1 791.892.983.154.7 Example 1894.795.190.757.1 Example 1993.093.786.149.3 Example 2096.696.592.963.1 Example 2183.682.292.457.3 Example 2288.880.992.258.9

[0327] The platelets of Examples 17-22 were all of excellent quality. It was confirmed that platelet production proceeded well not only in flasks but also in bioreactors.

[0328]

[0329] 6. Comparative Example 7

[0330] mTeSR plus culture medium was added to a T75 flask along with 10 µg / ml of ROCK inhibitor (Y-27632), and human induced pluripotent stem cells (hiPSCs) were placed at 4,000 cells / cm² on the bottom of the T75 flask. 2 The cells were seeded at a density of [value] and cultured under conditions of 37°C and 5% CO2. After 24 hours of culture, the cells were washed once with PBS to remove Y-27632 and replaced with fresh mTeSR plus culture medium. Human induced pluripotent stem cells were attached to the bottom of the flask by culturing for 3 days while changing the culture medium daily.

[0331] Subsequently, the attached human induced pluripotent stem cells (hiPSCs) were cultured in medium A at 37°C and 5% CO2 for 2 days. Medium A was prepared by adding 6 μM of the GSK3 inhibitor CHIR99021 to RPMI1640 basal medium (containing 300 μM AA2P and 2% B-27). The medium was changed daily.

[0332] Afterwards, medium A was replaced with medium B, and culture was continued for 3 days at 37°C and 5% CO2. Medium B was prepared by adding 50 ng / ml VEGF and 20 ng / ml bFGF to RPMI1640 basic medium (containing 300 μM AA2P and 2% B-27). The medium was replaced daily. Subsequently, culture was further conducted for 4 days in medium (medium C) to which 10 μM SB431542 was added to medium B to prepare a culture medium containing human hematopoietic stem cells (hHSC).

[0333] On the 9th day from the start of culture, the ratio of cells expressing specific surface markers (CD41a and CD45) to the total number of suspension cells was determined via flow cytometry, and CD41a relative to the total cells + It was confirmed that the cell ratio was 82.74%, and at this point, a floating cell population was obtained from the culture medium.

[0334] The proportion of cells expressing each surface marker in the obtained suspension cell population was as follows: CD45 + 8.57%; and CD34 + 77.01%.

[0335] The obtained suspension cell population is 1×10 5 The cells were introduced into medium D at a density of cells / mL and cultured at 37°C and 5% CO2 for 3 days to differentiate into megakaryocytes. Afterward, the medium D was changed to medium E and cultured for an additional 5 days at 37°C and 5% CO2 to mature the megakaryocytes.

[0336] For medium D, IMDM basic medium containing 300 µM AA2P and 2% B-27 was supplemented with 25 ng / ml TPO, 25 ng / ml SCF, 10 ng / ml IL-3, and 10 ng / ml IL-6, and for medium E, IMDM basic medium containing 300 µM AA2P and 2% B-27 was supplemented with 100 ng / ml TPO.

[0337] The cell culture medium was collected and centrifuged at 300 xg for 3 minutes. The precipitate was separated into megakaryocytes, and the suspended matter into platelets. Platelets of Comparative Example 7 were obtained from the suspended matter.

[0338]

[0339] 7. Comparative analysis of growth factors in Example 1 and commercially available platelets

[0340] The type and content of growth factors contained in the platelets of Example 1 are commercially available human blood-derived platelets (PLTGold ® It was compared with ).

[0341] Platelets and PLTGold of Example 1 ® The sample was placed in a cell lysis buffer treated with 1% each of a protease inhibitor and a phosphatase inhibitor, frozen and thawed at -80°C for at least 20 minutes for at least 3 times, and the supernatant was obtained by centrifugation.

[0342] All samples were standardized to 1 mg / ml through quantitative analysis using a BCA protein analysis kit (Pierce). Trend analysis of various growth factors contained in each sample was performed using a Quantibody array (Raybiotech). Samples standardized to 1 mg / ml were analyzed according to the method provided by the manufacturer, and the results were analyzed using a GenePix 4100A scanner (Axon instrument). The results are shown in Table 12 below.

[0343] Growth Factor Content (pg / ml) Growth Factor Content (pg / ml) Example 1 PLTGold Example 1 PLTGold AR3 3.4 115.2 BLC 0.3 0.7 BDNF 219.7 54.7 Eotaxin 3.0 2.4 bFGF 257.4 10.0 Eotaxin-211.5 33.1 BMP-422.3 41.4 G-CSF 4.9 2.1 BMP-516 5.0 1,266.3 GM-CSF 72.0 21.0 BMP-720 8.2 1,576.5 I-309 32.0 25.8 b-NGF 0.6 3.8 ICAM-11.2 10.1 3,226.8 EGF 14.9 5.1 IFNg 14.2 8.2 EGF R470.6402.0IL-1a21.311.8EG-VEGF3.034.3IL-1b8.44.4FGF-452.1282.0IL-1ra35.620.5FGF-719.3114.3IL-2959.2200.0GDF-151 43.440.3IL-412.03.0GDNF10.576.6IL-5817.7356.4GH31.9155.1IL-672.630.3HB-EGF1.56.3IL-6R243.0395.6HGF14.633.5IL-7684 .9202.2IGFBP-121.744.8IL-878.99.3IGFBP-229,656.48,429.7IL-1033.53.3IGFBP-3331.12,214.9IL-11343.5110.3IGFBP-419.62 17.8IL-12p4025.215.2IGFBP-6127.81545.6IL-12p7014.16.9IGF-I65.0211.8IL-131.00.3Insulin138.7524.9IL-1573.7104.7MCSF R33.9706.6IL-16129.7105.8NGF R61.4119.8IL-1715.75.5NT-318.5102.1MCP-14.72.6NT-459.2383.5MCSF3.30.3OPG1.48.1MIG24.8 22.6PDGF-AA1,469.4358.3MIP-1a4.07.2PIGF1.48.6MIP-1b1.00.8SCF90.257.5MIP-1d19.738.7SCF R3,869.3642.4PDGF-BB754.3448.8TGFa1.59.6RANTES4,957.45,510.3TGFb1114.1525.4TIMP-134,302.519,662.7TGFb326.2170.3TIMP-2364.78,242.1VEGF236.8124.3TNFa145.794.5VEGF R2390.3961.6TNFb327.4127.1VEGF R3122.1840.6TNF RI58.956.3VEGF-D62.9198.8TNF RII43.6180.9.

[0344] As shown in Table 12, the artificial platelets of Example 1 contain more BDNF, PDGF-AA, bFGF, EGF, GDF-15, IGFBP-2, SCF R, PDGF-BB, IL-8, MCSF, and TIMP-1 compared to human blood-derived platelets.

[0345] The artificial platelets of Example 1 contain bFGF, GDF-15, IGFBP-2, and SCF R at concentrations approximately 3 times higher and TIMP-1 at concentrations approximately 1.5 times higher than human blood-derived platelets. Accordingly, the artificial platelets of the present invention are expected to have excellent angiogenesis and tissue regeneration effects.

[0346] The artificial platelets of Example 1 also contain inflammatory and immunomodulatory factors such as IL-8 and MSCF at significantly increased concentrations compared to human blood-derived platelets.

[0347]

[0348] 8. Comparative analysis of growth factors in Example 1 and human-derived platelets

[0349] The content of major growth factors contained in the platelets of Example 1 was calculated through ELISA analysis and compared with human-derived platelets.

[0350] Human-derived platelets (hbPLT) were obtained as follows. Blood was collected from a donor at the Catholic University of Korea St. Mary's Hospital with the approval of the Institutional Review Board (IRB) (Approval No. CPT 2022-01). The human blood obtained through collection was placed in a conical tube, centrifuged at 150 g for 10 minutes to separate the supernatant, and transferred to a new conical tube. Subsequently, an equal volume of Tyrode buffer containing prostaglandin E-1 (PGE-1) at a concentration of 50 ng / mL was added, and the supernatant was removed by centrifugation at 2000 g for 10 minutes. Afterward, the sample was resuspended in T-PAS buffer or Tyrode buffer and used for analysis.

[0351] ELISA kits for each growth factor were used for the quantitative analysis of PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF. The results of the analysis, performed according to the methods provided by each manufacturer, were measured using SpectraMAX M2.

[0352] As a result, it was confirmed that artificial platelets contain a wider variety of growth factors at significantly higher concentrations compared to human blood-derived platelets (hbPLT) (Fig. 11, Table 13).

[0353] Growth factor concentration (pg / ml) Human blood-derived platelets (hbPLT) Platelets of Example 1 PDGF-AA83013,800 PDGF-BB4105,900 EGF40280 TGF-b501,100 bFGF<0.011,643 VEGF10210

[0354] As shown in Table 13, the manufactured artificial platelets contained PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF at high concentrations ranging from at least 7 times to up to about 20 times higher than human blood-derived platelets.

[0355]

[0356] 9. Evaluation of chondrocyte protective effect (in vitro)

[0357] Human articular chondrocytes were purchased from Cell Applications. To ensure the functionality of the chondrocytes, three-dimensional culture was performed using alginate beads. The chondrocytes were encapsulated in the beads and cultured for 14 days to induce re-differentiation before being used in the experiment. All chondrocytes used in the experiment were from passage 10 or lower.

[0358] To induce osteoarthritis in vitro, an osteoarthritis model was established by treating redifferentiated chondrocytes with IL-1β at a concentration of 10 ng / mL for 24 hours. Subsequently, 1 × 10⁶ human blood-derived platelets (hbPLT) were introduced into the osteoarthritis model. 8 Treat at a concentration of PLTs / mL, or 1×10⁶ platelets of Example 1 8 PLTs / mL or 2×10 8 Each was treated at a PLTs / mL concentration for 48 hours. After treatment, chondrocytes were obtained by degrading the beads with EDTA, and mRNA and protein analysis were performed using the obtained chondrocytes.

[0359]

[0360] (1) mRNA analysis (real-time PCR)

[0361] For mRNA analysis, total RNA was extracted from chondrocytes using an RNA extraction kit (Invitrogen) according to the manufacturer's instructions, and cDNA was synthesized using a cDNA synthesis kit (Applied Biosystems). The synthesized cDNA was analyzed by real-time PCR, and the expression of anabolic factors related to cartilage synthesis—Aggrecan (ACAN), Collagen Type II (COL2), and SOX9—as well as catabolic factors related to cartilage degradation—MMP1, MMP3, and ADAMTS5—and inflammatory cytokines—IL-6, IL-8, and IL-1β—were analyzed, respectively. The primers and PCR conditions used for the analysis are shown in Table 14 below.

[0362] Primer Name Sequence (5'→3') Annealing Temperature (°C) Product Size Accession No. ACAN (for)CTGCATTCCACGAAGCTAACCT(Sequence No. 1)6085bpBC150624ACAN (rev)GACGCCTCGCCTTCTTGAA(Sequence No. 2)Col2a1 (for)CTACTGGATTGACCCCAACCAA(Sequence No. 3)6063bpNM_001844Col2a1 (rev)TCCATGTTGCAGAAAACCTTCA(Sequence No. 4)SOX9 (for)GACTTCTGAACGAGAGCGAGA(Sequence No. 5)60124bpNM_000346SOX9 (rev)CCGTTCTTCACCGACTTCCTC(Sequence No. 6)MMP1 (for)AAGGCCAGTATGCACAGCTT(Sequence No. 7)6089bpNM_002421.4MMP1 (rev)TGTGTTTCTAGAGTCGCTGGG(Sequence No. 8)MMP3 (for)ATCCTACTGTTGCTGTGCGT(Sequence No. 9)6082bpNM_002422.5MMP3 (rev)GGTTCATGCTGGTGTCCTCA(Sequence No. 10)ADAMTS5(for)AAAGGGGAGAATCTGCCTGC(Sequence No. 11)6091bpNM_007038.5ADAMTS5(rev)CCAAGATCCCCAGTTGCCAT(Sequence No. 12)GAPDH (for)GAAATCCCATCACCATCTTCCA(Sequence No. 13)6061bpNM_002046.7GAPDH (rev)CCAGCATCGCCCCACTT(Sequence No. 14)IL-6 (for)CCACCGGGAACGAAAGAGAA(Sequence No. 15)6092bpNM_000600.5IL-6 (rev)GAGAAGGCAACTGGACCGAA(Sequence No. 16)IL-8 (for)CTCCAAACCTTTCCACCCCA(Sequence No. 17)60153bpBT007067.1IL-8 (rev)TTCTCCACAACCCTCTGCAC(Sequence No. 18)IL-1b (for)AACCTCTTCGAGGCACAAGG(Sequence No. 19)60107bpNM_000576.3IL-1b (rev)GGCGAGCTCAGGTACTTCTG(Sequence No. 20).

[0363] As a result, in an in vitro model of osteoarthritis, the group treated with the platelets of Example 1 showed a significant increase in mRNA expression of anabolic factors ACAN, COL2, and SOX9, while mRNA expression of catabolic factors MMP1, MMP3, and ADAMTS5 and inflammatory cytokines IL-6, IL-8, and IL-1β showed a decreasing trend (Figs. 13a to 13c). From these results, it was confirmed that the artificial platelets of the present invention can exhibit a protective effect on chondrocytes by promoting the synthesis of chondrocytes and suppressing chondrogenesis and inflammatory responses even under inflammatory stimulation.

[0364]

[0365] (2) Protein analysis (Western blot)

[0366] Protein expression in chondrocytes obtained after treatment with human-derived platelets (hbPLT) or the platelets of Example 1 in the above osteoarthritis in vitro model was analyzed. For protein extraction, the chondrocyte samples were lysed in RIPA buffer solution under low-temperature conditions for 10 minutes, and then centrifuged to recover the supernatant, thereby obtaining protein samples.

[0367] The protein concentration of the obtained protein samples was quantified using a protein quantification kit (BCA protein assay kit, Pierce), and after standardization to the same protein amount, a western blot assay was performed. The protein expression results obtained from the western blot were quantitatively analyzed using the ImageJ program.

[0368] As a result, in cells treated with the platelets of Example 1, the protein expression of anabolic factors ACAN and SOX9, which are involved in cartilage matrix synthesis, increased, while the protein expression of catabolic factors MMP1 and MMP3, which are involved in cartilage degradation, decreased (Fig. 14). In addition, the expression of TIMP, an extracellular matrix degrading enzyme inhibitor, increased.

[0369] In addition, the activation of the NF-κB signaling pathway was inhibited by treatment with the artificial platelets of the present invention. From this, it was confirmed that the artificial platelets of the present invention exhibit a protective effect on chondrocytes by promoting cartilage matrix synthesis and inhibiting cartilage degradation and inflammatory signals under osteoarthritis conditions.

[0370]

[0371] 10. Evaluation of the effect of relieving osteoarthritis pain

[0372] To prepare an animal model of osteoarthritis, rats were placed under inhalation anesthesia, the hair on the right hind leg was removed, and the skin was incised from the distal patella to the proximal tibial plate to expose the anterior cruciate ligament. Subsequently, an anterior cruciate ligament transection (ACLT) was performed to resect the anterior cruciate ligament and suture the joint capsule and surrounding muscles, and osteoarthritis was induced for 8 weeks after the surgery. 1 × 10⁶ of the platelets from Example 1 or human blood-derived platelets (hbPLT), respectively, were introduced into the joint cavity of the osteoarthritis-induced animals. 9 50 μL was administered at a concentration of PLTs / mL.

[0373] A weight-bearing test was performed to evaluate the pain-relieving effect associated with osteoarthritis. After administering artificial platelets or blood-derived platelets to the leg with induced osteoarthritis, weight bearing on the hind leg was measured at 4 and 8 weeks after administration. Weight bearing was analyzed by measuring the load applied to each hind leg while the animal was in a stable position on separate weighting plates using an incapacitance test meter, thereby assessing the degree of pain caused by osteoarthritis.

[0374] In addition, sensitivity to pain was evaluated using the von Frey test. After administering the platelets of Example 1 or blood-derived platelets to a leg with induced osteoarthritis, mechanical pain sensitivity was measured by stimulating the animal's sole with a filament in a wire grid test chamber at 4 weeks after administration and recording the force of the filament that induced a response.

[0375] As a result, in an osteoarthritis model, the group administered with the platelets of Example 1 showed significant recovery in weight-bearing performance during the weight-bearing test compared to the group administered with human-derived platelets, confirming that pain could be alleviated. In addition, the results of the von Frey test showed that mechanical pain sensitivity decreased in the group administered with the platelets of Example 1 (Fig. 15).

[0376]

[0377] 11. Evaluation of Tissue Regeneration Effects for Osteoarthritis

[0378] After administering the platelets of Example 1 or human blood-derived platelets (hbPLT) into the joint cavity of experimental animals with induced osteoarthritis, the tibial joint was isolated at 8 weeks after administration. The isolated tibial joint tissue was fixed in a 10% neutral formalin solution, decalcified, and embedded in a paraffin block, and then sections were prepared in the sagittal direction to produce slides.

[0379] The prepared slides were stained with Hematoxylin and Eosin (H&E) and Safranin O to analyze histological changes in articular cartilage. Specifically, the degree of structural damage to the articular cartilage was evaluated through H&E staining, and the proteoglycan content and extracellular matrix synthesis levels within the cartilage were evaluated through Safranin O staining. The degree of histological damage to the articular cartilage was quantitatively assessed using the MANKIN's score. The MANKIN's score was evaluated according to Table 15 below.

[0380] Category Score Structure Normal 0 Surface irregularities 1 Cells Pannus and surface irregularities 2 Clefts to transitional zone 3 Matrix staining Clefts to calcified zone 4 Cell disorganization 5 Tidemark integrity Normal 0 Diffuse hypercellularity 1 Clustering 2 Hypocellularity 3 Normal 0 Slight reduction 1 Moderate reduction 2 Severe reduction 3 No staining 4 Intact 0 Destroyed 1

[0381] As a result, H&E staining results confirmed that in the group administered the platelets of Example 1, the surface structure of the articular cartilage was maintained and structural damage was alleviated (Fig. 16). In addition, Safranin O staining results confirmed that the staining intensity of proteoglycans in the cartilage tissue increased in the group administered the platelets of Example 1, indicating that extracellular matrix synthesis was promoted. This histological improvement effect was also confirmed by a significant decrease in the Mankin score compared to the osteoarthritis model. The platelets of Example 1 can induce the regeneration of cartilage tissue in osteoarthritis animals by alleviating structural damage to articular cartilage and promoting extracellular matrix synthesis.

[0382]

[0383] 12. Evaluation of the effects of platelet administration dosage

[0384] An animal model of osteoarthritis induced by anterior cruciate ligament resection (ACLT) used in ‘10. Evaluation of Osteoarthritis Pain Relief Effect’ was used, and the platelets of Example 1 were administered at different concentrations to evaluate the dose-dependent effects.

[0385] 2×10⁶ platelets of Example 1 at different concentrations were injected into the joint cavity of an animal model of osteoarthritis induced. 8 PLTs / mL(Low), 1×10 9 PLTs / mL (Middle) and 2×10 9 50 μL each was administered at PLTs / mL (High).

[0386]

[0387] (1) Gait analysis

[0388] Eight weeks after the platelet administration of Example 1, gait analysis was performed using the Rodent Gait Fine Analysis System (SANS Biotechnology, China). The degree of gait impairment was evaluated by filming the test animals walking naturally on a walking track and analyzing the support area of ​​the feet.

[0389] As a result, in an animal model of osteoarthritis, the group administered the platelets of Example 1 showed alleviation of gait impairment compared to the control group regardless of the dosage administered, and in particular, the support area of ​​the foot recovered to a level close to that of the control group without osteoarthritis (Figs. 17a to 17b).

[0390]

[0391] (2) Weight-bearing test and pain sensitivity evaluation (von Frey test)

[0392] After administering the platelets of Example 1 or human blood-derived platelets to the leg with induced osteoarthritis, weight bearing on the hind leg was measured at 4 and 8 weeks after administration. Weight bearing was analyzed by measuring the load applied to each hind leg while the animal's posture was stable on left and right weight bearing plates using an incapacitance test meter, thereby assessing the degree of pain caused by osteoarthritis. Additionally, after administering the platelets of Example 1 or blood-derived platelets to the leg with induced osteoarthritis at various doses, mechanical pain sensitivity was measured at 4 and 8 weeks after administration by stimulating the animal's paw pad with a filament in a wire grid test chamber and recording the force of the filament that induced a response.

[0393] When the platelets of Example 1 were administered, body weight was restored to near the level of the normal control group over 8 weeks, and pain sensitivity was also significantly reduced. In addition, the above effects were enhanced as the dosage of platelets administered increased (Fig. 18).

[0394]

[0395] (3) Histological analysis

[0396] After administering the platelets of Example 1 or blood-derived platelets to a leg with induced osteoarthritis, the tibial joint was isolated at 8 weeks after administration. The isolated tissue was fixed in a 10% neutral formalin solution, decalcified, and embedded in a paraffin block. Subsequently, sagittal sections were prepared to produce slides. The prepared slides were stained with H&E and Safranin O to evaluate the structural damage of the articular cartilage and the degree of proteoglycan synthesis, and were quantitatively analyzed using the Mankin score.

[0397] As a result, it was confirmed that in the group administered the platelets of Example 1, structural damage to articular cartilage was alleviated and extracellular matrix synthesis was promoted through an increase in safranin 0 staining intensity. This histological improvement effect was also confirmed by a significant decrease in the Mankin score (Fig. 19).

[0398]

[0399] 13. Example 1 Evaluation of the protective effect of platelet-derived growth factor on chondrocytes

[0400] To evaluate the protective effect of the growth factors contained in the platelets of Example 1 on chondrocytes, PDGF-AA, PDGF-BB, GDF15, TGF-β, and TIMP were selected as candidate growth factors based on the results of the growth factor analysis of artificial platelets. Each growth factor was used at concentrations of PDGF-AA 10 ng / mL, PDGF-BB 50 ng / mL, GDF15 100 ng / mL, TGF-β 20 ng / mL, and TIMP1 100 ng / mL.

[0401] In an in vitro model of osteoarthritis using chondrocytes, samples were obtained 48 hours after each of the selected growth factors were treated. mRNA was extracted from the obtained chondrocytes, and the mRNA expression of ACAN and collagen type II alpha 1 (COL2A1), which are involved in cartilage matrix synthesis, ADAMTS5 and MMP3, which are involved in cartilage degradation, and the inflammatory cytokines IL-6 and IL-8 was analyzed by real-time PCR.

[0402] As a result, in the groups treated with GDF15 and PDGF-BB, the mRNA expression of ACAN and COL2A1, which are involved in extracellular matrix synthesis in damaged chondrocytes, increased, while the mRNA expression of MMP3 and ADAMTS5, which are extracellular matrix degrading enzymes, showed a decreasing trend. In addition, the mRNA expression of the inflammatory cytokines IL-6 and IL-8 also showed a decreasing trend (Figs. 20a to 20c).

[0403] From this, it was confirmed that among the growth factors included in the platelets of Example 1, GDF15 and PDGF-BB are key factors contributing to the protective effect on chondrocytes by promoting extracellular matrix synthesis in chondrocytes in an osteoarthritis-like environment and suppressing cartilage degradation and inflammatory responses. Therefore, the composition of the present invention can be usefully used for the prevention or treatment of bone diseases requiring cartilage regeneration or functional recovery by including the above growth factors.

[0404]

[0405] 14. Comparison of the therapeutic effects of platelets on osteoarthritis in Example 1 and Comparative Example 7

[0406] The protective effects of cartilage cells in Example 1 and Comparative Example 7 were compared and analyzed. The expression of platelet-specific markers in Comparative Example 7 is as shown in Table 16 below.

[0407] Expression level (%) CD41a CD42b CD61PAC-1 CD62P 89.5566.8291.7850.7841.02

[0408] After treating an in vitro model of osteoarthritis using chondrocytes with platelets from Example 1 and Comparative Example 7, respectively, the protective effect on chondrocytes was evaluated. After a certain period of time following treatment, chondrocytes were obtained, mRNA was extracted, and the expression of factors related to the production or degradation of the cartilage matrix was analyzed through real-time PCR.

[0409] As a result, in the group treated with the platelets of Example 1, mRNA expression of ACAN and COL2 was significantly increased, while mRNA expression of ADAMTS5 and MMP3 was significantly decreased. In contrast, in the group treated with the artificial platelets of Comparative Example 7, the increase in expression of ACAN and COL2 was negligible or not observed, and the inhibitory effect on the expression of ADAMTS5 and MMP3 was also limited (Fig. 21).

[0410] Therefore, it was confirmed that the platelets of Example 1 can provide a superior effect in the prevention or treatment of osteoarthritis by expressing platelet-specific surface markers at a high level.

[0411]

[0412] 15. Evaluation of the effect on improving bone diseases

[0413] 1×10⁶ platelets of Example 1 into the joint cavity of an animal model with induced osteoarthritis for 8 weeks 9 50 μL was administered at a concentration of PLTs / mL. At 8 weeks after platelet administration, the experimental animals were necropsied, and right tibial joint tissue fixed in neutral formalin was obtained.

[0414] Bone structure analysis was performed on the obtained tibial joint tissue using micro-computed tomography (micro-CT). Bone structure analysis was performed using a SkyScan 1273 system (Bruker), and bone volume, trabecular thickness, trabecular separation, trabecular number, and bone mineral density were measured.

[0415] As a result, in an animal model of osteoarthritis, the group administered artificial platelets showed an increase in bone volume and bone mineral density, and a tendency for trabecular thickness and the number of trabecular bones to increase compared to the control group, while the spacing between trabecular bones showed a tendency to decrease. These results indicate that bone structural damage is alleviated and bone microstructure is improved by the administration of platelets according to the present invention (Figs. 22a and 22b).

[0416]

[0417] 16. Confirmation of skin regeneration effect

[0418] Human dermal fibroblasts were inoculated into a culture vessel at a density of 3.5 × 10⁴ cells / cm² and cultured for 24 hours at 37°C under 5% CO₂ conditions to simulate a skin environment. Subsequently, an in vitro scratch wound model was formed by inducing physical damage by scraping the surface of the cultured fibroblasts using a micropipette tip.

[0419] After inducing injury, the cell surface was washed with phosphate-buffered saline, and then treated with fetal bovine serum (FBS) and the platelet lysate of Example 1, respectively, followed by additional culture for 48 hours. After the culture was completed, the degree of recovery of the injury site was quantitatively evaluated by analyzing the change in the area of ​​the injury site using the ImageJ program.

[0420] As a result, in the group treated with the platelet lysate of Example 1, the intercellular gaps formed by physical damage were observed to decrease rapidly compared to the control group, which means that the recovery of the damaged skin cell area was promoted. In addition, it was confirmed that fibroblast migration to the damaged site increased, effectively inducing wound closure through cell migration and rearrangement (Figs. 23a and 23b).

[0421]

[0422] 17. Evaluation of Vascular Endothelial Cell Proliferation Activity

[0423] Proliferative activity analysis was performed using human umbilical vein endothelial cells (HUVEC). HUVECs were inoculated into a culture vessel at a density of 1×10⁴ cells / cm², and the platelet lysate of Example 1 was added to the culture medium at a concentration of 400 μg / mL and cultured for 3 days.

[0424] After the culture was finished, to evaluate cell proliferation activity, CCK-8 reagent (Cell Counting Kit-8 reagent) was added to the culture medium and reacted for 1 hour. Subsequently, the absorbance at a wavelength of 450 nm was measured using SpectraMAX M2.

[0425] As a result, it was observed that the absorbance at 450 nm increased in the group treated with the platelet lysate of Example 1 compared to the control group, which indicates that the viability and proliferative activity of HUVECs increased (Fig. 24). From this, it was confirmed that the platelets of Example 1 can promote the proliferation of vascular endothelial cells to induce angiogenesis or vascular regeneration. Therefore, the artificial platelets of the present invention indicate that they can be used as a composition for tissue regeneration, wound healing, and the prevention or treatment of vascular-related diseases.

Claims

1. A pharmaceutical composition for the treatment or prevention of bone disease comprising, as an active ingredient, an artificial platelet having an increased concentration of any one growth factor selected from the group consisting of PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF compared to human-derived platelets.

2. A pharmaceutical composition for the treatment or prevention of bone disease according to claim 1, wherein the artificial platelet comprises PDGF-AA at a concentration of 10 to 20 ng / ml, PDGF-BB at a concentration of 4 to 8 ng / ml, EGF at a concentration of 0.1 to 0.5 ng / ml, TGF-β at a concentration of 0.7 to 1.3 ng / ml, bFGF at a concentration of 1.0 to 2.0 ng / ml, and VEGF at a concentration of 0.1 to 0.5 ng / ml.

3. A pharmaceutical composition for the treatment or prevention of bone disease according to claim 1, wherein the artificial platelet has an additionally increased concentration of any one growth factor selected from the group consisting of GDF-15 and TIMP-1 compared to the human-derived platelet.

4. A pharmaceutical composition for the treatment or prevention of bone disease according to claim 1, wherein the artificial platelet has a PAC-1 activity of 60% or more and a CD62P activity of 50% or more.

5. A pharmaceutical composition for the treatment or prevention of a bone disease according to claim 1, wherein the bone disease is any one selected from the group consisting of osteoarthritis, traumatic arthritis, chondromalacia, chondral defect, osteoporosis, and meniscal cartilage damage.

6. In Claim 1, the artificial platelet comprises: (S1) a step of culturing pluripotent stem cells to obtain a culture medium containing hematopoietic stem cells; (S2) among the cells contained in the culture medium, CD34 + A pharmaceutical composition for the treatment or prevention of bone disease, prepared by a method comprising the steps of: obtaining a population of suspended cells from the culture medium when the number of cells is at least 90% of the total number of cells; and (S3) differentiating the population of suspended cells into megakaryocytes in a first medium.

7. A pharmaceutical composition for the treatment or prevention of bone disease, wherein the method of claim 6 further comprises the step (S4) of culturing the megakaryocytes in a second medium containing TPO and SCF to mature them.

8. A pharmaceutical composition for the treatment or prevention of bone disease according to claim 6, wherein step (S1) comprises: (S1a) culturing the pluripotent stem cells in a third medium containing a GSK3 inhibitor; (S1b) culturing the cells cultured in the third medium in a fourth medium containing vascular endothelial growth factor and basic fibroblast growth factor; and (S1c) culturing the cells cultured in the fourth medium in a fifth medium containing vascular endothelial growth factor; basic fibroblast growth factor; and a transforming growth factor beta signaling inhibitor.

9. In claim 6, the method comprises (S0) pluripotent stem cells at a density of 5,000 to 8,500 cells / cm² on the bottom of a culture vessel. 2 A pharmaceutical composition for the treatment or prevention of bone disease, further comprising a seeding step.

10. A pharmaceutical composition for the treatment or prevention of bone disease according to claim 6, wherein the first medium comprises TPO and SCF and does not comprise interleukin-3 and interleukin-6.

11. In claim 6, among the cells included in the culture medium in (S2), CD34 + The cell count is at least 90% of the total cell count, and CD41a + The cell count is 50% to 80% of the total cell count, and CD42b + A pharmaceutical composition for the treatment or prevention of bone disease, wherein the suspension cell population is obtained from the culture medium when the number of cells is 40% to 60% of the total number of cells.

12. A pharmaceutical composition for the treatment or prevention of bone disease according to claim 7, wherein the second medium further comprises heparin sodium and a ROCK inhibitor.

13. In claim 7, the megakaryocytes are 1.0 × 10⁶ in a culture vessel having baffles formed on the bottom surface, or in a stirred bioreactor. 5 Up to 2×10 5 cells / cm 2 A pharmaceutical composition for the treatment or prevention of bone disease, which is administered and cultured.

14. A composition for tissue regeneration comprising, as an active ingredient, an artificial platelet having an increased concentration of any one growth factor selected from the group consisting of PDGF-AA, PDGF-BB, EGF, TGF-β, bFGF, and VEGF compared to human-derived platelets.

15. A tissue regeneration composition according to claim 14, wherein the artificial platelets comprise the PDGF-AA at a concentration of 10 to 20 ng / ml, the PDGF-BB at a concentration of 4 to 8 ng / ml, the EGF at a concentration of 0.1 to 0.5 ng / ml, the TGF-β at a concentration of 0.7 to 1.3 ng / ml, the bFGF at a concentration of 1.0 to 2.0 ng / ml, and the VEGF at a concentration of 0.1 to 0.5 ng / ml.

16. A tissue regeneration composition according to claim 14, wherein the artificial platelet has an additionally increased concentration of a growth factor selected from the group consisting of GDF-15 and TIMP-1 compared to the human-derived platelet.

17. A composition for tissue regeneration according to claim 14, wherein the artificial platelet has a PAC-1 activity of 60% or more and a CD62P activity of 50% or more.

18. In claim 14, the artificial platelet comprises: (S1) a step of culturing pluripotent stem cells to obtain a culture medium containing hematopoietic stem cells; (S2) among the cells contained in the culture medium, CD34 + A tissue regeneration composition prepared by a method comprising: (S3) obtaining a suspension cell population from the culture medium when the number of cells is at least 90% of the total number of cells; and (S3) differentiating the suspension cell population into megakaryocytes in a first medium.

19. A composition for tissue regeneration according to claim 18, wherein the method further comprises the step (S4) of culturing the megakaryocyte in a second medium containing TPO and SCF to mature it.

20. A composition for tissue regeneration according to claim 18, wherein step (S1) comprises: (S1a) culturing the pluripotent stem cells in a third medium containing a GSK3 inhibitor; (S1b) culturing the cells cultured in the third medium in a fourth medium containing vascular endothelial growth factor and basic fibroblast growth factor; and (S1c) culturing the cells cultured in the fourth medium in a fifth medium containing vascular endothelial growth factor; basic fibroblast growth factor; and a transforming growth factor beta signaling inhibitor.

21. In claim 18, the method comprises (S0) pluripotent stem cells at a density of 5,000 to 8,500 cells / cm² on the bottom of a culture vessel. 2 A composition for tissue regeneration comprising an additional step of seeding.

22. A tissue regeneration composition according to claim 18, wherein the first medium comprises TPO and SCF and does not comprise interleukin-3 and interleukin-6.

23. In claim 18, among the cells included in the culture medium in (S2), CD34 + The cell count is at least 90% of the total cell count, and CD41a + The cell count is 50% to 80% of the total cell count, and CD42b + A composition for tissue regeneration that obtains the suspension cell population from the culture medium when the number of cells is 40% to 60% of the total number of cells.

24. A tissue regeneration composition according to claim 19, wherein the second medium further comprises heparin sodium and a ROCK inhibitor.

25. In claim 19, the megakaryocytes are 1.0 × 10⁶ in a culture vessel having baffles formed on the bottom surface, or in a stirred bioreactor. 5 Up to 2×10 5 cells / cm 2 A composition for tissue regeneration that is introduced and cultured.

26. A tissue regeneration composition according to claim 14, wherein the tissue is any one selected from the group consisting of bone, cartilage, ligament, tendon, skin, and blood vessel.