Mirna biomarkers for asthma
A panel of miRNA biomarkers is used to accurately diagnose asthma and predict treatment responses, addressing the lack of objective tests and ensuring appropriate treatment, thereby enhancing asthma management and reducing waste.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF SOUTHAMPTON
- Filing Date
- 2025-12-24
- Publication Date
- 2026-07-09
AI Technical Summary
Current asthma diagnosis lacks a gold standard objective test, leading to subjectivity and uncertainty, and there is a need for reliable biomarkers to accurately diagnose asthma severity and predict treatment responses.
Utilizing a panel of miRNA biomarkers, including miR-223-3p, miR-191-5p, miR-197-3p, and miR-155-5p, to diagnose asthma and assess severity by comparing their levels in a sample against reference levels, and using these markers to guide appropriate treatment.
Provides a rapid and accurate method for diagnosing asthma and predicting treatment responses, reducing underdiagnosis and ensuring patients receive the right treatment early, thereby improving asthma management and avoiding unnecessary use of expensive biologic drugs.
Smart Images

Figure GB2025060078_09072026_PF_FP_ABST
Abstract
Description
[0001] BIOMARKERS
[0002] The present invention relates to novel biomarkers and their use in the diagnosis and treatment of asthma.
[0003] Asthma is a common chronic respiratory condition affecting over 300 million people worldwide. In the UK, asthma is the commonest chronic respiratory condition and severe asthma remains a significant burden for many patients. Though availability of effective asthma treatments has expanded considerably, especially for more complex disease, asthma continues to impose a significant burden at both societal and individual levels.
[0004] There is no single diagnostic test for asthma or to predict the risk of severe asthma. The diagnosis of asthma remains clinical, based on assessment of multiple clinical parameters, with an ongoing absence of a gold standard objective diagnostic test. This leaves asthma diagnosis open to subjectivity, complexity and uncertainty which collectively may lead to underdiagnosis, delayed diagnosis and delayed treatment.
[0005] Asthma severity is similarly unsatisfactorily defined by the level of treatment required to control disease where disease control is subjectively defined. A composite measure of asthma severity incorporating asthma treatment level, asthma control, lung function impairment, exacerbation frequency, and need for higher level asthma treatments has been proposed (Asthma severity scoring system (ASSESS) score). However, such classifications mean that the disease has to become a problem before its severity is recognised and appropriate treatment is applied. Early accurate identification of asthma patients at risk of severe disease could guide strategies to improve their management at earlier stages and potentially avert downstream adverse outcomes. Development of reliable objective markers to support precise asthma diagnosis and promptly differentiate severe from mild asthma is a pressing need.
[0006] Biomarkers such as microRNAs (miRNAs) may provide the markers needed to assist in asthma diagnosis and assessment of disease severity. miRNAs are small non-coding RNAs (ribonucleic acids), typically 22-25 nucleotides long, acting via RNA-induced silencing complexes to post-transcriptionally regulate messenger RNAs (mRNAs) possessing complementary sequences. Highly stable circulating miRNAs occur inbiological fluids including peripheral blood and are potential biomarkers for diagnosis, prognosis, and disease monitoring. Growing evidence indicates that miRNAs are differentially expressed in asthmatics compared to non-asthmatics and have immunoregulatory effects.
[0007] There is also emerging evidence that miRNAs may be associated with treatment responses in asthma. For example, association of inhaled corticosteroid responsiveness in childhood asthma with miR-155-5p, miR-532-5p and miR-21 has been suggested. Meanwhile, monoclonal antibody (biologic) asthma treatments have rapidly gained widespread adoption for treatment of severe treatment steroid dependent asthma in recent years. These drugs offer precision approaches for asthma endotypes targeting canonical players in asthma pathophysiology including IgE (Omalizumab), Interleukin (IL-) 5 or its receptor (Mepolizumab, Reslizumab, Benralizumab), IL-4Ra receptor (Dupilumab) and Thymic Stromal Lymphopoietin (TSLP; Tezepelumab). While offering significant benefits to many, they may not work in 20-30% of severe asthma patients who require a switch to an alternative biologic drug. These drugs are also expensive. There is therefore a need to identify patients who are likely to, or likely not to, respond to a particular therapeutic agent.
[0008] A rapid test measuring easily accessible biomarkers of asthma and its severity will be of great use to ensure people with asthma are accurately diagnosed and offered the right treatments as early as possible. Further, a rapid test measuring easily assessable biomarkers of biologic treatment outcome will enable patients to access the right treatment as early as possible preventing the use of unsuitable and expensive biologies and a waste of time for the wrong treatment. An aim of the present invention is therefore to provide such tests.
[0009] Summary of invention
[0010] Accordingly, in one aspect of the invention, there is provided a method of diagnosing asthma in a subject, the method comprising:
[0011] a) providing a sample obtained from the subject;
[0012] b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p (UGUCAGUUUGUCAAAUACCCCA (SEQ ID NO. 1)), miR-191-5p (CAACGGAAUCCCAAAAGCAGCUG (SEQ ID NO.2)), miR-197-3p (UUCACCACCUUCUCCACCCAGC (SEQ ID NO. 3)) and miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU (SEQ ID NO. 4)) in the sample;
[0013] c) comparing the level of the miRNA biomarkers with a reference level of the same miRNA biomarkers; and
[0014] d) using the results from c) to diagnose if the subject has asthma.
[0015] The reference level of the miRNA biomarkers may be the level that is present in an individual that does not have asthma.
[0016] The subject may be identified as having asthma if the level of miR-223-3p is higher than the reference level of miR-223-3p, the level of miR-191-5p is higher than the reference level of miR-191-5p, the level of miR-197-3p is higher than the reference level of miR-197-3p and the level of miR-155-5p is lower than the reference level of miR-155-5p.
[0017] The level of miR-223-3p may be considered higher than the reference level when the level of miR-223-3p is higher than the reference level by at least about 1.1 -fold or more, for example by at least about 1.15-fold or more, by at least about 1.2-fold or more, by at least about 1.25-fold or more or by at least about 1.3-fold or more.
[0018] The level of miR-191-5p may be considered higher than the reference level when the level of miR- 191 -5p is higher than the reference level by at least about 1.1 -fold or more, for example by at least about 1.15-fold or more, by at least about 1.2-fold or more, by at least about 1.25-fold or more, by at least about 1.3-fold or more, by at least about 1.35-fold or more, or by at least about 1.4-fold or more.
[0019] The level of miR-197-3p may be considered higher than the reference level when the level of miR-197-3p is higher than the reference level by at least about 1.1 -fold or more, for example by at least about 1.15-fold or more, by at least about 1.2-fold or more, by at least about 1.25-fold or more, or by at least about 1.3-fold or more.
[0020] The level of miR-155-5p may be considered lower than the reference level when the level of miR-155-5p is lower than the reference level by at least 1.1-fold or more, for example by at least about 1.2-fold or more, by at least about 1.3-fold or more.In another aspect of the invention, there is provided a method of treating asthma in a subject, the method comprising:
[0021] a) providing a sample obtained from the subject;
[0022] b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p in the sample;
[0023] c) comparing the level of the miRNA biomarkers with a reference level of the same miRNA biomarkers; and
[0024] d) administering an asthma therapy if indicated appropriate by the results from step c).
[0025] The reference level of the miRNA biomarkers may be the level that is present in an individual that does not have asthma.
[0026] The method may comprise the step of administering an asthma therapy to the subject if the level of miR-223-3p is higher than the reference level of miR-223-3p, the level of miR-191-5p is higher than the reference level of miR-191-5p, the level of miR-197-3p is higher than the reference level of miR-197-3p and the level of miR-155-5p is lower than the reference level of miR-155-5p.
[0027] The level of miR-223-3p may be considered higher than the reference level when the level of miR-223-3p is higher than the reference level by at least about 1.1 -fold or more, for example by at least about 1.15-fold or more, by at least about 1.2-fold or more, by at least about 1.25-fold or more, or by at least about 1.3-fold or more.
[0028] The level of miR-191-5p may be considered higher than the reference level when the level of miR- 191 -5p is higher than the reference level by at least about 1.1 -fold or more, for example by at least about 1.15-fold or more, by at least about 1.2-fold or more, by at least about 1.25-fold or more, by at least about 1.3-fold or more, by at least about 1.35-fold or more, or by at least about 1.4-fold or more.
[0029] The level of miR-197-3p may be considered higher than the reference level when the level of miR-197-3p is higher than the reference level by at least about 1.1 -fold or more,for example by at least about 1.15-fold or more, by at least about 1.2-fold or more, by at least about 1.25-fold or more, or by at least about 1.3-fold or more.
[0030] The level of miR-155-5p may be considered lower than the reference level when the level of miR-155-5p is lower than the reference level by at least 1.1-fold or more, for example by at least about 1.2-fold or more, by at least about 1.3-fold or more.
[0031] The asthma therapy may be steroid-containing inhalers, leukotriene receptor antagonists, theophylline, steroid tablets (e.g. prednisolone), biologies (e.g. Omalizumab, Mepolizumab, Reslizumab, Benralizumab, Dupilumab or Tezepelumab), bronchial thermoplasty, acupuncture, or Chinese herbal medicine.
[0032] In another aspect of the invention, there is provided a kit comprising means for detecting the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p. The kit may comprise specific amplification primers and / or probes for the specific quantitative amplification of miR-223-3p, miR-191 -5p, miR-197-3p and miR-155-5p. The kit may comprise instructions to use the kit. The kit may be for use with a sample provided by a subject.
[0033] In another aspect, there is provided use of a kit for diagnosing asthma in a subject comprising means for detecting the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p. The kit may comprise specific amplification primers and / or probes for the specific quantitative amplification of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p. The kit may comprise instructions for suitable operational parameters in the form of a label or separate insert. The instructions may inform a user about how to collect the sample. The instructions may inform a user how to use the kit to diagnose asthma.
[0034] In another aspect of the invention, there is provided a method of determining if a subject is likely to develop severe asthma, the method comprising:
[0035] a) providing a sample obtained from the subject;
[0036] b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-144-3p (UACAGUAUAGAUGAUGUACU (SEQ ID NO. 5)), miR-30a-5p (UGUAAACAUCCUCGACUGGAAG (SEQ ID NO. 6)), miR-660-5p (UACCCAUUGCAUAUCGGAGUUG (SEQ IDNO. 7)) and miR-125b-5p (UCCCUGAGACCCUAACUUGUGA (SEQ ID NO. 8)) in the sample;
[0037] c) comparing the level of the miRNA biomarkers with a reference level of the same miRNA biomarkers; and
[0038] d) using the results from c) to determine if the subject is likely to develop severe asthma.
[0039] The reference level of the miRNA biomarkers may be the level that is present in an individual that has mild asthma.
[0040] The subject may be identified as having severe asthma if the level of miR-223-3p is higher than the reference level of miR-223-3p, the level of miR-144-3p is lower than the reference level of miR-144-3p, the level of miR-30a-5p is lower than the reference level of miR-30a-5p, the level of miR-660-5p is lower than the reference level of miR-660-5p and the level of miR-125b-5p is lower than the reference level of miR-125b-5p.
[0041] The subject may have already been diagnosed as having asthma, e.g. mild asthma.
[0042] In another aspect of the invention, there is provided a method of identifying whether a subject having asthma is likely not to respond or likely to respond poorly to antiinterleukin-5 (anti-IL-5) monoclonal antibody therapy, the method comprising:
[0043] a) providing a sample obtained from the subject;
[0044] b) determining the level of miRNA biomarker miR-181a-5p (AACAUUCAACGCUGUCGGUGAGU (SEQ ID NO. 9)) in the sample; c) comparing the level of the miR-181a-5p determined from b) with a reference level of miR-181a-5p; and
[0045] d) using the results from c) to identify if the subject is likely not to respond or likely to respond poorly to anti-IL-5 monoclonal antibody therapy.
[0046] The reference level of miR-181a-5p may be the level that is present in an individual that has severe asthma and responds to anti-IL-5 monoclonal antibody.
[0047] The subject may be identified as not responding or responding poorly to anti-IL-5 monoclonal antibody therapy if the level of miR-181a-5p is higher than the reference level of miR-181a-5p.The anti-interleukin-5 (anti-IL-5) monoclonal antibody therapy may be Mepolizumab.
[0048] The subject may be suffering from / has severe asthma.
[0049] In another aspect of the invention, there is provided a method of identifying whether a subject having asthma is likely not to respond or likely to respond poorly to antiimmunoglobulin E (anti-IgE) monoclonal antibody therapy, the method comprising:
[0050] a) providing a sample obtained from the subject;
[0051] b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-30a-5p and miR-125b-5p in the sample;
[0052] c) comparing the level of the miRNA biomarkers with a reference level of the same biomarkers; and
[0053] d) using the results from c) to identify if the subject is likely not to respond or likely to respond poorly to anti-IgE antibody therapy.
[0054] The reference level of the miRNA biomarkers may be the level that is present in an individual that has severe asthma and responds to the anti-IgE monoclonal antibody therapy.
[0055] The subject may be identified as not responding or responding poorly to anti-Ig-E monoclonal antibody therapy if the level of miR-30a-5p is lower than the reference level of miR-30a-5p and the level of miR-125b-5p is lower than the reference level of miR-125-5p.
[0056] The anti-immunoglobulin E (anti-IgE) monoclonal antibody therapy may be Omalizumab or biosimilar.
[0057] The subject may be suffering from / has severe asthma.
[0058] In one aspect, there is provided a method of diagnosing asthma in a subject, the method comprising:
[0059] a) providing a sample obtained from the subject;
[0060] b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p in the sample;c) comparing the level of the miRNA biomarkers with a reference level of the same miRNA biomarkers; and
[0061] d) using the results from c) to diagnose if the subject has asthma, wherein the reference level of the miRNA biomarkers is the level that is present in an individual that does not have asthma, and
[0062] wherein the subject is identified as having asthma if the level of miR-223-3p is higher than the reference level of miR-223-3p, the level of miR-191-5p is higher than the reference level of miR-191-5p, the level of miR-197-3p is higher than the reference level of miR-197-3p and the level of miR-155-5p is lower than the reference level of miR-155-5p.
[0063] In one aspect, there is provided a method of diagnosing asthma in a subject, the method comprising:
[0064] a) providing a sample obtained from the subject;
[0065] b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p in the sample;
[0066] c) comparing the level of the miRNA biomarkers with a reference level of the same miRNA biomarkers; and
[0067] d) using the results from c) to diagnose if the subject has asthma, wherein the reference level of the miRNA biomarkers is the level that is present in an individual that does not have asthma, and
[0068] wherein the subject is identified as having asthma if the level of miR-223-3p is about 1-fold higher than the reference level of miR-223-3p, the level of miR-191-5p is about 1-fold higher than the reference level of miR-191-5p, the level of miR-197-3p is about 1-fold higher than the reference level of miR-197-3p and the level of miR-155- 5p is about 1-fold lower than the reference level of miR-155-5p.
[0069] The following embodiments may be applicable to any of the above aspects.
[0070] The reference level of a miRNA may be the amount of that miRNA that is present in an individual that does not have asthma and / or that has mild asthma. The reference value may refer to a cut-off value established by ROC curve analysis and Youden index and may be a concentration or a range of concentrations of the miRNA. The reference level may be the level of the miRNA in a reference sample tested simultaneously, whereinthe reference sample is a sample comprising a known amount of miRNA corresponding to a cut-off value. The reference / control may be provided with the diagnostic test and will be run against a standard curve of 1, 10, 100, 1000 copies for maximum of 35 cycles.
[0071] An individual may be defined as having mild asthma when they are receiving Global Initiative for Asthma (GINA) 20201steps 1-2 equivalent treatment, e.g. low dose inhaled corticosteroid (ICS), low dose ICS-formoterol, low dose ICS + short-acting beta 2-agonists (SABAs) or leukotriene receptor antagonist (LTRA).
[0072] An individual may be defined as having severe asthma when they are receiving GINA 20201steps 4-5 equivalent treatment, e.g. medium / high dose ICS-LABA (long-acting beta 2-agonists) ± biologic therapy (e.g. anti-IgE or anti-IL5). An individual with severe asthma may have uncontrolled symptoms and / or exacerbations despite ICS-LABA treatment. An individual may be defined as having severe asthma when they have asthma which requires treatment with high-dose ICS plus a second controller such as anti-IgE, anti-IL5, tiotropium, anti-IL5R, or anti-IL4R (and / or systemic corticosteroids) to prevent it from becoming uncontrolled despite this therapy2.
[0073] The sample may be a blood sample, e.g. a whole blood sample. The sample may be a serum sample.
[0074] The sample may be taken / obtained from the individual in the method of the invention. Alternatively, the sample may be provided (previously obtained, for example by a third party). The sample may be fresh, such as less than 1 day from withdrawal. Alternatively, the sample may be a stored sample, for example that has been frozen or refrigerated.
[0075] Some or all of the steps of the method(s) of the invention may be carried out in vitro.
[0076] The subject may be human.
[0077] The presence, absence, or level of the biomarkers of any method referred to herein may be determined by any suitable assay. The skilled person will recognise there are a number of methods and technologies available to determine the presence and / or level of the biomarkers / the panel of biomarkers, e.g. microarrays or quantitative PCR.Determining the level of the panel of biomarkers may comprise binding each of the biomarkers in the panel with one or more probes. A method of the invention may further comprise detecting the binding of the probe(s) to each of the biomarkers in the panel or detecting the level of bound probe-biomarker complexes.
[0078]
[0079] The person skilled in the art will appreciate that features of any one embodiment and / or aspect of the invention may be applied to all other embodiments and / or aspects of the invention.
[0080] Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying drawings.
[0081] Figure 1 - Circulating miRNAs differentially expressed in the sera of asthma patients and their diagnostic value, (a) Heat map of all miRNAs screened stratified by up / down regulation in asthma group (A; includes mild asthma (MA), N=50 and severe asthma (SA), N=50) in comparison to non-asthmatic individuals (NA; N=50). Fold change calculated using the mean of miRNA expression in NA group as a reference, (b) miRNAs relative expression (dCt; normalized to 6 reference miRNAs) in asthma group (N=100) in comparison to non-asthmatic individuals (N=50). (c) Receiver operating characteristic (ROC) curves of individual asthma diagnosis miRNAs and their combined panel. AUC - area under the ROC curve; CI - confidence interval. miRNA expression was evaluated by qPCR using miRCURY LNA technology followed by GeneGlobeanalysis (QIAGEN) with settings: fold change threshold >1.2, Ct<35. Statistical analysis: min to max with line at median, unpaired 2-tail t-test, *P < 0.05, **P < 0.01, ***p < 0.001, ****P < 0.0001.
[0082] Figure 2 - miRNAs differentially expressed in the sera of severe-asthma patients and their diagnostic value, (a) mild-asthma patients (MA; N=50) in comparison to non-asthmatic individuals (NA; N=50), (b) severe-asthma group (SA; N=50) in comparison to MA cohort - severity miRNAs, (c) Receiver operating characteristic (ROC) curves of individual severity miRNAs and their combined panel. AUC - area under the ROC curve; CI - confidence interval. miRNAs expression evaluated by qPCR using miRCURY LNA technology followed by GeneGlobe analysis (QIAGEN); dCt (normalized to 6 reference miRNAs). GeneGlobe settings: fold change threshold >1.2, Ct<35, unpaired 2-tail t-test, *P < 0.05, **P < 0.01, ***p < 0.001, ****P < 0.0001.
[0083] Figure 3 - Association of miRNA expression in the sera of asthma patients with clinical parameters of asthma. miRNAs expression in (a) asthma group FEV1 bottom and top (N=19) quartiles, (b) severe-asthma (SA) group severity score (modified ASSESS) bottom and top quartile (N=7), (c) SA group ACQ6 in groups divided by a conventional cut-off (ACQ6<1.5, N=14; ACQ6>1.5, N=34), (d) SA group FeNO bottom and top quartiles (N=l 1) and in groups divided by a conventional cut-off (FeNO<40, N=34; FeNO>40, N=8), (e) SA groups of patients that were (N=14) / were not (N=36) on maintenance oral corticosteroids (m-OCS), (f) SA group quality of life score (SGRQ) bottom and top quartiles (N=l 1). dCt, normalized to 6 reference miRNAs. Statistical analysis: min to max with line at median, unpaired 1 -tail t-test, *P < 0.05, **P < 0.01.
[0084] Figure 4 - Biological pathways affected by miRNAs differentially expressed in sera of severe asthma patients in comparison with non-asthma group, (a) Bubble chart showing biological pathways affected by identified target genes. X-axis corresponds to the percentage of targets in genes of the identified pathways. The size and the colour of the bubble corresponds to the number of miRs of interest involved in a pathway and to enrichment significance, respectively. Pathways are chosen based on the empirical p-value cut-off 0.05. (b) Heatmap of target genes in identified pathways (stratified by the percentage of targets in totaltargets of miRNAs of interest). The colour intensity shows the number of miRs of interest targeting a gene. The analysis is performed using miRSystem tool.
[0085] Figure 5 - Association of miRNAs expression with the Omalizumab (N negative 15, Npositive 13) (a) and Mupolizumab (Nnegative 7, Npositive 22) (b) treatment outcome. Heat maps show fold change expression of miRNAs relative to positive outcome group average and are segmented by miRs downregulated (top) and upregulated (bottom) in asthma group. Individual miRNAs expression presented as dCt (normalized to 6 reference miRNAs). GeneGlobe settings: fold change threshold >1.2, Ct<35, unpaired 2 -tail t-test, *P < 0.05, **P < 0.01.
[0086] Figure 6 - Pilot study outcome showing miRNAs differentially expressed in the sera of severe asthma patients in comparison with mild asthma and nonasthmatic individuals [M.A. Kyyaly et al. Circulating miRNAs — A potential tool to identify severe asthma risk? Clin Transl Allergy. 202 l;e 12040],
[0087] Figure 7 - Association of miR expression with clinical parameters in severe asthma group. m-ASSESS score quartile division.
[0088] Figure 8 - miRNA expression in association with (a) improved (N=15) / worsened (N=4) ACQ6 after Omalizumab treatment (Mann-Whitney test, **P < 0.01), (b) the change of ACQ6 after the treatment (Y axes) with the distribution of treatment responders.
[0089] Figure 9 is a table showing a demographic distribution of patients from three studied groups. Values are presented in number of subjects and percentages (in brackets). BMI and age values are presented in medians and Interquartile ranges (in brackets). BMI: body mass index. m-OCS: maintenance oral corticosteroids. Na: not applicable.
[0090] Figure 10 - Modified Asthma Severity Score. ACQ-6 score of > 1.50 represents poor asthma control. Medication steps were defined by the GINA guidelines 2020. Asthma exacerbations were assessed over the preceding 12 months from WATCH study enrolment. Abbreviations: ACQ-6= asthma control questionnaire-6, FEV1= forced expiratory volume in 1 second, Salbutamol=short-acting p2-agonist (bronchodilator), ICS= inhaled corticosteroids, LTRA= leukotriene receptor antagonist, OCS= oral corticosteroids.
[0091] Figure 11 - Circulating miRNAs differentially expressed in the sera of asthma patients. miRNAs relative expression (dCt; normalized to 6 reference miRNAs) in the sera of asthma patients (A, N=100) in comparison with never-asthma individuals (NA, N=50), mild-asthma (MA, N=50) and severe-asthma patients (SA, N=50) in comparison with never-asthma individuals, and severe-asthma group in comparison with mild-asthma cohort - severity miRNAs. miRNA expression was evaluated by qPCR using miRCURY LNA technology followed by GeneGlobe analysis (QIAGEN). GeneGlobe settings: fold change threshold >1.2, Ct<35.
[0092] Figure 12 - ROC curve analysis of asthma diagnosis and asthma severity miRNAs. Summary of (a) ROC analysis and (b) multiple logistic regression models. All the analysis performed in GraphPad Prism software (version 10.0.3). The optimal cut-off values, sensitivity, and specificity were determined by calculating the Youden index. AUC - area under the ROC curve; CI - confidence interval.
[0093] Figure 13 - Biological pathways affected by miRNAs differentially expressed in sera of severe asthma patients in comparison with never-asthma group. The analysis is performed using miRSystem tool, pathways are chosen based on the empirical p-value cut-off 0.05.
[0094] MATERIALS AND METHODS
[0095] Study design:
[0096] First, a systematic review of studies reporting differential expression of specific miRNAs in the tissues and body fluids of adults and children with asthma across 3 databases (Medline, Embase, and SCOPUS) was done. This review identified miRNAs that were reported in more than 2 publications to be differentially expressed in asthma patients compared to people without asthma. These miRNAs showed consistent expression in the blood of asthma patients which enabled the construction of panels of miRNAs expressed in sera that can be used as potential non-invasive biomarkers forasthma diagnosis and severity-risk assessment. Then, a pilot study assessing miRNAs expression in the sera from patients with mild-asthma, severe-asthma and healthy individuals (N = 4 per group) was conducted using miRCURY LNA miRNA Focus PCR Panel kit (QIAGEN) which is designed for profiling 175 human miRNAs commonly found in serum and plasma. This pilot study demonstrated miRNAs in sera that distinguished severe-asthma from both never-asthma and mild-asthma (Figure 6).
[0097] The asthma diagnosis and severity-risk miRNA panels from the systematic review together with the miRNAs identified in our subsequent pilot study enabled us to design a panel of 35 miRNAs (Figure 1) whose expression was evaluated using miRCURY LNA miRNA custom PCR panels in the sera collected from 3 groups of adults (N = 50 each). These groups were classified as severe-asthma, never-asthma and mild-asthma.
[0098] An additional subgroup of biologic naive severe asthma patients (N = 57) that underwent treatment with either Mepolizumab or Omalizumab at a later time point, after the sera were collected, was assessed to study the association of miRNA expression with subsequent asthma biologic response. Nineteen miRNAs (Figure 5) were screened in the sera of these patients including those that were differentially expressed in mild asthma and severe asthma groups and / or miRNAs that showed differential expression in the sera of responders to the biologic treatments compared to non-responders in preliminary experiments with the initial smaller number of samples from severe asthma patients in this study.
[0099] Study population
[0100] Participant samples and clinical data were obtained from 2 existing cohort studies. The Isle of Wight Whole Population Birth Cohort (I0WBC) was established in 1989 to prospectively study the natural history of asthma and allergies in participants (N = 1456) born on the Isle of Wight, United Kingdom (UK), between January 1st1989 and February 28th1990. Ethics approval was obtained for I0WBC from the Isle of Wight NHS Ethics committee (No 05 / 89; dated 08 / 22 / 1988). The Wessex AsThma CoHort of difficult asthma (WATCH) study (N = 500) was established in the Regional Difficult Asthma clinic at University Hospitals Southampton NHS Foundations Trust for patients who are managed with “additional controller medications” and / or “specialist therapies”, according to the BTS Adult Asthma Management Guidelines 2019. The study design and protocol were approved by West Midlands-Solihull Research Ethics Committee(14 / WM / 1226). In both cohorts, participants gave written informed consent for their data and samples to be used in future ethically approved asthma research studies. The present study was approved by Wales REC 6 (20 / WA / 0301).
[0101] For this study, never-asthma was defined as I0WBC participants without history of diagnosed asthma or recurrent wheezing at any time point during their life when assessed at 26-years. Mild-asthma was defined as I0WBC participants with physician diagnosed asthma at 26-years who were on GINA steps 1-2 equivalent treatment. Severe-asthma was defined as biologic naive WATCH participants who met ERS / ATS definition for severe asthma and were on GINA 2020 steps 4-5 equivalent treatment.
[0102] Sample collection and RNA extraction
[0103] For mild and never-asthma participants, serum samples were collected at the 26-year IOWBC assessment and stored at -80°C until analysis. For severe-asthma patients, serum samples were collected at WATCH enrolment and stored at -80°C until analysis. miRNA from 200ul of stored serum was extracted with miRNeasy Serum / Plasma Advanced Kit (QIAGEN, Germany) with the addition of spike-in controls (RNA Spikein Kit, Qiagen) to provide controls for the quality of the RNA isolation.
[0104] qRT-PCR and data analysis
[0105] RNA was reverse transcribed to cDNA using miRCURY LNA RT Kit (QIAGEN) with the addition of spike-in controls for quality control of cDNA synthesis using DNA Engine Tetrad 2 Cycler (Bio-Rad, USA). miRNA expression was evaluated by quantitative PCR on 7900HT Fast Real-Time PCR System with 384-well block module (Applied Biosystems, USA) using miRCURY LNA miRNA SYBR Green custom PCR Panels for Human Serum / Plasma (Qiagen) following manufacturer’s protocol. The PCR data obtained were analysed using QIAGEN web portal GeneGlobe (www.geneglobe.qiagen.com / analyze) which provides a range of web-based tools for data analysis including real-time PCR modules that transforms threshold cycle (Ct) values from QIAGEN PCR panels to calculated results for miRNA expression applying 2AACtmethod. The GeneGlobe settings: fold change threshold >1.2, and Ct<35. Data normalization was performed using 6 reference miRs: miR-let-7i-5p, miR-148b-3p, miR-30e-5p, miR-222-3p, miR-425-5p, and miR-484. Haemolysis and spike-in controls for RNA extraction quality, RT efficiency and PCR amplification pl ate -to -pl ate differences were also included.Bioinformatics analysis of targets and biological pathways
[0106] The potential target genes and their associated biological pathways for miRNAs differentially expressed in the sera of severe-asthma patients compared with never-asthma were determined with an online tool miRSystem. MiRSystem is an online tool which uses 7 well-known target prediction databases, experimentally validated data from TarBase and miRecords, and 5 functional annotation databases and applies various statistical approaches. Target gene summary report and functional annotation summary report were obtained with the following tool settings: 5 pathway databases (KEGG, Biocarta, PID, Reactome, GO tier 2), Hit>3, O / E ratio >2, total genes in pathway >25 and <500. Pathways were chosen based on the empirical p-value cut-off of 0.05.
[0107] Clinical Parameters
[0108] Clinical outcomes of interest that were assessed in severe asthma patients from WATCH included forced expiratory volume in 1 second (FEV1), fractional exhaled nitric oxide (FeNO), and for severe asthma also included Asthma Control Questionnaire (ACQ-6), exacerbations needing oral corticosteroid (OCS) in the past 12 months, being on maintenance (daily) OCS (m-OCS), modified ASSESS score and St. George’s Respiratory Questionnaire (SGRQ). Associated methodology has been previously described for WATCH. Details of ASSESS score calculation can be seen in Figure 10. For the additional subgroup of patients treated with available biologies at the time (Omalizumab or Mepolizumab), treatment response was defined by conventional clinical response criteria.
[0109] Statistical analysis
[0110] miRNA expression comparison between groups was performed using GeneGlobe with an unpaired 2-tail t-test. The association of miRNA expression and clinical parameters and its statistical analyses were performed using GraphPad Prism software (version 10.0.3). An unpaired 2-tail t-test was applied with p-value <0.05 considered statistically significant. For the diagnostic panel, multiple logistic regression combining predictors was carried out followed by ROC curve analysis of the obtained probabilities using GraphPad Prism software (version 10.0.3). The optimal cut-off value, sensitivity, and specificity were determined by calculating the Youden index. Receiver operating characteristic (ROC) curve analysis was performed, and the area under the ROC curve (AUC) with the 95% confidence interval (CI) were calculated to evaluate the diagnostic value of individual miRNAs.RESULTS
[0111] 1. Demographics:
[0112] Figure 6 presents the demographic characteristics of three groups: never-asthma, mild asthma, and severe asthma. Severe asthma group has a lower female predominance, and a significantly higher BMI (Body Mass Index) (P<0.001). Asthma onset was also significantly younger in mild cases (P<0.001). Atopy was the most common in mild asthma group, while smoking rates were similar across all groups.
[0113] 2. Asthma diagnosis (GeneGlobe data and ROC curve analysis):
[0114] First, never-asthma participants (N = 50) were compared with all asthmatic individuals (combining mild-asthma and severe-asthma, N = 100). The analysis revealed that out of the 35 microRNAs screened, four microRNAs were differentially expressed in the sera of asthma patients in comparison to never-asthma individuals: miR-223-3p, miR-191-5p and miR-197-3p were upregulated 1.38 (p<0.001), 1.44 (p<0.0001) and 1.33 (p<0.001) fold respectively whilst miR-155-5p was downregulated 1.22 (p<0.01) fold in the asthma group (Figures 1 and 11).
[0115] The diagnostic values of these miRNAs were evaluated by ROC curve analysis. The ROC curve AUC and 95% CI for individual asthma diagnosis miRNAs were the following: 0.700 (0.610-0.791) for miR-223-3p, 0.799 (0.726-0.871) for miR-191-5p, 0.715 (0.621-0.809) for miR-197-3p, and 0.548 (0.442-0.655) for miR-155-5p (Figures 1c and 12a). To increase the diagnostic accuracy, multiple logistic regression combining all diagnostic miRNAs was carried out and evaluated by ROC curve analysis (Figure 12b). The resulting combination revealed better performance with AUC value of 0.855 (0.796-0.914), sensitivity 87% and specificity 66%.
[0116] 3. miRNA for asthma severity and associated clinical parameters:
[0117] The comparison of mild-asthma with never-asthma individuals showed only 2 miRNAs, miR-191-5p and miR-197-3p, significantly upregulated 1.3 (p<0.0001) and 1.28 (p<0.01) fold respectively in mild-asthma samples (Figures 2a and 11). Both miRNAs were also observed to be upregulated in the severe-asthma group with significantly higher upregulation in severe-asthma in comparison to mild-asthma individuals in the case of miR-191-5p (1.23 fold, p<0.0001).Comparison of severe-asthma with mild-asthma individuals revealed 1 upregulated (miR-223-3p) and 4 downregulated miRNAs (miR-144-3p, miR-30a-5p, miR-660-5p, miR-125b-5p) in severe-asthma patients (Figures 2b and 11). Interestingly, those miRNAs were unchanged in the mild-asthma group in comparison with never-asthma individuals which makes them unique to severe asthma status.
[0118] Understanding association of miRNA expression with different clinical parameters of asthma severity might also be informative in the context of asthma severity-risk identification.
[0119] To determine the connection of miRNAs with asthma severity characteristics the levels of expression between top and bottom quartiles of a variable were compared as well as between subgroups stratified by conventional cut-off values for the clinical parameter of interest. To assess whether sera microRNAs differentially expressed in asthmatic individuals could be linked to lung function, the association of screened miRNAs with FEVi of asthma group was evaluated. The comparison of miRNAs expression between FEVi bottom and top quartiles among asthma patients showed that miR-30a-5p, miR-155-5p and miR-15a-5p, downregulation was associated with a diminished lung function (lower FEVI quartile) (Figure 3a).
[0120] A modified ASSESS score (m-ASSESS) was also created, substituting ACQ-6 for Asthma Control Test (ACT) within this multidimensional score given that ACQ-6 was the available measure of asthma control in WATCH (see Figure 10).
[0121] Upregulation of miR-223-3p and miR-197-3p was observed in the top quartile of modified asthma severity score (m-ASSESS) (Figure 3b). The quartile stratification of the samples is shown in Figure 7. miR-197-3p was also significantly upregulated in the group of patients with inadequate asthma control (Q4 and ACQ-6 > 1.5) (Figure 3c).
[0122] The top quartile FeNO values group showed higher expression of miR-191-5p (Figure 3d). Both, miR-191-5p and miR-151a-3p were upregulated in patients with higher level of airway inflammation (FeNO > 40 ppb).miR-191-5p was also more abundant in the sera of severe asthma patients on m-OCS (Figure 3e). Finally, the association of miRNA expression with quality of life (SGRQ) of severe-asthma patients showed downregulation of miR-15a-5p in the top (worst) quartile of SGRQ score (Figure 3f).
[0123] Thus, it was shown that several miRNAs are associated with various clinical parameters and could be potential markers of airway inflammation and asthma severity. The predictive values of these miRNAs for asthma severity were evaluated by ROC curve analysis. The ROC curve AUC and 95% CI were the following: 0.724 (0.624-0.824) for miR-223-3p, 0.713 (0.607-0.819) for miR-30a-5p, 0.685 (0.579-0.791) for miR-660-5p, 0.643 (0.534-0.752) for miR-125b-5p, and 0.597 (0.486-0.709) for miR-144-3p. When all 5 miRNAs were combined, the sensitivity was 76%, specificity 68% and AUC was 0.766 (0.672-0.860) (Figures 2c and 12).
[0124] 4. Targets and biological pathways of miRNAs differentially expressed in the sera of severe asthma patients.
[0125] To determine the potential target genes of miRNAs studied and biological pathways (terms) they are involved in, miRSystem was used. A list of miRNAs differentially expressed in the sera of severe-asthma patients in comparison with never-asthma individuals (Figure 11) was uploaded in miRSystem which generated the target gene summary report and functional annotation summary report.
[0126] The enriched pathways identified (Figure 4a) were associated with mammalian carbohydrate interconversions including involvement in steroid inactivation, cell processes (meiosis, chromosome maintenance, regulation of retinoblastoma protein that plays a role in cell division cycle, transcription of rRNA), development and homeostasis of various cells and tissues through forkhead box A (FOXA) transcription factors. A considerable proportion of identified pathways were related to inflammation and immune responses. Amongst them were the formation of proteinaceous fibrillar deposits (amyloids) that complicate conditions characterized by chronic inflammation, cytokine signalling including IL-4 and Interferon (IFN) a / as well as antigen presentation and processing involving proteasome.
[0127] The heatmap of target genes in identified terms (Figure 4b) demonstrates that cytokine signalling, and antigen presentation and processing pathways were more enriched andtargeted by the higher number of miRNAs of interest. The miRNAs that target the identified pathways are shown in Figure 13. Those pathways play crucial roles in airway inflammation (hallmark of asthma), and asthma exacerbations (hallmark of asthma severity) and are the targets for asthma treatment with biologies like Omalizumab and Mepolizumab. Therefore, miRNA expression was assessed in relation to the biologic treatment outcome.
[0128] 5. Association of miRNA expression with the outcome of biologies treatment. miRNA expression in the sera of a subgroup of biologic naive severe-asthma patients that later went on either Mepolizumab (N = 29) or Omalizumab (N = 28) treatment was studied and its possible association with the treatment outcome was evaluated.
[0129] The heatmaps on Figure 5 show the comparison of the expression of all miRNAs screened in the sera of severe-asthma patients with positive and negative response to either treatment. Two miRNAs, miR-30a-5p and miR-125b-5p, were significantly downregulated in the sera of patients that did not respond to Omalizumab treatment, whereas miR-181a-5p was upregulated in Mepolizumab non-responders.
[0130] The miRNA expression levels in respect to several clinical features and their change after the biologic treatment were looked at. The only significant change was observed in ACQ-6 where miR-125b-5p was downregulated with the ACQ-6 worsening after Omalizumab treatment (Figure 8). Notably, all the patients that responded to that treatment were in a group where ACQ6 improved and miR-125b-5p showed higher expression levels (Figure 8b).
[0131] DISCUSSION
[0132] Using GeneGlobe analysis miRNAs of diagnostic value differentially expressed in the sera of asthma patients (miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p) compared to never-asthma group were identified. ROC curve analysis showed that a combination of these 4 miRNAs have high predictive value for asthma diagnosis with an AUC of 0.855. Further, 5 miRNAs unique to severe asthma status (miR-223-3p, miR-144-3p, miR-30a-5p, miR-660-5p, miR-125b-5p) were identified. A combination of these 5 severity miRNAs had the ability to discriminate mild from severe asthma with relatively high sensitivity and specificity (AUC=0.76). This notion is supported by thefact that these miRNAs were associated with asthma characteristics that indicate more severe asthma such as lower lung function and higher ACQ-6.
[0133] Some of these miRNAs have been previously studied in asthma and other conditions. For example, miR-223-3p is easily detectable and was reported to be upregulated in various tissues of asthma patients like bronchial brushings, peripheral blood leukocytes and sputum. It is linked with higher eosinophils and neutrophils in tissue and regulates immune cell proliferation, differentiation and polarization during inflammation. Similarly, miR-155 was shown to be downregulated in asthmatic individuals compared to healthy subjects in exhaled breath condensates, asthmatic human bronchial epithelial cells and nasal biopsy specimens. In line with these studies, it was also found this miRNA to be down regulated in serum in asthma patients. However, some studies reported increased miR-155 levels in serum and plasma of asthma patients and its association with degree of asthma severity. One possible explanation for this discrepancy might be that the present study looked at the specific miR-155-5p strand, whereas those previous studies reported findings for miR-155 at a broader level. However, both, -3p and -5p miRNA strands might be functional and express functions that differ in one strand from another. miR-155 is involved in the regulation of allergic inflammation and suppresses Th2 immunity in allergic disorders. Hence, it is conceivable that downregulation of miR-155 promotes allergic inflammation. miR-191-5p and miR-197-3p were shown to be increased in extracellular vesicles of asthma patients and participate in eosinophilic inflammation and remodelling respectively indicating their role in asthma. In summary, these 4 miRNAs have been reported to be associated with asthma in various biological fluids or tissues. However, for the first time the inventors show that all 4 miRNAs can be detected in serum, are differentially expressed in asthma patients and combining them can have diagnostic value in asthma.
[0134] The interest in miRNA expression association with severity of asthma has evolved recently. 5 miRNAs have been found that were differentially expressed in severe asthma. Consistent with our severity miRNA findings, Maes at al. also showed 223-3p to be significantly upregulated in sputum of patients with severe asthma compared with that in healthy control subjects. miR-144-3p was reported to be differentially expressed in serum of asthmatic children in comparison to healthy subjects and was associated with severity of disease in serum and airways of asthmatic patients on higher doses of corticosteroids. miR-660-5p has not been reported in asthma before but was shown tobe upregulated in lung fibroblasts of chronic obstructive pulmonary disease patients. miR-30a-3p was decreased in the peripheral blood and was reported to attenuate fibrosis in asthma. mir-125b was downregulated in sputum although increased in plasma and serum exosomes of asthma patients. miR-125b-5p was downregulated in bronchial biopsies of asthmatic individuals. Supportive to the present findings, miR-125b was linked with asthma severity. In the present study, the relationship between miRNA expression and various clinical parameters of asthma severity was further explored. The findings show the association of miR-30a-5p, miR-155-5p and miR-15a-5p decrease with a diminished lung function (lower FEV1 quartile) of asthma patients. That is consistent with other studies that showed association of increased miR-223-3p and decreased miR-125b-5p expression with lower FEVi% predicted, as well as the correlation of miR-191-5p expression with lung function impairment and inflammation. Importantly, miR-30a-5p and miR-15a-5p were differentially expressed only in severe-asthma group in comparison with never-asthma and mild-asthma individuals, which suggests that miRNAs may be relevant to both asthma development and severity.
[0135] Further investigation of the association of miRNA expression in severity-associated clinical parameters in the severe-asthma group revealed the relation of increased levels of miR-223-3p and miR-197-3p to higher m-ASSESS score with miR-197-3p also upregulated in the sera of patients with inadequate asthma control. Upregulation of miR-151a-3p and miR-191-5p was observed in the sera of patients with greater airway inflammation and of individuals on maintenance OCS in the case of miR-191-5p whereas downregulation of miR-15a-5p was associated with lower quality of life. These findings suggest the role of miRNAs under study as potential markers of airway inflammation and asthma severity.
[0136] To gain better insight into the role of miRNAs in the pathophysiology of asthma, analysis of pathways and genes targeted by miRNA differentially expressed in severe-asthma group was performed. Several asthma-related pathways were identified. One of them is the network of transcription factors FOXA2-FOXA3 known to be inversely correlated to each other and contribute to mucous cell metaplasia in asthma. Several pathways were associated with mammalian carbohydrate interconversions including sucrose and starch metabolism which were recently shown to be associated with an increased prevalence of asthma if consumed in excess.The antigen presentation and cytokine signalling pathways, including IFNa / and IL-4 signalling events, exhibited greater enrichment and were targeted by a higher number of miRNAs of interest. Those pathways play a vital role in airway inflammation in asthma. IFNa / p TLR9-mediated release by plasmacytoid dendritic cells is inhibited by FcaRI activation during airway viral infection and potentially increase the duration and / or severity of viral-induced airway damage. Indeed, deficient type I IFN responses were observed in blood monocytes from patients with atopic asthma.
[0137] Two of the common monoclonal antibody therapies, Omalizumab and Mepolizumab, are designed to bind free IgE promoted by IL-4 inhibiting cell degranulation and release of inflammatory mediators and to target circulating IL-5 preventing its binding to the specific receptor and reducing eosinophilic inflammation respectively. Some of the studies showed that patients with a more severe baseline disease, measured by ACQ-6, were less likely to respond well to these drugs. Identifying biomarkers might allow for more personalized and targeted approaches in the management of asthma, potentially leading to improved treatment strategies. The elucidation of miRNA expression association with the outcome of the biologies treatment showed upregulation of miR-181a-5p in Mepolizumab non-responders. Interestingly, miR-181a-5p levels were unchanged in mild-asthma and severe-asthma groups in comparison with never-asthma individuals which makes this miRNA meaningful only in the context of treatment outcome rather than asthma diagnosis. miR-181a-5p was reported to attenuate neutrophilic inflammation in asthma by targeting DEK as well as to alleviate Treg / Thl7 imbalance and delay asthma development in mice. Importantly, overexpression of miR-181a-5p suppressed the production of inflammatory cytokines (TNFa, IL- ip and IL-6) in RPMI-2650 cells stimulated with ovalbumin. IL-5 is also a potent pro -inflammatory cytokine, and its production can be affected by attenuated cytokine microenvironment. For example, TNFa is one of the cytokines that induces eosinophil degranulation that leads to IL-5 production in its turn. Downregulation of TNFa might lead to reduced IL-5 and changed cytokine milieu in general. This allows us to speculate that overexpression of miR-181a-5p in Mepolizumab non-responders might have attenuated the cytokine milieu and affected circulating IL-5 leading to IL-5 targeted treatment failure.
[0138] As for miRNAs implemented in response to Omalizumab, downregulation of miR-30a-5p and miR-125b-5p was observed in the sera of patients that did not respond toOmalizumab treatment. Notably, these miRNAs were identified as unique severity miRNAs in this study. miR-30a targets autophagy-related gene 5 (ATG5) suggesting that lower miR-30a levels lead to its overexpression which promotes asthma progression. ATG5 expression is related to increased Th2 / Thl ratio, inflammation, exacerbation risk and severity in adult asthma patients and leads to eosinophil proliferation and differentiation which in its turn might cause the IgE increase. It is also shown that miR-30a-3p downregulates IL-4. Omalizumab targets free IgE, promoted by IL-4. It is possible therefore that overproduction of IgE and eosinophil proliferation caused by the decrease of miR-30a-5p prevents the effective response to Omalizumab. Similarly, miR-125b was reported to influence cytokine signalling by targeting TNF mRNA translation. Downregulation of this miRNA might cause TNF-induced eosinophil degranulation and the release of mediators which can promote type 2 immunity by increasing the production of the IgE. Notably, miR-125b-5p was downregulated in the sera of severe-asthma patients whose ACQ-6 worsened after Omalizumab treatment and all the patients that responded to the treatment were in a group where ACQ6 improved and miR-125b-5p showed higher expression levels. This suggests a potential role of miR-125b-5p Omalizumab responsiveness.
[0139] Thus, working with relatively big, well-defined groups of asthma patients in this study miRNAs have been identified that are differentially expressed in the sera of asthma patients and associated with several clinical parameters, which make them potent asthma diagnostic markers. A set of miRNAs that are unique to severe-asthma, are associated with asthma severity indices such as lower lung function and higher ACQ-6 and therefore might serve as asthma severity risk biomarkers have also been defined. Specific pathways associated with those miRNAs which helps to gain a better understanding of the role that miRNAs play in the complexity of asthma have been identified. Further studies are needed to validate these findings and determine the clinical utility of miRNA-based approaches in asthma diagnosis and management.
[0140] References
[0141] 1. Global Initiative for Asthma. Global Strategy for Asthma Management and Prevention. Updated 2020. Available from: https: / / ginasthma.org /
[0142] 2. Chung KF, et al. International ERS / ATS guidelines on definition, evaluation and treatment of severe asthma. Eur Respir J 2014; 43: 343-73
Claims
Claims1. A method of diagnosing asthma in a subject, the method comprising:a) providing a sample obtained from the subject;b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p in the sample;c) comparing the level of the miRNA biomarkers with a reference level of the same miRNA biomarkers; andd) using the results from c) to diagnose if the subject has asthma.
2. The method of claim 1, wherein the reference level is the level that is present in an individual that does not have asthma.
3. The method of claim 1 or claim 2, wherein the subject is diagnosed as having asthma if the level of miR-223-3p is higher than the reference level of miR-223- 3p, the level of miR-191-5p is higher than the reference level of miR-191-5p, the level of miR-197-3p is higher than the reference level of miR-197-3p and the level of miR-155-5p is lower than the reference level of miR-155-5p.
4. A method of determining if a subject is likely to develop severe asthma, the method comprising:a) providing a sample obtained from the subject;b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-144-3p, miR-30a-5p, miR-660-5p and miR-125b-5p in the sample;c) comparing the level of the miRNA biomarkers with a reference level of the same miRNA biomarkers; andd) using the results from c) to determine if the subject is likely to develop severe asthma.
5. The method of claim 4, wherein the reference level is the level that is present in an individual that has mild asthma.
6. The method of claim 4 or claim 5, wherein the subject is determined to have severe asthma if the level of miR-223-3p is higher than the reference level of miR-223-3p, the level of miR-144-3p is lower than the reference level of miR- 144-3p, the level of miR-30a-5p is lower than the reference level of miR-30a- 5p, the level of miR-660-5p is lower than the reference level of miR-660-5p and the level of miR-125b-5p is lower than the reference level of miR-125b-5p.
7. The method of any one of claims 4 to 6, wherein the subject has already been diagnosed as having asthma.
8. A method of identifying whether a subject having asthma is likely not to respond or likely to respond poorly to anti-interleukin-5 (anti-IL-5) monoclonal antibody therapy, the method comprising:a) providing a sample obtained from the subject;b) determining the level of miRNA biomarker miR-181a-5p in the sample; c) comparing the level of the miR-181a-5p determined from b) with a reference level of miR-181a-5p; andd) using the results from c) to identify if the subject is likely not to respond or likely to respond poorly to anti-IL-5 monoclonal antibody therapy.
9. The method of claim 8, wherein the reference level is the level that is present in an individual that has severe asthma and responds to anti-IL-5 monoclonal antibody.
10. The method of claim 8 or claim 9, wherein the subject is identified as not responding or responding poorly to anti-IL-5 monoclonal antibody therapy if the level of miR-181a-5p is higher than the reference level of miR-181a-5p.
11. A method of identifying whether a subject having asthma is likely not to respond or likely to respond poorly to anti-immunoglobulin E (anti-IgE) monoclonal antibody therapy, the method comprising:a) providing a sample obtained from the subject;b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-30a-5p and miR-125b-5p in the sample;c) comparing the level of the miRNA biomarkers with a reference level of the same biomarkers; andd) using the results from c) to identify if the subject is likely not to respond or likely to respond poorly to anti-IgE antibody therapy.
12. The method of claim 11, wherein the reference level is the level that is present in an individual that has severe asthma and responds to the anti-IgE monoclonal antibody therapy.
13. The method of claim 11 or claim 12, wherein the subject is identified as not responding or responding poorly to anti-Ig-E monoclonal antibody therapy if the level of miR-30a-5p is lower than the reference level of miR-30a-5p and the level of miR-125b-5p is lower than the reference level of miR-125b-5p.
14. A method of treating asthma in a subject, the method comprising:a) providing a sample obtained from the subject;b) determining the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p in the sample;c) comparing the level of the miRNA biomarkers with a reference level of the same miRNA biomarkers; andd) administering an asthma therapy if indicated appropriate by the results from step c).
15. The method of claim 14, wherein the reference level is the level that is present in an individual that does not have asthma.
16. The method of claim 14 or claim 15, wherein step d) comprises administering an asthma therapy to the subject if the level of miR-223-3p is higher than the reference level of miR-223-3p, the level of miR-191-5p is higher than the reference level of miR-191-5p, the level of miR-197-3p is higher than the reference level of miR-197-3p and the level of miR-155-5p is lower than the reference level of miR-155-5p.
17. The method of any one of claims 14 to 16, wherein the asthma therapy is selected from the group consisting of steroid-containing inhalers, leukotriene receptor antagonists, theophylline, steroid tablets, Omalizumab, Mepolizumab, Reslizumab, Benralizumab, Dupilumab, Tezepelumab, bronchial thermoplasty, acupuncture, and Chinese herbal medicine.
18. The method of any one of the preceding claims, wherein the sample is a blood sample.
19. The method of any one of the preceding claims, wherein the subject is human.
20. A kit comprising means for detecting the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR- 155-5p.
21. Use of a kit for diagnosing asthma in a subject, wherein the kit comprises means for detecting the level of a panel of miRNA biomarkers comprising or consisting of miR-223-3p, miR-191-5p, miR-197-3p and miR-155-5p.