1386 results about "Combination therapy" patented technology

The disclosure provides a method of treating a human subject afflicted with lung cancer (e.g., non-small cell lung cancer (NSCLC)) with a programmed death-1 (PD-1) pathway inhibitor (e.g., an anti-PD-1 antibody) and a concurrent chemoradiotherapy (CCRT, e.g., a platinum doublet chemotherapy (PDCT) and a radiation therapy) followed by a combination of a PD-1 pathway inhibitor (e.g., an anti-PD-1 antibody) and a lymphocyte activation gene-3 (LAG-3) antagonist (e.g., an anti-LAG-3 antibody). In some aspects, the method comprises a recovery period that begins upon completion of the treatment with the PD-1 pathway inhibitor and the CCRT and ends at the start of the treatment with the combination of the PD-1 pathway inhibitor and the LAG-3 antagonist.

The present invention relates to combination therapy with (a) a mutant IDH inhibitor having the Formula I and (b) one or more of an antimetabolite agent, a hypomethylating agent, and a mutant Flt3 (Flt3) inhibitor, for the treatment of cancer.

A system and method are herein disclosed. The system and method use a generative AI agent to analyze and identify synergistic blends of natural compounds for combination therapies by leveraging an array of specialized modes to access data from a multitude of sources including patient medical history (including test results, drug history, and imaging) to improve the efficacy of compounds, including traditional medicine, in line with combination therapy principles, aimed at: enhanced efficacy, decreased toxicity, improved dosage, and reduced drug resistance. In this way, the generative AI agent determines cross-therapeutic similarities and / or dissimilarities between pharmaceutical, naturopathic, homeopathic, and nutraceutical compounds along a plurality of compound property vectors such as efficiency, efficacy, toxicity, effects, side-effects, chemistry, pharmacology, pharmacokinetics, mechanisms of action, and pharmacodynamics, thereby enabling the proposition of cross-disciplinary and transdisciplinary therapeutic analyses and the identification of synergistic effects in combination therapies.

The disclosure provides method of treating cancer in a patient in need thereof, comprising safely and efficaciously administering to the patient PLX038, a long lasting-PEGylated prodrug of the topoisomerase I inhibitor. The disclosure further provides combination therapies of PLX038 with inhibitors of the DNA damage response (DDR).

Multispecific antibody having a binding site for ICOS and a binding site for a second antigen, e.g., an immune checkpoint molecule such as PD-L1. Use of the multispecific antibody in immuno-oncology, including for treatment of solid tumours.

To provide methods of treating a B-cell proliferative disorder.SOLUTION: The present invention relates to methods of treating a B-cell proliferative disorder by administering an anti-CD20 / anti-CD3 bispecific antibody, and methods for reduction of adverse effects in response to the administration of the anti-CD20 / anti-CD3 bispecific antibody. The present invention further relates to combination treatment methods of treating a B-cell proliferative disorder.SELECTED DRAWING: None

The present invention provides compositions comprising one or more ACAT inhibitors and one or more GLP-1 receptor agonists (GLP-1 RAs). The combination therapy reduces side effects associated with high-dose GLP-1 RA monotherapy and provides durable management of weight loss by suppressing rebound of body weight, blood glucose, and cholesterol levels after treatment.

The invention belongs to the technical field of biological medicine, and particularly relates to application of hUC-MSCs combined with Met in preparation of anti-diabetic drugs. The diabetes mellitus is particularly type 2 diabetes mellitus. Through construction of a T2DM rat model, paraffin tissue section detection, serum ELISA, cell experiments and the like, researches prove that T2DM can be effectively treated by HUC-MSCs combined with Met treatment, including reduction of body blood sugar and recovery of blood sugar regulation ability; liver injury caused by T2DM is relieved and repaired; the glycolipid metabolism of the liver of the T2DM rat is improved; the immune inflammation disorder caused by T2DM is relieved; and the apoptosis level of liver cells is improved. And compared with a single hUC-MSCs or Met treatment mode, the combined treatment mode has a better treatment effect. The invention provides a theoretical basis and a new treatment strategy for treatment of T2DM.

The present invention relates to combination therapies employing tumor targeted anti-CEA / CD3 bispecific antibodies and / or agents blocking PD-L1 / PD-1 interaction in combination with 4-1BB (CD137) agonists, in particular 4-1BBL trimer containing antigen binding molecules that also target FAP, the use of these combination therapies for the treatment of cancer and methods of using the combination therapies.

The disclosure provides a method for treating a subject afflicted with a tumor derived from a small cell lung cancer (SCLC) having a high tumor mutational burden (TMB) status comprising administering to the subject a monotherapy comprising an anti-PD-1 antibody or a combination therapy comprising an anti-PD-1 antibody and an anti-CTLA-4 antibody. The present disclosure also provides a method for identifying a subject suitable for treatment with an anti-PD-1 antibody or a combination therapy comprising an anti-PD-1 antibody and an anti-CTLA-4 antibody comprising measuring a TMB status of a biological sample of the subject. A high TMB status identifies the patient as suitable for treatment with an anti-PD-1 antibody or antigen-binding portion thereof. The TMB status can be determined by sequencing nucleic acids in the tumor and identifying a genomic alteration, e.g., a somatic nonsynonymous mutation, in the sequenced nucleic acids.

The invention relates to a combination of a binding agent comprising (i) a first binding region which binds to PD-1, PD-L1, or both and which antagonizes the PD-1 / PD-L1 interaction; and (ii) a second binding region which binds to VEGF, VEGF receptor (VEGFR), or both and which antagonizes the VEGF / VEGFR interaction, and an antibody-drug conjugate comprising an antibody or fragment thereof that specifically binds to a target expressed on the surface of a tumour cell.

To provide a method and device for predicting plasma concentration transition in combination of multiple drugs, by easily determining Ki, fm in vivo, and making them into a database, since, there has been dynamic prediction using a physiologic medicine speed theory (PBPK) model, as a prediction method of a drug interaction for medical products, however, prediction using an inhibition constant (Ki) of in vitro data and a contribution ratio (fm) of a metabolic enzyme, do not always match increase of clinical AUC.SOLUTION: There is provided a method for determining a parameter of a compartment model from a pharmacokinetic parameter of an interacted drug and interaction drug, then converting the compartment parameter into a PBPK model parameter, then determining by simulation using the PBPK model, a Ki value and fm being AUC increase ratios observed clinically. The acquired parameter is made into a database, and simulation of blood concentration transition of the interacted drug and interaction drug is performed.SELECTED DRAWING: Figure 1

The disclosure provides method of treating cancer in a patient with ATM-deficient or ATR-deficient tumors, comprising safely and efficaciously administering to the patient PLXO38, a long lasting-PEGylated prodrug of the topoisomerase I inhibitor. The disclosure further provides combination therapies of PLXO38 with inhibitors of the DNA damage response (DDR).

Provided herein are compositions and methods for the treatment of an autoimmune or inflammatory disease, such as rheumatoid arthritis. Said compositions comprise a TNFR1 inhibitor. Some embodiments comprise combination therapy featuring the TNFR1 inhibitor with at least one additional anti-inflammatory therapeutic agent.

The present invention relates to: a receptor tyrosine kinase like orphan receptor 1 (ROR 1) antibody or an antigen-binding fragment thereof; a nucleic acid encoding same; a recombinant expression vector carrying the nucleic acid; a host cell transinfected with the recombinant expression vector; a method for preparing the antibody or the antigen-binding fragment thereof; a bi- or multi-specific antibody bearing the antibody or the antigen-binding fragment thereof; an immune cell-engaging bi- or multi-specific antibody; an antibody-drug conjugate (ADC) in which the antibody or the antigen-binding fragment thereof is bound to a drug; a chimeric antigen receptor (CAR) containing the scFv of the antibody as an antigen-binding site of an extracellular domain; an immune cell having the chimeric antigen receptor introduced thereinto; a composition for combination therapy including the antibody or the antigen-binding fragment thereof; a composition for preventing or treating cancer; and a method for preventing or treating cancer.

The present invention is directed to the combination therapy of cancer with an allosteric EGFR inhibitor and an orthosteric EGFR inhibitor, as well as uses and pharmaceutical compositions thereof.

The present disclosure provides the medical use of an antigen-binding molecule that binds to gp130 in combination with an antagonist of an angiogenic factor to treat / prevent fibrosis, diseases / conditions characterised by fibrosis, pathological angiogenesis, diseases / conditions characterised by angiogenesis, pathological inflammation and / or diseases / conditions characterised by inflammation. The present disclosure also provides a combination comprising an antigen-binding molecule that binds to gp130 and an antagonist of an angiogenic factor.

The present provides a method of treating ovarian cancer, breast cancer, gastrointestinal cancer, lung cancer, cancer of the brain or prostate cancer in a subject in need thereof, comprising administering to the subject a first amount of a selective PARP1 inhibitor or a pharmaceutically acceptable salt thereof, and a second amount of an ATR inhibitor or a pharmaceutically acceptable salt thereof. Also disclosed are compositions and kits comprising a PARP inhibitor and ATR inhibitor.

The present disclosure is directed to methods of identifying subjects as likely or unlikely to have a durable response to a RAS(ON) inhibitor based on certain characteristics of the subjects. In addition, the present disclosure provides therapies for treating cancer, including combination therapies useful for treating subjects identified as not likely to have a durable response to a RAS(ON) inhibitor monotherapy.

Treatment of Cancer Methods for treatment of cancer, in particular soft tissue sarcomas (STS), are described, as well as compounds, compositions, and combined preparations for use in such methods. An effective amount of: a LAG-3 protein, or a derivative thereof that is able to bind to MHC class II molecules; a programmed cell death protein-1 (PD-1) pathway inhibitor; and radiotherapy, is administered to a subject. Optionally the subject has undergone, is undergoing, or is to undergo, surgery for treatment of the cancer. A clinical trial study is described in which a triple combination of LAG-3 derivative eftilagimod alpha, a PD-1 pathway inhibitor, and radiotherapy was administered. The combination was surprisingly effective in the treatment of STS in patients who have completed 10 weeks of treatment, followed by surgery 2-3 weeks later. A substantial number of near complete pathological responses were observed, which are rarely seen in STS patients with standard therapeutic approaches including radiotherapy.

The invention discloses a combined treatment medicine for acute myelogenous leukemia. The combined treatment medicine is prepared from vinaclaria, azacitidine and aclarithromycin. The medicine is applied to preparation of an acute myelogenous leukemia cell proliferation inhibitor; the medicine is applied to preparation of an acute myelogenous leukemia cell apoptosis inducer. The three medicines are combined to achieve a synergistic effect: the three medicines have a synergistic anti-tumor effect instead of a simple superposition effect, and a new combined medication mechanism is a result obtained through laboratory research and an initial effect of clinical application. The subsequent consolidation treatment scheme may also be used for part of initially treated patients with acute myelogenous leukemia, which are not suitable for enhanced chemotherapy or intense intense treatment by using targeted drugs, and relapse / refractory patients with acute myelogenous leukemia, and a better treatment scheme can also bring new hope and dawn to more patients.

The invention provides compositions and methods for treating diseases associated with expression of BCMA. The invention also relates to a method of administering a BCMA-targeting agent which is an anti-BCMA antibody molecule or a recombinant non-antibody protein that binds to BCMA, and a gamma secretase inhibitor.

The present disclosure generally relates to microsurgical instruments for ophthalmic surgical procedures, and more particularly, methods and microsurgical instruments for vitreoretinal procedures. In certain embodiments described herein, a vitreoretinal procedure is performed utilizing two surgical instruments: 1) a treatment instrument configured to a) treat a target ophthalmic tissue (e.g., sever and remove the vitreous body), and b) infuse fluid into the intraocular space to maintain intraocular pressure (IOP); and 2) an illumination probe for providing illumination within the intraocular space. The combined treatment and infusion functionalities of the treatment instrument eliminate the need for a separate infusion cannula, thus enabling the vitreoretinal procedure to be performed with only two instruments and reducing the number of incisions made in the eye. Additionally, utilization of two instruments facilitates easier manipulation of the eye by a surgeon, as one of the two instruments can be used to “steer” the eye during the procedure.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The present invention provides a combination therapy for effectively treating and / or preventing diseases associated with cells expressing CA19-9, including cancer diseases such as pancreatic cancer and metastases thereof.

The invention relates to combination therapies employing an anti-PD1 / anti-LAG3 bispecific antibody and an HLA-G T cell-activating bispecific antibody, the use of these combination therapies for the treatment of cancer and methods of using the combination therapies.

The present invention provides methods for treating patients suffering from familial hypercholesterolemia, including both HeFH and HoFH. The methods of the invention provide for lowering at least one lipid parameter in the patient by administering a therapeutically effective amount of an antibody or antigen-binding fragment thereof that specifically binds to ANGPTL3 in combination with a therapeutically effective amount of a statin, a first lipid lowering agent other than a statin, and a second lipid lowering agent other than a statin. The first non-statin lipid lowering agent is an agent that inhibits cholesterol uptake (e.g. ezetimibe) and the second non-statin lipid-lowering agent is an inhibitor of microsomal triglyceride transfer protein (e.g. lomitapide). The combination therapy is useful in treating hypercholesterolemia, as well as hyperlipidemia, hyperlipoproteinemia and dyslipidemia, including hypertriglyceridemia, chylomicronemia, and to prevent or treat diseases or disorders, for which abnormal lipid metabolism is a risk factor, such as cardiovascular diseases.

The disclosure concerns a method of treating cancer, especially, such as multiple myeloma, involving the combination of an anti-BCMA (B cell maturation antigen) antibody, Belantamab mafodotin -GSK2857916- and a gamma-secretase inhibitor, e.g., nirogacestat -PF03084014-. The disclosure also relates to dosages, duration of treatment and time lapses between administration of the anti-BCMA antibody and the gamma-secretase inhibitor.

The invention discloses a curative effect evaluation system for treating liver cancer by combining HDRBT with thermal ablation in multi-modal radiomics, and relates to the field of liver cancer treatment, and the system comprises a multi-modal image data acquisition module which is used for collecting multi-modal image data; the three-dimensional visual model construction module is used for reconstructing a three-dimensional structure of liver tumors, peripheral blood vessels and bile ducts through an image segmentation algorithm, and generating a visual model by fusing radiomics characteristics; the combined treatment plan generation module is used for integrating the dosimetry parameters of the HDRBT and the process parameters of the thermal ablation, optimizing a catheter implanting path, the position of a thermal ablation electrode and a treatment sequence, and generating a combined treatment scheme; and the curative effect evaluation module is used for quantitatively analyzing tumor volume change, ablation boundary integrity and residual tumor activity through accurate registration of multi-modal images before and after treatment. According to the scheme, the problems of incomplete thermal ablation and high recurrence rate of hepatocellular carcinoma can be solved, and full-chain technical support is provided for clinical precise application.

Described herein are combination therapies comprising a CDK2 degrader and a CDK4 / 6 inhibitor. The combination therapies are for use in the treatment of disorders such as cancer.