753 results about "Combination therapy" patented technology

The disclosure provides method of treating cancer in a patient in need thereof, comprising safely and efficaciously administering to the patient PLX038, a long lasting-PEGylated prodrug of the topoisomerase I inhibitor. The disclosure further provides combination therapies of PLX038 with inhibitors of the DNA damage response (DDR).

Multispecific antibody having a binding site for ICOS and a binding site for a second antigen, e.g., an immune checkpoint molecule such as PD-L1. Use of the multispecific antibody in immuno-oncology, including for treatment of solid tumours.

The present invention provides compositions comprising one or more ACAT inhibitors and one or more GLP-1 receptor agonists (GLP-1 RAs). The combination therapy reduces side effects associated with high-dose GLP-1 RA monotherapy and provides durable management of weight loss by suppressing rebound of body weight, blood glucose, and cholesterol levels after treatment.

The present invention relates to combination therapies employing tumor targeted anti-CEA / CD3 bispecific antibodies and / or agents blocking PD-L1 / PD-1 interaction in combination with 4-1BB (CD137) agonists, in particular 4-1BBL trimer containing antigen binding molecules that also target FAP, the use of these combination therapies for the treatment of cancer and methods of using the combination therapies.

The disclosure provides method of treating cancer in a patient with ATM-deficient or ATR-deficient tumors, comprising safely and efficaciously administering to the patient PLXO38, a long lasting-PEGylated prodrug of the topoisomerase I inhibitor. The disclosure further provides combination therapies of PLXO38 with inhibitors of the DNA damage response (DDR).

The present invention relates to: a receptor tyrosine kinase like orphan receptor 1 (ROR 1) antibody or an antigen-binding fragment thereof; a nucleic acid encoding same; a recombinant expression vector carrying the nucleic acid; a host cell transinfected with the recombinant expression vector; a method for preparing the antibody or the antigen-binding fragment thereof; a bi- or multi-specific antibody bearing the antibody or the antigen-binding fragment thereof; an immune cell-engaging bi- or multi-specific antibody; an antibody-drug conjugate (ADC) in which the antibody or the antigen-binding fragment thereof is bound to a drug; a chimeric antigen receptor (CAR) containing the scFv of the antibody as an antigen-binding site of an extracellular domain; an immune cell having the chimeric antigen receptor introduced thereinto; a composition for combination therapy including the antibody or the antigen-binding fragment thereof; a composition for preventing or treating cancer; and a method for preventing or treating cancer.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The invention relates to combination therapies employing an anti-PD1 / anti-LAG3 bispecific antibody and an HLA-G T cell-activating bispecific antibody, the use of these combination therapies for the treatment of cancer and methods of using the combination therapies.

The disclosure concerns a method of treating cancer, especially, such as multiple myeloma, involving the combination of an anti-BCMA (B cell maturation antigen) antibody, Belantamab mafodotin -GSK2857916- and a gamma-secretase inhibitor, e.g., nirogacestat -PF03084014-. The disclosure also relates to dosages, duration of treatment and time lapses between administration of the anti-BCMA antibody and the gamma-secretase inhibitor.

The invention provides methods and compositions for treatment of a subject with a glioma. The methods comprise administering a composition comprising Coenzyme Q10 to the subject by continuous intravenous infusion; and administering radiation therapy to the subject. The composition comprising Coenzyme Q10 may be administered to the subject by continuous intravenous infusion for at least 24 hours before the radiation therapy is initiated.

Disclosed herein are kits and methods for treating pulmonary arterial hypertension (PAH), comprising administering to a subject in need thereof: •a therapeutically effective amount of a tyrosine kinase inhibitor or a pharmaceutically acceptable salt thereof; and•a therapeutically effective amount of a dimeric fusion protein comprising: •the extracellular domain of the activin type 2A (ACTR IIA) or the activin type 2B receptor (ACTR IIB); and the Fc domain of human immunoglobulin G1 (IgG1). In some embodiments, the tyrosine kinase inhibitor is Seralutinib or a pharmaceutically acceptable salt thereof and the fusion protein is Sotatercept.

1 BNT ref [P1819WO01] / / C&F ref. 240673WO A b s t r a c t The present invention relates to an anti-CTLA4 antibody or fragment thereof and / or a chemotherapy agent for use in a method of treating cancer in a subject in need thereof, wherein the subject is administered a combination comprising the anti-CTLA4 antibody or fragment thereof and the chemotherapy agent. The invention further provides a composition 5 and a kit of parts comprising the anti-CTLA4 antibody or fragment thereof and the chemotherapy agent. The invention further concerns a method of treating cancer in a subject in need thereof, wherein the method comprises administering to the subject the anti-CTLA4 antibody or fragment thereof and the chemotherapy agent. The invention further provides a combination of the anti-CTLA4 antibody or fragment thereof and the chemotherapy agent. 10

Provided herein are methods of treating proliferative diseases or disorders (e.g., a cancer) in a patient in need thereof using a combination therapy of Compound (I) or a pharmaceutically acceptable salt thereof and a PD-1 inhibitor (e.g., Pembrolizumab).

The invention belongs to the technical field of biological pharmacy, and relates to a bifunctional fusion protein targeting PD-1 / PD-L1 and IL-33 as well as a construction method and application of the bifunctional fusion protein. The bifunctional fusion protein comprises a PD-1 / PD-L1 antibody and a targeted IL-33 functional fragment, T cells are activated by blocking a PD-1 / PD-L1 signal to kill tumor cells, meanwhile, the level of IL-33 in tumor tissue is reduced, and the activity of IL-33 is inhibited. Researches show that the bifunctional fusion protein can increase infiltration of functional T cells, enhance T cell response and remodel a tumor microenvironment so as to generate an anti-tumor effect superior to that of combined treatment, and has a very good application prospect.

Disclosed herein are improved methods for treating muscular dystrophy, such as DMD, BMD, or FSHD. Various combination therapies and monotherapies are provided.

The present invention provides SETD2 protein inhibitors, as well as methods, compositions and kits for treating a disease, disorder or condition in a subject using a SETD2 protein inhibitor and optionally a second therapeutic agent, wherein the second therapeutic agent comprises one or more glycocortin receptor agonists, one or more immunomodulatory drugs, one or more proteasome inhibitors, one or more Bcl-2 inhibitors, one or more multi-effect pathway modulators, one or more XPO1 inhibitors, and one or more pharmaceutically acceptable salts thereof, one or more histone deacetylase inhibitors or one or more EZH2 inhibitors, or a combination thereof.

The invention belongs to the field of gene engineering, and particularly designs oligonucleotide and application thereof in preparation of a medicine for treating osimertinib drug-resistant non-small cell lung cancer. Research finds that 3 'tRF-mtAsnGTT is highly expressed in osimertinib drug-resistant non-small cell lung cancer cells, and the inventor designs an effective oligonucleotide capable of specifically inhibiting the function of 3' tRF-mtAsnGTT, so that tumor cell proliferation is inhibited, cell apoptosis is promoted, and the drug sensitivity of the cells to osimertinib is remarkably improved. The invention provides a novel targeting strategy and application approach for molecular intervention and combined treatment of osimertinib resistance of non-small cell lung cancer.

This disclosure provides a method for treating hair loss in a subject requiring treatment for hair loss, comprising topically administering an effective amount of cortexolone-17α-propionate and an effective amount of minoxidil to the subject. This disclosure further provides a topical pharmaceutical formulation comprising cortexolone-17α-propionate, minoxidil, and one or more pharmaceutically acceptable carriers.

The present disclosure provides immune cells comprising an exogenous T cell receptor (TCR) and T cell modulatory polypeptides (TMPs) for use in methods of treating a disease or condition. The TMPs comprise one or more immunomodulatory polypeptides that stimulate activation and / or proliferation of the immune cell. Also disclosed are methods of expanding a population of immune cells and methods of selectively delivering an immunomodulatory polypeptide using the same. Also disclosed are pharmaceutical combinations comprising the same and their use in methods of treating a disease or condition.

The present invention relates to methods for treating overweight or obese in individuals in need thereof, and / or individuals with fatty liver disease or diabetes. In particular, the present invention relates to a method of treating obesity, fatty liver disease or diabetes in an individual in need thereof, the method comprising administering a SIK-3 inhibitor and a metabolic modulator to the individual.

The invention discloses an application of mRNA (messenger Ribonucleic Acid) for coding p16 protein in preparation of a medicine for treating pancreatic cancer. The mRNA for coding the p16 protein comprises a nucleic acid sequence as shown in SEQ ID NO.1-3. The invention also provides an application of the mRNA for coding the p16 protein and a universal RAS inhibitor daraxonrasib in the preparation of a medicine for treating pancreatic cancer in combination with the mRNA for coding the p16 protein and the universal RAS inhibitor daraxonrasib. Further, the mRNA encoding the p16 protein can be entrapped in a lipid nanoparticle. Experiments show that the function of CDKN2A is recovered by delivering p16 mRNA, the sensitivity of pancreatic cancer cells to the daraxonrasib can be enhanced, the drug resistance of the daraxonrasib can be reversed, and a remarkable synergistic anti-tumor effect is shown in various pancreatic cancer mouse models. The invention provides a new combined treatment strategy for the treatment of pancreatic cancer, especially pancreatic ductal adenocarcinoma.

Therapeutic use and dosing regimen of anti-ICOS antibodies or antigen-binding fragments thereof for modulating the ratio between regulatory T cells and effector T cells, stimulating the immune system of patients, and / or treating tumours or cancers, as monotherapy or combination therapy, e.g., with anti-PD-L1 antibodies or antigen-binding fragments thereof.

The invention relates to an application of a DNAJB4 gene and an encoding protein thereof in preparation of a product for enhancing cancer radiotherapy sensitivity. The DNAJB4 gene provided by the invention is closely related to cancer radiotherapy sensitivity, and overexpression of the DNAJB4 gene is positively related to radiotherapy sensitivity of head and neck squamous cell carcinoma, cervical cancer or breast cancer. A product prepared from the target DNAJB4 selectively degrades DNA-PKcs through a CMA way, high specificity is achieved, and toxicity to normal tissue can be reduced; the radiotherapy remission rate of a patient with high DNAJB4 expression is obviously improved (clinical queue data); the combined treatment prolongs the median lifetime of the mouse model; the drug resistance risk can be reduced by combining with existing therapies (radiotherapy and immunotherapy).

This invention relates to combination therapies comprising an inhibitor of anaplastic lymphoma kinase (ALK) and, an inhibitor of cyclin dependent kinase 4 and 6 (CDK4 / 6 inhibitor) or an inhibitor of cyclin dependent kinase 2, 4 and 6 (CDK2 / 4 / 6 inhibitor), and associated methods of treatment, combinations, pharmaceutical compositions and uses thereof.

Various formulations for combination therapy of liposomes and SR-BI inhibitors that result in enhanced liposome uptake by target cells are provided, exemplified by combination therapy with CPX-351 and BLT-1. Also provided are various formulations for combination therapy of liposomes and ENT inhibitors that result in enhanced uptake of liposome-encapsulated cytarabine by target cells. Also provided are methods for using the formulations in combination therapy. Also provided are methods for reducing cardiotoxicity in age-group patient populations receiving therapy with cytarabine and daunorubicin, and CPX-351.

Disclosed herein are compositions and methods for treating cancer, specifically extensive-stage small-cell lung cancer (ES-SCLC), through the administration of a combination therapy. In some embodiments, the method comprises administering plinabulin, one or more immune checkpoint inhibitors, including but not limited to pembrolizumab, and a regimen of etoposide with a platinum-based agent (EP). The disclosed methods enhance tumor reduction, prolong progression-free survival, and improve overall treatment efficacy compared to traditional therapies.

The present invention is directed to an oncolytic vector together with one or more antibiotics, one or more a probiotics or other microbiome-targeting compositions, and / or one or more fecal transplant for use in the treatment of cancer. The invention is also directed to a pharmaceutical composition comprising an oncolytic vector with one or more of the following: an antibiotic, a probiotic, a microbiome-targeting composition and a fecal transplant. The invention is also directed to a kit which comprises a first container, a second container, and a package insert, wherein the first container comprises at least one dose of a pharmaceutical composition containing an oncolytic vector, the second container containing one of the following: an antibiotic, a probiotic, a microbiome-targeting composition or a fecal transplant, and the package insert comprises instructions for treating a subject having cancer using the compositions of the first and second containers, wherein said probiotic, microbiome-targeting composition or fecal transplant comprises or promotes a bacterial species which improves the effect of the treatment with an oncolytic vector in a subject when said bacterial species is present in the gut microbiome of said subject, and wherein said antibiotic is effective against a bacterial species which decreases the effect of the treatment with an oncolytic vector in a subject when said bacterial species is present in the gut microbiome of said subject.

Provided are compositions for use in treating a subject having a small cell lung cancer (SCLC) - derived tumor having a high tumor mutational burden (TMB) status.SOLUTION: Provided are methods of treating a subject having an SCLC-derived tumor having a TMB status, comprising administering to the subject a monotherapy comprising an anti-PD-1 antibody or a combination therapy comprising an anti-PD-1 antibody and an anti-CTLA-4 antibody. Also provided are methods of identifying a subject suitable for treatment with an anti-PD-1 antibody or a combination therapy comprising an anti-PD-1 antibody and an anti-CTLA-4 antibody, comprising determining the TMB status in a biological sample of the subject. A high TMB status identifies the patient as suitable for treatment with an anti-PD-1 antibody or antigen-binding portion thereof. TMB status can be determined by sequencing nucleic acids in the tumor and identifying genomic alterations, e.g., somatic non-synonymous mutations, in the sequenced nucleic acids.SELECTED DRAWING: None

The invention discloses an application of ametinib in preparation of a lung cancer treatment medicine, belongs to the technical field of biological medicines, and aims to widely research the direct anti-tumor effect of ametinib in lung cancer at present. The invention provides a new action mechanism of the ametinib for regulating intestinal flora to influence glutamine metabolism so as to inhibit lung cancer development, and experiments prove that the ametinib treatment increases the abundance of flora related to amino acid metabolism in intestinal tracts, so that the content of glutamine in the intestinal tracts is reduced; the invention has reference significance in research and development of adjuvant therapy drugs or combined therapy drugs for lung cancer, preparation of antitumor drugs and the like.

The present invention relates to a composition comprising eptinezumab and LuAG09222. This composition may be used, for example, to treat or prevent headache, pain, migraine, cluster headache, or endometriosis.