DNA methylation biomarkers for detection of esophageal adenocarcinoma and high-grade dysplasia

Abstract

Methods and kits for early detection of high-grade dysplasia or esophageal adenocarcinoma are described. The methods and kits utilize the methylation status of biomarkers, such as BTBD3, DCLK2, MAFB, and cg7186.

Description

F053-6017PCT / 25-002-WO-PCTDNA METHYLATION BIOMARKERS FOR DETECTION OF ESOPHAGEAL ADENOCARCINOMA AND HIGH-GRADE DYSPLASIACROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 739,444 filed December 27, 2024 the entire contents of which are incorporated by reference herein.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under CA271902 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] The Sequence Listing associated with this application is provided in xml format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing is 3JN4919.XML. The text is 20,480 bytes, was created on December 23, 2025, and is being submitted electronically via Patent Center.FIELD OF THE DISCLOSURE

[0004] The present disclosure provides methods and kits for early detection of esophageal adenocarcinoma and high-grade dysplasia using the methylation status of biomarkers. The biomarkers include BTBD3, DCLK2, MAFB, and cg7186. Following detection of esophageal adenocarcinoma and high-grade dysplasia, subjects can be referred for follow-up diagnostics or treatment.BACKGROUND OF THE DISCLOSURE

[0005] Esophageal adenocarcinoma (EAC) incidence is rapidly increasing in the US for both known and unknown reasons and affects 20,000 people each year. It has a poor prognosis with less than 20% of patients surviving 5 years. Survival rates dramatically improve if EAC is detected at an early stage, when it can be cured by surgical or endoscopic resection. Importantly, virtually all EAC is believed to arise from a precancerous condition called Barrett’s esophagus (BE), which can evolve into EAC over time through BE to high grade dysplasia (HGD) to an EAC progression sequence. An important development in the treatment of HGD and early EAC are radiofrequency ablation (RFA) and intramucosal resection (EMR), which are endoscopic therapies that can cure these lesions. HGD and early stage EAC can be removed with RFA and EMR with low morbidity and mortality, substantially reducing the risk for EAC therapy-related death. Given this low morbidity and low mortality treatment option, assays that can detect HGD and / or EAC are of high value and have the potential to reduce EAC-related death and preserve the quality of life of BEF053-6017PCT / 25-002-WO-PCTpatients.SUMMARY OF THE DISCLOSURE

[0006] The present disclosure provides methods and kits for early detection of esophageal adenocarcinoma and high-grade dysplasia using the methylation status of biomarkers. The biomarkers include BTBD3, DCLK2, MAFB, and cg7186. Following detection of esophageal adenocarcinoma and / or high-grade dysplasia, subjects can be referred for follow-up diagnostics or treatment.BRIEF DESCRIPTION OF THE FIGURES

[0007] Some of the drawings submitted herewith may be better understood in color. Applicant considers the color versions of the drawings as part of the original submission and reserves the right to present color images of the drawings in later proceedings.

[0008] FIG. 1. Dot-plot graphs of individual markers BTBD3, DCLK2, MAFB, cg7186 in DNA extracted from an endoscopic biopsy training sample set using the multiplex methylation-specific digital PCR (MS-dPCR) assay. Each sample was defined by histologic diagnosis, shown on x-axis, as determined by a pathologist. The y-axis shows the relative methylation percent when compared to the reference gene C-LESS for total DNA, as measured by MS-dPCR assays for each marker. One way ANOVA was used to determine statistical significance between histologic groups based on relative methylation percent. P-values < 0.01 when compared to normal tissue are considered significant (*).

[0009] FIG. 2. The MS-dPCR marker panel was able to distinguish high grade dyplasia / esophageal adenocarcinoma (HGD / EAC) from squamous epithelium / nondysplastic Barrett’s esophagus (SQ / NDBE), with an area under the curve (AUC) of 0.925, when evaluated in the endoscopic biopsy training sample set, using a leave 10% out cross validation Random Forest model. Cl stands for confidence interval.

[0010] FIG. 3. Table of Single plex and Multiplex biopsy results. RM stands for the relative methylation percent (RM%).DETAILED DESCRIPTION

[0011] In Barrett's esophagus (BE), healthy esophageal epithelium is replaced with metaplastic columnar cells likely due to damage from prolonged exposure of the esophagus to the refluxate of gastroesophageal reflux disease (GERD). The inherent risk of progression from BE to adenocarcinoma of the esophagus has been established. Histologically, this progression involves clear sequential stages from metaplasia alone to low grade dysplasia, then to high grade dysplasia, and finally to esophageal adenocarcinoma (EAC).F053-6017PCT / 25-002-WO-PCT

[0012] This metaplasia to dysplasia to carcinoma sequence has prompted several national gastroenterology societies to recommend screening for BE in high risk subjects with multiple risk factors followed by endoscopic surveillance (depending on the grade of dysplasia) to detect the development of dysplasia or carcinoma at an early stage (Spechler et al., Gastroenterology 2011 , 140:el8-52; Wang et al, Am J Gastroenterol 2008, 103:788-97; Fitzgerald et al, Gut 2014, 63:7-42). Endoscopic treatments of low grade dysplasia (LGD), high grade dysplasia (HGD), and early carcinoma have been developed and shown to be effective in reducing the incidence of carcinoma and improving survival in BE subjects (Prasad et al., Gastroenterology 2007, 132: 1226-33; Prasad et al, Gastroenterology 2009; Shaheen et al, N Engl J Med 2009, 360:2277-88; Phoa et al., JAMA 2014, 311:1209-17).

[0013] Screening for BE is conventionally performed using sedated endoscopy (sEGD) which reveals the replacement of the normal squamous lining of the esophagus by metaplastic columnar epithelium in subjects with BE. However sEGD is expensive with both direct and indirect costs and is not suitable for widespread application. It is also associated with potential complications (Sami et al, CGH 2015, 13:623-34). Other techniques such as unsedated transnasal endoscopy (uTNE) have comparable accuracy to sEGD with lower cost, but continue to be poorly regarded as a widely applicable tool by providers (Sami et al, Am J Gastroenterol. 2015, 110: 148-58; Peery et al, Gastrointest. Endosc. 2012, 75:945-953 e2; Atkinson et al., Gastroenterol. Hepatol. 2007, 4:426-7). Despite adequate access to the uTNE device, the utilization of uTNE by referring physicians remains limited (Atkinson et al, Am J Gastroenterol. 2008, 103:92-7).

[0014] Endoscopic detection of dysplasia is conventionally performed using four quadrant random biopsies every 1-2 cm of the BE segment in addition to careful inspection of the BE segment with high resolution white light imaging and advanced imaging techniques. While this has been recommended by gastrointestinal (Gl) societies (e.g., Spechler et al, Gastroenterology 2011 , 140:el 8-52; Wang et al, Am J Gastroenterol 2008, 103:788-97; Fitzgerald et al., Gut 2014, 63:7-42), the compliance with these recommendations amongst practicing gastroenterologists remains poor (Abrams et al, Clin Gastroenterol Hepatol 2009). Indeed compliance decreases with increasing BE segment length leading to increasing rates of missed dysplasia. Other challenges with dysplasia detection in BE include the spotty distribution of dysplasia in BE (Cameron et al, Am J Gastroenterol 1997, 92:586-91) which leads to sampling error, poor inter-observer agreement amongst pathologists while grading dysplasia, and the relatively poor sensitivity of current surveillance strategies in detecting prevalent dysplasia or carcinoma (Sharma et al, Gastroenterology 2004, 127:310-30). The utility of advanced imaging techniques in the community remains unclear with only a third of practicing gastroenterologists reporting useF053-6017PCT / 25-002-WO-PCTroutinely in BE surveillance (Singh et al, Gastrointestinal endoscopy 2013;78:689-95).

[0015] Less invasive techniques for esophageal monitoring have been developed. For example, one technique includes a swallowable balloon-based esophageal sampling device for detecting methylated DNAs ((e.g., ESOCHECK™ (Lucid Diagnostics, New York, NY; Moinova et al., Sci Transl Med. 2018; 10(424):eaao5848), RealSeqS analysis of esophageal brushings (Douville et al., Gastroenterology. 2021; 160(6):2043-2054.e2). ESOCHECK™ has been recently approved by the FDA. More particularly, the ESOCHECK™ device is a swallowable sponge on a string developed and studied for use in BE screening (Kadri et al, BMJ 2010, 341:c4372). The device includes a polyurethane foam sponge compressed in a gelatin capsule, attached to a string. The capsule is swallowed by the patient. The gelatin shell of the capsule dissolves in the gastric fluid releasing the foam device as a sphere which is then pulled out with the attached string, providing brushing / cytology samples of the proximal stomach and esophagus. Biomarker studies can then be performed on these samples to detect BE. Two large multicenter studies have been performed in the United Kingdom with such a device using trefoil factor 3 (a protein specific to BE epithelium) detected on immunohistochemistry as a BE biomarker, demonstrating the feasibility, safety and accuracy of this approach (Kadri et al., BMJ 2010, 341:c4372; Ross-Innes et al, PLoS medicine 2015, 12:el001780). The sensitivity and specificity of this bioarker in the detection of BE has been reported to be 73% and 94% for BE segments of > 1 cm in circumferential length. Additionally this capsule sponge device has been used safely in a study conducted at Mayo Clinic Rochester in subjects with eosinophilic esophagitis (Katzka et al, CGH 2015, 13:77-83 e2).

[0016] There is a need for non-endoscopic methods for the surveillance of patients with BE. DNA biomarkers can be a useful, less invasive method of detecting HGD or EAC.

[0017] Biomarker studies have mostly focused on altered gene expression, leading to development of tests for mRNA signatures of tumor progression. Epigenetic alterations in DNA also provides valuable prognostic information. Epigenetics refers to changes in gene expression that are not due to mutations (i.e. changes in the sequence, such as loss or gain of nucleotides, of a gene). Thus, epigenetics is a reversible regulation of gene expression caused by several mechanisms other than mutation.

[0018] The most widely studied epigenetic modification is DNA methylation. Other epigenetic changes include changes to the three dimensional structure of DNA, histone protein modification, micro-RNA inhibitory activity, imprinting, X-inactivation, and long-distance chromosomal interaction.

[0019] DNA methylation occurs at CpG sites across the genome and regulates gene expression. Cytosine is one of a group of four building blocks (i.e., nucleotides) from which DNA is constructedF053-6017PCT / 25-002-WO-PCT(i.e. cytosine (C), thiamine (T), adenine (A), and guanosine (G)). The chemical structure of cytosine is in the form of a six-sided hexagon or pyrimidine ring. Cytosine can be paired with guanosine in a linear sequence along the single DNA strand to form 5’-CG-3’, or CpG pairs. “CpG” refers to a cytosine-phosphate-guanosine chemical bond in which the phosphate binds the two nucleotides together. In mammals, in 70-80% of these CpG pairs the cytosine is methylated. (Chatterjee, et al., Biochemica et Biophisica Acta 2012;1819:763-70).

[0020] The term “CpG island” refers to regions in the genome with a high concentration of CG dinucleotide pairs or CpG sites. The length of DNA occupied by the CpG island is usually 300-3000 base pairs. The CpG island can be defined by various criteria including the length of recurrent CG dinucleotide pairs occupying at least 200 base pairs (bp) of DNA, a CG content of the segment of at least 50%, and / or that the observed / expected CpG ratio is greater than 60%. There are an estimated 28-30 million CpG sites across the genome.

[0021] CpG islands are commonly found in gene promoters. Across mammals, an average of forty percent of gene promoters contain CpG islands (Fatemi, et al., Nucleic Acids Res. 2005; 33:e176). Gene promoters are particularly CG-rich in the human genome, as 70% of promoters in the human genome have high CG content. Although CpG islands are highly associated with gene promoters, CpG islands can also exist in other regions of the genome (such as in gene bodies or in intergenic regions).

[0022] In most CpG sites scattered throughout the DNA the cytosine nucleotide is methylated. In contrast, the cytosine is more often unmethylated in CpG sites located in the CpG islands of the promoter regions of genes, supporting a role of methylation status of cytosine in CpG islands in gene transcriptional activity.

[0023] Methylation of cytosine refers to the enzymatic addition of a methyl group or single carbon atom to position #5 of the pyrimidine ring of cytosine, which leads to the conversion of cytosine to 5-methyl-cytosine. The methylation of cytosine can be accomplished by a family of enzymes called DNA methyltransferases (DNMTs). The 5-methyl-cytosine, when formed, is prone to mutation or the chemical transformation of the original cytosine to form thymine. Five-methyl-cytosines account for 1% of the nucleotide bases overall in the normal human genome.

[0024] As described in the present disclosure, methylated DNA biomarkers that show significantly higher methylation levels in HGD and EAC compared to the normal esophagus and BE samples were identified. More particularly, the present disclosure provides methods and kits to identify HGD or EAC using the methylation status of the epigenetic biomarkers BTBD3, DCLK2, MAFB, and cg7186. Following detection of HGD or EAC, subjects can be referred for treatment.

[0025] Before bisulfite conversion, the genomic sequences being assessed for methylation statusF053-6017PCT / 25-002-WO-PCTinclude:for BTBD3 (forward strand):ATCCCGGCCCCAAACTGGCAGGGTCTTTATCCCACCATTAGAGAGAGGTAAGTGCCGCGC TAGTCTATTTACTTTAAAAGTTTTCCTGTGTTGAAGTTTCTGCTTTTGCAAAACCTGTAATGT ATTTGAACACAAATCTGTTTCCTCTTTTCCCAGAAGCTTTTTATTGGTAATGGAAAATTGCCT TGTATCT (SEQ ID NO: 1);for DCLK2 (reverse strand):CGGTCGGCTCCCGAGCGGGACTTGTGAGGCGTGGCCGGGTGGAGGAGGCGCTTGCGGG GGCGTGGGGCTCCCCGGCAGGCGG (SEQ ID NO: 2);for MAFB (reverse strand):CGCTCGCAGCCGCTCGCAGCTCGGCGGTGCAGCTGTGCTGGATCCGGCGGCGCCGCAG CCTTTTATCGCCTCCTGATGTCACTGGGGTGCGGGGGCCCGGGCGGCCCGGTGCGCGGG CCAATAGCTGCACGGCCTCCGCGGCCCAGCGG (SEQ ID NO: 3); andfor cg7186( forward strand):TCTCCAAATGGAGGGAGTTCTTTTTTTCTTCTTCCATCTCATCTACTCAATAACGGAGCCGC TGCAGCCGCTGCACGCTGCACACACACGGCACAGTCCCTGGGTCC (SEQ ID NO:4)

[0026] In certain samples, increased methylation of BTBD3, DCLK2, MAFB, and cg7186 indicate the presence of HGD or EAC. Increased methylation can be represented or indicated by a "methylation value" (e.g., representing a methylation frequency, fraction, ratio, percent, etc.). In certain examples, a methylation value, represents the methylation status and can thus be used as a quantitative indicator of methylation status across multiple copies of a locus. This is of particular use when it is desirable to compare the methylation status of a sequence in a sample to a threshold or reference value. As used herein, "methylation frequency" or "methylation percent (%)" refer to the number of instances in which a molecule or locus is methylated relative to the number of instances the molecule or locus is unmethylated. Certain embodiments disclosed herein utilize a relative methylation percentage (RM%) which is a ratio percent of the amount of target methylated alleles.

[0027] While in certain examples, the disclosure provides that increased methylation is indicative of HGD or EAC, one of ordinary skill in the art will understand that different reference points can lead to different directional changes indicative of HGD and / or EAC. For example, one may collect a data set of methylation levels of BTBD3, DCLK2, MAFB, and cg7186 from patients with HGD or EAC. If this dataset were used as the reference level, then HGD and / or EAC would be indicated if there was no significant difference from the reference level. An increase in methylation is indicative of HGD or EAC when the reference level includes normal or BE samples.F053-6017PCT / 25-002-WO-PCT

[0028] The strength of this biomarker panel lies in its capability for early detection of HGD and / or EAC. If combined with promising BE biomarkers, a robust biomarker panel can be used in an esophageal cytology based approach for BE screening and surveillance. Given the emerging technical advances in swallowable cytology collection devices (Kaz & Grady, Transl Gastroenterol Hepatol 2019, 4:25), the DNA-methylation based molecular assays described herein can be further validated and used in cytology balloon collected samples.

[0029] In summary, the disclosure provides the development of DNA-methylation based molecular assays for the detection of HGD or EAC.

[0030] Aspects of the current disclosure are now described in more supporting detail as follows: (I) Epigenetic Biomarkers; (II) Methylation Detection; (III) Digital™ PCR (dPCR™); (IV) Comparisons and Reference Levels; (V) Kits; (VI) Methods of Use; (VII) Exemplary Embodiments; and (VIII) Closing Paragraphs. These headings are provided for organizational purposes only and do not limit the scope or interpretation of the disclosure.

[0031] (I) Epigenetic Biomarkers. A biomarker is a biological marker or measurable indication of a biological state. Biomarkers can include molecules, genes, proteins, cells, or fragments thereof or the expression or state of these molecules, genes, proteins, cells, or fragments thereof. For example, a biomarker can include an epigenetic biomarker which is a type of biomarker related to epigenetics. Epigenetics is the study of how environmental and behavioral factors can change gene activity without altering the DNA sequence. The four main epigenetic factors include DNA methylation, histone modification, chromatic remodeling, and noncoding RNA. "Methylation" refers to the addition of a methyl group to DNA, specifically at cytosine nucleotides, which can significantly impact gene expression by, for example, altering how accessible the DNA is for transcription machinery.

[0032] The current disclosure describes use of the methylation status of BTBD3, DCLK2, MAFB, and cg7186 for early detection of high-grade dysplasia (HGD) or esophageal adenocarcinoma (EAC).

[0033] BTB / POZ domain-containing protein 3 (BTBD3) is a protein coding gene. It is predicted to be involved in cerebral cortex development and dendrite morphogenesis. The gene is located on chromosome 20 in humans.

[0034] Doublecortin like kinase 2 (DCLK2) encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine / threonine protein kinase domain, which shows substantial homology to Ca2+ / calmodulin-dependent protein kinase, and a serine / proline-rich domain in between theF053-6017PCT / 25-002-WO-PCTdoublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. This gene is located on chromosome 4 of humans.

[0035] MAF bZIP transcription factor B (MAFB) encodes a protein called a basic leucine zipper (bZIP) transcription factor that plays an important role in the regulation of lineage-specific hematopoiesis. The encoded nuclear protein represses ETS1 -mediated transcription of erythroid-specific genes in myeloid cells. This gene contains no introns and is on chromosome 20 of humans.

[0036] Particular embodiments utilize methylation status of all three biomarker genes: BTBD3, DCLK2, MAFB, and cg7186. Particular embodiments utilize methylation status of a two biomarker panel of genes: BTBD3 and DCL 2; BTBD3 and MAFB; DCLK2 and MAFB; cg7186 and BTBD3; cg7186and DCLK2; orcg7186and MAFB. Particular embodiments can include other or additional biomarkers. For example, one or more of the biomarkers can be used in a biomarker panel with additional biomarkers (e.g., BTBD3 and other biomarkers; DCLK2 and other biomarkers; MAFB and other biomarkers; cg7186 and other biomarkers; or BTBD3, DCLK2, MAFB, cg7186, and other biomarkers). Other biomarkers are known to those skilled in the art including PCT / US2023 / 063976.

[0037] Particular embodiments may also actively exclude use of a biomarker. For example, certain embodiments exclude use of BTBD3. Certain embodiments exclude use of DCLK2. Certain embodiments exclude use of MAFB. Certain embodiments exclude use of cg7186. Certain embodiments exclude use of any biomarker other than BTBD3, DCLK2, and MAFB. Certain embodiments exclude use of any biomarker other than BTBD3, DCLK2, MAFB, and cg7186. Other embodiments exclude use of any biomarker other than BTBD3 and DCLK2. Other embodiments exclude use of any biomarker other than BTBD3 and MAFB. Other embodiments exclude use of any biomarker other than DCLK2 and MAFB. Other embodiments exclude use of any biomarker other than cg7186 and BTBD3. Other embodiments exclude use of any biomarker other than cg7186 and DCLK2. Other embodiments exclude use of any biomarker other than cg7186 and MAFB.

[0038] In particular embodiments, when more than one biomarker is assayed, values of the detected biomarkers can be calculated into a score. Each value can be weighted evenly within an algorithm generating a score, or the values for particular biomarkers can be weighted more heavily in reaching the score. For example, biomarkers with higher area under the ROC curve (AUC) or partial AUC (pAUC) and / or methylation difference scores could be weighted more heavily than biomarkers with lower AUC or pAUC and / or methylation difference scores. For example, in particular embodiments, DCLK2 and MAFB may be weighted more heavily thanF053-6017PCT / 25-002-WO-PCTBTBD3.

[0039] Biomarkers may also be grouped into classes, and each class given a weighted score. For example, biomarker values described herein (i.e. , BTBD3, DCLK2, MAFB, and cg7186) or a subset thereof may be grouped into a class with a specific weight and other biomarkers can be grouped into a different class with a different weight For example: Class 1: BTBD3, DCLK2, MAFB and cg7186’, and Class 2: other validated biomarkers. Similarly, Class 2 can be divided into multiple classes. Another example includes Class 1: BTBD3, DCLK2, MAFB, and cg7186', Class 2: a first subset of other validated biomarkers; and Class 3: a second subset of validated biomarkers. Another example includes Class 1: BTBD3-, Class 2: DCLK2 and MAFB and Class 3: cg7186 and other validated biomarkers.

[0040] Any biomarker or class of biomarkers can be included in a particular value calculation. For example, in particular embodiments, Class 1 is included. In particular embodiments, Class 2 is included. In particular embodiments, Class 3 is included. In particular embodiments, groups of classes can be included, for example, Classes 1 and 2 and / or 1 and 3. Particular classes can also be excluded. For example, in particular embodiments, Class 2 is excluded. In particular embodiments, Class 3 is excluded.

[0041] (II) Methylation Detection. Methylation of the biomarkers can be assessed using various methylation detection assays. A “methylation detection assay” refers to an assay for distinguishing methylated versus unmethylated cytosine loci in DNA. Techniques for measuring cytosine methylation include bisulfite-based methylation assays. The addition of bisulfite to DNA results in the methylation of unmethylated cytosine and its ultimate conversion to the nucleotide uracil. Uracil has similar binding properties to thiamine in the DNA sequence. Previously methylated cytosine does not undergo similar chemical conversion on exposure to bisulfite. Bisulfite assays can thus be used to discriminate previously methylated versus unmethylated cytosine. In particular embodiments, a methylation detection assay is commercially available.

[0042] Within the current disclosure, a bisulfite converted BTBD3 (forward strand) assay amplicon includes:ATTTCGGTTTTAAATTGGTAGGGTTTTTATTTTATTATTAGAGAGAGGTAAGTGTCGCGTTAG TTTATTTATTTTAAAAGTTTTTTTGTGTTGAAGTTTTTGTTTTTGTAAAATTTGTAATGTATTTG AATATAAATTTGTTTTTTTTTTTTTTAGAAGTTTTTTATTGGTAATGGAAAATTGTTTTGTATTT(SEQ ID NO: 5);a bisulfite converted DCLK2 (reverse strand) assay amplicon includes:CCGCCTACCGAAAAACCCCACGCCCCCGCAAACGCCTCCTCCACCCGACCACGCCTCACA AATCCCGCTCGAAAACCGACCG (SEQ ID NO: 6);F053-6017PCT / 25-002-WO-PCTa bisulfite converted MAFB (reverse strand) assay amplicon includes:CCGCTAAACCGCGAAAACCGTACAACTATTAACCCGCGCACCGAACCGCCCGAACCCCCG CACCCCAATAACATCAAAAAACGATAAAAAACTACGACGCCGCCGAATCCAACACAACTAC ACCGCCGAACTACGAACGACTACGAACG (SEQ ID NO: 7); anda bisulfite converted cg7186 (forward strand) includes:TTTTTAAATGGAGGGAGTTTTTTTTTTTTTTTTTTATTTTATTTATTTAATAACGGAGTCGTTGT AGTCGTTGTACGTTGTATATATACGGTATAGTTTTTGGGTTC (SEQ ID NO: 8)

[0043] A methylation detection assay is known in the art and these methods can be used for absolute quantification or relative quantification of methylated nucleic acid. Such methylation assays include, among other techniques, two main steps. The first step is a methylation specific reaction or separation, such as (i) bisulfite treatment, (ii) methylation specific binding, or (iii) a methylation specific restriction enzyme. The second main step involves (i) amplification and detection, or (ii) direct detection by various methods, such as (a) PCR (sequence specific amplification), such as Taqman® (Roche Molecular Systems, Inc., Pleasanton, CA), (b) sequencing of untreated DNA and bisulfite treated DNA, (c) sequencing by ligation of dye modified probes (including cycling ligation and cleavage), (d) pyrosequencing, (e) single molecule sequencing, (f) mass spectrometry, or (g) Southern blot analysis.

[0044] An exemplary quantitative methylation detection assay combines bisulfite treatment and restriction analysis COBRA, which uses methylation sensitive restriction endonucleases, gel electrophoresis, and detection based on labeled hybridization probes. (Ziong and Laird, Nucleic Acid Res. 1997 25; 2532-4). Another exemplary detection assay is the methylation specific polymerase chain reaction PCR (MSPCR) for amplification of DNA segments of interest. This assay can be performed after sodium bisulfite conversion of cytosine and uses methylation sensitive probes. Other detection assays include the Quantitative Methylation (QM) assay, which combines PCR amplification with fluorescent probes designed to bind to putative methylation sites; MethyLight™ (Qiagen, Redwood City, CA) a quantitative methylation detection assay that uses fluorescence based PCR (Eads, et al., Cancer Res. 1999; 59:2302-2306); and Ms-SNuPE, a quantitative technique for determining differences in methylation levels in CpG sites. As with other techniques, Ms-SNuPE also requires bisulfite treatment to be performed first, leading to the conversion of unmethylated cytosine to uracil while methyl cytosine is unaffected. PCR primers specific for bisulfite converted DNA are then used to amplify the target sequence of interest (see Table 1). The amplified PCR product is isolated and used to quantitate the methylation status of the CpG site of interest. (Gonzalgo and Jones Nuclei Acids Res1997; 25:252-31).

[0045] In particular embodiments, reliable identification of specific cytosine loci distributedF053-6017PCT / 25-002-WO-PCTthroughout the genome has been detailed in, for example, the document “CpG Loci Identification. A guide to Illumina’s method for unambiguous CpG loci identification and tracking for the GOLDENGATE® and I N Fl N I UM® assays for Methylation”. Briefly, Illumina has developed a CpG locus identifier that designates cytosine loci based on the actual or contextual sequence of nucleotides in which the cytosine is located. It uses a similar strategy as used by NCBI’s re single nucleotide polymorphism (SNP) IPS (rs#) and is based on the sequence flanking the cytosine of interest. Thus a unique CpG locus cluster ID number is assigned to each of the cytosine undergoing evaluation. The system is consistent and not affected by changes in public databases and genome assemblies. Flanking sequences of 60 bases 5’ and 3’ to the CG locus (i.e. a total of 122 base sequences) is used to identify the locus. Thus a unique “CpG cluster number” or eg# is assigned to the sequence of 122 bp which contains the CpG of interest. Thus, only if the 122 bp in the CpG cluster is identical is there a risk of a locus being assigned the same number and being located in more than one position in the genome. Three separate criteria are utilized to track an individual CpG locus based on this unique ID system, chromosome number, genomic coordinate, and genome build. The lesser of the two coordinates “C” or “G” in CpG is used in the unique CG loci identification. The CG locus is also designated in relation to the first ‘unambiguous” pair of nucleotides containing either an ‘A’ or T. If one of these nucleotides is 5’ to the CG then the arrangement is designated TOP and if such a nucleotide is 3’ it is designated BOT.

[0046] In particular embodiments, the INFINIUM® (llumina, Inc., San Diego California, USA) Human Methylation 450 Beadchip assay can be used. The Illumina assay can be used for genome wide quantitative methylation profiling. In particular embodiments, genomic DNA can be extracted from cells. Genomic DNA can be isolated and proteins or other contaminants can be removed from the DNA using proteinase K. The DNA can then be removed from the solution using available methods such as organic extraction, salting out, or binding the DNA to a solid phase support. As described above, and in the Infinium® Assay Methylation Protocol Guide, the DNA can be treated with sodium bisulfite. The bisulfite converted DNA can then be denatured and amplified. A next step can use enzymatic means to fragment the DNA. The fragmented DNA can then be precipitated using isopropanol and separated by centrifugation. The separated DNA can next be suspended in a hybridization buffer. The fragmented DNA can then be hybridized to beads that have been covalently limited to 50mer nucleotide segments at a locus specific to the cytosine nucleotide of interest in the genome. There are a total of over 500,000 bead types specifically designed to anneal to the locus where the particular cytosine is located, and the beads are bound to silicon-based arrays. There are two bead types designed for each locus, one bead type represents a probe that is designed to match to the methylated locus at which the cytosineF053-6017PCT / 25-002-WO-PCTnucleotide will remain unchanged. The other bead type corresponds to an initially unmethylated cytosine, which after sodium bisulfite treatment, is converted to uracil and ultimately a thiamine nucleotide. Unhybridized DNA (DNA not annealed to the beads) is washed away leaving only DNA segments bound to the appropriate bead and containing the cytosine of interest. If the cytosine of interest was unmethylated prior to the sodium bisulfite treatment, then it will match with the unmethylated or “U” bead probe. If the cytosine was methylated, single base mismatch will occur with the “U” bead probe oligomer. No further nucleotide extension on the bead oligomer occurs. This will lead to low fluorescent signal from the “U” bead. The reverse will happen on the “M” or methylated bead probe.

[0047] Lasers can then be used to stimulate fluorophores bound to the beads. The level of methylation at each cytosine locus is detected by the intensity of the fluorescence from the methylated compared to the unmethylated bead. Cytosine methylation level is expressed as “0” which is the ratio of the methylated-bead probe signal to total signal intensity at that cytosine locus.

[0048] In particular embodiments, pyrosequencing can be used to detect biomarker methylation. Pyrosequencing is a method of DNA sequencing that relies on detection of the release of pyrophosphates as DNA is synthesized (and is therefore a “sequencing by synthesis” technique). To assess methylation by pyrosequencing, a DNA sample can be incubated with sodium bisulfite, converting unmethylated cytosine to uracil. The presence of uracil will result in thymine incorporation during PCR amplification. Therefore, sequencing results that include thymine at a nucleotide position that is known to encode cytosine can be interpreted as unmethylated sites. In contrast cytosines present in the sequencing results indicate that the site was methylated in the original DNA sample, because methylation protects cytosine from conversion to uracil upon treatment. Bisulfite treatment can also be performed on control samples with known methylation patterns, to reduce or eliminate false positive results. Commercially available pyrosequencing machines include Pyro Mark Q96 (Qiagen, Hilden, Germany). For more details on methods to use pyrosequencing for measurement of methylation, see Delaney et al. Methods Mol Biol. 2015 1343: 249-264. Pyrosequencing is especially useful for detecting methylation in the CpG sites within genes.

[0049] While not preferred, measurement of mRNA levels transcribed by genes with altered cytosine methylation can also be assessed to indirectly indicate methylation status. Any technique for determining expression levels of mRNA can be used including Northern blot analysis, fluorescent in situ hybridization (FISH), RNase protection assays (RPA), microarrays, PCR-based, or other technologies for measuring RNA levels can be used.F053-6017PCT / 25-002-WO-PCT

[0050] Up (hyper)- or down (hypo)-methylation of genes also can be detected indirectly using, for example, cDNA arrays, cDNA fragment fingerprinting, cDNA sequencing, clone hybridization, differential display, differential screening, FRET detection, liquid microarrays, PCR, RT-PCR, quantitative RT-PCR analysis with TaqMan assays, molecular beacons, microelectric arrays, oligonucleotide arrays, polynucleotide arrays, serial analysis of gene expression (SAGE), and / or subtractive hybridization.

[0051] Further hybridization technologies that may be used are described in, for example, U.S. Pat. Nos. 5,143,854; 5,288,644; 5,324,633; 5,432,049; 5,470,710; 5,492,806; 5,503,980; 5,510,270; 5,525,464; 5,547,839; 5,580,732; 5,661 ,028; and 5,800,992 as well as WO 95 / 21265; WO 96 / 31622; WO 97 / 10365; WO 97 / 27317; EP 373203; and EP 785280.

[0052] Additionally, protein products of genes that are differentially methylated can be measured to indirectly assess cytosine methylation levels. Proteins translated from mRNA reflect the same phenomenon of altered gene expression related to changes in cytosine methylation. Therefore, protein expression could also be used to biologically classify a sample as normal or having HGD or EAC.

[0053] "Protein detection” includes detection of full-length proteins, mature proteins, pre-proteins, polypeptides, isoforms, mutations, post-translationally modified proteins and variants thereof, and can be detected in any suitable manner.

[0054] In particular embodiments, a protein biomarker is detected by contacting a sample with reagents (e.g., antibodies), generating complexes of reagent and biomarker(s), and detecting the complexes. Particular embodiments for detecting and measuring protein levels can use methods including agglutination, chemiluminescence, electro-chemiluminescence (ECL), enzyme-linked immunoassays (ELISA), immunoassay, immunoblotting, immunodiffusion, immunoelectrophoresis, immunofluorescence, immunohistochemistry, immunoprecipitation, mass-spectrometry, and western blot. See also, e.g., E. Maggio, Enzyme-Immunoassay (1980), CRC Press, Inc., Boca Raton, Fla; and U.S. Pat. Nos. 4,727,022; 4,659,678; 4,376,110; 4,275,149; 4,233,402; and 4,230,797.

[0055] Various methylation detection assays use nucleic acids and / or proteins linked to chips, such as microarray chips. See, for example, U.S. Pat. Nos. 5,143,854; 6,087,112; 5,215,882; 5,707,807; 5,807,522; 5,958,342; 5,994,076; 6,004,755; 6,048,695; 6,060,240; 6,090,556; and 6,040,138. Binding to nucleic acids or proteins on microarrays can be detected by scanning the microarray with a variety of lasers or charge coupled device (CCD)-based scanners, and extracting features with software packages, for example, Imagene (Biodiscovery, Hawthorne, CA), Feature Extraction Software (Agilent), Scanalyze (Eisen, M. 1999. SCANALYZE UserF053-6017PCT / 25-002-WO-PCTManual; Stanford Univ., Stanford, Calif. Ver 2.32.), or GenePix (Axon Instruments).

[0056] Embodiments disclosed herein can be used with high throughput screening (HTS). Typically, HTS refers to a format that performs at least 100 assays, at least 500 assays, at least 1000 assays, at least 5000 assays, at least 10,000 assays, or more per day. When enumerating assays, either the number of samples or the number of biomarkers assayed can be considered.

[0057] Generally, HTS methods involve a logical or physical array of either samples, or the nucleic acid or protein biomarkers, or both. Appropriate array formats include both liquid and solid phase arrays. For example, assays employing liquid phase arrays, e.g. , for hybridization of nucleic acids, binding of antibodies or other receptors to ligand, etc., can be performed in multiwell or microtiter plates. Microtiter plates with 96, 384, or 1536 wells are widely available, and even higher numbers of wells, e.g., 3456 and 9600 can be used. In general, the choice of microtiter plates is determined by the methods and equipment, e.g., robotic handling and loading systems, used for sample preparation and analysis.

[0058] HTS assays and screening systems are commercially available from, for example, Zymark Corp. (Hopkinton, MA); Air Technical Industries (Mentor, OH); Beckman Instruments, Inc. (Fullerton, CA); Precision Systems, Inc. (Natick, MA), etc. These systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide HTS as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols for the various methods of HTS.

[0059] (III) Digital PCR (dPCR). Particular embodiments utilize dPCR™ (Qiagen, Germantown, MD). dPCR technology uses a nanoplate to divide PCR samples into partitions. Hindson et al., Anal. Chem. 83(22): 8604-8610 (2011). The partitions support PCR amplification of the target template molecules they contain and use reagents and workflows similar to those used for most standard Taqman probe-based assays.

[0060] Multiplex dPCR™ expands the capabilities of traditional dPCR™ allowing for simultaneous detection and quantification of multiple genomic targets in a single reaction. Each partitions contains a different combination of primers and probes specific to target sequences. The reduced sample and reagent volumes also contribute to cost savings and help to conserve valuable sample material in an area of the industry that typically has low productivity and low final product volumes. The ability to test more samples, extract rich information, and obtain high data quality from a single experiment make dPCR an attractive tool.

[0061] For example, within the context of the current disclosure, a representative partition would include fragmented DNA for analysis and primer / probe sequences from the table below (orF053-6017PCT / 25-002-WO-PCTsequences having at least 90% sequence identity thereto):

[0062] Table 1. The primer and probe sequences for the methylation-specific multiplex digital PCR assays

[0063] Following PCR, each partition is analyzed or read to determine the fraction of PCR-positive partitions in the original sample. These data are then analyzed using Poisson statistics to determine the target concentration in the original sample. See Qiagen QIAcuity Digital™ (dPCR™) PCR Technology.

[0064] While multiplex dPCR™ is a preferred approach utilized within the current disclosure, as indicated above, traditional dPCR™ or other sample partition PCR methods based on the same underlying principles may also be used. These approaches are now described more generally.

[0065] Sample Partitioning. Numerous methods can be used to divide samples into discrete partitions (e.g., partitions). Exemplary partitioning methods and systems include use of one or more nanoplates, emulsification, droplet actuation, microfluidics platforms, continuous-flow microfluidics, reagent immobilization, and combinations thereof. In some embodiments, partitioning is performed to divide a sample into a sufficient number of partitions such that each partition contains one or zero nucleic acid molecules. In some embodiments, the number and size of partitions is based on the concentration and volume of the bulk sample.

[0066] Methods and devices for partitioning a bulk volume into partitions by emulsification are described in Nakano et al. J. Biotechno 102, 117-124 (2003) and Margulies et al. Nature 437, 376-380 (2005). Systems and methods to generate partitions are described in U.S. Publication No. 2010 / 0173394. Microfluidics systems and methods to divide a bulk volume into partitions are described in U.S. Publication Nos. 2010 / 0236929; 2010 / 0311599; and 2010 / 0163412, and U.S. Patent No. 7,851,184. Microfluidic systems and methods that generate monodisperse partitionsF053-6017PCT / 25-002-WO-PCTare described in Kiss etal. Anal. Chem. 80(23), 8975-8981 (2008). Further microfluidics systems and methods for manipulating and / or partitioning samples using channels, valves, pumps, etc. are described in U.S. Patent No. 7,842,248. Continuous-flow microfluidics systems and methods are described in Kopp et al., Science, 280, 1046-1048 (1998).

[0067] Partitioning methods can be augmented with partition manipulation techniques, including electrical (e.g., electrostatic actuation, dielectrophoresis), magnetic, thermal (e.g., thermal Marangoni effects, thermocapillary), mechanical (e.g., surface acoustic waves, micropumping, peristaltic), optical (e.g., opto-electrowetting, optical tweezers), and chemical means (e.g., chemical gradients). In some embodiments, a droplet microactuator is supplemented with a microfluidics platform (e.g. continuous flow components).

[0068] Some embodiments use a droplet microactuator. A droplet microactuator can be capable of effecting droplet manipulation and / or operations, such as dispensing, splitting, transporting, merging, mixing, agitating, and the like. Droplet operation structures and manipulation techniques are described in U.S. Publication Nos. 2006 / 0194331 and 2006 / 0254933 and U.S. Patent Nos.6,911,132; 6,773,566; and 6,565,727.

[0069] Amplification. The partitioned nucleic acids of a sample can be amplified by any suitable PCR methodology that can be practiced with methylation-based PCR assays. Exemplary PCR types include allele-specific PCR, assembly PCR, asymmetric PCR, endpoint PCR, hot-start PCR, in situ PCR, intersequence-specific PCR, inverse PCR, linear after exponential PCR, ligation-mediated PCR, methylation-specific PCR, miniprimer PCR, multiplex ligation-dependent probe amplification, multiplex PCR, nested PCR, overlap-extension PCR, polymerase cycling assembly, qualitative PCR, quantitative PCR, real-time PCR, single-cell PCR, solid-phase PCR, thermal asymmetric interlaced PCR, touchdown PCR, universal fast walking PCR, etc. Ligase chain reaction (LCR) may also be used.

[0070] PCR may be performed with a thermostable polymerase, such as Taq DNA polymerase (e.g., wild-type enzyme, a Stoffel fragment, FastStart polymerase, etc.), Pfu DNA polymerase, S-Tbr polymerase, Tth polymerase, Vent polymerase, or a combination thereof, among others.

[0071] PCR are driven by thermal cycling. Alternative amplification reactions, which may be performed isothermally, can also be used. Exemplary isothermal techniques include branched-probe DNA assays, cascade-RCA, helicase-dependent amplification, loop-mediated isothermal amplification (LAMP), nucleic acid based amplification (NASBA), nicking enzyme amplification reaction (NEAR), PAN-AC, Q-beta replicase amplification, rolling circle replication (RCA), self-sustaining sequence replication, strand-displacement amplification, etc.

[0072] Amplification may be performed with any suitable reagents (e.g. template nucleic acid (e.g.F053-6017PCT / 25-002-WO-PCTDNA or RNA)), primers, probes, buffers, replication catalyzing enzymes (e.g. DNA polymerase, RNA polymerase), nucleotides, salts (e.g. MgCh), etc. In some embodiments, an amplification mixture includes any combination of at least one primer or primer pair, at least one probe, at least one replication enzyme (e.g., at least one polymerase), and deoxynucleotide (and / or nucleotide) triphosphates (dNTPs and / or NTPs), etc.

[0073] Amplification reagents can be added to a sample prior to partitioning, concurrently with partitioning and / or after partitioning has occurred. In some embodiments, all partitions are subjected to amplification conditions (e.g. reagents and thermal cycling), but amplification only occurs in partitions containing target nucleic acids (e.g. nucleic acids containing sequences complementary to primers added to the sample). The template nucleic acid can be the limiting reagent in a partitioned amplification reaction. In some embodiments, a partition contains one or zero target (e.g. template) nucleic acid molecules.

[0074] As indicated previously, in some embodiments, nucleic acid targets, primers, and / or probes are immobilized to a surface, for example, a substrate, plate, array, bead, particle, etc. Immobilization of one or more reagents provides (or assists in) one or more of: partitioning of reagents (e.g. target nucleic acids, primers, probes, etc.), controlling the number of reagents per partition, and / or controlling the ratio of one reagent to another in each partition. In some embodiments, assay reagents and / or target nucleic acids are immobilized to a surface while retaining the capability to interact and / or react with other reagents (e.g. reagent dispensed from a microfluidic platform, a droplet microactuator, etc.). In some embodiments, reagents are immobilized on a substrate and or partitioned reagents are brought into contact with the immobilized reagents. Techniques for immobilization of nucleic acids and other reagents to surfaces are well understood by those of ordinary skill in the art. See, for example, U.S. Patent No. 5,472,881 and Taira et al. Biotechnol. Bioeng. 89(7), 835-8 (2005).

[0075] Target Sequence Detection. Detection methods can be utilized to identify sample partitions containing amplified target(s). Detection can be based on one or more characteristics of a sample partition such as a physical, chemical, luminescent, or electrical aspects, which correlate with amplification.

[0076] In particular embodiments, fluorescence detection methods are used to detect amplified target(s), and / or identification of sample partitions containing amplified target(s). Exemplary fluorescent detection reagents include TaqMan probes, SYBR Green fluorescent probes, molecular beacon probes, scorpion probes, and / or LightUp probes® (LightUp Technologies AB, Huddinge, Sweden). Additional detection reagents and methods are described in, for example, U.S. Patent Nos. 5,945,283; 5,210,015; 5,538,848; and 5,863,736; PCT Publication WOF053-6017PCT / 25-002-WO-PCT97 / 22719; and publications: Gibson et al., Genome Research, 6, 995-1001 (1996); Heid et al., Genome Research, 6, 986-994 (1996); Holland et al., Proc. Natl. Acad. Sci. USA 88, 7276-7280, (1991); Livak et al., Genome Research, 4, 357-362 (1995); Piatek et al., Nat. Biotechnol. 16, 359-63 (1998); Neri et al., Advances in Nucleic Acid and Protein Analysis, 3826, 117-125 (2000); Compton, Nature 350, 91-92 (1991); Thelwell et al., Nucleic Acids Research, 28, 3752-3761 (2000); Tyagi and Kramer, Nat. Biotechnol. 14, 303-308 (1996); Tyagi et al., Nat. Biotechnol. 16, 49-53 (1998); and Sohn et al., Proc. Natl. Acad. Sci. U.S.A. 97, 10687-10690 (2000).

[0077] In some embodiments, detection reagents are included with amplification reagents added to the bulk or partitioned sample. In some embodiments, amplification reagents also serve as detection reagents. In some embodiments, detection reagents are added to partitions following amplification. In some embodiments, measurements of the absolute copy number and the relative proportion of target nucleic acids in a sample (e.g. relative to other targets nucleic acids, relative to non-target nucleic acids, relative to total nucleic acids, etc.) can be measured based on the detection of sample partitions containing amplified targets.

[0078] In some embodiments, following amplification, sample partitions containing amplified target(s) are sorted from sample partitions not containing amplified targets or from sample partitions containing other amplified target(s). In some embodiments, sample partitions are sorted following amplification based on physical, chemical, and / or optical characteristics of the sample partition, the nucleic acids therein (e.g. concentration), and / or status of detection reagents. In some embodiments, individual sample partitions are isolated for subsequent manipulation, processing, and / or analysis of the amplified target(s) therein. In some embodiments, sample partitions containing similar characteristics (e.g. same fluorescent labels, similar nucleic acid concentrations, etc.) are grouped (e.g. into packets) for subsequent manipulation, processing, and / or analysis.

[0079] Multiplexing. A relevant point of dPCR is multiplexing. The most common multiplex methods in dPCR are based on the fact that DNA reporter molecules generate a fluorescence signal for each DNA target sequence in a spectral range that corresponds to the detection range of a detection channel. One DNA target sequence can therefore be detected for each detection channel on the device side. As a result, the degree of multiplexing of a device is initially limited to the number of available detection channels. The dPCR devices currently available on the market have between 2-6 different fluorescence detection channels, which means that a maximum of 6 target sequences can be analyzed on the device side. It is important to note that wavelengths can overlap with a large number of detection channels and the resulting crosstalk results in lower specificity and sensitivity.F053-6017PCT / 25-002-WO-PCT

[0080] A method for increasing the multiplex level above the devices capability uses combinatorial approaches, e.g., using a combination of Taqman probes and DropOff probes as the target sequence of specific reporter molecules. The combinatorics of the signals generated by these probes also result in a higher degree of multiplexing. Additionally, there are other methods for increasing the degree of multiplexing in digital PCR. US Patent No. 9,921,154 B2 describes a multiplex digital PCR analysis of more target sequences than optical channels available, taking into account further sample-specific aspects.

[0081] Different target sequence-specific probes can, for example, use different fluorophores as labels or can carry multiple fluorophore labels in order to generate multiple populations in the same detection channel. Since in the ground state the signals of the probes described here are suppressed with low efficiency by FRET quenching, the initial signal suppression is comparatively low, which is why effective modeling of the signal strength and thus a separation of the populations in the data space is only possible to a limited extent.

[0082] (IV) Comparisons and Reference Levels. As indicated previously, up (hyper)- or down (hypo)-methylation of the biomarkers (e.g., methylation status) can be assessed and a methylation value can be generated and compared to a relevant reference level. The value can be one or more numerical values resulting from the assaying of a sample, and can be derived, e.g., by measuring methylation status of the biomarker(s) in the sample by an assay, or from a dataset obtained from a provider such as a laboratory, or from a dataset stored on a server.

[0083] In the broadest sense, the value may be qualitative or quantitative. As such, where detection is qualitative, the methods and kits provide a reading or evaluation, e.g., assessment, of whether or not the biomarker is methylated in the sample being assayed. In further embodiments, the methods and kits provide a quantitative detection of methylation, i.e., an evaluation or assessment of the actual amount or relative abundance of methylation of the biomarker in the sample being assayed. In such embodiments, the quantitative detection may be absolute or relative. As such, the term “quantifying” when used in the context of quantifying methylation of a biomarker in a sample can refer to absolute or to relative quantification. Absolute quantification can be accomplished by inclusion of samples with known methylation parameters as one or more control biomarkers and referencing, e.g., normalizing, the detected methylation level of the experimental biomarker with the known control biomarkers (e.g., through generation of a standard curve). Alternatively, relative quantification can be accomplished by comparison of generated methylation values between two or more different biomarkers to provide a relative quantification of each of the two or more biomarkers, e.g., relative to each other. The actual measurement of values for the biomarkers can be determined using any method known in the art.F053-6017PCT / 25-002-WO-PCT

[0084] As stated previously, detected biomarker levels (e.g., methylation values) can be compared to one or more reference levels. Reference levels can be obtained from one or more relevant datasets. A "dataset" as used herein is a set of numerical values resulting from evaluation of a sample (or population of samples) under a desired condition. The values of the dataset can be obtained, for example, by experimentally obtaining measures from sample(s) and constructing a dataset from these measurements. As is understood by one of ordinary skill in the art, the reference level can be based on e.g., any mathematical or statistical formula useful and known in the art for arriving at a meaningful aggregate reference level from a collection of individual datapoints; e.g., mean, median, median of the mean, etc. Alternatively, a reference level or dataset to create a reference level can be obtained from a service provider such as a laboratory, or from a database or a server on which the dataset has been stored.

[0085] A reference level from a dataset can be derived from previous measures derived from a population. A "population" is any grouping of subjects or samples of like specified characteristics. The grouping could be according to, for example, clinical parameters, clinical assessments, therapeutic regimens, disease status, severity of HGD or EAC. In particular embodiments, a population is a group of subjects without cancer (i.e., healthy). In particular embodiments, a population is a group of subjects with Barrett’s esophagus. In particular embodiments, a population is a group of subjects with HGD or EAC. In particular embodiments described herein, a subject without HGD, EAC or Barrett’s esophagus is referred to as a subject without cancer, a healthy subject, or a normal subject.

[0086] In particular embodiments, conclusions are drawn based on whether a methylation value is statistically significantly different or not statistically significantly different from a reference level. A measure is not statistically significantly different if the difference is within a level that would be expected to occur based on chance alone. In contrast, a statistically significant difference is one that is greater than what would be expected to occur by chance alone. Statistical significance or lack thereof can be determined by any of various methods well-known in the art. An example of a commonly used measure of statistical significance is the p-value. The p-value represents the probability of obtaining a given result equivalent to a particular datapoint, where the datapoint is the result of random chance alone. A result is often considered significant (not random chance) at a p-value less than 0.05.

[0087] In particular embodiments, methylation values obtained based on the biomarkers and / or other dataset components can be subjected to an analytic process with chosen parameters. The parameters of the analytic process may be those disclosed herein or those derived using the guidelines described herein. The analytic process used to generate a result may be any type ofF053-6017PCT / 25-002-WO-PCTprocess capable of identifying HGD or EAC samples based on methylation status detection, for example, a linear algorithm, a quadratic algorithm, a decision tree algorithm, or a voting algorithm. The analytic process may set a threshold for determining the probability that a sample belongs to a given class. The probability preferably is at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or higher. Detection relies on performing a methylation assay on the biological sample.

[0088] The receiver operating characteristics (ROC) curve is a graph plotting sensitivity (true positive rate), which is defined in this setting as the percentage of HGD or EAC cases with a positive test on the Y axis and false positive rate (1 -specificity). False positive rate refers to the percentage of subjects without cancer falsely found to have a positive test.

[0089] The area under the ROC curves (AUG) indicates the accuracy of the test in identifying normal from abnormal cases (Hanley & McNeil, Radiology 1982; 143:29-36). The AUG is the area under the ROC plot from the curve to the diagonal line from the point of intersection of the X- and Y- axes and with an angle of incline of 45° (a test with no discrimination between two groups), has a 45° diagonal line from the lower left to the upper right corner). The higher the area under the receiver operating characteristics (ROC) curve, the greater the accuracy of the test in predicting the condition of interest. An area ROC = 1.0 indicates a perfect test, which is positive in all cases with the disorder (e.g., HGD or EAC) and negative in all normal individuals without the disorder. Thus, the closer the plot is to the upper left corner, the higher the overall accuracy of the test.

[0090] Certain embodiments disclosed herein utilize logistic regression models. In some embodiments, the method includes utilizing a logistic regression model to categorize a sample as a normal, HGD, or EAC sample. In certain examples, a logistic regression model can be trained on biopsy sample sets (training set) aslogit(p) = log p / - p)) = / ?0+ / ?i i + ••• + Pnxn,where p and p stand for the probability score of the specified sample being positive and the intercept or coefficient of each biomarker.

[0091] (V) Kits. Kits disclosed herein include materials to assay a sample for the methylation status of one or more biomarkers disclosed herein. In particular embodiments, the kits include materials to amplify sequences. In particular embodiments, the kits include materials to conduct PCR. Materials to conduct PCR include components of amplification mixtures, such as at least one primer or primer pair, at least one probe, at least one replication enzyme (e.g., at least one polymerase), and deoxynucleotide (and / or nucleotide) triphosphates (dNTPs and / or NTPs), etc. Particular embodiments provide a droplet generation oil (e.g., immiscible oil). ParticularF053-6017PCT / 25-002-WO-PCTembodiments provide the primer and probes sequences provided in Table 1 or sequences having at least 90% sequence identity thereto.

[0092] In particular embodiments, such kits include at least one polynucleotide that hybridizes to at least one of the biomarker sequences described herein and at least one reagent for detecting gene methylation. Reagents for detecting methylation include, for example, sodium bisulfite, polynucleotides designed to hybridize to the products of a biomarker sequence if the biomarker sequence is unmethylated (e.g., includes at least one C-U transition), and / or methylationsensitive or methylation-dependent restriction enzymes. In particular embodiments, the kit provides a solid support in the form of an assay device suitable for use in an assay.

[0093] Additional embodiments include detection reagents. Exemplary detection reagents can include radioactive isotopes or radiolabels (e.g., 32P and 13C), enzymes (e.g., luciferase, HRP and AP), dyes (e.g., rhodamine and cyanine), fluorescent tags or dyes (e.g., GFP, YFP, FITC), magnetic beads, or biotin. In particular embodiments, the detectable label is fluorescein, GFP, rhodamine, cyanine dyes, Alexa dyes, luciferase, or a radiolabels. TaqMan probes, SYBR Green fluorescent probes, molecular beacon probes, scorpion probes, and / or LightUp probes® (LightUp Technologies) may also be used.

[0094] Particular embodiments can include reference levels and / or control conditions (positive and / or negative).

[0095] In some embodiments, the kit further includes a buffer, preservative, or protein / nucleic acid stabilizer. In particular embodiments, the kit further includes other components of the reaction mixture as described herein. For example, the kit includes one or more aliquots of a thermostable DNA polymerase and / or one or more aliquots of dNTPs as described herein. In particular embodiments, the kit further includes a control sample containing a known amount of the template DNA molecule of a single allele of the locus. In some embodiments, the kit includes a negative control sample, e.g., a sample that does not contain a DNA molecule that contains a single allele of a locus. In some embodiments, the kit includes a positive control sample, e.g., a sample including one or more of the individual alleles of a known amount of a locus.

[0096] In some embodiments, the kit includes packaging material. As used herein, the term "packaging material" may refer to the physical structure that contains the components of the kit. In particular embodiments, the packaging material maintains sterility of the kit components and is made of materials commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampoule, etc.). Other materials useful for performing assays are included in the kit, including test tubes, pipettes, and the like.

[0097] Instructions for carrying out and interpreting methylation assays, including, optionally,F053-6017PCT / 25-002-WO-PCTinstructions for generating a score, can also be included in a kit. Instructions can be provided in written, taped, videoed, VCR, CD-ROM, flashdrive, USB formats or can be provided on a website or other remote location.

[0098] In particular embodiments, kits exclude equipment (e.g., plate readers). In particular embodiments, kits exclude materials commonly found in laboratory settings (pipettes; test tubes; distilled H2O).

[0099] (VI) Methods of Use. Methods of using methylation-based assays disclosed herein are also provided. Particular embodiments include assaying a sample derived from a subject for the methylation status of disclosed biomarkers or biomarker combinations.

[0100] The assayed sample can be any appropriate biological sample. Particular embodiments utilize cytology samples (e.g., esophageal brushing samples). Certain examples include obtaining samples through endoscopic brushing or nonendoscopic whole esophageal brushing or swabbing using a tethered device (e.g. such as a capsule sponge, balloon, or other device). Particular examples can include obtaining esophageal brushings using a high capacity cytology brush (Hobbs Medical, Stafford Springs, CT) with circumferential sampling from the cardia through the full esophageal length (BE + squamous mucosa) to simulate a swallowed sponge-on-string device. Capsule sponge devices such as those available from PAVMed / Capnostics (Esophacap device) or Medtronic (Cytosponge device) may also be used. In certain examples, after sample acquisition, brushes or sponges can be placed into containers with lysis buffer, and optionally frozen at -80°C for later analysis.

[0101] In particular embodiments the sample is obtained from a healthy subject, a subject having HGD, or a subject having EAC.

[0102] Particular embodiments disclosed herein include obtaining a sample from a subject; performing a methylation detection assay on the sample; determining one or more methylation values based on the assaying; and determining the sample to have HGD or EAC from the differential methylation value of a biomarker, as described elsewhere herein.

[0103] Particular embodiments disclosed herein include obtaining a sample from a subject; analyzing the sample for altered methylation of at least one biomarker; determining that the altered methylation of the at least one biomarker indicates presence of HGD or EAC.

[0104] Particular embodiments also include predicting or diagnosing HGD or EAC in a subject by obtaining a sample from a subject; assaying the sample for methylation status of one or more biomarkers disclosed herein; generating one or more methylation values based on the assaying; comparing the one or more methylation values to a reference level; and predicting or diagnosing HGD or EAC in the subject according to the methylation value of the biomarker as determined byF053-6017PCT / 25-002-WO-PCTthe up- or down-methylation of the one or more biomarkers, as described elsewhere herein.

[0105] A prediction or diagnosis according to the methods and kits disclosed herein can direct a treatment regimen. For example, a biological classification, prediction or diagnosis of HGD or EAC can direct a more aggressive or experimental treatment course. For example, a prediction or diagnosis of HGD or EAC can direct a subject to receive an ablative therapy (e.g., radiofrequency ablation (RFA), photodynamic therapy, thermal laser, argon plasma coagulation (APC), multipolar electrocoagulation, or cryotherapy) or a resection therapy (e.g., endoscopic mucosal resection (EMR)). Those of ordinary skill in the art classify treatments at a particular time as aggressive, experimental, moderate, minimal or “no” treatment based on a subject’s prognosis and relevant standards and treatments at the time. For example, a treatment undergoing a clinical trial is an experimental treatment. Once the treatment is approved by a relevant regulatory agency within a jurisdiction, the treatment is no longer experimental in that jurisdiction.

[0106] In particular embodiments, the biomarkers include one or more of the biomarkers disclosed herein: BTBD3, DCLK2, and MAFB. In particular embodiments, the methylation status or the methylation value for each biomarker is determined using any methylation assay known in the art including dPCR™, MethyLight™, Ms-SNuPE, COBRA, and MSPCR methylation assays.

[0107] In particular embodiments, methods include surveilling a subject for the development of HGD or EAC. Methods for surveilling include generating a methylation value as described herein and repeating the generating at select time intervals. In particular embodiments, select time intervals include every day, every week, every month, every two months, every three months, every four months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every year, every 15 months, every 18 months, every 2 years, every 2.5 years, every 3 years, every 4 years, every 5 years, every 10 years or more or increments thereof. In particular embodiments, the time interval can change during the course of surveilling. Reasons for changing the time interval may include a change in the subject’s condition, access to healthcare, or ease / cost of performing the methods disclosed here.

[0108] The Exemplary Embodiments below are included to demonstrate particular embodiments of the disclosure. Those of ordinary skill in the art should recognize in light of the present disclosure that many changes can be made to the specific embodiments disclosed herein and still obtain a like or similar result without departing from the spirit and scope of the disclosure.

[0109] (VII) Exemplary Embodiments.1. A method for determining a presence of high grade dysplasia (HGD) or esophageal adenocarcinoma (EAC) in a subject, the method including:obtaining a sample derived from the subject;F053-6017PCT / 25-002-WO-PCTdetecting a methylation status of cytosines located in an epigenetic loci selected from BTBD3, DCLK2, MAFB, and / or Cg7186 from the sample to generate a methylation value; anddetermining that HGD or EAC is present or absent in the subject based on the generated methylation value.2. The method of embodiment 1 , wherein the sample was obtained with an esophageal brush, esophageal sponge, or cytology balloon.3. The method of embodiments 1 or 2, wherein the sample includes genomic DNA.4. The method of any of embodiments 1-3, wherein the subject has Barrett’s esophagus. 5. The method of any of embodiments 1-4, wherein the subject is at risk of developing HGD or EAC.6. The method of any of embodiments 1-6, wherein the epigenetic loci include BTBD3.7. The method of any of embodiments 1-6, wherein the epigenetic loci include DCLK2.8. The method of any of embodiments 1-6, wherein the epigenetic loci include MAFB.9. The method of any of embodiments 1-6, wherein the epigenetic loci include Cg7186.10. The method of any of embodiments 1-9, wherein the epigenetic loci include (i) BTBD3 and DCLK2, (ii) BTBD3 and MAFB, or (iii) DCLK2 and MAFB.11. The method of any of embodiments 1-10, wherein the epigenetic loci include (i) Cg7186 and BTBD3 (ii) Cg7186 and DCLK2, or (iii) Cg7186 and MAFB.12. The method of any of embodiments 1-6, wherein the epigenetic loci include BTBD3, DCLK2, and MAFB.13. The method of any of embodiments 1-12, wherein the epigenetic loci include BTBD3, DCLK2, MAFB, and Cg7186.14. The method of any of embodiments 1-13, wherein the detecting includes extracting DNA from the sample.15. The method of any of embodiments 1-14, wherein the detecting includes digital polymerase chain reaction.16. The method of any of embodiments 1-15, wherein the detecting includes multiplexed digital polymerase chain reaction.17. The method of any of embodiments 12-16, wherein the DNA includes genomic DNA.18. The method of any of embodiments 12-17, wherein the extracted DNA includes 4 ng of DNA.19. The method of any of embodiments 1-18, wherein the detecting includes treating extracted DNA with bisulfite.F053-6017PCT / 25-002-WO-PCT20. The method of any of embodiments 1-19, wherein the detecting includes amplifying extracted DNA.21. The method of any of embodiments 1-20, wherein the detecting includes amplifying bisulfite-treated DNA.22. The method of any of embodiments 1-21, wherein the detecting includes providing a reaction mixture including:a set of primers specific to each of the epigenetic loci, wherein the primers are designed to identify the methylation status of the epigenetic loci;a set of probes specific to each of the epigenetic loci, wherein each probe is distinguishable based on a unique signal;a DNA polymerase; anddeoxynucleotide triphosphates (dNTPs).23. The method of embodiment 22, wherein the set of primers have sequences of SEQ ID NO: 9 and SEQ ID NO: 10 or sequences having at least 95% sequence identity thereto.24. The method of embodiments 22 or 23, wherein the set of probes include at least one probe having a sequence of SEQ ID NO: 11 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 11.25. The method of any of embodiments 22-24, wherein the set of primers have sequences of SEQ ID NO: 12 and SEQ ID NO: 13 or sequences having at least 95% sequence identity thereto.26. The method of any of embodiments 22-25, wherein the set of probes include at least one probe having a sequence of SEQ ID NO: 14 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 14.27. The method of any of embodiments 22-26, wherein the set of primers have sequences of SEQ ID NO: 15 and SEQ ID NO: 16 or sequences having at least 95% sequence identity thereto.28. The method of any of embodiments 22-27, wherein the set of probes include at least one probe having a sequence of SEQ ID NO: 17 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 17.29. The method of any of embodiments 22-26, wherein the set of primers have sequences of SEQ ID NO: 18 and SEQ ID NO: 19 or sequences having at least 95% sequence identity thereto.30. The method of any of embodiments 22-27, wherein the set of probes include at least one probe having a sequence of SEQ ID NO: 20 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 20.31. The method of any of embodiments 22-30, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 12, and 13, or sequences having at least 95% sequence identity thereto.F053-6017PCT / 25-002-WO-PCT32. The method of any of embodiments 22-31, wherein the set of probes have sequences of SEQ ID NOs: 11 and 14 or sequences having at least 95% sequence identity thereto.33. The method of any of embodiments 22-32, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 15, and 16, or sequences having at least 95% sequence identity thereto. 34. The method of any of embodiments 22-33, wherein the set of probes have sequences of SEQ ID NOs: 11 and 17 or sequences having at least 95% sequence identity thereto.35. The method of any of embodiments 22-34, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 18, and 19, or sequences having at least 95% sequence identity thereto. 36. The method of any of embodiments 22-35, wherein the set of probes have sequences of SEQ ID NOs: 11 and 20 or sequences having at least 95% sequence identity thereto.37. The method of any of embodiments 22-36, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 12, and 13, or sequences having at least 95% sequence identity thereto. 38. The method of any of embodiments 22-37, wherein the set of probes have sequences of SEQ ID NOs: 11 and 14 or sequences having at least 95% sequence identity thereto.39. The method of any of embodiments 22-38, wherein the set of primers have sequences of SEQ ID NOs: 12, 13, 18, and 19, or sequences having at least 95% sequence identity thereto.40. The method of any of embodiments 22-39, wherein the set of probes have sequences of SEQ ID NOs: 14 and 20 or sequences having at least 95% sequence identity thereto.41. The method of any of embodiments 22-40, wherein the set of primers have sequences of SEQ ID NOs: 15, 16, 18, and 19, or sequences having at least 95% sequence identity thereto.42. The method of any of embodiments 22-41, wherein the set of probes have sequences of SEQ ID NOs: 17 and 20 or sequences having at least 95% sequence identity thereto.43. The method of any of embodiments 22-42, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 12, 13, 15, 16, 18, or 19 or sequences having at least 95% sequence identity thereto.44. The method of any of embodiments 22-43, wherein the set of probes have sequences of SEQ ID NOs: 11, 14, 17, or 20 or sequences having at least 95% sequence identity thereto. 45. The method of any of embodiments 22-44, wherein the reaction mixture further includes a buffer.46. The method of any of embodiments 22-45, wherein each probe is labeled with a detectable label.47. The method of embodiment 46, wherein the detectable label includes a dye, a radioactive isotope, an enzyme, a magnetic bead, or biotin.48. The method of any of embodiments 22-47, wherein each probe is a fluorescently labeledF053-6017PCT / 25-002-WO-PCTprobe.49. The method of any of embodiments 22-48, wherein the detecting includes partitioning the reaction mixture into a plurality of partitions, wherein each partition contains a fraction of the reaction mixture.50. The method of embodiment 49, wherein the partitions are nanoplate partitions.51. The method of embodiments 49 or 50, wherein the detecting includes thermally cycling partitions to amplify the epigenetic loci within each droplet, wherein each partition may contain zero, one, or multiple copies of the epigenetic loci.52. The method of any of embodiments 49-51 , wherein the detecting includes detecting unique probe signals emitted from each partition to determine the presence or absence of each epigenetic loci within individual partitions.53. The method of embodiment 52, wherein the detecting includes analyzing the detected unique probe signals to quantify a number of partitions containing each epigenetic loci, thereby determining the methylation value of each epigenetic loci in the sample.54. The method of any of embodiments 1-53, wherein the generated methylation value is compared to a reference level.55. The method of embodiment 54, wherein the reference level is derived from a population of subjects with normal or Barrett’s esophagus.56. The method of embodiment 55, wherein the generated methylation value is increased in comparison to the reference level; and HGD or EAC is determined to be present.57. The method of embodiment 55, wherein the generated methylation value is not increased in comparison to the reference level and HGD or EAC is determined to not be present.58. The method of embodiment 54, wherein the reference level is derived from a population of subjects HGD or EAC.59. The method of embodiment 58, wherein the generated methylation value is decreased in comparison to the reference level; and HGD or EAC is determined to not be present.60. The method of embodiment 58, wherein the generated methylation value is not decreased in comparison to the reference level and HGD or EAC is determined to be present.61. The method of any of embodiments 1-60, wherein the method further includes detecting a methylation status of cytosines located in other epigenetic loci.62. The method of any of embodiments 1-61, wherein the method further includes detecting other biomarkers.63. A kit for detecting a high grade dysplasia (HGD) or esophageal adenocarcinoma (EAC) tissue sample, the kit including reagents to detect methylation status of cytosines located in oneF053-6017PCT / 25-002-WO-PCTor more epigenetic loci selected from BTBD3, DCLK2, MAFB, and / or cg7186.64. The kit of embodiments 63, wherein the reagents detect methylation status of cytosine within (i) BTBD3 and DCLK2, (ii) BTBD3 and MAFB, or (iii) DCLK2 and MAFB.65. The kit of embodiments 63, wherein the reagents detect methylation status of cytosine within (i) cg7186 and BTBD3 and, (ii) cg7186 and DCLK2, or (iii) cg7186 and MAFB.66. The kit of embodiment 63, wherein the reagents detect methylation status of cytosines within BTBD3, DCLK2, and MAFB.67. The kit of embodiment 63, wherein the reagents detect methylation status of cytosines within BTBD3, DCLK2, MAFB, and eg 7186.68. The kit of any of embodiments 63-67, wherein the kit includes a primer pair having sequences of SEQ ID NO: 9 and SEQ ID NO: 10 or sequences having at least 95% sequence identity thereto.69. The kit of any of embodiments 63-68, wherein the kit includes a probe having a sequence of SEQ ID NO: 11 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 11.70. The kit of any of embodiments 63-69, wherein the kit includes a primer pair having sequences of SEQ ID NO: 12 and SEQ ID NO: 13 or sequences having at least 95% sequence identity thereto.71. The kit of any of embodiments 63-70, wherein the kit includes a probe having a sequence of SEQ ID NO: 14 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 14.72. The kit of any of embodiments 63-71, wherein the kit includes a primer pair having sequences of SEQ ID NO: 15 and SEQ ID NO: 16 or sequences having at least 95% sequence identity thereto.73. The kit of any of embodiments 63-72, wherein the kit includes a probe having a sequence of SEQ ID NO: 17 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 17.74. The kit of any of embodiments 63-73, wherein the kit includes a primer pair having sequences of SEQ ID NO: 18 and SEQ ID NO: 19 or sequences having at least 95% sequence identity thereto.75. The kit of any of embodiments 63-74, wherein the kit includes a probe having a sequence of SEQ ID NO: 20 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 20.76. The kit of any of embodiments 63-75, wherein the kit includes primer pairs havingF053-6017PCT / 25-002-WO-PCTsequences of SEQ ID NOs: 9, 10, 12 and 13 or sequences having at least 95% sequence identity thereto.77. The kit of any of embodiments 63-76, wherein the kit includes probes having sequences of SEQ ID NOs: 11 and 14 or sequences having at least 95% sequence identity thereto.78. The kit of any of embodiments 63-77, wherein the kit includes primer pairs having sequences of SEQ ID NOs: 9, 10, 15 and 16, or sequences having at least 95% sequence identity thereto.79. The kit of any of embodiments 63-78, wherein the kit includes probes having sequences of SEQ ID NOs: 11 and 17 or sequences having at least 95% sequence identity thereto.80. The kit of any of embodiments 63-79, wherein the kit includes primer pairs having sequences of SEQ ID NOs: 9, 10, 18 and 19, or sequences having at least 95% sequence identity thereto.81. The kit of any of embodiments 63-80, wherein the kit includes probes having sequences of SEQ ID NOs: 11 and 20 or sequences having at least 95% sequence identity thereto.82. The kit of any of embodiments 63-81, wherein the kit includes primer pairs having sequences of SEQ ID NOs: 12, 13, 15, and 16 or sequences having at least 95% sequence identity thereto.83. The kit of any of embodiments 63-82, wherein the kit includes probes having sequences of SEQ ID NOs: 14 and 17 or sequences having at least 95% sequence identity thereto.84. The kit of any of embodiments 63-83, wherein the kit includes primer pairs having sequences of SEQ ID NOs: 12, 13, 18 and 19, or sequences having at least 95% sequence identity thereto.85. The kit of any of embodiments 63-84, wherein the kit includes probes having sequences of SEQ ID NOs: 14 and 20 or sequences having at least 95% sequence identity thereto.86. The kit of any of embodiments 63-85, wherein the kit includes primer pairs having sequences of SEQ ID NOs: 15, 16, 18, and 19 or sequences having at least 95% sequence identity thereto.87. The kit of any of embodiments 63-86, wherein the kit includes probes having sequences of SEQ ID NOs: 17 and 20 or sequences having at least 95% sequence identity thereto.88. The kit of any of embodiments 63-87, wherein the kit includes primer pairs having sequences of SEQ ID NOs: 9, 10, 12, 13, 15, 16, 18, and 19 or sequences having at least 95% sequence identity thereto.89. The kit of any of embodiments 63-69, wherein the kit includes probes having sequences of SEQ ID NOs: 11, 14, 17, and 20 or sequences having at least 95% sequence identity thereto.F053-6017PCT / 25-002-WO-PCT90. The kit of any of embodiments 63-89, further including DNA-fragmenting enzymes.91. The kit of any of embodiments 63-90, further including bisulfite.92. The kit of any of embodiments 63-91 , further including a replication enzyme.93. The kit of embodiment 82, wherein the replication enzyme is a thermostable DNA polymerase.94. The kit of any of embodiments 63-93, further including deoxynucleotide triphosphates (dNTPs).95. The kit of any of embodiments 63-94, wherein each probe includes a detectable label. 96. The kit of embodiment 95, wherein the detectable label is a fluorescent label, dye, radioactive isotope, enzyme, magnetic bead, or biotin.97. The kit of embodiments 95 or 96, wherein the detectable label is a fluorescent label.98. The kit of any of embodiments 63-97, further including a reference level.99. The kit of embodiment 98, wherein the reference level is derived from a population of subjects with normal or Barrett’s esophagus.100. The kit of embodiment 99, wherein an increased methylation status as compared to the reference level distinguishes the sample as HGD or EAC.101. The kit of embodiment 98, wherein the reference level is derived from a population of subjects with HGD or EAC.102. The kit of embodiment 101, wherein a similar methylation status as compared to the reference level distinguishes the sample as HGD or EAC.103. The kit of embodiment 101, wherein a decreased methylation status as compared to the reference level distinguishes the sample as normal or Barrett’s esophagus.104. The kit of any of embodiments 63-103, wherein the kit further includes reagents to detect other biomarkers.105. The kit of any of embodiments 63-104, wherein the kit can be used with other kits for detecting biomarkers.106. The kit of any of embodiments 63-105, further including a sample collector.107. The kit of embodiment 106, wherein the sample collector includes an esophageal brush, esophageal sponge, or cytology balloon.108. A method to diagnose a subject as having a high-grade dysplasia (HGD) or esophageal adenocarcinoma (EAC), the method including:obtaining a sample derived from the subject;detecting a methylation status of cytosines located in an epigenetic loci selected from at least BTBD3, DCLK2, MAFB, and / or cg7186 from the sample to generate a methylation value;F053-6017PCT / 25-002-WO-PCTanddiagnosing the subject as having HGD or EAC based on the generated methylation value.109. The method of embodiment 108, wherein the diagnosing with HGD or EAC directs an aggressive or experimental treatment for the subject.110. The method of embodiments 108 or 109, wherein the diagnosing with HGD or EAC directs a treatment.111. The method of embodiment 110, wherein the treatment includes resection and / or ablative therapy.112. The method of embodiment 111, wherein the resection includes endoscopic mucosal resection (EMR).113. The method of embodiments 111 or 112, wherein the ablative therapy includes radiofrequency ablation (RFA), photodynamic therapy, thermal laser, argon plasma coagulation (APC), multipolar electrocoagulation, or cryotherapy.114. The method of any of embodiments 108-113, wherein the subject has a high risk for developing HGD or EAC.115. The method of any of embodiments 108-114, wherein the subject has Barrett’s esophagus.116. A method of surveilling a subject for development of HGD or EAC including generating a methylation value; andrepeating the generating, thereby surveilling a subject for the development of HGD or EAC. 117. The method of embodiment 116, wherein the generating includes obtaining a sample derived from the subject.118. The method of embodiments 116 or 117, wherein the generating includes detecting a methylation status of cytosines located in an epigenetic loci selected from at least BTBD3, DCLK2, MAFB, and / or cg7186 from a sample.119. The method of any of embodiments 116-118, further including determining the development of HGD or EAC based on the generated methylation value.120. The method of any of embodiments 116-119, wherein the subject has a high risk for developing HGD or EAC.121. The method of any of embodiments 116-120, wherein the subject has Barrett’s esophagus.122. The method of any of embodiments 116-121, wherein the method includes repeating the generating every 3 months to 3 years.123. The method of any of embodiments 116-122, further including treating the subject for HGD or EAC if the subject is diagnosed with HGD or EAC.124. The method of embodiment 123, wherein the treating includes resection and / or ablativeF053-6017PCT / 25-002-WO-PCTtherapy.125. The method of embodiment 124, wherein the resection includes endoscopic mucosal resection (EMR).126. The method of embodiments 124 or 125, wherein the ablative therapy includes radiofrequency ablation (RFA), photodynamic therapy, thermal laser, argon plasma coagulation (APC), multipolar electrocoagulation, or cryotherapy.

[0110] (VIII) Closing Paragraphs. The nucleic acid and amino acid sequences provided herein are shown using letter abbreviations for nucleotide bases and amino acid residues, as defined in 37 C.F.R. §1.831-1.835 and set forth in WIPO Standard ST.26 (implemented on July 1, 2022). Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included in embodiments where it would be appropriate.

[0111] Variants of the sequences disclosed and referenced herein are also included. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological activity can be found using computer programs well known in the art, such as DNASTAR™ (Madison, Wisconsin) software.

[0112] Variants of gene sequences can include codon optimized variants, sequence polymorphisms, splice variants, and / or mutations that do not affect the function of an encoded product to a statistically-significant degree.

[0113] Variants of the nucleic acids disclosed herein also include sequences with at least 70% sequence identity, 80% sequence identity, 81% sequence identity, 82% sequence identity, 83% sequence identity, 84% sequence identity, 85% sequence, 86% sequence identity, 87% sequence identity, 88% sequence identity, 89% sequence identity, 90% sequence identity, 91% sequence identity, 92% sequence identity, 93% sequence identity, 94% sequence identity, 95% sequence identity, 96% sequence identity, 97% sequence identity, 98% sequence identity, or 99% sequence identity to the nucleic acids disclosed herein.

[0114] “% sequence identity” refers to a relationship between two or more sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between protein, nucleic acid, or gene sequences as determined by the match between strings of such sequences. "Identity" (often referred to as "similarity") can be readily calculated by known methods, including those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, NY (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, NY (1994); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, NJ (1994); Sequence Analysis in Molecular Biology (Von Heijne, G., ed.) Academic Press (1987); and Sequence Analysis PrimerF053-6017PCT / 25-002-WO-PCT(Gribskov, M. and Devereux, J., eds.) Oxford University Press, NY (1992). Methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR, Inc., Madison, Wisconsin). Multiple alignment of the sequences can also be performed using the Clustal method of alignment (Higgins and Sharp CABIOS, 5, 151-153 (1989) with default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Relevant programs also include the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wisconsin); BLASTP, BLASTN, BLASTX (Altschul, et al., J. Mol. Biol. 215:403-410 (1990); DNASTAR (DNASTAR, Inc., Madison, Wisconsin); and the FASTA program incorporating the Smith-Waterman algorithm (Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Publisher: Plenum, New York, N.Y.. Within the context of this disclosure it will be understood that where sequence analysis software is used for analysis, the results of the analysis are based on the "default values" of the program referenced. As used herein "default values" will mean any set of values or parameters, which originally load with the software when first initialized.

[0115] Moreover, the term “gene” can include not only coding sequences but also regulatory regions such as promoters, enhancers, and termination regions. The term further can include all introns and other DNA sequences spliced from the mRNA transcript, along with variants resulting from alternative splice sites. Portions of complete gene sequences can be referenced as is understood by one of ordinary skill in the art.

[0116] Variants also include nucleic acid molecules that hybridize under stringent hybridization conditions to a sequence disclosed herein and provide the same function as the reference sequence. Exemplary stringent hybridization conditions include an overnight incubation at 42 °C in a solution including 50% formamide, 5XSSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5XDenhardt's solution, 10% dextran sulfate, and 20 pg / ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1XSSC at 50 °C. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature. For example, moderately high stringency conditions include an overnight incubation at 37°C in a solution including 6XSSPE (20XSSPE=3M NaCI; 0.2M NaH2PO4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 pg / ml salmon sperm blocking DNA; followed by washes at 50 °C with 1XSSPE, 0.1 % SDS. In addition, to achieve evenF053-6017PCT / 25-002-WO-PCTlower stringency, washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5XSSC). Variations in the above conditions may be accomplished through the inclusion and / or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.

[0117] As will be understood by one of ordinary skill in the art, each embodiment disclosed herein can comprise, consist essentially of or consist of its particular stated element, step, ingredient or component. Thus, the terms “include” or “including” should be interpreted to recite: “comprise, consist of, or consist essentially of.” The transition term “comprise” or “comprises” means has, but is not limited to, and allows for the inclusion of unspecified elements, steps, ingredients, or components, even in major amounts. The transitional phrase “consisting of’ excludes any element, step, ingredient or component not specified. The transition phrase “consisting essentially of” limits the scope of the embodiment to the specified elements, steps, ingredients or components and to those that do not materially affect the embodiment. A material effect would cause a statistically significant reduction in the ability to detect HGD or EAC, as described herein.

[0118] In the context of nucleotide sequences, “reagents to detect”, “target specific probes” and “specific for” mean that the nucleotide sequences interact with target sequences (or sequences related to the target sequence based on the particular assay) with sufficient specificity and strength to reliably detect methylation status of cytosines within the targeted sequence. Particular nucleotide sequences with these characteristics can be readily generated and identified by those of ordinary skill in the art, based on the teachings of the current disclosure and with reference to numerous publicly available resources and databases.

[0119] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. When further clarity is required, the term “about” has the meaning reasonably ascribed to it by a person skilled in the art when used in conjunction with a stated numerical valueF053-6017PCT / 25-002-WO-PCTor range, i.e. denoting somewhat more or somewhat less than the stated value or range, to within a range of ±20% of the stated value; ±19% of the stated value; ±18% of the stated value; ±17% of the stated value; ±16% of the stated value; ±15% of the stated value; ±14% of the stated value; ±13% of the stated value; ±12% of the stated value; ±11% of the stated value; ±10% of the stated value; ±9% of the stated value; ±8% of the stated value; ±7% of the stated value; ±6% of the stated value; ±5% of the stated value; ±4% of the stated value; ±3% of the stated value; ±2% of the stated value; or ±1% of the stated value.

[0120] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0121] The terms “a,” “an,” “the” and similar referents used in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0122] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other members of the group or other elements found herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0123] Certain embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoingF053-6017PCT / 25-002-WO-PCTdescription. The inventor expects skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0124] Furthermore, numerous references have been made to patents, printed publications, journal articles and other written text throughout this specification (referenced materials herein). Each of the referenced materials are individually incorporated herein by reference in their entirety for their referenced teaching.

[0125] In closing, it is to be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the present invention. Other modifications that may be employed are within the scope of the invention. Thus, by way of example, but not of limitation, alternative configurations of the present invention may be utilized in accordance with the teachings herein. Accordingly, the present invention is not limited to that precisely as shown and described.

[0126] The particulars shown herein are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of various embodiments of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for the fundamental understanding of the invention, the description taken with the drawings and / or examples making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0127] Definitions and explanations used in the present disclosure are meant and intended to be controlling in any future construction unless clearly and unambiguously modified in the examples or when application of the meaning renders any construction meaningless or essentially meaningless. In cases where the construction of the term would render it meaningless or essentially meaningless, the definition should be taken from Webster's Dictionary, 3rd Edition or a dictionary known to those of ordinary skill in the art, such as the Oxford Dictionary of Biochemistry and Molecular Biology (Eds. Attwood T et al., Oxford University Press, Oxford, 2006).

Claims

F053-6017PCT / 25-002-WO-PCTCLAIMSWhat is claimed is:

1. A method for determining a presence of high grade dysplasia (HGD) or esophageal adenocarcinoma (EAC) in a subject, the method comprising:obtaining a sample derived from the subject;detecting a methylation status of cytosines located in an epigenetic loci selected from BTBD3, DCLK2, MAFB, and cg7186 from the sample to generate a methylation value;anddetermining that HGD or EAC is present or absent in the subject based on the generated methylation value.

2. A method for determining a presence of high grade dysplasia (HGD) or esophageal adenocarcinoma (EAC) in a subject, the method comprising:obtaining a sample derived from the subject;detecting a methylation status of cytosines located in an epigenetic loci selected from BTBD3, DCLK2, MAFB, and / or cg7186 from the sample to generate a methylation value; anddetermining that HGD or EAC is present or absent in the subject based on the generated methylation value.

3. The method of claim 2, wherein the sample was obtained with an esophageal brush, esophageal sponge, or cytology balloon.

4. The method of claim 2, wherein the sample comprises genomic DNA.

5. The method of claim 2, wherein the subject has Barrett’s esophagus.

6. The method of claim 2, wherein the subject is at risk of developing HGD or EAC.

7. The method of claim 2, wherein the epigenetic loci comprise BTBD3.

8. The method of claim 2, wherein the epigenetic loci comprise DCLK2.

9. The method of claim 2, wherein the epigenetic loci comprise MAFB.

10. The method of claim 2, wherein the epigenetic loci comprise cg7186.

11. The method of claim 2, wherein the epigenetic loci comprise (i) BTBD3 and DCLK2, (ii) BTBD3 and MAFB, or (iii) DCLK2 and MAFB.

12. The method of claim 2, wherein the epigenetic loci comprise (i) cg7186 and BTBD3 DCLK2, (ii) cg7186 and DCLK2, or (iii) cg7186 and MAFB.

13. The method of claim 2, wherein the epigenetic loci comprise BTBD3, DCLK2, and MAFB.

14. The method of claim 2, wherein the epigenetic loci comprise BTBD3, DCLK2, MAFB and eg 7186.F053-6017PCT / 25-002-WO-PCT15. The method of claim 2, wherein the detecting comprises extracting DNA from the sample.

16. The method of claim 2, wherein the detecting comprises digital polymerase chain reaction.

17. The method of claim 2, wherein the detecting comprises multiplexed digital polymerase chain reaction.

18. The method of claim 17, wherein the DNA comprises genomic DNA.

19. The method of claim 15, wherein the extracted DNA comprises 4 ng of DNA.

20. The method of claim 2, wherein the detecting comprises treating extracted DNA with bisulfite.

21. The method of claim 2, wherein the detecting comprises amplifying extracted DNA.

22. The method of claim 2, wherein the detecting comprises amplifying bisulfite-treated DNA.

23. The method of claim 2, wherein the detecting comprises providing a reaction mixture comprising:a set of primers specific to each of the epigenetic loci, wherein the primers are designed to identify the methylation status of the epigenetic loci;a set of probes specific to each of the epigenetic loci, wherein each probe is distinguishable based on a unique signal;a DNA polymerase; anddeoxynucleotide triphosphates (dNTPs).

24. The method of claim 23, wherein the set of primers have sequences of SEQ ID NO: 9 and SEQ ID NO: 10 or sequences having at least 95% sequence identity thereto.

25. The method of claim 23, wherein the set of probes comprise at least one probe having a sequence of SEQ ID NO: 11 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 11.

26. The method of claim 23, wherein the set of primers have sequences of SEQ ID NO: 12 and SEQ ID NO: 13 or sequences having at least 95% sequence identity thereto.

27. The method of claim 23, wherein the set of probes comprise at least one probe having a sequence of SEQ ID NO: 14 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 14.

28. The method of claim 23, wherein the set of primers have sequences of SEQ ID NO: 15 and SEQ ID NO: 16 or sequences having at least 95% sequence identity thereto.

29. The method of claim 23, wherein the set of probes comprise at least one probe having a sequence of SEQ ID NO: 17 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 17.

30. The method of claim 23, wherein the set of primers have sequences of SEQ ID NO: 18F053-6017PCT / 25-002-WO-PCTand SEQ ID NO: 19 or sequences having at least 95% sequence identity thereto.

31. The method of claim 23, wherein the set of probes comprise at least one probe having a sequence of SEQ ID NO: 20 ora sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 20.

32. The method of claim 23, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 12, and 13 or sequences having at least 95% sequence identity thereto.

33. The method of claim 23, wherein the set of probes have sequences of SEQ ID NOs: 11 and 14 or sequences having at least 95% sequence identity thereto.

34. The method of claim 23, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 15, and 16, or sequences having at least 95% sequence identity thereto.

35. The method of claim 23, wherein the set of probes have sequences of SEQ ID NOs: 11 and 17 or sequences having at least 95% sequence identity thereto.

36. The method of claim 23, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 18, and 19, or sequences having at least 95% sequence identity thereto.

37. The method of claim 23, wherein the set of probes have sequences of SEQ ID NOs: 11 and 20 or sequences having at least 95% sequence identity thereto.

38. The method of claim 23, wherein the set of primers have sequences of SEQ ID NOs: 12, 13, 15, and 16 or sequences having at least 95% sequence identity thereto.

39. The method of claim 23, wherein the set of probes have sequences of SEQ ID NOs: 14 and 17 or sequences having at least 95% sequence identity thereto.

40. The method of claim 23, wherein the set of primers have sequences of SEQ ID NOs: 12, 13, 18, and 19, or sequences having at least 95% sequence identity thereto.

41. The method of claim 23, wherein the set of probes have sequences of SEQ ID NOs: 14 and 20 or sequences having at least 95% sequence identity thereto.

42. The method of claim 23, wherein the set of primers have sequences of SEQ ID NOs: 15, 16, 18, and 19 or sequences having at least 95% sequence identity thereto.

43. The method of claim 23, wherein the set of probes have sequences of SEQ ID NOs: 17 and 20 or sequences having at least 95% sequence identity thereto.

44. The method of claim 23, wherein the set of primers have sequences of SEQ ID NOs: 9, 10, 12, 13, 15, 16, 18, or 19 or sequences having at least 95% sequence identity thereto.

45. The method of claim 23, wherein the set of probes have sequences of SEQ ID NOs: 11, 14, 17, and 20 or sequences having at least 95% sequence identity thereto.

46. The method of claim 23, wherein the reaction mixture further comprises a buffer.

47. The method of claim 23, wherein each probe is labeled with a detectable label.F053-6017PCT / 25-002-WO-PCT48. The method of claim 47, wherein the detectable label comprises a dye, a radioactive isotope, an enzyme, a magnetic bead, or biotin.

49. The method of claim 23, wherein each probe is a fluorescently labeled probe.

50. The method of claim 23, wherein the detecting comprises partitioning the reaction mixture into a plurality of partitions, wherein each partition contains a fraction of the reaction mixture.

51. The method of claim 50, wherein the partitions are nanoplate partitions.

52. The method of claim 50, wherein the detecting comprises thermally cycling partitions to amplify the epigenetic loci within each droplet, wherein each partition may contain zero, one, or multiple copies of the epigenetic loci.

53. The method of claim 50, wherein the detecting comprises detecting unique probe signals emitted from each partition to determine the presence or absence of each epigenetic loci within individual partitions.

54. The method of claim 53, wherein the detecting comprises analyzing the detected unique probe signals to quantify a number of partitions containing each epigenetic loci, thereby determining the methylation value of each epigenetic loci in the sample.

55. The method of claim 2, wherein the generated methylation value is compared to a reference level.

56. The method of claim 55, wherein the reference level is derived from a population of subjects with normal or Barrett’s esophagus.

57. The method of claim 56, wherein the generated methylation value is increased in comparison to the reference level; and HGD or EAC is determined to be present.

58. The method of claim 56, wherein the generated methylation value is not increased in comparison to the reference level and HGD or EAC is determined to not be present.

59. The method of claim 55, wherein the reference level is derived from a population of subjects HGD or EAC.

60. The method of claim 59, wherein the generated methylation value is decreased in comparison to the reference level; and HGD or EAC is determined to not be present.

61. The method of claim 59, wherein the generated methylation value is not decreased in comparison to the reference level and HGD or EAC is determined to be present.

62. The method of claim 2, wherein the method further comprises detecting a methylation status of cytosines located in other epigenetic loci.

63. The method of claim 2, wherein the method further comprises detecting other biomarkers.

64. A kit for detecting a high grade dysplasia (HGD) or esophageal adenocarcinoma (EAC) tissue sample, the kit comprising reagents to detect methylation status of cytosines located in oneF053-6017PCT / 25-002-WO-PCTor more epigenetic loci selected from BTBD3, DCLK2, MAFB, and / or cg7186.

65. The kit of claim 64, wherein the epigenetic loci comprise BTBD3.

66. The kit of claim 64, wherein the epigenetic loci comprise DCLK2.

67. The kit of claim 64, wherein the epigenetic loci comprise MAFB.

68. The kit of claim 64, wherein the epigenetic loci comprise cg7186.

69. The kit of claim 64, wherein the reagents detect methylation status of cytosine within (i) BTBD3 and DCLK2, (ii) BTBD3 and MAFB, or (iii) DCLK2 and MAFB.

70. The kit of claim 64, wherein the epigenetic loci comprise (i) cg7186 and BTBD3 DCLK2, (ii) cg7186 and DCLK2, or (iii) cg7186 and MAFB.

71. The kit of claim 64, wherein the reagents detect methylation status of cytosines within BTBD3, DCLK2, and MAFB.

72. The kit of claim 64, wherein the reagents detect methylation status of cytosines within BTBD3, DCLK2, MAFB, and cg7186.

73. The kit of claim 64, wherein the kit comprises a primer pair having sequences of SEQ ID NO: 9 and SEQ ID NO: 10 or sequences having at least 95% sequence identity thereto.

74. The kit of claim 64, wherein the kit comprises a probe having a sequence of SEQ ID NO: 11 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO:

11.

75. The kit of claim 64, wherein the kit comprises a primer pair having sequences of SEQ ID NO: 12 and SEQ ID NO: 13 or sequences having at least 95% sequence identity thereto.

76. The kit of claim 64, wherein the kit comprises a probe having a sequence of SEQ ID NO: 14 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO:

14.

77. The kit of claim 64, wherein the kit comprises a primer pair having sequences of SEQ ID NO: 15 and SEQ ID NO: 16 or sequences having at least 95% sequence identity thereto.

78. The kit of claim 64, wherein the kit comprises a probe having a sequence of SEQ ID NO: 17 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO:

17.

79. The kit of claim 64, wherein the kit comprises a primer pair having sequences of SEQ ID NO: 18 and SEQ ID NO: 19 or sequences having at least 95% sequence identity thereto.

80. The kit of claim 64, wherein the kit comprises a probe having a sequence of SEQ ID NO: 20 or a sequence having at least 95% sequence identity to the sequence of SEQ ID NO:

20.

81. The kit of claim 64, wherein the kit comprises primer pairs having sequences of SEQ ID NOs: 9, 10, 12, and 13 or sequences having at least 95% sequence identity thereto.

82. The kit of claim 64, wherein the kit comprises probes having sequences of SEQ ID NOs: 11 and 14 or sequences having at least 95% sequence identity thereto.

83. The kit of claim 64, wherein the kit comprises primer pairs having sequences of SEQ IDF053-6017PCT / 25-002-WO-PCTNOs: 9, 10, 15, and 16, or sequences having at least 95% sequence identity thereto.

84. The kit of claim 64, wherein the kit comprises probes having sequences of SEQ ID NOs: 11 and 17 or sequences having at least 95% sequence identity thereto.

85. The kit of claim 64, wherein the kit comprises primer pairs having sequences of SEQ ID NOs: 9, 10, 18, and 19, or sequences having at least 95% sequence identity thereto.

86. The kit of claim 64, wherein the kit comprises probes having sequences of SEQ ID NOs: 11 and 20 or sequences having at least 95% sequence identity thereto.

87. The kit of claim 64, wherein the kit comprises primer pairs having sequences of SEQ ID NOs: 12, 13, 15, and 16, or sequences having at least 95% sequence identity thereto.

88. The kit of claim 64, wherein the kit comprises probes having sequences of SEQ ID NOs: 14 and 17 or sequences having at least 95% sequence identity thereto.

89. The kit of claim 64, wherein the kit comprises primer pairs having sequences of SEQ ID NOs: 12, 13, 18, and 19, or sequences having at least 95% sequence identity thereto.

90. The kit of claim 64, wherein the kit comprises probes having sequences of SEQ ID NOs: 14 and 20 or sequences having at least 95% sequence identity thereto.

91. The kit of claim 64, wherein the kit comprises primer pairs having sequences of SEQ ID NOs: 15, 16, 18, and 19 or sequences having at least 95% sequence identity thereto.

92. The kit of claim 64, wherein the kit comprises probes having sequences of SEQ ID NOs: 17 and 20 or sequences having at least 95% sequence identity thereto.

93. The kit of claim 64, wherein the kit comprises primer pairs having sequences of SEQ ID NOs: 9, 10, 12, 13, 15, 16, 18, and 19 or sequences having at least 95% sequence identity thereto.

94. The kit of claim 64, wherein the kit comprises probes having sequences of SEQ ID NOs: 11, 14, 17, and 20 or sequences having at least 95% sequence identity thereto.

95. The kit of claim 64, further comprising DNA-fragmenting enzymes.

96. The kit of claim 64, further comprising bisulfite.

97. The kit of claim 64, further comprising a replication enzyme.

98. The kit of claim 97, wherein the replication enzyme is a thermostable DNA polymerase.

99. The kit of claim 64, further comprising deoxynucleotide triphosphates (dNTPs).

100. The kit of claim 64, wherein each probe comprises a detectable label.

101. The kit of claim 100, wherein the detectable label is a fluorescent label, dye, radioactive isotope, enzyme, magnetic bead, or biotin.

102. The kit of claim 100, wherein the detectable label is a fluorescent label.

103. The kit of claim 64, further comprising a reference level.

104. The kit of claim 103, wherein the reference level is derived from a population of subjectsF053-6017PCT / 25-002-WO-PCTwith normal or Barrett’s esophagus.

105. The kit of claim 104, wherein an increased methylation status as compared to the reference level distinguishes the sample as HGD or EAC.

106. The kit of claim 103, wherein the reference level is derived from a population of subjects with HGD or EAC.

107. The kit of claim 106, wherein a similar methylation status as compared to the reference level distinguishes the sample as HGD or EAC.

108. The kit of claim 106, wherein a decreased methylation status as compared to the reference level distinguishes the sample as normal or Barrett’s esophagus.

109. The kit of claim 64, wherein the kit further comprises reagents to detect other biomarkers.

110. The kit of claim 64, wherein the kit can be used with other kits for detecting biomarkers.

111. The kit of claim 64, further comprising a sample collector.

112. The kit of claim 111, wherein the sample collector comprises an esophageal brush, esophageal sponge, or cytology balloon.

113. A method to diagnose a subject as having a high-grade dysplasia (HGD) or esophageal adenocarcinoma (EAC), the method comprising:obtaining a sample derived from the subject;detecting a methylation status of cytosines located in an epigenetic loci selected from at least BTBD3, DCLK2, and / or MAFB from the sample to generate a methylation value;anddiagnosing the subject as having HGD or EAC based on the generated methylation value.

114. The method of claim 113, wherein the diagnosing with HGD or EAC directs an aggressive or experimental treatment for the subject.

115. The method of claim 113, wherein the diagnosing with HGD or EAC directs a treatment.

116. The method of claim 115, wherein the treatment comprises resection and / or ablative therapy.

117. The method of claim 116, wherein the resection comprises endoscopic mucosal resection (EMR).

118. The method of claim 116, wherein the ablative therapy comprises radiofrequency ablation (RFA), photodynamic therapy, thermal laser, argon plasma coagulation (APC), multipolar electrocoagulation, or cryotherapy.

119. The method of claim 113, wherein the subject has a high risk for developing HGD or EAC.

120. The method of claim 113, wherein the subject has Barrett’s esophagus.

121. A method of surveill ing a subject for development of HGD or EAC comprisingF053-6017PCT / 25-002-WO-PCTgenerating a methylation value; andrepeating the generating, thereby surveying a subject for the development of HGD or EAC.

122. The method of claim 121, wherein the generating comprises obtaining a sample derived from the subject.

123. The method of claim 121 , wherein the generating comprises detecting a methylation status of cytosines located in an epigenetic loci selected from at least BTBD3, DCLK2, MAFB, and cg7186 from a sample.

124. The method of claim 121, further comprising determining the development of HGD or EAC based on the generated methylation value.

125. The method of claim 121 , wherein the subject has a high risk for developing HGD or EAC.

126. The method of claim 121, wherein the subject has Barrett’s esophagus.

127. The method of claim 121, wherein the method comprises repeating the generating every 3 months to 3 years.

128. The method of claim 121, further comprising treating the subject for HGD or EAC if the subject is diagnosed with HGD or EAC.

129. The method of claim 128, wherein the treating comprises resection and / or ablative therapy.

130. The method of claim 129, wherein the resection comprises endoscopic mucosal resection (EMR).

131. The method of claim 129, wherein the ablative therapy comprises radiofrequency ablation (RFA), photodynamic therapy, thermal laser, argon plasma coagulation (APC), multipolar electrocoagulation, or cryotherapy.

Images