Polypeptide and antibody containing same
By providing a polypeptide as the antibody light chain, a bispecific antibody was constructed, which solved the problem of poor MET signaling pathway inhibition in the prior art, enhanced the binding ability of target proteins and reduced the risk of drug resistance, and achieved effective treatment of MET amplified cancer.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- KYINNO BIOTECHNOLOGY (BEIJING) CO LTD
- Filing Date
- 2025-12-30
- Publication Date
- 2026-07-09
AI Technical Summary
Existing technologies are unable to effectively inhibit the MET signaling pathway, especially the ligand-independent pathway, leading to MET-amplified cancers' resistance to EGFR-TKIs. Furthermore, traditional monoclonal antibodies such as Onartuzumab are not effective in inhibiting MET signaling.
This invention provides a polypeptide as the light chain or light chain variable region of an antibody, which has binding affinity and specificity to different epitopes of the target protein, enabling the construction of bispecific antibodies, simplifying the assembly process, ensuring the uniformity of the chemical structure of the product, enhancing the binding ability of the target protein, and reducing the risk of drug resistance.
By constructing bispecific antibodies, the binding strength and persistence to target proteins were enhanced, the risk of drug resistance was reduced, the internalization ability and delivery efficiency of antibodies were improved, and effective inhibition of the MET signaling pathway was achieved.
Smart Images

Figure PCTCN2025147241-FTAPPB-I100001 
Figure PCTCN2025147241-FTAPPB-I100002 
Figure PCTCN2025147241-FTAPPB-I100003
Abstract
Description
A polypeptide and an antibody containing it.
[0001] Cross-references to related applications
[0002] This patent application claims priority to Chinese invention patent application No. CN202411968832.2, filed on December 30, 2024, the entire contents of which are incorporated herein by reference for all purposes. Technical Field
[0003] This invention relates to the field of biomedicine, and more specifically, to a peptide and its use as an antibody light chain, and to antibodies comprising said peptide as a light chain. Background Technology
[0004] The MET receptor tyrosine kinase (RTK) gene is mutated and / or amplified in various subgroups of human cancers. Clinical trials have demonstrated the activity of MET tyrosine kinase inhibitors (TKIs) in these patient populations, validating the role of MET as a cancer driver gene. Lung cancer, in particular, carrying MET exon 14 skipping mutations (MET-ex14) or high levels of MET amplification, responds well to MET TKIs. However, some c-Met monoclonal antibodies, such as Onartuzumab, currently in clinical trials, appear to be less effective in inhibiting ligand-independent MET signaling, limiting their efficacy in MET-amplified cancers.
[0005] Furthermore, the c-MET proto-oncogene can bypass the suppressed EGFR phosphorylation kinase pathway and amplify through the ERBB3-PI3K-AKT and MAPK-ERK1 / 2T pathways. The amplified c-Met promotes downstream signal transduction through bypass activation, avoiding the killing effect of EGFR-TKIs, thus promoting cancer cell proliferation and ultimately leading to EGFR-TKI resistance in patients. c-Met is expressed at low levels or not at all in normal tissues, but it is expressed in lung cancer, liver cancer, pancreatic cancer, and thyroid cancer tissues. To more effectively inhibit MET function, both ligand-dependent and ligand-independent MET signaling pathways must be inhibited simultaneously.
[0006] Bispecific antibodies are a common type of artificial antibody in this field, possessing two specific antigen-binding sites. A special category of bispecific antibodies is biparatopic antibodies (bpAbs). Biparatopic antibodies bind to two different, non-overlapping epitopes on the same antigen, offering significant advantages over traditional monoclonal antibodies (mAbs). For example, biparatopic antibodies exhibit enhanced target protein binding: simultaneous binding to two epitopes produces an "avidity effect," significantly increasing the binding strength between the antibody and antigen (especially for low-expressed antigens), making the binding more stable and durable; they reduce the risk of drug resistance: even if a single epitope mutation at the target site leads to monoclonal antibody inactivation, the biparatopic antibody can still bind through the other epitope, reducing the possibility of tumor or pathogen escape; and they have more efficient internalization capabilities: simultaneous binding to two epitopes induces stronger cross-linking of the antigen-antibody complex, accelerating clathrin-mediated endocytosis, resulting in antibody-drug conjugates (ADCs) with higher delivery efficiency.
[0007] Current conventional methods for preparing bispecific antibodies often require the simultaneous transfection of four plasmids to express two different heavy chains and two different light chains. However, when these four polypeptide chains are assembled into antibodies, mismatches between the heavy and light chains can occur. Therefore, a proposed method has emerged that provides a polypeptide that can act as a light chain and pair with two heavy chains that have affinity and binding specificity for a specific target protein, thereby constructing a bispecific antibody. That is, only three plasmids expressing two different heavy chains and one identical light chain (a total of three polypeptide chains) need to be transfected into cells. This greatly simplifies the assembly process and ensures a high degree of chemical homogeneity in the expressed products. Furthermore, this polypeptide can also act as a universal light chain and pair with two or more arbitrary heavy chains that have binding affinity and specificity for different target proteins, thereby constructing bispecific or even multispecific antibodies that have binding affinity and specificity for two or more target proteins. Summary of the Invention
[0008] To address the aforementioned problems, the present invention aims to provide a polypeptide, in which the light chain, light chain variable region, or CDRs in the light chain of an antibody can be used to construct an antibody with an antibody heavy chain, heavy chain variable region, or CDRs in the heavy chain that have binding affinity and / or specificity to different epitopes of a target protein (antigen), or with two or more antibody heavy chains, heavy chain variable regions, or CDRs in the heavy chain that respectively have binding affinity and / or specificity to different epitopes of a target protein (antigen). Another object of the present invention is to provide an antibody comprising the said polypeptide as a light chain, light chain variable region, or CDRs in the light chain, for example, in the form of a homodimer or heterodimer.
[0009] The technical solution of the present invention is as follows.
[0010] First aspect
[0011] This invention provides a polypeptide whose amino acid sequence comprises one of the following combinations of amino acid sequences:
[0012] (1)SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.68;
[0013] (2)SEQ ID NO.69 / SEQ ID NO.67 / SEQ ID NO.70;
[0014] (3) SEQ ID NO.66 / SEQ ID NO.71 / SEQ ID NO.72;
[0015] (4)SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.73;
[0016] (5)SEQ ID NO.74 / SEQ ID NO.67 / SEQ ID NO.68;
[0017] (6) SEQ ID NO.75 / SEQ ID NO.67 / SEQ ID NO.68;
[0018] (7) SEQ ID NO.76 / SEQ ID NO.67 / SEQ ID NO.77;
[0019] (8)SEQ ID NO.78 / SEQ ID NO.67 / SEQ ID NO.68;
[0020] (9) SEQ ID NO.79 / SEQ ID NO.67 / SEQ ID NO.68;
[0021] (10)SEQ ID NO.80 / SEQ ID NO.67 / SEQ ID NO.68;
[0022] (11)SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.81;
[0023] (12)SEQ ID NO.66 / SEQ ID NO.82 / SEQ ID NO.149;
[0024] (13)SEQ ID NO.83 / SEQ ID NO.67 / SEQ ID NO.84;
[0025] (14)SEQ ID NO.85 / SEQ ID NO.67 / SEQ ID NO.86;
[0026] (15)SEQ ID NO.80 / SEQ ID NO.67 / SEQ ID NO.87;
[0027] (16)SEQ ID NO.88 / SEQ ID NO.67 / SEQ ID NO.89;
[0028] (17)SEQ ID NO.90 / SEQ ID NO.67 / SEQ ID NO.91;
[0029] (18)SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.92;
[0030] (19)SEQ ID NO.80 / SEQ ID NO.67 / SEQ ID NO.93;
[0031] (20)SEQ ID NO.94 / SEQ ID NO.67 / SEQ ID NO.95;
[0032] (21)SEQ ID NO.96 / SEQ ID NO.67 / SEQ ID NO.68;
[0033] (22)SEQ ID NO.97 / SEQ ID NO.98 / SEQ ID NO.68;
[0034] (23)SEQ ID NO.66 / SEQ ID NO.99 / SEQ ID NO.68;
[0035] (24)SEQ ID NO.100 / SEQ ID NO.67 / SEQ ID NO.101;
[0036] (25)SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.102;
[0037] (26)SEQ ID NO.103 / SEQ ID NO.104 / SEQ ID NO.105;
[0038] (27)SEQ ID NO.85 / SEQ ID NO.67 / SEQ ID NO.106;
[0039] (28)SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.107;
[0040] (29)SEQ ID NO.108 / SEQ ID NO.109 / SEQ ID NO.111;
[0041] (30)SEQ ID NO.110 / SEQ ID NO.67 / SEQ ID NO.111;
[0042] (31)SEQ ID NO.85 / SEQ ID NO.112 / SEQ ID NO.93;
[0043] (32)SEQ ID NO.113 / SEQ ID NO.67 / SEQ ID NO.114;
[0044] (33)SEQ ID NO.115 / SEQ ID NO.67 / SEQ ID NO.116;
[0045] (34)SEQ ID NO.117 / SEQ ID NO.67 / SEQ ID NO.68;
[0046] (35)SEQ ID NO.118 / SEQ ID NO.67 / SEQ ID NO.119;
[0047] (36)SEQ ID NO.120 / SEQ ID NO.67 / SEQ ID NO.68;
[0048] (37)SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.121;
[0049] (38)SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.122;
[0050] (39)SEQ ID NO.123 / SEQ ID NO.67 / SEQ ID NO.124;
[0051] (40)SEQ ID NO.118 / SEQ ID NO.67 / SEQ ID NO.125;
[0052] (41) SEQ ID NO.126 / SEQ ID NO.67 / SEQ ID NO.68;
[0053] (42)SEQ ID NO.127 / SEQ ID NO.67 / SEQ ID NO.128;
[0054] (43) SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.129;
[0055] (44) SEQ ID NO.130 / SEQ ID NO.67 / SEQ ID NO.68;
[0056] (45)SEQ ID NO.66 / SEQ ID NO.82 / SEQ ID NO.131;
[0057] (46) SEQ ID NO.132 / SEQ ID NO.133 / SEQ ID NO.134;
[0058] (47) SEQ ID NO.135 / SEQ ID NO.67 / SEQ ID NO.136; and
[0059] (48) SEQ ID NO.118 / SEQ ID NO.67 / SEQ ID NO.131.
[0060] Furthermore, the polypeptide may comprise any one of the amino acid sequences shown in SEQ ID NO.14 to SEQ ID NO.61, or may comprise an amino acid sequence having at least 75% identity with any one of the amino acid sequences shown in SEQ ID NO.14 to SEQ ID NO.61.
[0061] Furthermore, the polypeptide may also contain the amino acid sequence shown in SEQ ID NO.11, or contain an amino acid sequence that has at least 75% identity with the amino acid sequence shown in SEQ ID NO.11.
[0062] In the context of this invention, the term "at least 75% identity" encompasses any percentage of identity between two amino acid sequences, ranging from at least 75% to 100%, such as 75%, 80%, 85%, 90%, or even 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% identity.
[0063] Second aspect
[0064] This invention provides a polypeptide comprising the following amino acid sequence:
[0065] (i)SA-X1-S-X2-V-X3-X4-M-X5 (SEQ ID NO.150), where:
[0066] X1 is selected from S, T, and N;
[0067] X2 is selected from G and S;
[0068] X3 is selected from R, T, S, and I;
[0069] X4 is selected from Y and F;
[0070] X5 is selected from H and Q;
[0071] (ii) X6-TS-X7-LAS (SEQ ID NO.151), where:
[0072] X6 is selected from D and A;
[0073] X7 is selected from K and R;
[0074] (iii)Q-X8-WS-X9-X10-P-X11-YT(SEQ ID NO.152), where:
[0075] X8 is selected from Q and L;
[0076] X9 is selected from S, R, and P;
[0077] X10 is selected from N and Y;
[0078] X11 is selected from P and S.
[0079] Furthermore, in the SA-X1-S-X2-V-X3-X4-M-X5 (SEQ ID NO.150), X1 can be selected from S and T; X2 can be S; X3 can be selected from R, T and S or from R, T and I; X4 can be Y; or X5 can be H.
[0080] Furthermore, in X6-TS-X7-LAS (SEQ ID NO.151), X6 can be D; or X7 can be K.
[0081] Furthermore, in Q-X8-WS-X9-X10-P-X11-YT (SEQ ID NO.152), X8 can be Q; X9 can be selected from S and R; X10 can be N; or X11 can be P.
[0082] Preferably, the polypeptide may contain the amino acid sequence shown in SEQ ID NO.67 or SEQ ID NO.109.
[0083] Preferably, the polypeptide does not simultaneously contain the amino acid sequence shown in SEQ ID NO. 66, the amino acid sequence shown in SEQ ID NO. 67, and the amino acid sequence shown in SEQ ID NO. 68.
[0084] Furthermore, the polypeptide may comprise a combination of the following amino acid sequences:
[0085] (1) The amino acid sequence shown in SEQ ID NO. 79; the amino acid sequence shown in SEQ ID NO. 67; the amino acid sequence shown in SEQ ID NO. 68;
[0086] (2) The amino acid sequence shown in SEQ ID NO. 94; the amino acid sequence shown in SEQ ID NO. 67; the amino acid sequence shown in SEQ ID NO. 95;
[0087] (3) The amino acid sequence shown in SEQ ID NO. 100; the amino acid sequence shown in SEQ ID NO. 67; the amino acid sequence shown in SEQ ID NO. 101;
[0088] (4) The amino acid sequence shown in SEQ ID NO. 108; the amino acid sequence shown in SEQ ID NO. 109; the amino acid sequence shown in SEQ ID NO. 111; or
[0089] (5) The amino acid sequence shown in SEQ ID NO.118; the amino acid sequence shown in SEQ ID NO.67; the amino acid sequence shown in SEQ ID NO.125.
[0090] Further, the polypeptide may comprise any one of the amino acid sequences shown in SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42, and SEQ ID NO.53, or may comprise an amino acid sequence having at least 75% identity with any one of the amino acid sequences shown in SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42, and SEQ ID NO.53.
[0091] Furthermore, the polypeptide may also contain the amino acid sequence shown in SEQ ID NO.11, or contain an amino acid sequence that has at least 75% identity with the amino acid sequence shown in SEQ ID NO.11.
[0092] The polypeptides provided in the first and second aspects of this specification are all derived from the specific polypeptides or antibodies provided in the embodiments of this application. The polypeptides provided by this invention, as the light chain, light chain variable region, or antigen complementarity-determining region (CDR) of an antibody, can be used to construct antibodies by reacting with the heavy chain, heavy chain variable region, or heavy chain CDR of an antibody that has binding affinity and / or specificity to different target proteins (antigens). The antibodies retain or have stronger binding affinity and / or specificity to the target protein (antigen) and corresponding biological activity. Alternatively, the polypeptides provided by this invention, as the light chain, light chain variable region, or antigen complementarity-determining region (CDR) of an antibody, can be used to construct antibodies by reacting with the heavy chain, heavy chain variable region, or heavy chain CDR of an antibody that has binding affinity and / or specificity to different epitopes of the same target protein (antigen). The antibodies retain or have stronger binding affinity and / or specificity to the target protein (antigen) and corresponding biological activity.
[0093] The constructed antibody can have any structural form, such as a monoclonal antibody or antibody forms like scFv, dsFv, (dsFv)2, Fab, Fab', F(ab')2, or Fv. For example, the polypeptide, as the light chain, light chain variable region, or CDRs in the light chain of an antibody, can be combined with the heavy chain, heavy chain variable region, or CDRs in the heavy chain of an antibody that has binding affinity and / or specificity to a target protein (antigen) to construct an antibody that still has binding affinity and / or specificity to that target protein (antigen). This antibody is a homodimer form of antibody (a monospecific antibody) having two identical heavy chains and two identical light chains. Alternatively, for example, the polypeptide, as the light chain, variable region of the light chain, or CDRs in the light chain of an antibody, can be combined with the heavy chain, variable region of the heavy chain, or CDRs in the heavy chain (parents) of two antibodies that have binding affinity and / or specificity for different target proteins (antigens) or the same target protein (antigen), to construct an antibody that still has binding affinity and / or specificity for that target protein (antigen), or an antibody that even has stronger binding affinity and / or specificity than the parent. This antibody is a heterodimeric antibody with two different heavy chains and two identical light chains (a bispecific antibody). Furthermore, the polypeptide provided by this invention can also be used to construct multispecific antibodies that have binding affinity and / or specificity for more target proteins (antigens).
[0094] Third aspect
[0095] The present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide described in the first or second aspect.
[0096] Fourth aspect
[0097] The present invention provides the use of the polypeptide described in the first or second aspect or the nucleic acid molecule described in the third aspect in the construction of antibodies.
[0098] Experiments have shown that, as the light chain or light chain variable region of an antibody, the polypeptide provided in the first aspect of the present invention can be used with the heavy chain or antibody heavy chain variable region of an antibody that has binding affinity and / or specificity to different target proteins (antigens) to construct new antibodies, wherein the antibodies retain (or even have stronger) binding affinity and / or specificity to the target protein (antigen) and biological activity, etc.
[0099] According to a specific embodiment of the present invention, the target protein may be receptor tyrosine kinase c-Met, epidermal growth factor receptor (EGFR), or B7 family protein B7-H3. In the context of the present invention, c-Met, EGFR, or B7-H3 may be mammalian, such as primate or rodent c-Met, EGFR, or B7-H3, more preferably human.
[0100] Accordingly, as described in the first or second aspect above, the constructed antibody can be a homodimeric antibody having two identical heavy chains and two identical light chains, or a heterodimeric antibody having two different heavy chains and two identical light chains. The polypeptide can serve as the light chain or a variable region of the light chain of the antibody. For example, if the constructed antibody is a bispecific antibody, the polypeptide provided in the first or second aspect of this invention serves as the common light chain of the bispecific antibody.
[0101] Fifth aspect
[0102] The present invention provides an antibody or an antigen-binding fragment thereof, wherein the antibody or the antigen-binding fragment thereof comprises a polypeptide provided in the first or second aspect of the present invention as a light chain, a light chain variable region, or CDRs in the light chain of the antibody.
[0103] In the context of this invention, the antigen-binding fragment is any functional fragment of an antibody capable of specifically binding to a target protein. In the context of this invention, "target protein" and "target" and "antigen" are used interchangeably.
[0104] The antibodies or antigen-binding fragments provided by this invention can be IgG-like antibodies, or antibody forms such as scFv, dsFv, (dsFv)2, Fab, Fab', F(ab')2, or Fv. In this invention, "IgG-like antibody" refers to an antibody or antigen-binding fragment having two Fab arms and an optional Fc region, and is a traditional monoclonal antibody (mAb) structure or a similar structure. In this invention, "Fab arm" refers to a Fab fragment (Antigen-binding fragment), which consists of a complete light chain (variable and constant regions) and a partial heavy chain structure (variable region and a constant region fragment), with the light and heavy chains linked by disulfide bonds. Regarding target protein (antigen) binding properties, the antibodies or antigen-binding fragments provided by this invention can be bispecific antibodies.
[0105] Preferably, the antibody or antigen-binding fragment provided by the present invention comprises the amino acid sequence provided by the first or second aspect of the present invention (e.g., as shown in any one of items (1) to (48) of the first aspect) as light chain CDRs; or comprises the amino acid sequence shown in any one of SEQ ID NO. 14 to SEQ ID NO. 61 as a light chain variable region (VL). Alternatively, the antibody or antigen-binding fragment provided by the present invention further comprises the amino acid sequence shown in SEQ ID NO. 11 as a light chain constant region.
[0106] Furthermore, the antibody or its antigen-binding fragment provided by the present invention further includes a heavy chain variable region (VH), which forms a binding domain for the target protein with the antibody light chain, the light chain variable region, or CDRs in the light chain. According to a specific embodiment of the present invention, the target protein may be c-Met, EGFR, or B7-H3.
[0107] According to a specific embodiment of the present invention, the antibody or its antigen-binding fragment respectively comprises heavy chain CDRs (HCDR1, HCDR2 and HCDR3) and light chain CDRs (LCDR1, LCDR2 and LCDR3) as shown below:
[0108] The heavy chain CDRs respectively contain the amino acid sequences shown in SEQ ID NO.137 / SEQ ID NO.138 / SEQ ID NO.139; or respectively contain the amino acid sequences shown in SEQ ID NO.143 / SEQ ID NO.144 / SEQ ID NO.145; and
[0109] The light chain CDRs each contain an amino acid sequence of one of the combinations of amino acid sequences shown in (1) to (48) of the first aspect.
[0110] Further, the antibody or its antigen-binding fragment may comprise a heavy chain variable region and a light chain variable region, both of which include the aforementioned CDRs and the framework region (FR) therebetween, and the arrangement of the regions may be FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Further, regarding the amino acid sequence, the heavy chain variable region may comprise the amino acid sequence shown in SEQ ID NO. 62 or SEQ ID NO. 63, or a sequence having at least 75% identity with the amino acid sequence shown in SEQ ID NO. 62 or SEQ ID NO. 63; the light chain variable region may comprise any one of the amino acid sequences shown in SEQ ID NO. 14 to SEQ ID NO. 61, or a sequence having at least 75% identity with the amino acid sequence shown in any one of SEQ ID NO. 14 to SEQ ID NO. 61.
[0111] Alternatively, the antibody or its antigen-binding fragment provided by the present invention may comprise light chain CDRs (LCDR1, LCDR2, and LCDR3) as shown below:
[0112] (i)LCDR1: SA-X1-S-X2-V-X3-X4-M-X5 (SEQ ID NO.150), where:
[0113] X1 is selected from S, T, and N;
[0114] X2 is selected from G and S;
[0115] X3 is selected from R, T, S, and I;
[0116] X4 is selected from Y and F;
[0117] X5 is selected from H and Q;
[0118] (ii) LCDR2: X6-TS-X7-LAS (SEQ ID NO.151), where:
[0119] X6 is selected from D and A;
[0120] X7 is selected from K and R;
[0121] (iii) LCDR3: Q-X8-WS-X9-X10-P-X11-YT (SEQ ID NO.152), where:
[0122] X8 is selected from Q and L;
[0123] X9 is selected from S, R, and P;
[0124] X10 is selected from N and Y;
[0125] X11 is selected from P and S.
[0126] Furthermore, in the LCDR1, X1 can be selected from S and T; X2 can be S; X3 can be selected from R, T and S or from R, T and I; X4 can be Y; or X5 can be H.
[0127] Furthermore, in the LCDR2, X6 can be D; or X7 can be K.
[0128] Furthermore, in the LCDR3, X8 can be Q; X9 can be selected from S and R; X10 can be N; or X11 can be P.
[0129] Preferably, the LCDR2 may contain the amino acid sequence shown in SEQ ID NO.67 or SEQ ID NO.109.
[0130] Preferably, the antibody or its antigen-binding fragment may not simultaneously contain the amino acid sequence shown in SEQ ID NO. 66; the amino acid sequence shown in SEQ ID NO. 67; or the amino acid sequence shown in SEQ ID NO. 68.
[0131] Furthermore, the light chain CDRs respectively include:
[0132] (1) LCDR1: amino acid sequence shown in SEQ ID NO.79; LCDR2: amino acid sequence shown in SEQ ID NO.67; LCDR3: amino acid sequence shown in SEQ ID NO.68;
[0133] (2) LCDR1: amino acid sequence shown in SEQ ID NO.94; LCDR2: amino acid sequence shown in SEQ ID NO.67; LCDR3: amino acid sequence shown in SEQ ID NO.95;
[0134] (3) LCDR1: amino acid sequence shown in SEQ ID NO.100; LCDR2: amino acid sequence shown in SEQ ID NO.67; LCDR3: amino acid sequence shown in SEQ ID NO.101;
[0135] (4) LCDR1: amino acid sequence shown in SEQ ID NO. 108; LCDR2: amino acid sequence shown in SEQ ID NO. 109; LCDR3: amino acid sequence shown in SEQ ID NO. 111; or
[0136] (5) LCDR1: amino acid sequence shown in SEQ ID NO.118; LCDR2: amino acid sequence shown in SEQ ID NO.67; LCDR3: amino acid sequence shown in SEQ ID NO.125.
[0137] Further, the antibody or its antigen-binding fragment may include a light chain variable region. In terms of amino acid sequence, the light chain variable region may include the amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42, and SEQ ID NO.53, or may include an amino acid sequence having at least 75% identity with the amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42, and SEQ ID NO.53.
[0138] The antibody or its antigen-binding fragment may be a mouse antibody, a chimeric antibody, or a humanized antibody; and may further include a heavy chain constant region and / or a light chain constant region. According to a specific embodiment of the present invention, the heavy chain constant region may be the heavy chain constant region of IgG1 or IgG4; the light chain constant region may be a kappa or lambda light chain constant region. For example, the heavy chain constant region of the antibody or its antigen-binding fragment contains the amino acid sequence shown in SEQ ID NO. 10 (hIgG1); the light chain constant region of the antibody or its antigen-binding fragment contains the amino acid sequence shown in SEQ ID NO. 11 (hkappa). Alternatively, the heavy chain constant region of the antibody or its antigen-binding fragment contains the amino acid sequence shown in SEQ ID NO. 12 (hIgG1; Knob) or SEQ ID NO. 13 (hIgG1; Hole); the light chain constant region of the antibody or its antigen-binding fragment contains the amino acid sequence shown in SEQ ID NO. 11.
[0139] The antibody or antigen-binding fragment provided by this invention may have at least two VH+VL domain combinations (further, at least two Fab arms), i.e., it is an IgG-like antibody. When the antibody or antigen-binding fragment provided by this invention is an IgG-like antibody, the at least two VH+VL domain combinations may be identical, thereby binding to the same target protein (antigen). In this case, the antibody or antigen-binding fragment contains the same amino acid sequence combination selected from LCDR1 to LCDR3 and optionally HCDR1 to HCDR3 provided above in its at least two VH+VL domain combinations (further, at least two Fab arms), or contains the same amino acid sequence combination of the light chain variable region and optionally the heavy chain variable region provided above. The antibody or antigen-binding fragment also contains a heavy chain constant region and a light chain constant region. For example, as described above, the heavy chain constant region contains the amino acid sequence shown in SEQ ID NO. 10; the light chain constant region contains the amino acid sequence shown in SEQ ID NO. 11. Further, the antibody or antigen-binding fragment has a heavy chain and a light chain, for example, a monoclonal antibody having the same two heavy chains and the same two light chains.
[0140] Alternatively, the at least two VH+VL domain combinations (further, at least two Fab arms) of the antibody or its antigen-binding fragment provided by the present invention may be different, thereby binding to different target proteins (antigens). In this case, the antibody contains different amino acid sequence combinations of LCDR1 to LCDR3 and optionally HCDR1 to HCDR3 provided above in its at least two VH+VL domain combinations (further, at least two Fab arms), or contains different amino acid sequence combinations of the light chain variable region and optionally the heavy chain variable region provided above. In this case, it is preferred that the at least two VH+VL domain combinations (further, at least two Fab arms) of the antibody or its antigen-binding fragment contain the same light chain CDRs (LCDR1 to LCDR3) sequence combination, or contain the same light chain VL sequence. For example, the at least two VH+VL domain combinations (further, at least two Fab arms) each contain the amino acid sequence combination provided in any of items (1) to (48) above. Furthermore, each of the at least two VH+VL domain combinations (furthermore, the two Fab arms) comprises a light chain variable region containing any one of the amino acid sequences shown in SEQ ID NO.14 to SEQ ID NO.61; in particular, each comprises a light chain variable region containing any one of the amino acid sequences shown in SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.53.
[0141] According to a specific embodiment of the present invention, the at least two VH+VL domain combinations can be combined with c-Met, EGFR or B7-H3 respectively.
[0142] According to a specific embodiment of the present invention, the antibody or its antigen-binding fragment comprises:
[0143] The first VH+VL domain combination (further, the Fab arm) of c-Met comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 137, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 138, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 139; and the second VH+VL domain combination (further, the Fab arm) of c-Met comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 143, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 144, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 145; and
[0144] The first VH+VL domain combination and the second VH+VL domain combination respectively include:
[0145] (1) LCDR1 containing the amino acid sequence shown in SEQ ID NO.79, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.68;
[0146] (2) LCDR1 containing the amino acid sequence shown in SEQ ID NO.94, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.95;
[0147] (3) LCDR1 containing the amino acid sequence shown in SEQ ID NO.100, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.101;
[0148] (4) LCDR1 containing the amino acid sequence shown in SEQ ID NO. 108, LCDR2 containing the amino acid sequence shown in SEQ ID NO. 109, and LCDR3 containing the amino acid sequence shown in SEQ ID NO. 111; or
[0149] (5) LCDR1 containing the amino acid sequence shown in SEQ ID NO.118, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.125.
[0150] According to a specific embodiment of the present invention, the antibody or its antigen-binding fragment further comprises:
[0151] The first VH+VL domain combination (further, Fab arm) of c-Met comprises a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO. 62; and the second VH+VL domain combination (further, Fab arm) of c-Met comprises a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO. 64; and
[0152] The first VH+VL domain combination and the second VH+VL domain combination each comprise: a light chain variable region comprising an amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.53, or a light chain variable region comprising an amino acid sequence having at least 75% identity with an amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.53.
[0153] Alternatively, according to a specific embodiment of the present invention, the antibody or its antigen-binding fragment comprises:
[0154] The first VH+VL domain combination (further, the Fab arm) of EGFR comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 159, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 160, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 161; and the second VH+VL domain combination (further, the Fab arm) of c-Met comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 162, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 163, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 164; and,
[0155] The first VH+VL domain combination and the second VH+VL domain combination respectively include:
[0156] (1) LCDR1 containing the amino acid sequence shown in SEQ ID NO.79, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.68;
[0157] (2) LCDR1 containing the amino acid sequence shown in SEQ ID NO.94, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.95;
[0158] (3) LCDR1 containing the amino acid sequence shown in SEQ ID NO.100, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.101;
[0159] (4) LCDR1 containing the amino acid sequence shown in SEQ ID NO. 108, LCDR2 containing the amino acid sequence shown in SEQ ID NO. 109, and LCDR3 containing the amino acid sequence shown in SEQ ID NO. 111; or
[0160] (5) LCDR1 containing the amino acid sequence shown in SEQ ID NO.118, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.125.
[0161] According to a specific embodiment of the present invention, the antibody or its antigen-binding fragment further comprises:
[0162] The first VH+VL domain combination (further, Fab arm) of EGFR comprises a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO. 153; and the second VH+VL domain combination (further, Fab arm) of c-Met comprises a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO. 154; and,
[0163] The first VH+VL domain combination and the second VH+VL domain combination each comprise: a light chain variable region comprising an amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.53, or a light chain variable region comprising an amino acid sequence having at least 75% identity with an amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.53.
[0164] Alternatively, according to a specific embodiment of the present invention, the antibody or its antigen-binding fragment is as follows:
[0165] The first VH+VL domain combination (further, the Fab arm) of EGFR comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 159, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 160, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 165; and the second VH+VL domain combination (further, the Fab arm) of B7H3 comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 166, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 167, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 168; and,
[0166] The first VH+VL domain combination and the second VH+VL domain combination respectively include:
[0167] (1) LCDR1 containing the amino acid sequence shown in SEQ ID NO.79, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.68;
[0168] (2) LCDR1 containing the amino acid sequence shown in SEQ ID NO.94, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.95;
[0169] (3) LCDR1 containing the amino acid sequence shown in SEQ ID NO.100, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.101;
[0170] (4) LCDR1 containing the amino acid sequence shown in SEQ ID NO. 108, LCDR2 containing the amino acid sequence shown in SEQ ID NO. 109, and LCDR3 containing the amino acid sequence shown in SEQ ID NO. 111; or
[0171] (5) LCDR1 containing the amino acid sequence shown in SEQ ID NO.118, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.125.
[0172] According to a specific embodiment of the present invention, the antibody or its antigen-binding fragment is further described as follows:
[0173] The first VH+VL domain combination (further, Fab arm) of EGFR includes a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO. 155; and the second VH+VL domain combination (further, Fab arm) of B7H3 includes a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO. 156.
[0174] Furthermore, the first VH+VL domain combination and the second VH+VL domain combination respectively include: a light chain variable region containing an amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.53, or a light chain variable region containing an amino acid sequence having at least 75% identity with an amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.53.
[0175] In this case, the antibody or its antigen-binding fragment may further comprise a heavy chain constant region and / or a light chain constant region. According to a specific embodiment of the present invention, the heavy chain constant region may be the heavy chain constant region of IgG1 or IgG4; the light chain constant region may be the kappa or lambda light chain constant region. For example, the heavy chain constant region of the antibody or its antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO. 10 (hIgG1); the light chain constant region of the antibody or its antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO. 11 (hkappa). Alternatively, the heavy chain constant region of the antibody or its antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO. 12 (hIgG1; Knob) or SEQ ID NO. 13 (hIgG1; Hole); the light chain constant region of the antibody or its antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO. 11.
[0176] Further, the antibody is a bispecific antibody, which has two different heavy chains but contains the same two light chains. One of the two heavy chains, heavy chain 1, contains SEQ ID NO.12 (hIgG1; Knob), preferably, heavy chain 1 containing the variable region of the amino acid sequence shown in SEQ ID NO.62; the other of the two heavy chains, heavy chain 2, contains SEQ ID NO.13 (hIgG1; Hole), preferably, heavy chain 2 containing the variable region of the amino acid sequence shown in SEQ ID NO.64. The two identical light chains each contain the variable region of the light chain containing any one of the amino acid sequences shown in SEQ ID NO.14 to SEQ ID NO.61 and the constant region of the light chain containing the amino acid sequence shown in SEQ ID NO.11.
[0177] According to a specific embodiment of the present invention, the bispecific antibody provided by the present invention is shown in Example 5 of "Best Mode for Carrying Out the Invention", and is abbreviated as 22C10xLY6-hIgG1-CLC-M1, 22C10xLY6-hIgG1-CLC-M2, 22C10xLY6-hIgG1-CLC-M3, ..., 22C10xLY6-hIgG1-CLC-M48. Alternatively, the bispecific antibodies provided by the present invention are shown in Example 10 of "Best Mode for Carrying Out the Invention", and are abbreviated as EGFR×MET-CLC-M9, EGFR×MET-CLC-M20, EGFR×MET-CLC-M24, EGFR×MET-CLC-M29, EGFR×MET-CLC-M40, EGFR×B7H3-CLC-M9, EGFR×B7H3-CLC-M20, EGFR×B7H3-CLC-M24, EGFR×B7H3-CLC-M29, and EGFR×B7H3-CLC-M40.
[0178] Sixth aspect
[0179] The present invention provides a composition comprising a polypeptide as described in the first or second aspect of the present invention, a nucleic acid molecule as described in the third aspect, or an antibody or an antigen-binding fragment thereof as described in the fifth aspect of the present invention.
[0180] The composition is preferably a pharmaceutical composition, which may further optionally contain pharmaceutically acceptable excipients, carriers, or excipients. The pharmaceutical composition can be formulated into various dosage forms known in the medical or pharmaceutical fields and administered in an applicable manner.
[0181] Seventh aspect
[0182] The present invention provides the use of the polypeptide described in the first or second aspect, the nucleic acid molecule described in the third aspect, or the antibody or antigen-binding fragment thereof described in the fifth aspect in the preparation of a medicament for treating or alleviating a disease.
[0183] The disease can be a tumor or cancer, such as a tumor or cancer associated with c-Met, EGFR, and / or B7-H3 expression. For example, the disease can be small cell lung cancer, non-small cell lung cancer, prostate cancer, nasopharyngeal carcinoma, hepatocellular carcinoma, pancreatic ductal adenocarcinoma, head and neck squamous cell carcinoma, esophageal cancer, biliary tract cancer, melanoma, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, osteosarcoma, gastric adenocarcinoma, pancreatic cancer, colorectal cancer, liver cancer, gastric cancer, thyroid cancer, glioblastoma, head and neck cancer, and breast cancer.
[0184] Eighth aspect
[0185] The present invention provides a method for treating or alleviating a disease, the method comprising administering to a subject in need of the polypeptide described in the first or second aspect of the present invention, the nucleic acid molecule described in the third aspect, or the antibody or antigen-binding fragment thereof described in the fifth aspect of the present invention.
[0186] The method provided by this invention can be used to treat or alleviate tumors or cancers, such as those associated with c-Met, EGFR, and / or B7-H3 expression. For example, the diseases may include small cell lung cancer, non-small cell lung cancer, prostate cancer, nasopharyngeal carcinoma, hepatocellular carcinoma, pancreatic ductal adenocarcinoma, head and neck squamous cell carcinoma, esophageal cancer, biliary tract cancer, melanoma, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, osteosarcoma, gastric adenocarcinoma, pancreatic cancer, colorectal cancer, liver cancer, gastric cancer, thyroid cancer, glioblastoma, head and neck cancer, and breast cancer.
[0187] The subjects are mammals, preferably primates or rodents, and more preferably humans.
[0188] Based on previously constructed transgenic mice with all alleles of the common light chain knocked in and both λ / κ light chains knocked out (Examples 1 and 2), the inventors of this invention obtained a series of murine antibodies by immunizing them with c-Met as an immunogen. The inventors screened the variable regions of the light chains from these murine antibodies and used them as universal common light chains to pair with antibody heavy chains targeting different epitopes of c-Met, constructing a variety of bispecific antibodies. Experiments showed that, compared with the corresponding parental antibodies targeting a single epitope or the positive control drug Onartuzumab, these bispecific antibodies using the common light chain exhibited significantly enhanced binding activity to c-Met protein and also showed higher internalization activity in c-Met-expressing tumor cells.
[0189] The inventors of this invention analyzed the variable region sequences of the aforementioned light chains and found that among the 48 sequences obtained, five polypeptides exhibited particularly strong performance in mediating antigen-binding and cellular internalization activities. Sequence alignment revealed that the complementarity-determining regions (CDRs) of these five light chains showed high homology, with highly consistent LCDR2s, and all LCDR3s contained a conserved "WY" amino acid core motif. Given the known functions of this motif and LCDR2 in membrane interactions and endosome escape, the inventors reasonably hypothesized that this specific CDR structural feature constitutes a multifunctional module that, while mediating high-affinity antigen binding, may also promote antibody endocytosis and transport.
[0190] To verify the universality of this common light chain, the inventors further combined the above five light chains with antibody heavy chains targeting other tumor-associated antigens such as EGFR and B7H3, respectively, to construct bispecific antibodies across targets. The results showed that, compared with the parental monoclonal antibodies corresponding to each target, the bispecific antibodies constructed in this way also exhibited significantly enhanced target binding activity or the ability to block downstream signaling pathways.
[0191] In summary, this invention identifies a group of light chain variable regions with specific conserved CDR sequence characteristics (especially highly consistent LCDR2 and LCDR3 containing a "WY" core; and when X3 in LCDR1 is not Ser(S)). Experiments have confirmed that these regions can serve as highly efficient universal common light chains, enabling the constructed bispecific antibodies to maintain or even enhance their binding and functional activity against different targets (such as c-Met, EGFR, and B7H3) when paired with specific heavy chains for different targets. This discovery provides key core sequences and design ideas for developing "plug-and-play" common light chain bispecific antibodies (and further, antibody-drug conjugates) platforms with higher affinity and internalization potential, and has significant application prospects in fields such as tumor therapy. Attached Figure Description
[0192] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:
[0193] Figure 1: Detection results of the antibody according to the present invention binding to c-Met overexpressing cells.
[0194] Figure 2: Detection results of antibody internalization in HS746T cells according to the present invention.
[0195] Figure 3: Detection results of antibody internalization in MKN45 cells according to the present invention.
[0196] Figure 4: Detection results of the antibody according to the present invention inhibiting the proliferation of EBC-1 cells.
[0197] Figures 5 and 6: Detection results of the antibody according to the present invention blocking the binding of EGF to EGFR and downstream signal transduction.
[0198] Figures 7 and 8: Detection results of MET signaling blockade by the antibody according to the present invention.
[0199] The best way to implement an invention
[0200] The present invention will be described below with reference to specific embodiments. Those skilled in the art will understand that these embodiments are for illustrative purposes only and do not limit the scope of the invention in any way.
[0201] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all medicinal materials and reagents used in the following examples are commercially available products.
[0202] The following constant region sequence was used when constructing the antibody:
[0203] Human heavy chain CH1 and FC sequences (SEQ ID NO.10):
[0204] hIgG1-WT:
[0205] Human light chain CL sequence (SEQ ID NO.11):
[0206] hkappa:
[0207] Human heavy chain Knob CH1 and FC sequences (FC: hIgG1; knob: S354C / T366W)
[0208] SEQ ID NO.12):
[0209] Human heavy chain Hole CH1 and FC sequences (FC: hIgG1; hole: Y349C / T366S / L368A / Y407V; SEQ ID NO.13):
[0210] Example 1: Screening of common light chains
[0211] Analysis of existing technologies revealed that KV4-type germlines are expressed at a relatively high frequency in mice and pair with mouse heavy chains at a higher frequency. Therefore, this type of germline sequence was selected, and the following mouse germline sequence KV4-59 was chosen from it because it is relatively easy to humanize, has good solubility, low immunogenicity, and no potential modification sites.
[0212] KV4-59 (SEQ ID NO.1):
[0213] The above sequence was modified. Since CDR3 of the light chain (see underlined portion) plays a crucial role in the affinity between the antibody and antigen, an amino acid was added after CDR3 to enhance the affinity for potential antigens. The following three sequences were obtained:
[0214] KV4-59-1 (SEQ ID NO.2):
[0215] KV4-59-2 (SEQ ID NO.3):
[0216] KV4-59-3 (SEQ ID NO.4):
[0217] The above three sequences were used as the variable region sequences of the antibody light chain, and chimeric antibodies were constructed by combining them with the variable region sequences of the heavy chain of the mouse anti-chicken egg lysozyme antibody and the constant regions of the human heavy and light chains.
[0218] The heavy chain variable region sequence of mouse anti-chicken egg lysozyme antibody (SEQ ID NO.5):
[0219] By examining the expression levels, thermal stability, solubility, and freeze-thaw stability of the three chimeric antibodies, it was confirmed that the antibody constructed using KV4-59-1 (SEQ ID NO.2) as the variable region sequence of the antibody light chain has better properties.
[0220] Example 2: Construction of transgenic mice
[0221] Based on the C57 mouse antibody lambda light chain gene sequence, sgRNAs were designed from both ends of the gene cluster. In vitro validation was performed using a Cas9-gRNA target efficiency assay kit (Vishanglide, Cat#: VK007-30T). Highly efficient sgRNA sequences were selected: TGAATGCCATGTACTTATGG (SEQ ID NO. 6) and AAGTTCAGCTCCTAAAATGG (SEQ ID NO. 7). These sgRNA sequences were synthesized and microinjected into mouse zygotes along with spCas91.1 protein. The sgRNA mediated Cas9 protein cleavage of the target gene fragment to be deleted, causing DNA double-strand breaks. DNA repair occurred at both ends of the genome via non-homologous end joining (NHEJ), while the target fragment in the middle was deleted, achieving gene knockout. Genotyping of mice two weeks after birth confirmed that the lambda gene had been knocked out.
[0222] Based on the C57 mouse antibody kappa light chain gene sequence, sgRNAs were designed from both ends of the gene cluster. In vitro validation was performed using a Cas9-gRNA target efficiency assay kit (Vishanglide, Cat#: VK007-30T). Highly efficient sgRNA sequences were selected: IGK-L1: GTGAATGCCATGTACTTATGG (SEQ ID NO.8); IGK-R1: CAAGTTCAGCTCCTAAAATGG (SEQ ID NO.9). These sgRNA sequences were synthesized and microinjected into mouse zygotes along with spCas91.1 protein. The sgRNA mediated the Cas9 protein to cleave the DNA at the target site, creating a gap. Using a Donor DNA fragment with a homologous arm and the target fragment KV4-59-1 (SEQ ID NO.2), homologous recombination was used to knock the DNA fragment into the target site. Genotyping was performed on mice two weeks after birth, confirming the knock-in of the common light chain gene.
[0223] Heterozygous mice with lambda gene knockout were mated with heterozygous mice with common light chain knock-in. Genotyping was performed on each offspring 2 weeks after birth to detect common light chain gene knock-in and lambda knockout, until mice with all alleles of common light chain gene knock-in and both lambda and kappa knockout were obtained.
[0224] Example 3: Preparation of hybridoma cells secreting anti-c-Met antibodies
[0225] Mice constructed in Example 2 were immunized using HGFR SEMA-mFc (Kyinno, Cat#: KP-1271) as an immunogen. Mice with high titers were selected, and serum was collected. After dissection, the spleen was harvested, and spleen cells were isolated. These spleen cells were fused with cultured myeloma cells to obtain hybridoma cells. The binding activity of the hybridoma cell supernatant to the antigen protein was detected using ELISA, yielding multiple positive hybridoma cell lines secreting anti-c-Met antibodies.
[0226] The light chains of murine antibodies against c-Met were obtained from positive hybridoma cell lines, totaling 48 polypeptides. Their variable region sequences are as follows (heavy chain and light chain CDRs are underlined and obtained according to the KABAT definition method, the same below): CLC-M1 (VL: SEQ ID NO.14; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.68)
[0227] CLC-M2(VL:SEQ ID NO.15;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.69 / SEQ ID NO.67 / SEQ ID NO.70)
[0228] CLC-M3(VL:SEQ ID NO.16;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.71 / SEQ ID NO.72)
[0229] CLC-M4(VL:SEQ ID NO.17;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.73)
[0230] CLC-M5(VL:SEQ ID NO.18;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.74 / SEQ ID NO.67 / SEQ ID NO.68)
[0231] CLC-M6(VL:SEQ ID NO.19:LCDR1 / LCDR2 / LCDR3:SEQ ID NO.75 / SEQ ID NO.67 / SEQ ID NO.68)
[0232] CLC-M7(VL:SEQ ID NO.20:LCDR1 / LCDR2 / LCDR3:SEQ ID NO.76 / SEQ ID NO.67 / SEQ ID NO.77)
[0233] CLC-M8(VL:SEQ ID NO.21;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.78 / SEQ ID NO.67 / SEQ ID NO.68)
[0234] CLC-M9(VL:SEQ ID NO.22;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.79 / SEQ ID NO.67 / SEQ ID NO.68)
[0235] CLC-M10(VL:SEQ ID NO.23;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.80 / SEQ ID NO.67 / SEQ ID NO.68)
[0236] CLC-M11(VL:SEQ ID NO.24;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.81)
[0237] CLC-M12(VL:SEQ ID NO.25;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.82 / SEQ ID NO.149)
[0238] CLC-M13(VL:SEQ ID NO.26;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.83 / SEQ ID NO.67 / SEQ ID NO.84)
[0239] CLC-M14(VL:SEQ ID NO.27;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.85 / SEQ ID NO.67 / SEQ ID NO.86)
[0240] CLC-M15(VL:SEQ ID NO.28;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.80 / SEQ ID NO.67 / SEQ ID NO.87)
[0241] CLC-M16(VL:SEQ ID NO.29;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.88 / SEQ ID NO.67 / SEQ ID NO.89)
[0242] CLC-M17(VL:SEQ ID NO.30;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.90 / SEQ ID NO.67 / SEQ ID NO.91)
[0243] CLC-M18(VL:SEQ ID NO.31;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.92)
[0244] CLC-M19(VL:SEQ ID NO.32;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.80 / SEQ ID NO.67 / SEQ ID NO.93)
[0245] CLC-M20(VL:SEQ ID NO.33;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.94 / SEQ ID NO.67 / SEQ ID NO.95)
[0246] CLC-M21(VL:SEQ ID NO.34;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.96 / SEQ ID NO.67 / SEQ ID NO.68)
[0247] CLC-M22(VL:SEQ ID NO.35;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.97 / SEQ ID NO.98 / SEQ ID NO.68)
[0248] CLC-M23(VL:SEQ ID NO.36;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.99 / SEQ ID NO.68)
[0249] CLC-M24(VL:SEQ ID NO.37;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.100 / SEQ ID NO.67 / SEQ ID NO.101)
[0250] CLC-M25(VL:SEQ ID NO.38;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.102)
[0251] CLC-M26(VL:SEQ ID NO.39;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.103 / SEQ ID NO.104 / SEQ IDNO.105)
[0252] CLC-M27(VL:SEQ ID NO.40;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.85 / SEQ ID NO.67 / SEQ ID NO.106)
[0253] CLC-M28(VL:SEQ ID NO.41;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.107)
[0254] CLC-M29(VL:SEQ ID NO.42;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.108 / SEQ ID NO.109 / SEQ IDNO.111)
[0255] CLC-M30(VL:SEQ ID NO.43;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.110 / SEQ ID NO.67 / SEQ ID NO.111)
[0256] CLC-M31(VL:SEQ ID NO.44;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.85 / SEQ ID NO.112 / SEQ ID NO.93)
[0257] CLC-M32(VL:SEQ ID NO.45;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.113 / SEQ ID NO.67 / SEQ ID NO.114)
[0258] CLC-M33(VL:SEQ ID NO.46;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.115 / SEQ ID NO.67 / SEQ ID NO.116)
[0259] CLC-M34(VL:SEQ ID NO.47;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.117 / SEQ ID NO.67 / SEQ ID NO.68)
[0260] CLC-M35(VL:SEQ ID NO.48;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.118 / SEQ ID NO.67 / SEQ ID NO.119)
[0261] CLC-M36(VL:SEQ ID NO.49;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.120 / SEQ ID NO.67 / SEQ ID NO.68)
[0262] CLC-M37(VL:SEQ ID NO.50;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.121)
[0263] CLC-M38(VL:SEQ ID NO.51;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.122)
[0264] CLC-M39(VL:SEQ ID NO.52;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.123 / SEQ ID NO.67 / SEQ ID NO.124)
[0265] CLC-M40(VL:SEQ ID NO.53;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.118 / SEQ ID NO.67 / SEQ ID NO.125)
[0266] CLC-M41(VL:SEQ ID NO.54;LCDR1 / LCDR2 / LCDR3:SEQ ID NO.126 / SEQ ID NO.67 / SEQ ID NO.68)
[0267] CLC-M42 (VL: SEQ ID NO.55; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.127 / SEQ ID NO.67 / SEQ ID NO.128)
[0268] CLC-M43 (VL: SEQ ID NO.56; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.66 / SEQ ID NO.67 / SEQ ID NO.129)
[0269] CLC-M44 (VL: SEQ ID NO.57; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.130 / SEQ ID NO.67 / SEQ ID NO.68)
[0270] CLC-M45 (VL: SEQ ID NO.58; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.66 / SEQ ID NO.82 / SEQ ID NO.131)
[0271] CLC-M46 (VL: SEQ ID NO.59; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.132 / SEQ ID NO.133 / SEQ IDNO.134)
[0272] CLC-M47 (VL: SEQ ID NO.60; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.135 / SEQ ID NO.67 / SEQ ID NO.136)
[0273] CLC-M48 (VL: SEQ ID NO.61; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.118 / SEQ ID NO.67 / SEQ ID NO.131)
[0274] Following the experimental procedure described above, HGFR SEMA-mFc (Kangyuan Bochuang: Cat#KP-1271) was used as the immunogen to immunize the mice constructed in Example 2. Two murine antibodies against c-Met were ultimately obtained, named mu22C10 and muLY6, respectively. Their variable region sequences are as follows (heavy chain and light chain CDRs are underlined):
[0275] mu22C10 (anti-c-Met mouse antibody)
[0276] muLY6 (anti-c-Met mouse antibody)
[0277] Example 4: Construction of chimeric antibody against c-Met
[0278] The coding sequences of the heavy chain variable region (SEQ ID NO. 62) and light chain variable region (SEQ ID NO. 63) of the murine anti-c-Met antibody mu22C10 were linked with the coding sequences of the heavy chain constant region (SEQ ID NO. 10) of human IgG1 and the light chain constant region (SEQ ID NO. 11) of human kappa, respectively. The resulting coding genes were cloned into a eukaryotic expression vector, expressed, and a chimeric anti-c-Met antibody was obtained and named 22C10.
[0279] The coding sequences of the heavy chain variable region (SEQ ID NO. 64) and light chain variable region (SEQ ID NO. 65) of the murine anti-c-Met antibody muLY6 were linked with the coding sequences of the heavy chain constant region (SEQ ID NO. 10) of human IgG1 and the light chain constant region (SEQ ID NO. 11) of human kappa, respectively. The resulting coding genes were cloned into a eukaryotic expression vector, expressed, and used to obtain chimeric antibodies against c-Met, which were named LY6.
[0280] Example 5 Construction of MET×MET bispecific antibody
[0281] The 48 polypeptides CLC-M1 to CLC-M48 (SEQ ID NO.14 to SEQ ID NO.61) obtained in Example 3 were linked to the coding sequence of the constant region of the human kappa light chain (SEQ ID NO.11) to obtain the common light chain coding sequence of the bispecific antibody. The obtained coding sequences were cloned into eukaryotic expression vectors to obtain 48 recombinant expression plasmids.
[0282] The heavy chain variable region (SEQ ID NO. 62) of the murine anti-c-Met antibody mu22C10 was linked to the coding sequences of the human heavy chain Knob CH1 and FC sequence (SEQ ID NO. 12) to obtain the coding sequence of one heavy chain (heavy chain 1) of the bispecific antibody. The heavy chain variable region (SEQ ID NO. 64) of the murine c-Met antibody muLY6 was linked to the coding sequences of the human heavy chain Hole CH1 and FC sequence (SEQ ID NO. 13) to obtain the coding sequence of the other heavy chain (heavy chain 2) of the bispecific antibody. These obtained coding sequences were cloned into eukaryotic expression vectors to obtain one plasmid encoding heavy chain 1 and one plasmid encoding heavy chain 2.
[0283] MET×MET bispecific antibodies were produced by transient co-transfection of three plasmids using the HEK293F expression system. In short, for a 1L shake flask, HEK293F cells were introduced at a rate of 1×10⁻⁶ cells / mL. 6 Inoculate at a density of 1 / mL in 250mL of culture medium and incubate at 110rpm in 5% CO2. The next day, mix the three pre-prepared expression plasmids (expressing one of CLC-M1 to CLC-M48, expression heavy chain 1, and expression heavy chain 2) with the transfection reagent in a certain ratio and then inoculate at 2×10⁻⁶. 6 At a cell density of 10 cells / mL, the transfection complex was added to the cells. After 24 hours, nutrients and DNA inhibitors were added. After 5-7 days of cell culture, the expression supernatant was collected, centrifuged, filtered, and purified using a MabSelectSure affinity chromatography column (GE Healthcare). The purity of the purified antibody was detected by SDS-PAGE electrophoresis, and the antibody concentration was detected by Nanodrop.
[0284] Forty-eight MET×MET bispecific antibodies were obtained and named 22C10xLY6-hIgG1-CLC-M1, 22C10xLY6-hIgG1-CLC-M2, 22C10xLY6-hIgG1-CLC-M3, ..., 22C10xLY6-hIgG1-CLC-M48.
[0285] The resulting MET×MET bispecific antibodies bind to different epitopes on c-MET due to the different heavy chains, and are also known as MET×MET biepitaxy antibodies.
[0286] Example 6: Detection of the binding of MET×MET bispecific antibody to c-Met overexpressing cells
[0287] This embodiment tested the binding activity of the MET×MET bispecific antibody provided by the present invention with c-Met expressed on cells.
[0288] CHOK1 cells overexpressing c-Met were constructed and named "CHOK1-cMET" cells (Kangyuan Bochuang, Cat#: KC-2524).
[0289] The antibodies to be tested included the anti-c-Met chimeric antibodies 22C10 and LY6 constructed in Example 4, 48 MET×MET bispecific antibodies constructed in Example 5, and the control antibody Onartuzumab and the irrelevant antibody IgG1 Isotype. The antibodies to be tested were serially diluted and co-incubated with CHOK1-cMET cells, and then co-incubated with the anti-human secondary antibody Goat anti-human IgG-PE (SouthernBiotech, Cat#: 2010-09). Flow cytometry was used to detect the antibody signals bound to the cells. The EC50 results of the antibodies are shown in Figure 1 and Table 1.
[0290] Table 1. Detection results of antibody binding to c-Met overexpressing cells
[0291] The results showed that, compared with the parent antibody used to assemble the bispecific antibodies, all 48 assembled bispecific antibodies exhibited significantly stronger binding activity to the target protein c-Met.
[0292] Example 7: Detection of internalization of MET×MET bispecific antibody in c-Met-expressing tumor cells
[0293] This embodiment evaluates the internalization behavior of the MET×MET bispecific antibody provided by the present invention in c-Met-expressing tumor cells.
[0294] The cells used were gastric cancer cells HS746T (Kangyuan Bochuang, Cat#: KC-2524) and MKN45 (Kangyuan Bochuang, Cat#: KC-0412; MET). ++ Previous studies have shown that the antibody binds to c-Met-expressing cells without internalization when incubated at 4°C, but initiates receptor-mediated endocytosis when the incubation system is transferred to 37°C. Therefore, by labeling the bispecific antibody with a fluorescently labeled secondary antibody and detecting fluorescence changes at the two incubation temperatures, the extent to which the antibody is taken up by cells can be quantitatively determined, thereby evaluating the antibody's internalization behavior. The experimental procedure is as follows.
[0295] First, HS746T or MKN45 cells in the logarithmic growth phase with a viability greater than 90% were washed with PBS and resuspended in FACS Buffer. The cell density was adjusted to 1,000,000 cells / mL, and 50 μL of cell suspension was added to each well of a 96-well plate. The wells containing cells were divided into four groups: blank control group (cells only), secondary antibody control group (cells + secondary antibody), binding control group (for detecting membrane surface binding), and test group (for detecting endocytosis). Then, 50 μL of the test antibody or isotype control antibody at a concentration of 1 μg / mL was added to the test group and binding control group, while an equal volume of FACS Buffer was added to the remaining groups. The cells were incubated at 4°C in the dark for 40 minutes. After incubation, the cells were washed twice with pre-cooled FACS Buffer.
[0296] After washing, 2 μL of PE-labeled secondary antibody was added to the test group, binding control group, and secondary antibody control group, while an equal volume of buffer was added to the blank control group. All were incubated again at 4°C in the dark for 40 minutes, followed by two washes with pre-chilled FACS buffer. Subsequently, the blank control group, secondary antibody control group, and binding control group were resuspended in 250 μL of FACS buffer and stored at 4°C in the dark. The test group was resuspended in 200 μL of complete culture medium or FACS buffer and incubated at 37°C for 0 h, 0.5 h, 1 h, and 2 h at predetermined time points to initiate the endocytosis process.
[0297] After incubation, the test group cells underwent specific treatment: first, they were washed once with FACS Buffer, then resuspended in 100 μL of stripping Buffer and incubated at room temperature for 7 min to remove antibodies still bound to the cell membrane surface; subsequently, Neutralizing Buffer was immediately added for neutralization, and after centrifugation, the cells were finally resuspended in 250 μL of FACS Buffer. After all groups were treated, the PE fluorescence intensity of each group was detected by flow cytometry, and the data were analyzed using FlowJo software to calculate the mean fluorescence intensity (MFI) of each group.
[0298] The internalization rate at each time point was calculated using the following formula, where MFInh is the average fluorescence intensity of the test group at each internalization time point (h), and MFI0h is the fluorescence intensity of the test group after 0h of incubation:
[0299] Internalization rate (%) = ((test group (MFInh-MFI0h)) / (combined control group (MFI)))×100.
[0300] The internalization rates of the antibodies provided by this invention in the two cell lines mentioned above are shown in Figure 2 and Table 2, and Figure 3 and Table 3, respectively.
[0301] Table 2. Results of antibody internalization rate (%) in c-Met-expressing gastric cancer cells HS746T
[0302] Table 3. Results of antibody internalization rate (%) in c-Met-expressing gastric cancer cells MKN45
[0303] Example 8: Inhibition of the proliferation of tumor cells dependent on the c-Met signaling pathway by MET×MET bispecific antibody
[0304] This embodiment evaluates the inhibitory effect of the MET×MET bispecific antibody provided by the present invention on the proliferation of tumor cells that depend on the c-Met signaling pathway.
[0305] The cells used were lung squamous cell carcinoma cells EBC-1 (Kangyuan Bochuang, Cat#: KC-0195), which highly express c-Met and whose proliferation is highly dependent on the HGF / MET signaling axis. Therefore, if MET dimerization is blocked or its downstream proliferation signaling is inhibited, the growth rate of these cells will decrease. Thus, by detecting changes in cell viability under different concentrations of bispecific antibody treatment, the inhibitory ability of this antibody on MET-dependent cell growth can be quantitatively assessed. The experimental procedure is as follows.
[0306] Logarithmic growth phase EBC-1 cells were added to 96-well white detection plates at a density of 1500 cells / well, with a volume of 100 μL per well. The 96-well plates were then incubated at 37°C and 5% CO2 for 12–16 h to allow for full cell adhesion. The wells of the 96-well plate were divided into test and control groups. The antibody to be tested was prepared into a starting working solution of 20 μg / mL using complete culture medium, and then serially diluted 3.16 times to obtain a series of working solutions with different concentrations. Then, equal volumes (100 μL) of antibody solutions of each concentration were added to the wells of the test group, bringing the final volume of each well to 200 μL. An equal volume of complete culture medium was added to the wells of the control group. The 96-well plates were then incubated at 37°C and 5% CO2 for 96 h without changing the culture medium. After culture, the 96-well plate was removed and equilibrated at room temperature for 30 min. Then, following the instructions of the CellCounting-Lite 3D kit (Vazyme, Cat#: DD1102-V20.1), the following steps were taken: Add an equal volume of the detection reagent to each well (i.e., 100 μL of reagent to 100 μL of culture system); mix on a shaker for 5 min to ensure complete cell lysis; incubate at room temperature in the dark for 25 min, and then read the relative luminescence value (RLU) of each well using a microplate chemiluminescence detector.
[0307] The RLU value of the control group (untreated) represents the baseline number of viable cells reached during natural growth over a 96-hour culture period. The decrease in RLU value in the test group indicates that antibody treatment led to a reduction in the final number of viable cells, reflecting the antibody's inhibitory effect on cell growth (anti-proliferation) and / or direct cytotoxicity. The RLU of the control group was normalized to 100% cell viability, and the cell viability inhibition rate for each antibody concentration treatment group was calculated as (Test group RLU / Control group RLU × 100%). Dose-response curves were plotted to obtain the IC50. 50 .
[0308] The dose-response curve and IC50 value of the antibody provided in this invention on the inhibition of EBC-1 cell proliferation are shown in Figure 4 and Table 4, respectively.
[0309] Table 4. Results of antibody inhibition of tumor cell proliferation (survival rate %)
[0310] Example 9: Structural Commonality Analysis of 48 Peptides
[0311] For the 48 peptides obtained in Example 3, sequence alignment analysis was used to analyze the structural commonalities of these peptides in the amino acid residue composition of CDR1 to CDR3, and attempts were made to associate the structural commonalities with the constructed MET×MET bispecific antibody and its antigen affinity, target protein binding, internalization in tumor cells, tumor cell proliferation inhibition activity, antibody stability, etc.
[0312] The results showed that, after constructing MET×MET bispecific antibodies from the VL of 5 of the 48 peptides, the resulting antibodies generally exhibited higher activity and had a high degree of structural commonality in the amino acid sequences of the CDR1 to CDR3 amino acid regions of the light chain variable region.
[0313] The general formula structures of the VL amino acid sequences in the five polypeptides are summarized and shown in Table 5.
[0314] Table 5. General formula structure of VL amino acid sequence
[0315] Example 10 Construction of EGFR×MET and EGFR×B7H3 bispecific antibodies
[0316] (I) Construction of EGFR×MET bispecific antibody
[0317] The variable region of the heavy chain of the anti-EGFR murine antibody 22A12Y2C (see PCT / CN2025 / 084077) was linked to the coding sequences of the human heavy chain Knob CH1 and FC sequence (SEQ ID NO.12) to obtain the coding sequence of one heavy chain (heavy chain 1) of the bispecific antibody. The variable region of the heavy chain of the c-Met murine antibody 15H1Y1C (see PCT / CN2025 / 084077) was linked to the coding sequences of the human heavy chain Hole CH1 and FC sequence (SEQ ID NO.13) to obtain the coding sequence of the other heavy chain (heavy chain 2) of the bispecific antibody. The obtained coding sequences were cloned into eukaryotic expression vectors to obtain one plasmid encoding heavy chain 1 and one plasmid encoding heavy chain 2.
[0318] EGFR×MET bispecific antibodies were produced by transient co-transfection of three plasmids using the HEK293F expression system. In short, for a 1L shake flask, HEK293F cells were introduced at a rate of 1×10⁻⁶ cells / mL. 6 Inoculate at a density of 1 / mL in 250mL of culture medium and incubate at 110rpm in 5% CO2. The next day, mix the three pre-prepared expression plasmids (one of the five light chains mentioned in Example 9, expression heavy chain 1, and expression heavy chain 2) with the transfection reagent in a certain ratio and then incubate at 2×10⁻⁶. 6 At a cell density of 10 cells / mL, the transfection complex was added to the cells. After 24 hours, nutrients and DNA inhibitors were added. After 5-7 days of cell culture, the expression supernatant was collected, centrifuged, filtered, and purified using a MabSelectSure affinity chromatography column (GE Healthcare). The purity of the purified antibody was detected by SDS-PAGE electrophoresis, and the antibody concentration was detected by Nanodrop.
[0319] >22A12Y2C (anti-EGFR mouse anti)-VH (VH: SEQ ID NO.153; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.159 / SEQ ID NO.160 / SEQ ID NO.161):
[0320] >15H1Y1C (mouse anti-c-Met)-VH (VH: SEQ ID NO.154; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.162 / SEQ ID NO.163 / SEQ ID NO.164):
[0321] EGFR×MET bispecific antibodies were obtained and named EGFR×MET-CLC-M9, EGFR×MET-CLC-M20, EGFR×MET-CLC-M24, EGFR×MET-CLC-M29 and EGFR×MET-CLC-M40, respectively.
[0322] (II) Construction of EGFR×B7H3 bispecific antibody
[0323] The variable region of the heavy chain of the murine anti-EGFR antibody 31A2Y4C (see PCT / CN2025 / 136365) was linked to the coding sequences of the human heavy chain Knob CH1 and FC sequence (SEQ ID NO. 12) to obtain the coding sequence of one heavy chain (heavy chain 1) of the bispecific antibody. The variable region of the heavy chain of the murine B7H3 antibody 125C3Y3C (see PCT / CN2025 / 136365) was linked to the coding sequences of the human heavy chain Hole CH1 and FC sequence (SEQ ID NO. 13) to obtain the coding sequence of the other heavy chain (heavy chain 2) of the bispecific antibody. The obtained coding sequences were cloned into eukaryotic expression vectors to obtain one plasmid encoding heavy chain 1 and one plasmid encoding heavy chain 2.
[0324] EGFR×B7H3 bispecific antibodies were produced by transient co-transfection of three plasmids using the HEK293F expression system. In short, for a 1L shake flask, HEK293F cells were introduced at a rate of 1×10-1... 6 Inoculate at a density of 1 / mL in 250mL of culture medium and incubate at 110rpm in 5% CO2. The next day, mix the three pre-prepared expression plasmids (one of the five light chains mentioned in Example 9, expression heavy chain 1, and expression heavy chain 2) with the transfection reagent in a certain ratio and then incubate at 2×10⁻⁶. 6 At a cell density of 10 cells / mL, the transfection complex was added to the cells. After 24 hours, nutrients and DNA inhibitors were added. After 5-7 days of cell culture, the expression supernatant was collected, centrifuged, filtered, and purified using a MabSelectSure affinity chromatography column (GE Healthcare). The purity of the purified antibody was detected by SDS-PAGE electrophoresis, and the antibody concentration was detected by Nanodrop.
[0325] >31A2Y4C (anti-EGFR mouse antibody)-VH (VH: SEQ ID NO.155; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.159 / SEQ ID NO.160 / SEQ ID NO.165):
[0326] >125C3Y3C (mouse anti-B7H3)-VH (VH: SEQ ID NO.156; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.166 / SEQ ID NO.167 / SEQ ID NO.168):
[0327] Bispecific antibodies against EGFR×B7H3 were obtained and named EGFR×B7H3-CLC-M9, EGFR×B7H3-CLC-M20, EGFR×B7H3-CLC-M24, EGFR×B7H3-CLC-M29 and EGFR×B7H3-CLC-M40, respectively.
[0328] Example 11: Blocking of EGF-EGFR binding and downstream signal transduction by EGFR×MET or EGFR×B7H3 bispecific antibodies.
[0329] This embodiment aims to utilize the 293T NFAT-Luc2-EGFR reporter cell system to evaluate the effect of the test antibody on the activation of the EGF-EGFR signaling pathway under EGF-induced EGFR signaling activation conditions by detecting changes in luciferase activity, thereby determining its ability to block EGF-EGFR binding and downstream signal transduction.
[0330] 293T NFAT-Luc2-EGFR (Kangyuan Bochuang, Cat#: KC-2952) cells in the logarithmic growth phase were digested and collected. After cell counting and adjusting cell density, 80 μL of cell suspension was added to each well of a 96-well transparent flat-bottomed black plate, with a cell count of 2 × 10⁶ cells. 4 / wells, and cultured at 37℃, 5% CO2 for 6 h; prepared 20 μg / mL antibody solution, serially diluted 3.16 times to obtain 9 concentrations, and prepared 300 ng / mL EGF solution; added 10 μL of serially diluted antibody solution to each well of a 96-well plate seeded with cells, with 3 replicates for each concentration, and continued culturing at 37℃, 5% CO2 for 30–60 min; then added 10 μL of EGF solution to the corresponding well, and added culture medium to the blank control wells and single-cell control wells to make the total volume of the wells 100 μL, and continued culturing at 37℃, 5% CO2 for 6 h; for endpoint detection, melted Bright-Glo reagent and allowed the cell plate to equilibrate at room temperature for 30 min, added an equal volume of Bright-Glo solution to each well, and vortexed for 5 min to lyse the cells, then read the cold light signal; the data were analyzed using GraphPad Prism 7 software and bar graphs were plotted. The results are shown in Figure 5 and Table 6, and Figure 6 and Table 7.
[0331] Experimental results showed that, under EGF stimulation in 293T NFAT-Luc2-EGFR reporter cells, EGFR×MET-CLC-M9, EGFR×MET-CLC-M20, EGFR×MET-CLC-M24, EGFR×MET-CLC-M29, and EGFR×MET-CLC-M40, as well as EGFR×B7H3-CLC-M9, EGFR×B7H3-CLC-M20, EGFR×B7H3-CLC-M24, EGFR×B7H3-CLC-M29, and EGFR×B7H3-CLC-M40, all exhibited dose-dependent signal inhibition, demonstrating clear functional blocking activity in terms of IC50 and maximum inhibition (Bottom value), and were stronger than the control bispecific antibody and parental monoclonal antibody; in contrast, hIgG1 isotype did not show an inhibitory effect.
[0332] Table 6. Detection results of EGFR×MET bispecific antibody on EGF-EGFR binding and downstream signal transduction blockade
[0333] In Table 6:
[0334] JNJ372-EGFR×Met: Kangyuan Bochuang, Cat#: KB-1123; The variable region sequence of the known EGFR×c-Met specific antibody Amivantamab (JNJ-372) was used;
[0335] EGFR-1: An anti-EGFR chimeric antibody, prepared using anti-EGFR mouse anti-22A12Y2C VH (see above) and VL (below) as described in Example 4:
[0336] >22A12Y2C-VL (VL: SEQ ID NO.15; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.69 / SEQ IDNO.67 / SEQ ID NO.70):
[0337] MET-1: An anti-MET chimeric antibody, prepared using anti-c-Met mouse anti-15H1Y1C VH (see above) and VL (below) as described in Example 4:
[0338] >15H1Y1C-VL (VL: SEQ ID NO.157; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.169 / SEQ IDNO.82 / SEQ ID NO.170)
[0339] Table 7. Detection results of EGFR×B7H3 bispecific antibody against EGF-EGFR binding and downstream signal transduction blockade
[0340] In Table 7:
[0341] EGFR-1: An anti-EGFR chimeric antibody, prepared using anti-EGFR mouse anti-31A2Y4C VH (see above) and VL (below) as described in Example 4:
[0342] >31A2Y4C-VL (VL: SEQ ID NO.158; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.171 / SEQ ID NO.133 / SEQ ID NO.172)
[0343] B7H3-1: Anti-B7H3 chimeric antibody, using anti-B7H3 mouse anti-125C3Y3C VH (see above) and VL (below) as described in Example 4:
[0344] >125C3Y3C-VL (VL: SEQ ID NO.158; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.171 / SEQ ID NO.133 / SEQ ID NO.172)
[0345] Example 12: Blocking of MET signaling by EGFR×MET or MET×MET bispecific antibodies
[0346] An in vitro functional evaluation system based on the 293T SER-Luc2-MET reporter cell line was established. Under the condition of HGF-induced MET signal activation, the inhibitory effect of EGFR×MET or MET×MET bispecific antibodies on HGF-MET signaling pathway activation was evaluated by detecting changes in luciferase activity, thereby verifying the functional blocking ability of the bispecific antibodies on the MET pathway.
[0347] 293T SER-Luc2-MET cells in the logarithmic growth phase were digested and harvested. After cell counting, the cell density was adjusted, and 80 μL of cell suspension was added to each well of a 96-well transparent flat-bottomed black plate, with a cell count of 2 × 10⁶ cells. 4Cells were cultured in 96-well plates at 37°C and 5% CO2 for 6–16 h. A 20 μg / mL antibody solution was prepared and serially diluted 3.16 times to obtain nine different concentrations. A 0.01 μg / mL RH-HGF solution was also prepared. 10 μL of the serially diluted antibody solution was added to each well of the cell-seeded 96-well plate, with three replicates per concentration. The plates were then incubated at 37°C and 5% CO2 for 30–60 min. Subsequently, 10 μL of RH-HGF solution was added to the corresponding well, with three replicates per concentration. Culture medium was added to the blank control and single-cell control wells to bring the total volume to 100 μL. The plates were then incubated at 37°C and 5% CO2 for 6 h. For endpoint detection, the Bright-Glo reagent was melted and the cell plate was equilibrated at room temperature for 30 min. An equal volume of Bright-Glo solution was added to each well, and the plates were shaken for 5 min to lyse the cells. The cold light signal was then read. Data were analyzed using GraphPad Prism. The software was used to analyze the data and generate bar charts. The results are shown in Figure 7 and Table 8, and Figure 8 and Table 9.
[0348] Experimental results showed that in the 293T-SER-Luc2-MET reporter cell system stimulated with RH-HGF, both EGFR×MET and MET×MET bispecific antibodies exhibited dose-dependent MET signaling inhibition. Among them, multiple CLC conformations (such as CLC-M9, CLC-M20, CLC-M24, CLC-M29, and CLC-M40) showed lower IC50 values. 50 With a lower bottom value, it showed better inhibitory effects than the control bispecific antibody and the parental monoclonal antibody, while no significant inhibitory effect was observed in hIgG1 Isotype.
[0349] Table 8. Detection results of MET signal transduction blockade by EGFR×MET bispecific antibody
[0350] Table 9. Detection results of MET×MET bispecific antibody blocking MET signal transduction
[0351] The above description of specific embodiments of the present invention does not limit the present invention. Those skilled in the art can make various changes or modifications based on the present invention, and as long as they do not depart from the spirit of the present invention, they should all fall within the scope of the appended claims.
Claims
1. A polypeptide comprising the following amino acid sequence: (i)SA-X1-S-X2-V-X3-X4-M-X5 (SEQ ID NO.150), where: X1 is selected from S, T, and N; X2 is selected from G and S; X3 is selected from R, T, S, and I; X4 is selected from Y and F; X5 is selected from H and Q; (ii) X6-TS-X7-LAS (SEQ ID NO.151), where: X6 is selected from D and A; X7 is selected from K and R; (iii)Q-X8-WS-X9-X10-P-X11-YT(SEQ ID NO.152), where: X8 is selected from Q and L; X9 is selected from S, R, and P; X10 is selected from N and Y; X11 is selected from P and S.
2. The polypeptide according to claim 1, wherein: In the SA-X1-S-X2-V-X3-X4-M-X5 (SEQ ID NO.150), X1 to X5 are independently selected from each other: X1 is selected from S and T; X2 is S; X3 is selected from R, T and S or selected from R, T and I; X4 is Y; or X5 is H; In the X6-TS-X7-LAS (SEQ ID NO.151), X6 to X7 are independently of each other: X6 is D; or, X7 is K; or In the Q-X8-WS-X9-X10-P-X11-YT (SEQ ID NO.152), X8 to X11 are independent of each other: X8 is Q; X9 is selected from S and R; X10 is N; or, X11 is P; Preferably, the polypeptide comprises the amino acid sequence shown in SEQ ID NO. 67 or SEQ ID NO. 109; Preferably, the polypeptide does not simultaneously contain the amino acid sequence shown in SEQ ID NO. 66, the amino acid sequence shown in SEQ ID NO. 67, and the amino acid sequence shown in SEQ ID NO.
68.
3. The polypeptide according to claim 1 or 2, wherein, The polypeptide comprises a combination of the following amino acid sequences: (1) The amino acid sequence shown in SEQ ID NO. 79; the amino acid sequence shown in SEQ ID NO. 67; the amino acid sequence shown in SEQ ID NO. 68; (2) The amino acid sequence shown in SEQ ID NO. 94; the amino acid sequence shown in SEQ ID NO. 67; the amino acid sequence shown in SEQ ID NO. 95; (3) The amino acid sequence shown in SEQ ID NO. 100; the amino acid sequence shown in SEQ ID NO. 67; the amino acid sequence shown in SEQ ID NO. 101; (4) The amino acid sequence shown in SEQ ID NO. 108; the amino acid sequence shown in SEQ ID NO. 109; the amino acid sequence shown in SEQ ID NO. 111; or (5) The amino acid sequence shown in SEQ ID NO. 118; the amino acid sequence shown in SEQ ID NO. 67; the amino acid sequence shown in SEQ ID NO. 125; Preferably, the polypeptide comprises an amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.53, or comprises an amino acid sequence having at least 75% identity with an amino acid sequence shown in any one of SEQ ID NO.22, SEQ ID NO.33, SEQ ID NO.37, SEQ ID NO.42 and SEQ ID NO.
53. More preferably, the polypeptide comprises the amino acid sequence shown in SEQ ID NO.11, or comprises an amino acid sequence having at least 75% identity with the amino acid sequence shown in SEQ ID NO.
11.
4. A nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide of any one of claims 1 to 3.
5. The use of the polypeptide of any one of claims 1 to 3 or the nucleic acid molecule of claim 4 in the construction of antibodies.
6. An antibody or an antigen-binding fragment thereof, said antibody or antigen-binding fragment comprising the polypeptide of any one of claims 1 to 3.
7. The antibody or antigen-binding fragment thereof according to claim 6, wherein, The antibody or its antigen-binding fragment has at least two VH+VL domain combinations, wherein the VL comprises the polypeptide of any one of claims 1 to 3; Preferably, the antibody or its antigen-binding fragment contains light chain CDRs in at least two of its VLs: (i)LCDR1: SA-X1-S-X2-V-X3-X4-M-X5 (SEQ ID NO.150), where: X1 is selected from S, T, and N; X2 is selected from G and S; X3 is selected from R, T, S, and I; X4 is selected from Y and F; X5 is selected from H and Q; (ii) LCDR2: X6-TS-X7-LAS (SEQ ID NO.151), where: X6 is selected from D and A; X7 is selected from K and R; (iii) LCDR3: Q-X8-WS-X9-X10-P-X11-YT (SEQ ID NO.152), where: X8 is selected from Q and L; X9 is selected from S, R, and P; X10 is selected from N and Y; X11 is selected from P and S.
8. The antibody or antigen-binding fragment thereof according to claim 6 or 7, wherein, The antibody or its antigen-binding fragment has at least two VH+VL domain combinations, which can bind to c-Met, EGFR or B7-H3 respectively.
9. The antibody or antigen-binding fragment thereof according to claim 8, wherein, The antibody or its antigen-binding fragment comprises: Combining the first VH+VL domain combination of c-Met, the first VH+VL domain combination comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 137, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 138, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 139; and, combining the second VH+VL domain combination of c-Met, the second VH+VL domain combination comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 143, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 144, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 145; and The first VH+VL domain combination and the second VH+VL domain combination respectively include: (1) LCDR1 containing the amino acid sequence shown in SEQ ID NO.79, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.68; (2) LCDR1 containing the amino acid sequence shown in SEQ ID NO.94, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.95; (3) LCDR1 containing the amino acid sequence shown in SEQ ID NO.100, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.101; (4) LCDR1 containing the amino acid sequence shown in SEQ ID NO. 108, LCDR2 containing the amino acid sequence shown in SEQ ID NO. 109, and LCDR3 containing the amino acid sequence shown in SEQ ID NO. 111; or (5) LCDR1 containing the amino acid sequence shown in SEQ ID NO.118, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.
125.
10. The antibody or antigen-binding fragment thereof according to claim 8, wherein, The antibody or its antigen-binding fragment comprises: The first VH+VL domain combination of EGFR comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 159, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 160, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 161; and the second VH+VL domain combination of c-Met comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 162, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 163, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 164; and The first VH+VL domain combination and the second VH+VL domain combination respectively include: (1) LCDR1 containing the amino acid sequence shown in SEQ ID NO.79, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.68; (2) LCDR1 containing the amino acid sequence shown in SEQ ID NO.94, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.95; (3) LCDR1 containing the amino acid sequence shown in SEQ ID NO.100, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.101; (4) LCDR1 containing the amino acid sequence shown in SEQ ID NO. 108, LCDR2 containing the amino acid sequence shown in SEQ ID NO. 109, and LCDR3 containing the amino acid sequence shown in SEQ ID NO. 111; or (5) LCDR1 containing the amino acid sequence shown in SEQ ID NO.118, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.
125.
11. The antibody or antigen-binding fragment thereof according to claim 8, wherein, The antibody or its antigen-binding fragment comprises: The first VH+VL domain combination of EGFR comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 159, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 160, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 165; and the second VH+VL domain combination of B7H3 comprises: HCDR1 containing the amino acid sequence shown in SEQ ID NO. 166, HCDR2 containing the amino acid sequence shown in SEQ ID NO. 167, and HCDR3 containing the amino acid sequence shown in SEQ ID NO. 168; and The first VH+VL domain combination and the second VH+VL domain combination respectively include: (1) LCDR1 containing the amino acid sequence shown in SEQ ID NO.79, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.68; (2) LCDR1 containing the amino acid sequence shown in SEQ ID NO.94, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.95; (3) LCDR1 containing the amino acid sequence shown in SEQ ID NO.100, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.101; (4) LCDR1 containing the amino acid sequence shown in SEQ ID NO. 108, LCDR2 containing the amino acid sequence shown in SEQ ID NO. 109, and LCDR3 containing the amino acid sequence shown in SEQ ID NO. 111; or (5) LCDR1 containing the amino acid sequence shown in SEQ ID NO.118, LCDR2 containing the amino acid sequence shown in SEQ ID NO.67, and LCDR3 containing the amino acid sequence shown in SEQ ID NO.
125.
12. A composition comprising a polypeptide according to any one of claims 1 to 3, a nucleic acid molecule according to claim 4, or an antibody or an antigen-binding fragment thereof according to any one of claims 6 to 11.
13. Use of the polypeptide of any one of claims 1 to 3, the nucleic acid molecule of claim 4, the antibody of any one of claims 6 to 11 or its antigen-binding fragment, or the composition of claim 12 in the preparation of a medicament for treating or alleviating a disease.
14. A method for treating or alleviating a disease, the method comprising administering to a subject in need of the polypeptide of any one of claims 1 to 3, the nucleic acid molecule of claim 4, the antibody of any one of claims 6 to 11 or an antigen-binding fragment thereof, or the composition of claim 12.