Detection and quantification of nucleic acid sequences of microbial targets using electrochemical biosensors
A multiplexed electrochemical biosensor platform enables rapid and sensitive detection of antibiotic-resistant pathogens and genes using electrochemical impedance spectroscopy, addressing the limitations of existing methods by providing efficient and cost-effective monitoring.
Patent Information
- Application Number
- PCT/IL2025/051173
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-30
- Filing Date
- 2025-12-30
- Publication Date
- 2026-07-09
AI Technical Summary
Current methods for detecting and quantifying antibiotic-resistant pathogens and genes are time-consuming, expensive, and require specialized facilities, making them unsuitable for routine monitoring of wastewater effluents.
Development of a multiplexed electrochemical biosensor platform with nucleic acid-based target-binding moieties that uses electrochemical impedance spectroscopy to detect and quantify specific nucleic acid sequences, allowing for rapid on-site identification and quantification of bacterial pathogens and antibiotic resistance genes.
The biosensor provides high sensitivity and specificity, achieving detection limits as low as 1 nM with linear response across a wide range of concentrations, and can reliably detect targets in complex environmental matrices, facilitating rapid and cost-effective monitoring.
Smart Images

Figure IL2025051173_09072026_PF_FP_ABST
Abstract
Description
[0001] DETECTION AND QUANTIFICATION OF NUCLEIC ACID SEQUENCES OF MICROBIAL TARGETS USING ELECTROCHEMICAL BIOSENSORS TECHNOLOGICAL FIELD
[0002] The present disclosure relates to electrochemical biosensors for sensing target molecules. More specifically, the present disclosure provides systems and methods for determining the presence and / or quantity of pathogens and pathogenic and antibiotic resistance genes in samples, specifically environmental samples, using electrochemical biosensors.
[0003] BACKGROUND ART
[0004] References considered to be relevant as background to the presently disclosed subject matter are listed below:
[0005] 1. Coque, T.M., Canton, R., Perez-Cobas, A.E., Femandez-de-Bobadilla, M.D. and Baquero, F., 2023. Antimicrobial resistance in the global health network: known unknowns and challenges for efficient responses in the 21st century. Microorganisms, 11(4), p.1050.
[0006] 2. Sassolas, A.; Leca-Bouvier, B. D.; Blum, L. J., DNA biosensors and microarrays. Chem Rev 2008, 70S (1), 109-139.
[0007] 3. Xiao, Y.; Lai, R. Y.; Plaxco, K. W., Preparation of electrode-immobilized, redox -modified oligonucleotides for electrochemical DNA and aptamer-based sensing. Nat Protoc 2007, 2 (11), 2875-2880.
[0008] 4. Fan, C. H.; Plaxco, K. W .; Heeger, A. J., Electrochemical interrogation of conformational changes as a reagentless method for the sequence-specific detection of DNA. P Natl Acad Set USA 2003, 100 (16), 9134-9137.
[0009] 5. Hashem, A.; Hossain, M. A. M.; Marlinda, A. R.; Al Mamun, M.; Sagadevan, S.; Shahnavaz, Z.; Simarani, K.; Johan, M. R., Nucleic acid-based electrochemical biosensors for rapid clinical diagnosis: Advances, challenges, and opportunities. Crit Rev Cl Lab Set 2022, 59 (3), 156-177.
[0010] Acknowledgement of the above references herein is not to be inferred as meaning that these are in any way relevant to the patentability of the presently disclosed subject matter.BACKGROUND
[0011] Electrochemical (EC) biosensors facilitate direct electronic transduction of specific molecular binding into electrons, making them highly specific and ultra-sensitive with a broad dynamic range. Electrochemical Impedance Spectroscopy (ElS)-based biosensors are particularly suited for rapid on-site applications since they are label-free, require little to no sample preparation, and can be easily multiplexed. The detection mechanism is based on the effect of biomolecular binding on the impedance of the working electrode. In faradic EIS, biomolecular interactions, including antibody-antigen, enzyme-substrate or DNA duplex formation, affect the kinetics of electron transfer between a redox probe and the electrode surface, resulting in changes to the charge transfer resistance (RCT) component of the impedance. The RCT depicts the opposition experienced to electron movement through the interface between the bulk and the circuit, and it increases in the presence of bound biomolecules. ElS-based (impedimetric) biosensors have been used for the detection of metabolic disorder biomarkers, pathogenic bacteria, and viral infections.
[0012] Coque, T.M. et al [1] is a review related to controlling AMR in human health. Sassolas, A. et al [2] discusses DNA biosensors and DNA microarrays. Xiao, Y. [3] discusses about electrochemical DNA (E-DNA) andE-AB (electrochemical, aptamer-based) sensors. Fan, C. H.; [4] also discusses electrochemical DNA (E-DNA) and Hashem, A. [5] is a review describing the advances, challenges, and prospects of NA-based electrochemical biosensors for clinical diagnosis.
[0013] GENERAL DESCRIPTION
[0014] A first aspect of the present disclosure relates to a biosensor chip system usable for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample. The disclosed system comprising the following components: a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same. The at least one working electrode is connected to at least one nucleic acid-based target-binding and / or affinity moiety. The binding moiety is capable of specifically recognizing and binding the at least one target nucleic acid sequence. The plurality of electrodes is configured for at least one electrical analysis of said sample.
[0015] Another aspect of the present disclosure relates to a sample inspection system, also disclosed herein as an array, comprising: (i) a plurality of biosensor chips, wherein each biosensor chip comprising at least one working electrode and at least one reference electrode, or a plurality of anychip device or system comprising the same. The at least one working electrode is connected to at least one nucleic acid-based target-binding and / or affinity moiety, capable of specifically recognizing and binding at least one target nucleic acid sequence of at least one microbial target. The plurality of electrodes is configured for at least one electrical analysis of the sample. In some optional embodiments, the sample inspection system (e.g., array) may further comprise: (ii), a channel arrangement adapted to pass fluid sample in a plurality of channels. The fluid or fluidized sample is in contact with plurality of electrodes of the plurality of biosensor chips.
[0016] Another aspect of the present disclosure relates to a method for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample. The method comprising the following steps: In step (a), contacting the at least one sample with a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same. The at least one working electrode is connected to at least one nucleic acid-based target-binding and / or affinity moiety. The nucleic acid-based target binding (or affinity) moiety specifically recognizes and binds the at least one target nucleic acid sequence. In step (b), applying one or more electrical measurements between at least one working electrode and the at least one reference electrode. The one or more electrical measurements may include determining electrochemical impedance spectroscopy (EIS), voltammetry and / or amperometry measurements or other electrical measurements between the electrodes. For example, EIS measurements comprise applying one or more selected voltage signals between the at least one working electrode and the at least one reference electrode, determining electrical current between the electrodes in response to the one or more voltage signals. Step (c) of the disclosed methods involve determining relations between electrical current response and voltage signal for the one or more signal frequencies and determining electrical impedance for different frequencies based on the relations between current and voltage for different frequencies. The impedance variation is indicative of presence and / or quantity of the at least one target nucleic acid sequence in the sample. In examples utilizing voltammetry and / or amperometry measurements, variation in current and / or voltage transmission between the electrodes is indicative of presence and / or quantity of the at least one target nucleic acid sequence in the sample.
[0017] Another aspect of the present disclosure relates to a method for monitoring and evaluating quality and / or pathogenic exposure potential of an environmental water source, by continuous electricalanalysis of at least one sample of the environmental water source. The method comprising the following steps: In step (a), contacting the at least one sample with a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same. The at least one working electrode is connected to at least one nucleic acid-based target-binding (or affinity) moiety, wherein said contacting is via continuous flow of said sample through said plurality of electrodes. The nucleic acid-based target-binding (or affinity) moiety specifically recognizes and binds at least one target nucleic acid sequence of at least one microbial target in the sample. In step (b), applying one or more selected electrical and / or electrochemical measurements between the at least one working electrode and the at least one reference electrode. The one or more selected electrical and / or electrochemical measurements may include EIS comprising applying voltage signal between the said at least one working electrode and the at least one reference electrode, determining electrical current between the electrodes in response to said voltage signals for a selected number of one or more signal frequencies. Step (c) involves determining relations between electrical current response and voltage signal for the one or more signal frequencies and determining electrical impedance between the at least one working electrode and the at least one counter electrode. The impedance variation being is of presence and / or quantity of the at least one pathogenic nucleic acid sequence of at least one pathogen, and optionally, at least one pathogen in the sample. In examples utilizing voltammetry and / or amperometry measurements, variation in current and / or voltage transmission between the electrodes is indicative of presence and / or quantity of at least one nucleic acid sequence in the sample. Generally, in some embodiments, the method comprises repeating the method steps for at least two temporally separated samples obtained from the environmental water source.
[0018] Another aspect of the present disclosure relates to a kit comprising: a biosensor chip system usable for identifying and / or quantifying and / or monitoring at least one nucleic acid sequence of at least one microbial target in a sample. The system comprises a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same. The at least one working electrode is connected to at least one nucleic acidbased target-binding (or affinity) moiety. The plurality of electrodes is configured for electrical analysis of said sample.
[0019] In some embodiments, the kit further comprises at least one of the following: (i) reagents suitable for enrichment of the microbial target in the sample, (ii) a dissociation module whereby voltagebiases that are suitable to drive a nucleic acid melting reaction are employed by the system, and (iii) a temperature-control module.
[0020] The dissociation module may be configured for dissociating the nucleic acids from the respective affinity molecules. The dissociation module may be associated with temperature, pH, salt concentration, or other chemical techniques for dissociating the interaction between the nucleic acids and affinity molecules.
[0021] These and other aspects of the present disclosure will become apparent as the description proceeds.
[0022] BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to better understand the subject matter that is disclosed herein and to exemplify how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:
[0024] Figure 1A-1E. Fabrication, functionalization, and EIS measurements of a DNA biochip Fig. 1A. an electrochemical multichip prototype comprising 12 individual electrochemical cells with microelectrode size d=150 pM. Each microelectrode was functionalized by microarray printing of a thiol-modified single-stranded DNA oligomer or alternatively, an amine-terminated single-stranded DNA oligomer was covalently immobilized to a self-assembled-modified gold electrode surface. The covalently bound DNA probes withstand rigorous rinsing, as confirmed by fluorescently labeled DNA probes (bottom) Bar=40 pM.
[0025] Fig. IB. An illustration of an EC chip equipped with microelectrodes: gold working and counter electrodes, and silver-silver chloride (Ag / AgCl) quasi-reference electrode and thiol-modified ssDNA oligomer probe immobilized on the gold working electrodes via a gold-thiolate chemical bond.
[0026] Fig. 1C. Significant increase in the RCT is observed following ssDNA probe immobilization whereas little to no change is observed in a control that included a non-thiolated probe, highlighting the efficiency of covalent immobilization vs non-specific adsorption.
[0027] Fig. ID. Different probe concentrations facilitate a dose-dependent increase in the measured RCT due to an increasing electrode surface coverage. Non-specifically adsorbed ssDNA probe increases the RCT by ~ 20%, similar to using a low concentration (0.2 pM) of thiolated probe. Changes in RCT were calculated as the average percent change from a bare electrode. Error bars represent the standard deviation of 6-9 separate measurements.Fig. IE. A further increase in the measured RCT is observed after incubation with a complementary ssDNA oligomer target indicating that DNA hybridization and duplex formation affect the impedimetric response and can be detected by EIS.
[0028] The ssDNA target is a selected antibacterial -resistance gene, blaCTX-M, encoding for extended-spectrum beta-lactamase (ESBL): 5’-GCA TGG CTC GGC TGC AAT T-3’, as denoted by SEQ ID NO: 1. The probe was a 20-mer (bp) oligonucleotide that is complementary to the target: 5’-ThioMC3-D / AA TTG CAG CCG AGC CAT GC-3’, as denoted by SEQ ID NO: 2.
[0029] Figure 2A-2B. Functionalization of miniaturized electrochemical EIS biosensor with aminated DNA probe
[0030] Fig. 2A. Schematic representation of a miniaturized electrochemical EIS biosensor. An EC chip is micro-fabricated on Si / SiCh and the working electrodes are modified with a self-assembled monolayer (SAM) and functionalized with aminated DNA probe using glutaraldehyde crosslinker. The impedimetric biochip is loaded with target DNA samples, hybridization is detected and quantified by an EIS measurement.
[0031] Fig. 2B. Graphical representation of glutaraldehyde crosslinking reaction with two amine functional groups that tend to form double Schiff s bases between aminated oligo probe and SAM-modified electrode surface.
[0032] Figure 3A-3E. EIS detection of AMR blaCTX-M gene sequence.
[0033] Fig 3A. Cyclic voltammogram of unmodified EC chip (black), SAM modified (red), probe DNA functionalized EC chip (blue), target DNA hybridized (pink) and EC biochip with non-target DNA (green).
[0034] Fig 3B. EIS Nyquist plot of unmodified EC chip (black), SAM modified (red), probe DNA functionalized EC chip (blue), target DNA hybridized (pink) and EC biochip with non-target DNA (green).
[0035] Fig 3C. Bar graph of RCT (ohm) calculated from Nyquist plot after fitting with Randles circuit.
[0036] Fig 3D. Bar graph of the percentage of RCT from EC bio chip hybridized with target DNA and non-target DNA. Error bar indicates ± SD.
[0037] Fig 3E. A calibration curve was obtained for different concentrations of target DNA.
[0038] Figure 4A-4D. Fluorescence analysis of FAM-probe DNA functionalized EC chip and hybridization with target DNA-Cy5
[0039] Fig. 4A. The optical image shows the working electrode in bright field.
[0040] Fig. 4B. Green color fluorescence emission from FAM tagged probe DNA functionalized and SAM-modified EC chip.Fig. 4C. Red color fluorescence emission from Cy5-tagged target DNA hybridized with probe DNA EC chip.
[0041] Fig. 4D. Overlay image of both FAM and Cy5 fluorescence emissions from EC chip.
[0042] Figure 5A-5B. Schematic illustration of the proposed biosensor platform
[0043] Fig. 5A. Schematic representation of the biosensor. The scheme shows a chip (70) containing an array of miniaturized EC cells (Ci) connected to a control unit (60). Each EC cell can be interrogated as an individual channel (denoted: Ci, C^-Cri) and comprises three electrodes: reference (er), working (ew), and counter (ec) that are connected via respective interconnects (13 / 13w, J 3c) to the control unit (60). The chip is assembled into a sample collector package (12) usable for introducing a sample into the biosensor chip device. The control unit 60 may also be associated with a dissociation module 14 configured to be in contact with the sample collector 12 and / or chamber 13.
[0044] Fig. 5B. A miniaturized electrochemical chip equipped with a microelectrochemical cell array fabricated on a solid substrate. The chip also contains contact pads to interface with a USB-stick potentiostat (left). The microelectrochemical cell array is segmented into target-specific ‘biosensing regions’ by covalently immobilizing an ssDNA oligomer probe that is complementary to selected taxonomic or antibiotic resistance gene (ARG) biomarkers. A brief incubation with a sample that contains the specific target, facilitates a measurable increase in the charge transfer resistance component of the impedance RCT) due to duplex formation on the surface of the micro working electrode. The increase in ?cris dose-dependent thus allowing quantitative detection. The microelectrodes are individually addressable and multiple channels can be interrogated simultaneously. The potentiostat circuitry and biochip microelectrodes are amenable for miniaturization and compatible with CMOS-integrating technologies potentially allowing for a massively multiplexed detection, low power consumption and cloud analysis via smartphone-enabled data acquisition.
[0045] Figure 6A-6D. A multiplexed electrochemical chip design and platform for high throughput measurements
[0046] Fig. 6A-6B. A computer-assisted design showing a multiplexed chip containing 48 individual micro-electrochemical cells with contact pads commensurate with a commercially available socket and mounted on a printed circuit board shown in (Fig. 6B).
[0047] Fig. 6C. A Teflon package is used to combine the different components and also accommodates a microfluidic setup.
[0048] Fig. 6D. The design illustration of the different components.Figure 7A-7B. Fabrication of multiplexed electrochemical chips
[0049] Fig. 7A. Multiplexed EC chip design with a total of 8 chips; each chip has 48 EC cells. Fig. 7B.
[0050] Fabricated Multiplexed EC chips with insulation layer; each chip has 48 EC cells, and each cell contains 3 electrodes (WE - 250 pm, CE and RE). Following fabrication (and surface characterization of the deposited electrodes), the reference electrodes are electroplated generating an On-chip Ag / AgCl reference electrodes.
[0051] Figure 8. EIS detection of DNA hybridization
[0052] A dose-dependent increase in the impedimetric Rcr response is observed following incubation with samples containing increasing concentrations of a complementary ssDNA target due to the on-chip hybridization and duplex formation.
[0053] Figure 9A-9D. EC Biosensor prototype
[0054] Fig 9A. A full silicon wafer containing 8 multiplexed chips, each with 48 EC cells.
[0055] Fig 9B. A commercial chip carrier placed on top of the chip for measurements.
[0056] Fig 9C. A PDMS molds designed in a two-well configuration and microfluidic channel to hold the measurement solution on the multiplexed chip.
[0057] Fig 9D. The multiplexed EC chip measurement platform. A single EC cell is marked with a rectangle on the contact box and the connection point to the potentiostat. A red arrow indicates the location of the chip.
[0058] Figure 10. Schematic illustration of the functional mechanism of the EC sensor
[0059] The pre-cleaned surface of gold working microelectrodes on each electrochemical cell on the chip (‘GE-chip’) is functionalized with a nucleic acid probes - gene-specific, thiol-modified oligomer probes (‘oligo probe -SEF) by using Au-S (gold thiolate) chemistry ('GE probe’). Unbound surface areas are blocked with 6-mercaptohexanol (6-MCH) to minimize nonspecific adsorption, and the chips are then incubated at 37 °C for 2 hours to allow self-assembly of the thiolated DNA onto the gold surface ('GE-probe-blocking’). The probe-functionalized chip (‘GE-Probe-blocking’) can then be exposed to the target DNA, for example, the P-lactamase gene (blaCTX-M), an antibiotic resistance gene encoding for the enzyme extended-spectrum-b-lactamase ('ESBL CTX-M target DNA’). Following exposure, the immobilized probes hybridize with complementary CTX-M target DNA sequences.
[0060] Figure 11A-11C. EIS detection of ESBL CTXM target DNA sequence (19mer) in different concentrations (InM / mL to 50 M / mL)
[0061] Fig 11 A. EIS- Nyquist plot for bare chip, probe and 6-MCH modified biochip and it hybridized with different concentrations of target DNA with negative control (NC).Fig 11B. their corresponding measured RCT in Ohms increases.
[0062] Fig 11C Calibration curve with linear fit for the percent changes in the RCT against concentrations of blaCTX-M target DNA. Error bar represents SD (±), n=12.
[0063] Figure 12A-12D. EIS detection of blaCTX-M target DNA (lOObp) in different concentrations (1- 100 nM / mL) using a reverse probe (blaCTX-M R)
[0064] Fig 12A. schematic representation of oligo probes positions in blaCTX-M target DNA. Fig 12B.
[0065] Nyquist plot for bare chip, probe and 6-MCH modified biochip and it hybridized with different concentrations of a longer fragment target DNA with negative control (NC).
[0066] Fig 12C bar graph represent their corresponding measured RCT (Ohms) increases with cone, of target DNA.
[0067] Fig 12D. Calibration curve with linear fit for the percent changes in the RCT against concentrations of blaCTXM target DNA. Error bar represents SD (±), n=12.
[0068] Figure 13A-13C. EIS detection of blaCTX-M target DNA (lOObp) in different concentrations (1- 100 nM / mL) using forward probe (CTX-M F)
[0069] Fig 13A. Nyquist plot for bare chip, probe and 6-MCH modified biochip and it hybridized with different concentrations of a longer fragment target DNA with negative control (NC).
[0070] Fig 13B. bar graph represents their corresponding measured RCT (Ohms) increases with cone, of target DNA.
[0071] Fig 13C Calibration curve with linear fit for the percent changes in the RCT against concentrations of blaCTXM target DNA. Error bar represents SEM (±), n=9. *mer = base pair (bp).
[0072] Figure 14A-14C. validation of EIS biosensor for the detection of different blaCTX-M target 19mer and lOOmer (100 nM / mL) spiked in SWW along with control SWW
[0073] Fig 14A. Nyquist plot for bare chip, probe and 6-MCH modified biochip and it hybridized with different length of target DNA spiked SWW with control.
[0074] Fig 14B. bar graph represents their corresponding measured RCT (Ohms) against target DNA SWW samples.
[0075] Fig 14C The percentage changes in the RCT against different length of blaCTXM target DNA spiked in SWW in EIS detection. Error bar represents SD (±), n=12. t-test, two-tailed *P < 0.0332. **mer = base pair (bp).
[0076] Figure 15A-15B. cross validation of EIS biosensor
[0077] Fig 15A. for the detection of ARGs (ESBL CTXM); and Fig 15B. taxonomic indicators (E.coli uidA) using their forward (FP) and reverse probes (RP) and their target sequences (FT and RT).Error bars represent the standard error of the mean (SEM, n = 6). Statistical significance was determined using a two-tailed t-test < 0.0001; ***p < 0.0002).
[0078] Figure 16A-16C. EIS response of target DNA hybridization kinetics
[0079] Fig 16A. Nyquist plots showing EIS responses for bare, blaCTX-M F-5'-SH probe, and 6MCH modified EC biochips, following hybridization with target DNA (19mer and lOOmer) over various incubation periods.
[0080] Fig 16B. Percent change in RCT ( RCT %) as a function of hybridization time for 19mer target DNA hybridization.
[0081] Fig 16C. Percent change in RCT (JRCT° / O) as a function of hybridization time for and lOOmer target DNA hybridization.
[0082] Error bars represent standard deviation (± SD, n = 3).
[0083] Figure 17. DNA concentration from E. coli samples using different extraction protocols DNA concentration ng / pl was determined with Qubit Fluorometric Quantification. (n=5) Figure 18. CTXM quantitation using different DNA extraction protocols
[0084] Effect of short-term incubation in copiotrophic medium (i.e. LB) on abundance of bacteria and antibiotic resistance genes in wastewater samples
[0085] Quantitative PCR (qPCR) was conducted to quantify total bacterial abundance using universal primers that target the 16S rRNA gene (16S); specific primers for E. coli that target the [3-glucuronidase gene (uidA); and primers that target the [3-lactamase encoding genes blaCTX-Ml and blaTEM, respectively. The significant increase in the relative abundance of E. coli and [3-lactamase encoding genes after three and six hours of incubation (albeit the mild increase in total bacterial abundance) underlines the capacity of short-term incubations to stimulate clinically associated bacteria and antibiotic resistance genes.
[0086] Figure 19. Effect of incubation on bacterial community composition
[0087] Bacterial community composition (family level) of wastewater sample following incubation for 0, 3 and 6 hours in Luria Broth (LB) medium at 44 °C. Reads were generated through high throughput sequencing of 16S rRNA gene amplicons and analyzed using the Qiime 2 bioinformatics package.
[0088] Figure 20. Effect of incubation on abundance of bacteria and antibiotic resistance genes using culture-independent quantitative PCR
[0089] qPCR analysis showing the abundance of total bacteria (16S rRNA gene), E. coli (uidA) and two ARGs (blaCTXMl and blaTEM) in wastewater samples following incubation for 0, 3 and 6 hours.Figure 21. Effect of incubation on abundance of total and antibiotic-resistant E. coli using cultivation assays
[0090] Abundance of total and antibiotic-resistant E. coli after incubation for 0, 3, 6, 9, 12, and 24 hours.
[0091] DETAILED DESCRIPTION OF EMBODIMENTS
[0092] Bacterial pathogens are a major threat to public health, and it is estimated that over 50% of global infection-related deaths are caused by five species: Staphylococcus aureus, Escherichia coli, Streptococcus pneumoniae, Klebsiella pneumoniae, and Pseudomonas aeruginosa (Ikuta, et al. The Lancet 400, no. 10369 (2022): 2221-2248). The emergence of antimicrobial resistance (AMR, which includes multidrug- and pan-resistance) in highly pathogenic strains has resulted in untreatable infections (De Oliveira, D.M., et al. 2020. Clinical microbiology reviews, 33(3), pp.10- 1128) leading the World Health Organization to define AMR as one of the greatest public health threats facing humanity (World Health Organization. Global Antimicrobial Resistance and Use Surveillance System (GLASS) Report: 2021. Global Report 2021, 167). While pathogens and AMR are traditionally associated with clinical environments, there is growing understanding that the global scope of antibiotic resistance is also strongly linked to food, animals and terrestrial and aquatic environments (Larsson, D.G. and Flach, C.F., 2022. Nature Reviews Microbiology, 20(5), pp.257-269).
[0093] Antibiotic resistance genes (ARGs) can mobilize between bacteria and are therefore characterized as emerging contaminants, leading to the opinion that ARGs should be monitored along with fecal pathogens as food (European Food Safety Authority (EFSA), Aerts, M., et al. 2019. EFSA journal, 77(6), p.e05709) and water (Liguori, K., et al. 2022. Environmental science & technology, 56(13), pp.9149-9160) quality indicators. There are already calls to include specific antibiotic-resistant bacteria (i.e. Extended spectrum beta-lactamase (ESBL)-producing E. coli) and / or ARGs (i.e. blaCTX-M) in national and global AMR surveillance programs (WHO, 2021; Ishii, 2020. Current opinion in environmental science & health, 16, pp.47-53), and it is likely that such criteria will be adopted by regulatory agencies in the coming years. When considering AMR, it is important to determine the capacity of certain bacteria to harbor specific genes conferring resistance to specific antibiotics (Werner, C., et al. 2021. Frontiers in Applied Mathematics and Statistics, 7, p.669391, and the increased risk of mortality and morbidity for a selected pathogen harboring specific ARGs that confer resistance to specific antibiotics (Rello, J., et al. 2019. European Journal of Clinical Microbiology & Infectious Diseases, 38, pp.319-323).Consequently, evaluation of AMR in clinical, food and natural environments require concurrent surveillance of pathogen indicators and associated ARGs that are relevant to the investigated environment. However, cultivation of resistant pathogen indicators (i.e. antibiotic-resistant fecal coliforms) and PCR-based quantification of ARGs are time-consuming, expensive, and require specialized facilities and staff, and are therefore not realistic for routine monitoring of wastewater effluents. Consequentially, within the framework of medical and food surveillance and water quality assessment, it is essential to develop rapid on-line monitoring systems that provide insights into the status of antibiotic-resistant pathogens.
[0094] The present disclosure relates to a nucleic acid-based electrochemical biosensor for the detection and quantification of bacterial pathogen indicators and pathogen-associated antibiotic resistance genes. This sensor can be used for rapid on-site identification and quantification (and eventually for on-line monitoring) of bacterial indicators and associated ARGs in individual or multiplexed configurations. Multiplexed biosensors can be specifically fabricated for diagnosis and surveillance of specific bug-drug combinations that are relevant to clinical, food, and natural environments.
[0095] Still further, the present disclosure presents the development and validation of a multiplexed electrochemical (EC) biosensor platform capable of detecting and quantifying specific nucleic acid sequences with high sensitivity and specificity. The device includes a selected number of biosensor chip cells (e.g., 12, 24, 48, 96, or any selected number of cells), each containing an independent three-electrode system, allowing simultaneous and reproducible electrochemical measurements across multiple targets (Fig. 1, Fig. 7 and Fig.9). The biosensor was functionalized with thiolated DNA probes targeting two distinct regions of the clinically relevant blaCTX-M P-lactamase gene, enabling dual-site hybridization for enhanced specificity (Fig. 10). Using electrochemical impedance spectroscopy (EIS), the inventors demonstrated a clear, concentration-dependent increase in charge transfer resistance (R_CT) upon hybridization with complementary DNA sequences. Calibration experiments with synthetic targets showed a linear response across a wide range of concentrations and a detection limit as low as 1 nM (Fig. 11), confirming the biosensor's high analytical sensitivity.
[0096] Subsequent experiments extended the system’s applicability to longer DNA fragments (100 bp) using both forward and reverse probes (Figs. 12-13). The biosensor maintained its sensitivity and linearity, detecting target DNA down to 1 nM, and thus proved capable of identifying both short and long gene fragments. Validation in synthetic wastewater (Fig. 14) confirmed that the sensor could reliably detect blaCTX-M sequences even in complex environmental matrices, whilecross-reactivity tests against non-specific E. coli uidA targets (Fig. 15) demonstrated excellent sequence specificity. Kinetic analyses (Fig. 16) revealed that hybridization reached saturation within approximately 30 to 35 minutes, indicating rapid detection capability. Finally, optimization of DNA extraction and fragmentation protocols identified probe-tip sonication as the most effective method for producing high-quality, appropriately sized DNA fragments for biosensor analysis (Figs. 17-18). Overall, the results establish this multiplexed EC biosensor as a robust, rapid, and sensitive platform for molecular detection of antibiotic resistance genes in both controlled and environmental samples.
[0097] More specifically, the present disclosure provides a biosensor chip that can operate in either single or multiplexed mode, integrated into a platform that includes pre- and post-processing components for nucleic acid extraction, sample purification and enhancement of signal-to-noise ratio. Figures 5A and 5B schematically illustrate a biosensor chip device (10) configuration for sample analysis according to some embodiments of the present disclosure. The biosensor chip (10) contains an electrochemical cell (G) configured for holding a plurality of electrodes, Ci, C2 etc. including at least one working electrode ewand at least one reference electrode Er. Typically, the plurality of electrodes may also include one or more counter electrode ecas exemplified in the figure. The plurality of electrodes may be of an arrangement of a micro-working electrode array, microelectrochemical cell array, or any other configuration of electrodes and is generally placed within a sensor chamber configured for holding a sample or allowing a sample to flow therethrough. The plurality of electrodes is connected, or connectable, via electrical contacts (13w,13r,13e) to a control unit (60) configured for operating the electrodes for one or more electrochemical measurements.
[0098] The plurality of electrodes may include at least one working electrode (e„), at least one reference electrode (e,-) and may also include one or more counter electrode (ec). The electrodes may be formed on a substrate (13) to simplify alignment and electrical connections. In some embodiments, the electrodes may be made of gold, carbon paste, glassy carbon, platinum, copper, aluminum, Indium tin oxide, or any other metal or metallic alloy, or conjugated carbon, or nanoparticle-modified electrode. -In some embodiments, the chamber may be made of Polytetrafluoroethylene (Teflon) or Acetal homopolymer (Delrin) or polypropylene, or polymethyl methacrylate or polyimide or polyvinylidene fluoride or polystyrene or other thermoplastics or heat-resistant plastic materials. The biosensor chip (10) may generally be a part of a sample measurement system, acting as a first chip device or a second chip device.More specifically, Figure 5 shows the biosensor chip device (10) and, a sample collector (12) usable for introducing a sample into the biosensor chip device (10). The portion of the substrate (13) carrying active end of the electrodes (eir,e,-,et) of the chip device (10) is packaged in a chamber (electrochemical cell G) and electrical contacts of the electrodes are shown (13w,13r,13e) extending from the chamber and connecting the electrodes to a control unit (60). Further, according to some embodiments of the present disclosure, the working electrode ewis connected to, or carrying, one or more nucleic acid-based target-binding (or affinity) moiety, capable of specifically recognizing and binding one or more selected nucleic acid sequences.
[0099] In some embodiments, at least the working electrode (ew) may preferably be formed and / or coated by a layer of gold, to enable biofunctionalization thereof.
[0100] The control unit 60 may include one or more electrical circuits adapted for performing one or more electrochemical measurements through the plurality of electrodes Ci, C2 etc., and may include a processing utility for processing and analyzing the measurement results. The processing utility may include one or more processors, memory and input / output interface, and is configured to perform one or more processing operations and / or apply selected electrical conditions onto the plurality of electrodes Ci, C2 etc., as described herein.
[0101] The electrochemical measurement may include electrochemical impedance spectroscopy (EIS) in which the impedance between selected electrodes is measured for different voltage variation frequencies. In some other embodiments, the electrochemical measurement may include voltammetry, where a varying electrical potential is applied to the working electrode ew, and corresponding current between the working ewand reference erelectrodes is measured with respect to the applied potential. In some further embodiments, the electrochemical measurement may include amperometry measurement, where a current between the electrodes is measured for a fixed selected potential applied thereto.
[0102] In some embodiments, the control unit 60 may also be associated with a dissociation module 14 configured to be in contact with sample collector 12 and / or chamber 13. Dissociation module 14 may be configured to perform one or more dissociation actions for separating between the nucleic acids and the affinity molecules. For example, dissociation module 14 may utilize applying a negative voltage bias on the working electrode versus the reference electrode such that a repulsive electrostatic potential driving a dissociation reaction (i.e., melting) that results in the unbinding of a double-stranded helix. Alternatively, dissociation module 14 may utilize a heater configured to raise the temperature inside the reaction chamber (thermal cycling) allowing for a melting reaction and the regeneration of the nucleic acid-functionalized biochip device. In some furtherembodiments, dissociation module 14 may utilize sonic or ultrasonic excitation of the sample for dissociating the nucleic acid-functionalized biochip device.
[0103] Electrical operation of the electrode arrangement may vary in accordance with the biosensor operation. More specifically, in some embodiments, the biosensor chip device may operate for electrochemical impedance spectroscopy (EIS), i.e., determining impedance between electrodes in different signal frequencies. Detection of impedance of the working electrode for different signal frequencies provides an indication on electrochemical interaction with the electrode or any material bound thereto and provides indication on presence and quantity of selected pathogens interacting with the nucleic acid molecules contacted with the working electrode, used herein as the nucleic acid-based target-binding moiety.
[0104] In some embodiments, the biosensor chip may operate within a chamber suitable for holding fluid sample. In some embodiments, the chamber may be configured as a channel enabling fluid flow therethrough, while at least a portion of the fluid is in contact with the plurality of electrodes. While in contact with the electrodes, certain pathogens or pathogen-derived target nucleic acids may interact with the one or more nucleic acid-based target-binding (or affinity) moiety of the working electrode, altering certain electrical parameters of the working electrode.
[0105] The electrode array (eir,e,-,et) may be connectable to an electronic device through respective contact pads (13w,13r,13c) e.g., extending from the substrate 13, for providing electrical current / voltage and enabling EIS, voltametric, amperometry, and / or other electrical measurements in the sample. For example, operating for EIS, the electronic device is configured to provide voltage signal in selected varying frequencies to determine of impedance between the electrodes. When operating for voltametric measurements, the electronic device is configured to vary voltage in cyclic, generally slow, way and determine current response along the voltage variation range. When operating for amperometry measurements, the electronic device is configured to apply a selected potential between the working and reference electrodes and determine current transmission between the electrodes. The electrode array may be operated using single potential amperometry and / or using pulsed potential amperometry to maintain the affinity moieties on the working electrodes. In some embodiments, contact pads (13w,13r,13c) may extend outside of the chip device (10) enabling insertion of the contact pads end as a ‘dongle-like’ attachment to a selected electronic device for performing measurements. In some configurations, the electronic device may be configured to provide potentiostat measurements, typically acting as a potentiostat device. The electronic device may be connectable / operated by one or more processors and correspondingcomputer readable instructions. For example, in some embodiments, the electronic device may be connectable (using wired or wireless connection) to a hand-held electronic device (e.g., a smartphone) carrying computer readable instructions for performing electrochemical impedance spectroscopy (EIS) measurement using the plurality of electrode (eir,e,-,et) and provides corresponding readouts. The electronic device may also include a user interface enabling presentation of EIS readout, as well as storage and / or network communication ports for storing the readout data and transmitting such data to remote systems for analyzing. The electronic device may also be responsible for data acquisition and storage e.g., using internal storage and / or remote / cloud storage.
[0106] In some embodiments, the biosensor chip may include, or be placed in, a chamber. The chamber may be configured as a volume for holding a fluid sample in which at least one microbial target is to be identified and / or quantified. In some embodiments, the chamber may be a flow chamber, or a channel enabling continuous flow of fluid therethrough. The fluid flow in the channel may be continuously or periodically measured for detecting and / or quantifying one or more selected pathogen and / or pathogen-derived nucleic acid.
[0107] In some embodiments, the biosensor chip may include an incubation container. The incubation container may be configured as a volume for holding a fluid sample in which at least one microbial target is to be enriched prior to identification and / or quantification.
[0108] Further, in some embodiments, the biosensor chip may include a selected number of electrode sets, where each working electrode is connected to at least one nucleic acid-based target-binding (or affinity) moiety, capable of specifically recognizing and binding selected (optionally different) microbial targets. Each set of plurality of electrodes may be placed within a separate chamber or channel, enabling independent measurements of the different microbial targets within a fluid sample. For example, an arrangement of biosensors may be placed within a channel for identifying and / or quantifying selected microbial targets in water pipes, to enable continuous or at least periodic monitoring of the water quality.
[0109] Therefore, in a first aspect, the present disclosure relates to a biosensor chip system usable for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample. The system comprising the following: a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same. The at least one working electrode is connected to at least one nucleic acid-based target-binding (or affinity) moiety. The target-binding moiety iscapable of specifically recognizing and binding the at least one target nucleic acid sequence. The plurality of electrodes is configured for at least one electrical analysis of said sample.
[0110] As mentioned above, the biosensor chip system is useful for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample. The term "usable for" as used herein means that the biosensor chip system can be employed or utilized for a particular application. These applications include identification and / or quantification and / or monitoring of at least one nucleic acid sequence of at least one microbial target in at least one sample. As mentioned above, the biosensor chip system is useful for detecting, identifying, and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample. For purposes of the present disclosure, "Detecting" refers to determining whether a target nucleic acid sequence is present or absent in a sample by generation of a detectable biosensor signal that meets or exceeds a predefined decision threshold relative to one or more controls (for example, a blank, negative control, and / or internal control). Still further, "Identification", in the context of the present disclosure refers to the process of qualitatively recognizing, assigning, or confirming the identity of the at least one target nucleic acid sequence and / or the corresponding microbial target (for example, at the level of species, strain, subtype, serotype, clade, genotype, or variant), based on sequence complementarity, hybridization specificity, probe / primer signature, binding profile, or other distinguishing signal pattern produced by the biosensor chip system. Identification may include differentiation of closely related organisms and / or discrimination between sequence variants differing by one or more nucleotides (for example, single nucleotide polymorphisms), and may be performed on a single target or a multiplex panel of targets. The biosensor chip system may further provide quantification of the target nucleic acid sequence. "Quantifying" refers to determining an amount or concentration of the target nucleic acid sequence in the sample, either as an absolute value (for example, copies per unit volume, mass, or reaction) or a relative value (for example, comparative abundance versus a reference target or baseline), optionally using a calibration curve, standard(s), and / or internal reference(s), and optionally reporting associated performance parameters such as limit of detection (LOD), limit of quantification (LOQ), dynamic range, and measurement uncertainty. In yet some further embodiments, the disclosed biosensor chip system provides monitoring of the target nuclei acid sequences in a sample. "Monitoring" refers to detecting and / or quantifying the target nucleic acid sequence at two or more time points and / or under two or more conditions to determine persistence, emergence, clearance, or changes inabundance or signal over time, including monitoring of treatment response, environmental surveillance, process control, or outbreak tracking.
[0111] In some particular embodiments, the biosensor chip system of the present disclosure provides detection and determination of target nucleic acid sequences of at least one microbial target, thereby, the detection and / or quantification of the microbial target. The term "microbial target" as used herein refers to a target related to at least one microorganism. A "microorganism", or microbe, is an organism of a microscopic size, which may exist in its single-celled form or as a colony of cells. Microorganisms also make up the microbiota found in and on all multicellular organisms. Microorganisms herein refer to bacteria, archaea, fungi, algae, protists, viruses, and bacteriophages. Still further, "Microbiome" or "microbial community" is a community of commensal, symbiotic, and pathogenic microorganisms (such as bacteria, archaea, fungi, viruses, algae, protists, parasite and bacteriophages) that can usually be found living together in a particular environment.
[0112] The "target nucleic acid sequence of the microbial target" refers, in some embodiments, to any target nucleic acid sequence that is specific for the microbial target and / or that is originated from the microbial target. It should be understood that the target nucleic acid sequence is comprised within the microbial target, it may be part of its genome (e.g., chromosomal DNA), or alternatively some external nucleic acid (extrachromosomal DNA, such as plasmid and the like). In yet some further embodiments, the target nucleic acid sequence may be indirectly connected to, associated with, the target microorganism and may thus, reflect its presence and / or amount. In some other embodiments, the target nucleic acid sequence of the microbial target refers to a taxonomic marker (such as the 16S rRNA gene) of a pathogenic microbe or of a virulence gene (a gene encoding a virulent factor) of the microbial target or any part thereof. In some more specific embodiments, a target nucleic acid sequence of a microbial target refers to at least one antibiotic resistance gene as detailed below.
[0113] The at least one target nucleic acid sequence of at least one microbial target is identified, quantified and / or monitored using at least one working electrode which is connected to at least one nucleic acid-based target-binding and / or affinity moiety. A "nucleic acid-based target-binding moiety", also sometimes referred to as a "nucleic acid-based affinity moiety" , is a molecule or molecule fragment comprising polymers of nucleotides that can specifically attach to a target nucleic acid sequence. The target-binding or the affinity moiety is that part of a molecule that is responsible for specifically attaching to another nucleic acid-based molecule. This target-binding moiety is capable of specifically recognizing and binding the at least one nucleic acid sequence."Specifically recognizing and binding" as used herein refers to an affinity moiety which interacts with a nucleic acid of a specific target molecule, while avoiding interactions with other molecules. It should be understood that in some embodiments, the nucleic acid-based target-binding moiety as used herein specifically recognizes and binds the target nucleic acid sequence via sequence complementarity, or at least partial sequence complementarity. As used herein, complementarity' with respect to nucleic acid sequences (the target binding moiety and the target sequence), refers to the degree to which one nucleic acid sequence is capable of forming sequencespecific hydrogen-bonded base pairs with another nucleic acid sequence. Complementarity may be complete (100%), wherein each nucleotide of a first sequence is paired with a corresponding complementary nucleotide of a second sequence, or may be partial, wherein one or more mismatches, insertions, and / or deletions are present, provided that the overall degree of complementarity remains sufficient to permit sequence-specific hybridization between the sequences under defined hybridization conditions. In this context, “sequence-specific hybridization” means preferential binding to the intended target sequence as compared to nontarget sequences. Complementarity is expressly intended to include reverse-complement sequences, such that a sequence is considered complementary to another sequence when it is capable of hybridizing to the antiparallel strand thereof in accordance with Watson-Crick basepairing rules. Thus, reference to a complementary sequence encompasses a sequence that is oriented in the reverse direction relative to the reference sequence and contains complementary nucleobases at corresponding positions.
[0114] Complementarity may be evaluated or determined under stringent, moderately stringent, or low-stringency hybridization conditions, and includes sequences that hybridize to one another under any such conditions. The degree of complementarity required for hybridization may vary depending on the stringency conditions employed, the length of the nucleic acid sequences, and the nucleotide composition thereof.
[0115] Complementarity further encompasses interactions between DNA-DNA, DNA-RNA, and RNA-RNA nucleic acid molecules, and applies equally to single-stranded or double-stranded nucleic acids, as well as to chemically modified nucleic acids, provided that the modified nucleic acids retain the ability to engage in sequence-specific base pairing.
[0116] In certain embodiments, complementarity may be expressed as a percentage of nucleotide positions within a defined alignment that are complementary between two sequences. By way of example, complementary sequences may exhibit at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementarity. In some embodiments, thecomplementarity is within a range of 50-100%, 55-100%, 60-100%, 65-100%, 70-100%, 75-100%, 80-100%, 85-100%, 90-100%, or 95-100%. In other embodiments, the complementarity is within a range of 50-90%, 55-95%, 60-95%, 65-95%, 70-95%, 75-95%, or 80-95%. Each such percentage and range is intended to be explicitly disclosed and independently combinable with any embodiment described herein, provided that the sequences retain the ability to hybridize in a sequence-specific manner.
[0117] The term nucleic acid , nucleic acid sequence”, or "polynucleotide" and “nucleic acid molecule” refers to polymers of nucleotides, and includes but is not limited to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), DNA / RNA hybrids including polynucleotide chains of regularly and / or irregularly alternating deoxyribosyl moieties and ribosyl moieties (i.e., wherein alternate nucleotide units have an —OH, then and — H, then an —OH, then an — H, and so on at the 2' position of a sugar moiety), and modifications of these kinds of polynucleotides, wherein the attachment of various entities or moieties to the nucleotide units at any position are included. The terms should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides. Preparation of nucleic acids is well known in the art. It should be appreciated that the invention may further refer to polyribonucleotide. The term "polyribonucleotide" refers to a polynucleotide comprising two or more modified or unmodified ribonucleotides and / or their analogs. The term "polyribonucleotide" is used interchangeably with the term "oligoribonucleotide”. Still further, in some embodiments, the nucleic acid sequence(s) or molecule(s) of the target recognized by the affinity moiety may be referred to as "polynucleotide(s)", "oligonucleotide(s)", and / or "nucleic acid(s)". As used herein, a "polynucleotide" comprises two or more nucleotides and may include DNA, RNA, and / or nucleic acid analogs, and may be single-stranded or double-stranded. Polynucleotides may be described by their length, for example as an "n-mer" (for example, a 19-mer) and / or, where applicable, by base pairs ("bp") (for example, a polynucleotide that is 19 bp in length), and the like.
[0118] As mentioned above, the biosensor chip system comprises a plurality of electrodes. In some embodiments, the plurality of electrodes is located within a channel enabling flow of a sample therethrough, wherein the sample is a fluid or fluidized sample. The fluid or fluidized sample is in contact with said plurality of electrodes when flowing through the channel. The term "fluid sample" refers to a collection of a substance that flows freely, taking the shape of its container. These typically include liquids and gases, such as water, urine, blood, air and natural gases. Theterm "fluidized sample" refers to a solid material that has been transformed into a fluid-like state through a specific process.
[0119] In some other embodiments, the plurality of electrodes in the disclosed biosensor chip system, is connectable to an incubation container. The "incubation container" refers to a vessel or environment designed to maintain specific conditions necessary to facilitate proliferation and / or expansion of the microbial target. These conditions may include, for example, a specified microbial medium, controlled temperature, specified period of incubation time, humidity, pH, and oxygen levels, suitable for this purpose.
[0120] In some further embodiments, the plurality of electrodes is connectable to a detection circuit adapted for performing at least one electrical analysis through the plurality of electrodes. An "electrical analysis" as used herein refers to the process of applying selected conditions to an electrical circuit, studying and evaluating electrical parameters of the circuits in response to the selected conditions. Typically, in electrical analysis, selected mathematical principles and calculations may be used for determining the electrical parameters such as resistance and impedance based on measured and applied parameters such as voltage and current.
[0121] In some embodiments, the microbial target relevant to the systems, methods and kit of the present disclosure, comprises at least one microbial pathogen. A "microbial pathogen" as used herein refers to a microbial entity which causes a disease in a human subject, or any other organism including but not limited to mammal, rodent, bird, fish, reptile, insect or plant, who does not have a compromised immune system.
[0122] In some embodiments, the microbial target comprises at least one of bacteria, archaea, fungi, algae, protists, viruses, and bacteriophages. In some specific embodiments, the microbial target comprises bacteria. In yet some more specific embodiments, the bacteria may be Multiple Drug Resistant (MDR) bacteria. An MDR bacterium is defined herein as a bacterium resistant to at least one antimicrobial drug in three or more antimicrobial categories; or Pandrug -resistant (PDR) where bacteria are not susceptible to any clinically available drug.
[0123] In some embodiments, the target nucleic acid sequence of the microbial target relevant to the systems, methods and kit of the present disclosure, comprises at least one antibiotic resistance gene and / or at least one virulence gene (a gene encoding at least one virulent factor).
[0124] In some embodiments, the target nucleic acid sequence of the microbial target comprises at least one antibiotic resistance gene.
[0125] "Antimicrobial Resistance (AMR)" is a phenomenon in which microbial targets such as bacteria, viruses, fungi and parasites no longer respond to antimicrobial medicines. As a result of drugresistance, antibiotics and other antimicrobial medicines become ineffective and infections become difficult or impossible to treat, increasing the risk of disease spread, severe illness, disability and death. Antibiotic resistance is defined as the ability of microbial targets to resist the effects of antibiotics. Resistance is frequently associated with antibiotic resistance genes (ARGs). The term "Antibiotic resistance genes (ARGs)", as used herein, refers to genes that confer resistance to antibiotics, for example by coding for enzymes which destroy the antibiotic compound, by coding for surface proteins, also denoted herein as efflux pumps, which prevent the entrance of an antibiotic compound to the microorganism, actively exports it, or by being a mutated form of the antibiotic's target thereby preventing its antibiotic function. ARGs can either be intrinsic to specific bacteria or be transferred to other bacteria through a process known as horizontal gene transfer (HGT). A major driver of gene transfer among bacteria is conjugation where circular pieces of DNA coined plasmids are transferred from one bacterium to the other. Antibiotic resistance genes carried by a variety of bacteria are known in the art and the sequences of antibiotic resistance genes in any particular bacteria can be determined if desired. However, it should be noted that the antibiotic resistance gene (ARGs) are constantly being discovered. Therefore, the term antibiotic resistance genes (or ARGs) as used herein encompasses both known and emerging ARGs.
[0126] In some specific embodiments, the resistance gene confers resistance to a narrow-spectrum P-lactam antibiotic of the penicillin class of antibiotics. In other embodiments, the resistance gene confers resistance to methicillin (e.g., methicillin or oxacillin), or flucloxacillin, or dicloxacillin, or some or all of these antibiotics. In some embodiments, the system of the disclosure is suitable for identification, quantification and / or monitoring of antibiotic-resistant genes in what has colloquially become known as methicillin-resistant S. aureus (MRS A) which in practice refers to strains of S. aureus that are insensitive or have reduced sensitivity to most or all penicillins. In other embodiments, the system is suitable for detecting vancomycin resistance in vancomycin resistant S. aureus (VRSA). In certain embodiments, vancomycin resistant S. aureus may also be resistant to at least one of, linezolid (ZYVOX™), daptomycin (CUBICIN ™), and quinupri stin / dalfopri stin (S YERCID™) .
[0127] Additional antibiotic resistant genes include but are not limited to fosfomycin resistance gene fosB, tetracycline resistance gene tetM, kanamycin nucleotidyltransferase aadD, bifunctional aminoglycoside modifying enzyme genes aacA-aphD, chloramphenicol acetyltransferase cat, mupirocin-resi stance gene ileS2, vancomycin resistance genes vanX, vanR, vanH, vraE, vraD,methicillin resistance factor femA, fmtA, mecl, streptomycin adenylyltransferase spcl, spc2, anti, ant2, pectinomycin adenyltransferase spd, ant9, aadA2, and any other resistance gene.
[0128] In some specific embodiments, the virulence gene may be a gene encoding any gene conferring resistance to any P-lactam antibiotic compound. In more specific embodiments, such genes may encode at least one P -lactamase. As used herein, the term “P-lactamase” denotes a protein capable of catalyzing cleavage of a P-lactamase substrate such as a P-lactam containing molecule (such as a P -lactam antibiotic) or derivative thereof.
[0129] P-lactamases are organized into four molecular classes (A, B, C and D) based on their amino acid sequences. Class A enzymes have a molecular weight of about 29 kDa and preferentially hydrolyze penicillins. Examples of class A enzymes include RTEM and the P-lactamase of Staphylococcus aureus. Class B enzymes include metalloenzymes that have a broader substrate profile than the other classes of P-lactamases. Class C enzymes have molecular weights of approximately 39 kDa and include the chromosomal cephalosporinases of gram-negative bacteria, which are responsible for the resistance of gram-negative bacteria to a variety of both traditional and newly designed antibiotics. In addition, class C enzymes also include the lactamase of P99 Enterobacter cloacae, which is responsible for making this Enterobacter species one of the most widely spread bacterial agents in United States hospitals. The class D enzymes are serine hydrolases, which exhibit a unique substrate profile.
[0130] P-lactamases can also be characterized by their activity against specific P-lactam antibiotics. The P-lactamase encoded by the A / C / IEM gene primarily confers resistance to first and second generation P-lactams. Extended spectrum P-lactamases (predominantly those encoded by / CTX-MI and other Z’ / flcrx-M groups) confers resistance to third generation cephalosporins such as cefotaxime and ceftriaxone. Carbapenemases (fourth generation) are frequently encoded by / NDM, / I / «OXA-4X, bla oA and Z> / OKPC genes. These genes can be found in a variety of ESKAPE pathogens, including E. coll and Klebsiella pneumoniae. ARGs and specifically P-lactamases are constantly emerging and therefore it is likely that the biosensor configurations of the present application will incorporate nucleic acid sequences complementary for genes or part of genes that are currently unknown.
[0131] As noted above, in more specific embodiments, the systems, methods and kit of the invention may be suitable for identification, quantification and / or monitoring of any gene that may confer resistance to any P-lactam antibiotics. The term " P-lactam" or " p lactam antibiotics" as used herein refers to any antibiotic agent which contains a P -lactam ring in its molecular structure.P-lactam antibiotics are a broad group of antibiotics that include different classes such as natural and semi-synthetic penicillins, clavulanic acid, carbapenems, penicillin derivatives (penams), cephalosporins (cephems), cephamycins and monobactams, that is, any antibiotic agent that contains a P-lactam ring in its molecular structure. They are the most widely used group of antibiotics. While not true antibiotics, the P-lactamase inhibitors are often included in this group. P-lactam antibiotics are analogues of D-alanyl-D-alanine the terminal amino acid residues on the precursor NAM / NAG-peptide subunits of the nascent peptidoglycan layer. The structural similarity between P-lactam antibiotics and D-alanyl-D-alanine prevents the final crosslinking (transpeptidation) of the nascent peptidoglycan layer, disrupting cell wall synthesis.
[0132] Under normal circumstances peptidoglycan precursors signal a reorganization of the bacterial cell wall and, as a consequence, trigger the activation of autolytic cell wall hydrolases. Inhibition of cross-linkage by P-lactams causes a build-up of peptidoglycan precursors, which triggers the digestion of existing peptidoglycan by autolytic hydrolases without the production of new peptidoglycan. As a result, the bactericidal action of P-lactam antibiotics is further enhanced. Generally, P-lactams are classified and grouped according to their core ring structures, where each group may be divided to different categories. The term "penam" is used to describe the core skeleton of a member of a penicillin antibiotic, i.e. a P-lactam containing a thiazolidine rings. Penicillins contain a P-lactam ring fused to a 5 -membered ring, where one of the atoms in the ring is sulfur and the ring is fully saturated. Penicillins may include narrow spectrum penicillins, such as benzathine penicillin, benzylpenicillin (penicillin G), phenoxymethylpenicillin (penicillin V), procaine penicillin and oxacillin. Narrow spectrum penicillinase-resistant penicillins include methicillin, dicloxacillin and flucioxacillin. The narrow spectrum P-lactamase-resistant penicillins may include temocillin. The moderate spectrum penicillins include for example, amoxicillin and ampicillin. The broad-spectrum penicillins include the co-amoxiclav (amoxicillin+clavulanic acid). Finally, the penicillin group also includes the extended spectrum penicillins, for example, azlocillin, carbenicillin, ticarcillin, mezlocillin and piperacillin.
[0133] Other members of this class include pivampicillin, hetacillin, bacampicillin, metampicillin, talampicillin, epicillin, carbenicillin, carindacillin, ticarcillin, azlocillin, piperacillin, mezlocillin, mecillinam, pivmecillinam, sulbenicillin, clometocillin, procaine benzylpenicillin, azidocillin, penamecillin, propicillin, pheneticillin, cioxacillin and nafcillin. P-lactams containing pyrrolidine rings are named carbapenams. A carbapenam is a P-lactam compound that is a saturated carbapenem. They exist primarily as biosynthetic intermediates on the way to the carbapenem antibiotics.Carbapenems have a structure that renders them highly resistant to P-lactamases and therefore are considered as the broadest spectrum of P-lactam antibiotics. The carbapenems are structurally very similar to the penicillins, but the sulfur atom in position 1 of the structure has been replaced with a carbon atom, and hence the name of the group, the carbapenems. Carbapenem antibiotics were originally developed from thienamycin, a naturally-derived product of Streptomyces cattleya. The carbapenems group includes: biapenem, doripenem, ertapenem, imipenem, meropenem, panipenem and PZ-601.p-lactams containing 2, 3 -dihydrothiazole rings are named penems. Penems are similar in structure to carbapenems. However, where penems have a sulfur, carbapenems have another carbon. There are no naturally occurring penems; all of them are synthetically made. An example for penems is faropenem.
[0134] P-lactams containing 3, 6-dihydro-2H-l, 3 -thiazine rings are named cephems. Cephems are a subgroup of P-lactam antibiotics and include cephalosporins and cephamycins. The cephalosporins are broad-spectrum, semisynthetic antibiotics, which share a nucleus of 7-aminocephalosporanic acid. First generation cephalosporins, also considered as the moderate spectrum includes cephalexin, cephalothin and cefazolin. Second generation cephalosporins that are considered as having moderate spectrum with anh-Haemophilus activity may include cefaclor, cefuroxime and cefamandole. Second generation cephamycins that exhibit moderate spectrum with anti -anaerobic activity include cefotetan and cefoxitin. Third generation cephalosporins considered as having broad spectrum of activity includes cefotaxime and cefpodoxime.
[0135] Finally, the fourth generation cephalosporins considered as broad spectrum with enhanced activity against Gram positive bacteria and P-lactamase stability include the cefepime and cefpirome. The cephalosporin class may further include: cefadroxil, cefixime, cefprozil, cephalexin, cephalothin, cefuroxime, cefamandole, cefepime and cefpirome.
[0136] Cephamycins are very similar to cephalosporins and are sometimes classified as cephalosporins. Like cephalosporins, cephamycins are based upon the cephem nucleus. Cephamycins were originally produced by Streptomyces, but synthetic ones have been produced as well. Cephamycins possess a methoxy group at the 7-alpha position and include: cefoxitin, cefotetan, cefmetazole and flomoxef.
[0137] P-lactams containing 1, 2, 3, 4-tetrahydropyridine rings are named carbacephems. Carbacephems are synthetically made antibiotics, based on the structure of cephalosporin, a cephem. Carbacephems are similar to cephems but with a carbon substituted for the sulfur. An example of carbacephems is loracarbef.Monobactams are P-lactam compounds wherein the P-lactam ring is alone and not fused to another ring (in contrast to most other P-lactams, which have two rings). They work only against Gramnegative bacteria. Other examples of monobactams are tigemonam, nocardicin A and tabtoxin. P-lactams containing 3, 6-dihydro-2H-l, 3 -oxazine rings are named oxacephems or clavams. Oxacephems are molecules similar to cephems, but with oxygen substituting for the sulfur. Thus, they are also known as oxapenams. An example for oxapenams is clavulanic acid. They are synthetically made compounds and have not been discovered in nature. Other examples of oxacephems include moxalactam and flomoxef.
[0138] Another group of P-lactam antibiotics is the P-lactamase inhibitors, for example, clavulanic acid. Although they exhibit negligible antimicrobial activity, they contain the P-lactam ring. Their sole purpose is to prevent the inactivation of P-lactam antibiotics by binding the P-lactamases, and, as such, they are co-administered with P-lactam antibiotics. P-lactamase inhibitors in clinical use include clavulanic acid and its potassium salt (usually combined with amoxicillin or ticarcillin), sulbactam and tazobactam.
[0139] In yet some other specific embodiments, the systems, methods and kit of the invention may be suitable for identification, quantification and / or monitoring of any gene that may confer resistance to aminoglycosides. More specifically, Aminoglycosides as used herein, are a class of antibiotics derived from natural or semi-synthetic sources, commonly produced by Streptomyces or Micromonospora bacteria. These compounds are characterized by their structure, which consists of amino-modified sugars linked to a central aminocyclitol ring via glycosidic bonds. Aminoglycosides target bacterial protein synthesis by binding irreversibly to the 30S ribosomal subunit. This binding interferes with the initiation complex formation, causes misreading of mRNA, and leads to the production of aberrant proteins. The resulting protein dysfunction ultimately disrupts bacterial cell integrity and leads to cell death, making aminoglycosides bactericidal. Aminoglycosides are particularly effective against aerobic Gram-negative bacteria, including Pseudomonas aeruginosa, Escherichia coli, and Klebsiella species. They have limited activity against Gram-positive bacteria unless combined with cell wall-active agents like betalactams or vancomycin. Known aminoglycosides include Gentamicin, Tobramycin, Amikacin, Streptomycin and Neomycin.
[0140] Resistance mechanisms for aminoglycosides include enzymatic inactivation (via aminoglycosidemodifying enzymes), alteration of the ribosomal binding site, and reduced uptake or increased efflux of the drug. Accordingly, antibiotic resistance genes as used herein may include in some embodiments, any gene encoding enzymes that may participate directly or indirectly inmodification of the aminoglycosides, or any gene encoding any factor that may participate directly or indirectly in the ribosomal recognition.
[0141] In yet some further specific embodiments, the systems, methods and kit of the invention may be suitable for identification, quantification and / or monitoring of any gene that may confer resistance to macrolides. More specifically, Macrolides are a class of antibiotics characterized by a macrocyclic lactone ring structure, with one or more deoxy sugars attached. These compounds are derived from Streptomyces species or produced synthetically and are known for their broadspectrum activity and favorable safety profiles. Macrolides function primarily as bacteriostatic agents, although they can exhibit bactericidal effects at higher concentrations against certain pathogens. Their mechanism of action involves binding to the 50S ribosomal subunit of bacterial ribosomes, specifically at the 23 S rRNA component. This binding inhibits the translocation step of protein synthesis, preventing the elongation of nascent peptide chains. Examples for macrolides include, but are not limited to Erythromycin, Clarithromycin, Azithromycin and Roxithromycin. Resistance mechanisms for macrolides include modifications in the target site, for example by Methylation of 23 S rRNA by erm (erythromycin ribosome methylation) genes, that reduce drug binding. Still further, efflux pumps that are encoded by mef genes, actively expel the drug from bacterial cells, and thus provide resistance. In yet some further embodiments, hydrolysis of the macrolide structure by bacterial esterases or phosphotransferases, is an additional mechanism for resistance. Thus, antibiotic resistance genes as used herein may include in some embodiments, any erm (erythromycin ribosome methylation) gene, that are a family of genes that encode methyltransferase enzymes responsible for conferring resistance to macrolides, as well as lincosamides and streptogramin B antibiotics. Still further, in some embodiments, resistance gene in the context of macrolides further refer to the mef (macrolide efflux), that genes encode efflux pumps that actively transport macrolide antibiotics out of bacterial cells, thereby conferring resistance. These pumps are part of the ATP -binding cassette (ABC) transporters or major facilitator superfamily (MFS) of efflux systems. The mef genes confer resistance primarily to 14-and 15-membered macrolides, such as erythromycin and azithromycin. In yet some further embodiments, genes encoding bacterial esterases or phosphotransferases that hydrolyze the macrolide structure are also referred to herein as antibiotic resistance genes.
[0142] In yet some further embodiments, the systems, methods and kit of the invention may be suitable for identification, quantification and / or monitoring of any gene that may confer resistance to chloramphenicol. Chloramphenicol is a broad-spectrum antibiotic that was originally isolated fromStreptomyces venezuelae and is now produced synthetically. It is effective against a wide range of bacterial pathogens but is used sparingly due to its potential for serious toxicity. Chloramphenicol inhibits bacterial protein synthesis by binding to the 50S ribosomal subunit, specifically the peptidyl transferase center. This prevents the elongation of peptide chains by blocking the transfer of the growing polypeptide to aminoacyl -tRNA. As a result, it halts protein synthesis and exerts a bacteriostatic effect on most bacteria. For some highly susceptible organisms, it can be bactericidal.
[0143] Resistance mechanisms for chloramphenicol include enzymatic inactivation, for example by chloramphenicol acetyltransferase (CAT), which acetylates and inactivates the drug; efflux pumps that actively expel chloramphenicol from bacterial cells, and ribosomal mutations that alter the binding site on the 50S ribosomal subunit, thereby reducing drug binding. Thus, in the context of chloramphenicol, an antibiotic resistance gene includes genes encoding chloramphenicol acetyltransferase (CAT), efflux pumps genes and mutated genes encoding the 50S ribosomal subunit.
[0144] In yet some further specific embodiments, the systems, methods and kit of the invention may be suitable for identification, quantification and / or monitoring of any gene that may confer resistance to tetracyclines. More specifically, tetracyclines are a class of broad-spectrum antibiotics derived from Streptomyces species or synthesized semi-synthetically. They are characterized by their four-ring (tetracyclic) molecular structure and are widely used in treating infections caused by both Gram-positive and Gram-negative bacteria, as well as atypical pathogens. Tetracyclines inhibit bacterial protein synthesis by reversibly binding to the 30S ribosomal subunit, specifically at the A-site of the ribosome. This action blocks the binding of aminoacyl-tRNA to the mRNA-ribosome complex, preventing the addition of amino acids to the growing polypeptide chain. The result is a bacteriostatic effect, halting bacterial growth.
[0145] Examples for tetracyclines include, but are not limited to natural tetracyclines such as, Tetracycline, Chlortetracycline and Oxytetracycline; Semi-synthetic tetracyclines such as Doxycycline and Minocycline, as well as the New-generation tetracyclines, such as tigecycline, Eravacycline and Omadacycline.
[0146] Resistance mechanisms for tetracyclines include efflux pumps, Ribosomal protection proteins (RPPs) and Enzymatic inactivation. Accordingly, antibiotic resistance genes in the context of tetracyclines refer in some embodiments to genes like tetA, that encode efflux pumps actively expel tetracyclines from the cell, and genes like tetM that encode RPPs that displace tetracycline from the ribosome.In yet some further specific embodiments, the systems, methods and kit of the invention may be suitable for identification, quantification and / or monitoring of any gene that may confer resistance to sulfonamides. Sulfonamides, also known as sulfa drugs, are a class of synthetic antimicrobial agents that were among the first effective systemic antibiotics developed. They are structurally related to para-aminobenzoic acid (PABA) and act by inhibiting bacterial folic acid synthesis, making them bacteriostatic. Sulfonamides are competitive inhibitors of dihydropteroate synthase (DHPS), an enzyme involved in the bacterial synthesis of folic acid.
[0147] Common sulfonamides include, but are not limited to sulfamethoxazole, sulfadiazine sulfisoxazole, sulfacetamide, and silver sulfadiazine.
[0148] Resistance mechanisms for sulfonamides include mutations in DHPS (Target Site Alteration), overproduction of PABA, efflux Pumps and acquisition of Resistance Genes. Accordingly, antibiotic resistance genes in the context of sulfonamides refer in some embodiments to genes encoding alternative DHPS enzymes (e.g., sull, sul2, or sul3 genes) that are inherently less susceptible to sulfonamides. Still further, in some embodiments, mutated folP gene, which encodes DHPS, can decrease the binding affinity of sulfonamides, rendering them less effective.
[0149] In more specific embodiments, the systems, methods and kit of the invention may be suitable for identification, quantification and / or monitoring of any gene that may confer resistance to polymyxins. Polymyxins are a class of antibiotics that target Gram-negative bacteria by disrupting their outer membrane. They are considered last-resort antibiotics due to their efficacy against multidrug-resistant (MDR) bacteria and their potential for toxicity. More specifically, polymyxins are cyclic polypeptide antibiotics with a hydrophobic tail and a positively charged (cationic) cyclic peptide head. This amphipathic structure is crucial for their mechanism of action, specifically, interaction with the bacterial outer membrane by binding the positively charged head of polymyxins binds to the negatively charged phosphate groups in the LPS of Gram-negative bacteria, that leads to cel lysis. Specifically, the hydrophobic tail inserts into the lipid bilayer, disrupting membrane structure, increasing permeability, and causing cell lysis. Known polymyxins include Polymyxin B, Polymyxin E (Colistin), Polymyxin M, Polymyxin S and Polymyxin T.
[0150] Resistance mechanisms for polymyxins include modification of LPS, Efflux Pumps, and Loss of LPS. Thus, in the context of polymyxins, an antibiotics resistant gene may refer to herein to genes like mcr genes (Mobilized Colistin Resistance), for example, mcr-1, or any one of mcr-2, 3, 4, 5, 6, 7, 8, 9 or 10. This gene family encodes enzymes that modify Lipid A by adding phosphoethanolamine, reducing polymyxin binding . Still further, in this connection, the phoP andphoQ regulate genes involved in LPS modification. Mutations or activation of this system can lead to increased expression of pmr genes. Thus, in some further embodiments, antibiotics resistant gene may be the pmr genes. More specifically, the pmrA and pmrB regulate genes responsible for LPS modifications, such as the addition of 4-amino-L-arabinose to Lipid A, reducing polymyxin binding. Mutations in pmrA or pmrB can lead to constitutive activation and resistance. Still further, in some embodiments, the arn Operon (pmrCAB Operon), encodes enzymes that add 4-amino-L-arabinose to Lipid A. Upregulation of this operon (often under the control of pmrA / pmrB) contributes to resistance. In yet some further embodiments, the eptA (Phosphoethanolamine Transferase) gene, that encodes an enzyme that adds phosphoethanol amine to Lipid A. Its expression is often regulated by phoP / phoQ or pmrA / pmrB systems. In yet some further embodiments, the Ipx Genes (Lipid A Biosynthesis Pathway), may be referred to herein as antibiotics resistant genes in the context of polymyxins. Specifically, mutations in genes like IpxA, IpxC, or IpxD can result in the loss of LPS production, leading to intrinsic resistance to polymyxins. Another phosphoethanolamine transferase gene, similar to eptA, can contribute to polymyxin resistance through LPS modification. Still further, pagP is a gene encoding an enzyme that adds palmitate to Lipid A, which can indirectly reduce susceptibility to polymyxins. Other Regulatory Genes that may be considered as antibiotics resistant genes in the context of polymyxins, include, but are not limited to mgrB (a negative regulator of the phoP / phoQ system) and basS / basR (involved in regulating LPS modification genes, similar to phoP / phoQ).
[0151] In more specific embodiments, the systems, methods and kit of the invention may be suitable for identification, quantification and / or monitoring of any gene that may confer resistance to glycopeptides. Glycopeptides are a class of antibiotics that inhibit bacterial cell wall synthesis, making them particularly effective against Gram-positive bacteria. Their unique mechanism of action and ability to combat resistant strains of bacteria make them critical tools in modern medicine, especially for treating serious infections caused by organisms like Staphylococcus aureus and Enterococcus spp. Glycopeptides bind to the D-Ala-D-Ala terminal of the peptidoglycan precursors in the bacterial cell wall. This binding inhibits the transglycosylation and transpeptidation steps of peptidoglycan synthesis, which are essential for cell wall formation. The result is weakened cell walls and eventually bacterial cell lysis. Clinically Important Glycopeptide Antibiotics include Vancomycin, Teicoplanin, Dalbavancin, Oritavancin, and Telavancin.
[0152] Resistance mechanisms for glycopeptides include altering the D-Ala-D-Ala target to D-Ala-D-Lactate, reducing binding affinity, as well as thickening of cell walls.The primary gene that confers resistance to glycopeptide antibiotics, such as vancomycin and teicoplanin, is the van gene family, specifically, van A, B, C, D, E, G, M, N, H, X, Y, Z. These genes encode enzymes that alter the bacterial cell wall precursor, preventing the binding of glycopeptide antibiotics and thereby rendering them ineffective.
[0153] Still further, in some embodiments, particularly in case of a target pathogen that may be a fungal pathogen, fungal resistance genes may be also referred to by the present disclosure as antibiotic resistance genes. More Specifically, antifungal antibiotics are compounds used to treat fungal infections by inhibiting the growth of or killing fungi, by targeting specific components of fungal cells, such as the cell wall, cell membrane, or intracellular processes. Antifungal antibiotics target key components of fungal cells, such as the cell membrane or cell wall, to inhibit growth or kill fungi. Polyenes like amphotericin B and nystatin bind to ergosterol in the fungal cell membrane, creating pores that cause cell contents to leak. Azoles, such as fluconazole, itraconazole, and ketoconazole, inhibit ergosterol synthesis by targeting the enzyme lanosterol 14a-demethylase, disrupting membrane integrity. Echinocandins like caspofungin, micafungin, and anidulafungin inhibit P-glucan synthase, a key enzyme in fungal cell wall synthesis, making them effective against Candida and Aspergillus species.
[0154] Other antifungal antibiotics include allylamines such as terbinafine, which block ergosterol synthesis by inhibiting squalene epoxidase, and griseofulvin, which disrupts fungal mitosis by affecting microtubules and is used for skin, hair, and nail infections. Flucytosine acts as a nucleic acid analog, inhibiting fungal DNA and RNA synthesis, often in combination with amphotericin B for severe infections like cryptococcal meningitis. Additionally, natural products like fumagillin and cycloheximide have antifungal properties, though the latter is mainly used in research. These drugs are essential for treating both superficial infections (e.g., athlete’s foot, oral thrush) and severe systemic conditions (e.g., invasive candidiasis, aspergillosis).
[0155] Resistance to antifungal antibiotics arises through genetic mutations or the overexpression of specific genes that enable fungi to evade drug effects. For azoles, mutations in the ERG11 gene, which encodes the target enzyme lanosterol 14a-demethylase, reduce drug binding, while efflux pump genes such as CDR1, CDR2, and MDR1 actively expel azoles, lowering their intracellular concentration. Mutations in ERG3, a downstream gene in the ergosterol biosynthesis pathway, can bypass the requirement for ergosterol, further diminishing azole efficacy. Resistance to echinocandins, which target P-glucan synthase, often involves point mutations in FKS1 or FKS2, reducing drug binding affinity and compromising cell wall disruption.Polyenes like amphotericin B are affected by mutations in ERG3 or ERG6, altering ergosterol biosynthesis or replacing ergosterol with other sterols in the membrane, reducing polyene binding. Flucytosine resistance arises from mutations in FUR1, which encodes uracil phosphoribosyltransferase, or in FCY1 and FCY2, impairing drug uptake and activation. Griseofulvin resistance is linked to mutations in P-tubulin genes that allow normal microtubule function despite drug presence. Broader mechanisms, such as biofilm formation (e.g., BCR1 in Candida albicans), stress response pathways (e.g., HSP90 overexpression), and chromosomal aneuploidy (e.g., duplication of ERG11 or efflux pump genes), further enhance resistance across multiple drug classes.
[0156] In some embodiments, the target nucleic acid sequence of the microbial target relevant to the systems, methods and kit of the present disclosure, comprises at least one virulence gene encoding at least one virulence factor.
[0157] The term "pathogen" or "pathogenic" or "virulent" as used herein means microbial target that can cause a disease or infection. In some embodiments, pathogenic microbial targets are microbial targets that cause a disease or infection in a human subject, or any other organism including but not limited to mammal, rodent, bird, fish, reptile, insect or a plant, who does not have a compromised immune system. Typically, pathogenic microbial targets, specifically bacteria, will produce certain proteins which are referred herein as "pathogenic factors" or "virulence factors" .
[0158] Pathogenic microbial targets are distinguishable from those microbial targets that normally colonize one or more of a healthy host's tissue and for which they are thus undesirable to kill under ordinary therapeutic circumstances because the latter generally do not express pathogenic factors, or express lower amounts of pathogenic factors relative to pathogenic microbial targets. Such virulence or pathogenic factors include but are not necessarily limited to proteins that are involved in pathogenic adhesion, colonization, invasion, biofilm formation or immune response inhibitors, or toxins.
[0159] Thus, in some embodiments, the target nucleic acid sequence of the microbial target relevant to the systems, methods and kit of the present disclosure, comprises at least one target nucleic acid sequence encoding at least one product (e.g., a protein product) comprising and / or associated with at least one of colonization, invasion, adhesion, biofilm formation, immune-response inhibitors and toxin / s.
[0160] The term "adhesion" as used herein refers to the ability of the pathogen to attach itself to the host's cells. This attachment is often mediated by specific molecules on the surface of both the pathogen and the host cell. Adhesion allows the pathogen to stay in place and resist being washedaway by bodily fluids. Adhesion is a crucial step for both colonization and invasion.
[0161] "Colonization" refers to the presence and multiplication of a pathogen on or within a host without causing any apparent disease. The pathogen establishes itself but doesn't necessarily breach any physical barriers. "Invasion" is the next step after successful colonization. It involves the pathogen actively breaching a physical barrier of the host, such as the skin, mucous membranes, or the lining of the gut. This allows the pathogen to access deeper tissues and potentially cause an infection. Some pathogens can form "biofilms", which are complex communities of microorganisms encased in a protective matrix of self-produced substances. Biofilms can form on surfaces within the host, such as teeth, catheters, or implants. They provide a protective barrier for the pathogen, making them more resistant to antibiotics and the host's immune system. Many pathogens have evolved mechanisms to evade or suppress the host's immune response. These mechanisms can involve producing "immune-response inhibitors" that interfere with the body's ability to recognize or attack the pathogen or toxins that damage immune cells. By weakening the immune response, the pathogen can establish itself more easily and cause infection.
[0162] Examples of virulence genes include, but are not limited to genes encoding toxins (e.g. Shiga toxin and cholera toxin), hemolysins, fimbrial and afimbrial adhesins, proteases, lipases, endonucleases, endotoxins and exotoxins cytotoxic factors, microcins and colicins and also those identified in the art. The sequences of bacterial genes from a wide array of bacterium types that encode various virulence factors are known in the art. Virulence factors can be encoded on the microorganism (e.g. bacterial) chromosome, or on a plasmid in the bacteria, or both. In some embodiments, the virulence factor may be encoded by a superantigen gene, such as a superantigen enterotoxin gene, one non-limiting example of which is the S. aureus Sek gene. Additional virulence factors for S. areus include but are not limited to cytolitic toxins, such as a-hemolysin, P-hemolysin, y-hemolysin, leukocidin, Panton-Valentine leukocidin (PVL); exotoxins, such as toxic shock syndrome toxin- 1 (TSST-1); enterotoxins, such as SEA, SEB, SECn, SED, SEE, SEG, SEH, and SEI, and exfoliative toxins, such as ETA and ETB. Homologues of all of these toxins expressed by other types of bacteria are contemplated herein as virulence gene targets as well.
[0163] More specifically, the term "toxin" as used herein means a substance generated by microorganism (e.g. bacteria), which can be classified as either exotoxin or endotoxin. Exotoxins are generated and actively secreted; endotoxins remain part of the bacteria. Usually, an endotoxin is part of the bacterial outer membrane, and it is not released until the bacterium is killed by the immune system. According to some specific and non-limiting embodiments of the present disclosure, the bacterial virulence and antibiotic resistance gene may be selected from any one of: blaCTX-M-15,blaNDM-1, blaKPC , blaOXA-48, blaVIM, actA (example is given in genebank accession no: NC_003210.1), Tem (example is given in genebank accession no: NC_009980), Shv (example is given in genebank accession no: NC_009648), oxa-1 (example is given in genebank accession no: NW_139440), oxa-7 (example is given in genebank accession no: X75562), pse-4 (example is given in genebank accession no: J05162), ctx-m (example is given in genebank accession no: NC_010870), ant(3")-Ia (aadAl) (example is given in genebank accession no: DQ489717), ant(2")-Ia (aadB)b (example is given in genebank accession no: DQ 176450), aac(3)-IIa (aacC2) (example is given in genebank accession no: NC_010886), aac(3)-IV (example is given in genebank accession no: DQ241380), aph(3')-Ia (aphAl) (example is given in genebank accession no: NC_007682), aph(3')-IIa (aphA2) (example is given in genebank accession no: NC_010170), tet(A) (example is given in genebank accession no: NC_005327), tet(B) (example is given in genebank accession no: FJ411076), tet(C) (example is given in genebank accession no: NC_010558), tet(D) (example is given in genebank accession no: NC_010558), tet(E) (example is given in genebank accession no: M34933), tet(Y) (example is given in genebank accession no: AB089608), catl (example is given in genebank accession no: NC_005773), catll NC_010119, catlll (example is given in genebank accession no: X07848), floR (example is given in genebank accession no: NC_009140), dhfrl (example is given in genebank accession no: NC_002525), dhfrV (example is given in genebank accession no: NC_010488), dhfrVII (example is given in genebank accession no: DQ388126), dhfrIX (example is given in genebank accession no: NC_010410), dhfrXIII (example is given in genebank accession no: NC_000962), dhfrXV (example is given in genebank accession no: Z83311), sull (example is given in genebank accession no: NC_000913), suIII (example is given in genebank accession no: NC_000913), integron class 1 3'-CS (example is given in genebank accession no: AJ867812), vat (example is given in genebank accession no: NC_011742), vatC (example is given in genebank accession no: AF015628), vatD (example is given in genebank accession no: AF368302), vatE (example is given in genebank accession no: NC_004566), vga (example is given in genebank accession no: AF117259), vgb (example is given in genebank accession no: AF117258), and vgbB (example is given in genebank accession no: AFO 15628).
[0164] The chip systems, methods and kit of the present disclosure may specifically bind any pathogenic bacterial gene, for example, any gene / s that provides resistance or in other words, inhibits, reduces, suppress or attenuates the susceptibility of the bacteria to any antimicrobial agent. The term antimicrobial agent as used herein refers to any entity with antimicrobial activity (e.g. bactericidal or bacteriostatic), i.e. the ability to inhibit the growth and / or kill microbial target suchas bacterium, for example Gram positive- and Gram-negative bacteria, and fungi. An antimicrobial agent may be any agent which results in inhibition of growth or reduction of viability of a microbial target by at least about 10%, 20%, 30% or at least about 40%, or at least about 50% or at least about 60% or at least about 70% or more than 70%, for example, 75%, 80%, 85%, 90%, 95%, 100% or any integer between 30% and 70% or more, as compared to in the absence of the antimicrobial agent. Stated another way, an antimicrobial agent is any agent which reduces a population of microbial cells, such as bacteria by at least about 30% or at least about 40%, or at least about 50% or at least about 60% or at least about 70% or more than 70%, or any integer between 30% and 70% as compared to in the absence of the antimicrobial agent. In one embodiment, an antimicrobial agent is an agent which specifically targets a bacteria cell. In another embodiment, an antimicrobial agent modifies (i.e. inhibits or activates or increases) a pathway which is specifically expressed in bacterial cells. An antimicrobial agent can include any chemical, peptide (i.e. an antimicrobial peptide), peptidomimetic, entity or moiety, or analogues of hybrids thereof, including without limitation synthetic and naturally occurring non-proteinaceous entities. In some embodiments, an antimicrobial agent is a small molecule having a chemical moiety. For example, chemical moieties include unsubstituted or substituted alkyl, aromatic or heterocyclyl moieties including macrolides, leptomycins and related natural products or analogues thereof. Antimicrobial agents can be any entity known to have a desired activity and / or property or can be selected from a library of diverse compounds.
[0165] As noted above, the affinity moiety may bind any gene that provides antibiotic resistance. As used herein, the term "resistance" is not meant to imply that the microbial target population is 100% resistant to a specific antibiotic compound but includes microbial targets that are tolerant of the antibiotics or any derivative thereof. More specifically, the term "antibiotic resistance gene / s" refers to gene / s conferring about 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% protection from an antibiotic compound, thereby reversing susceptibility and sensitivity thereof to said antibiotic compound.
[0166] Thus, in some embodiments, the virulence gene may be any gene that provides resistance to any of the anti-microbial compounds described herein above.
[0167] It should be appreciated that the present disclosure further encompasses a biosensor chip system specifically suitable for, usable for, or adapted for, detecting, identifying, characterizing, quantifying, and / or monitoring at least one non-pathogenic microorganism, for example in at least one environmental sample such as a food sample. In some embodiments, the disclosed biosensor chip system is useful for detecting non-pathogenic microorganisms that exhibit one or moreundesired characteristics and / or cause, or are associated with, an undesired change in a product, material, or habitat. By way of non-limiting example, in food products such microorganisms may cause spoilage and / or other undesired changes, including changes in texture, composition, taste and / or odor, color, uniformity, stability, and / or shelflife.
[0168] As discussed in Example 12, implementation of the biosensor chip system as an early-warning monitoring system enables rapid detection and / or identification of microbial contaminants prior to proliferation to levels that may compromise food safety, product quality, and / or shelf life. Such preventive monitoring may facilitate timely and targeted corrective actions (for example, sanitation, process adjustments, segregation of affected lots, and / or hold-and-test decisions), thereby reducing product loss and waste, improving process control, and supporting compliance with applicable regulatory and quality standards.
[0169] Accordingly, in some embodiments, the biosensor chip system of the present disclosure, as well as any kits and methods thereof, is configured for detection, identification, characterization, quantification, and / or monitoring of at least one microorganism associated with food spoilage (a “food spoilage microorganism”) in at least one food and / or food-related sample. As used herein, the term “food” (and “food product”) includes any edible or drinkable material intended for human or animal consumption, including beverages, ingredients, raw materials, intermediate products, finished products, and ready-to-eat products, and further includes food-contact materials and / or processing aids to the extent they may be sampled for monitoring. Food may be provided in any form, including fresh, chilled, frozen, shelf-stable, dried, powdered, concentrated, reconstituted, liquid, semi-solid, or solid form. Food may be natural, minimally processed, or processed, and may comprise single-ingredient or multi -ingredient formulations. Non-limiting examples of food categories and matrices include animal-derived products such as meat (including beef, pork, poultry), processed meats, seafood and fish, shellfish, eggs and egg products, and dairy products (including raw milk, pasteurized milk, cream, yogurt, cheese, butter, and milk powders); plant-derived products such as fruits and vegetables (fresh-cut or whole), juices and juice concentrates, grains and cereals, flour, legumes, nuts and seeds, herbs and spices, and plant-based beverages; fermented foods and beverages; baked goods, confectionery, and snacks; prepared foods and ready-to-eat meals, sauces, dressings, soups, and spreads; and water and other beverages, including bottled beverages and reconstitution water.
[0170] In some embodiments, the food spoilage microorganism is a non-pathogenic microorganism that causes, contributes to, or is associated with an undesired change in a food product, including off-odors and / or off-flavors, discoloration, gas formation, slime formation, curdling, texturaldegradation, “flat sour” spoilage, reduced uniformity, reduced stability, reduced organoleptic quality, and / or shortened shelflife.
[0171] Non-limiting examples of food spoilage microorganisms include Pseudomonas spp. (for example, Pseudomonas fluorescens); Brochothrix spp. (for example, Brochothrix thermosphacta); Alicyclobacillus spp. (for example, Alicyclobacillus acidoterrestris); lactic acid bacteria including Lactobacillus spp., Leuconostoc spp., Lactococcus spp., Pediococcus spp., and Camobacterium spp.; spoilage-associated Enterobacteriaceae including Enterobacter spp., Serratia spp., Hafnia spp., and Morganella spp.; spore-forming bacteria including Bacillus spp. and Clostridium spp. (including Clostridium spp. associated with “late blowing” defects in cheese); and yeasts and molds including Candida spp., Saccharomyces spp., Zygosaccharomyces spp., Penicillium spp., Aspergillus spp., Fusarium spp., and Altemaria spp.
[0172] In some embodiments, the biosensor chip system is further configured for detection, identification, and / or screening of pathogenic microorganisms (“foodbome pathogens”) in food and / or food-related samples. By way of non-limiting example, the biosensor chip may be functionalized with one or more high-specificity probes targeting Salmonella enterica (for example, sequences derived from hilA and / or invA) and / or Listeria monocytogenes (for example, sequences derived from hly and / or iap), as discussed in Example 11.
[0173] In some specific embodiments, the nucleic acid-based target-binding moiety of the biosensor chip system of the present disclosure may display complementarity to at least one fragment of the target sequence, or any part thereof. In some embodiments, such fragments or part of the nucleic acid sequence of the target may comprise between about 15 to 200 base pairs, specifically, in certain embodiments, the nucleic acid sequence has a length of at least 15 base pairs and up to 200 base pairs, inclusive. By way of non-limiting example, the sequence also referred to herein as a fragment, may have a length of 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 200 base pairs. Each such length is expressly contemplated as a distinct embodiment and may be combined with any degree of complementarity, hybridization condition, or nucleic acid type disclosed herein. In some embodiments, the nucleic acid sequence, of a fragment of the target, has a length within a subrange of 15-50 base pairs, 20-75 base pairs, 25-100 base pairs, 30-150 base pairs, 40-175 base pairs, or 50-200 base pairs, inclusive. In yet some further embodiments, the length of the target nucleic acid sequence, also referred to herein as a fragment, within the target may be about 20bp. In yet some further embodiments, the length of the target nucleic acid sequence may be in the length of lOObp. It should be understood that thesequence length is selected such that it is sufficient to confer sequence-specific hybridization to a target nucleic acid under stringent, moderately stringent, or low-stringency conditions, depending on the intended application.
[0174] In some embodiments, the target-binding moiety comprises at least one nucleic acid sequence complementary to a target sequence in at least one of the 5' and / or the 3' end of at least one fragment of the target nucleic acid sequence. In yet some further alternative or additional embodiments, the at least one nucleic acid-based target-binding moiety of the biosensor chip system of the present disclosure, may comprise at least one nucleic acid sequence complementary to a sequence in the 5' end of a fragment of the target sequence in a forward 5' to 3' orientation and / or at least one nucleic acid sequence complementary to a sequence in the 3' end of the fragment of the target sequence in a reverse 3' to 5' orientation. In yet some further specific embodiments, the at least one fragment of the target sequence is in the length of between about 50 to about 150 base pairs (bp).
[0175] As mentioned above, the biosensor chip system of the present disclosure comprises a plurality of electrodes that are configured for at least one electrical analysis of the sample.
[0176] In some embodiment, the at least one electrical analysis comprises at least one of: electrochemical impedance spectroscopy (EIS) analysis, voltammetry analysis, amperometry analysis, squarewave voltammetry analysis, differential-pulse voltammetry analysis, linear sweep voltammetry analysis, potentiometry analysis, Osteryoung Square Wave Voltammetry (OSWV), pulsed voltammetric methods, and chronoamperometry
[0177] In some embodiments, the at least one electrical analysis comprises electrochemical impedance spectroscopy (EIS) analysis.
[0178] "Electrochemical Impedance Spectroscopy (EIS)" refer to an electrochemical technique that probes the properties of a system by imposing a small amplitude, alternating current perturbation and analyzing the resulting impedance response. The frequency-dependent impedance spectrum provides insights into interfacial processes, charge transfer kinetics, mass transport phenomena, and the overall electrochemical behavior, enabling quantitative characterization and modeling of electrochemical systems.
[0179] In some other embodiments, the at least one electrical analysis comprises electrochemical voltammetry analysis.
[0180] "Voltammetry" is an electrochemical technique that quantifies the relationship between an analyte's concentration and the current generated at an electrode under controlled potential conditions. By systematically varying the applied potential, voltammetry provides informationabout redox reactions, diffusion coefficients, and analyte concentrations, enabling qualitative and quantitative analysis of electroactive species in a sample.
[0181] In some other embodiments, the at least one electrical analysis comprises electrochemical amperometry analysis.
[0182] "Amperometry" is an electrochemical technique that quantifies the concentration of an analyte by measuring the steady-state current generated at a constant applied potential. This analytical method relies on the relationship between the analyte's concentration and the rate of electron transfer at the electrode surface, enabling real-time monitoring of analyte levels and kinetic studies of electrochemical reactions.
[0183] Another aspect of the present disclosure relates to a sample inspection system, also referred to herein as an array, comprising: (i) a plurality of biosensor chips, wherein each biosensor chip comprising at least one working electrode and at least one reference electrode, or a plurality of any chip device or system comprising the same. The at least one working electrode is connected to at least one nucleic acid-based target-binding (or affinity) moiety, capable of specifically recognizing and binding at least one target nucleic acid sequence of at least one microbial target. The plurality of electrodes is configured for at least one electrical analysis of the sample. The sample inspection system (array) also, optionally, comprising: (ii) a channel arrangement adapted to pass fluid sample in a plurality of channels. The fluid or fluidized sample is in contact with plurality of electrodes of the plurality of biosensor chips. The term "plurality" of biosensor chips as used herein refers to more than one biosensor chip, specifically, two or more. In some embodiments, a plurality of biosensor chips (and / or a plurality of electrodes, channels, affinity moieties, targets, assays, measurements, or analyses) comprises 2 to about 100 elements. In some embodiments, the plurality comprises 2 to about 5, 2 to about 10, 2 to about 25, 2 to about 50, or 2 to about 100 elements. In some embodiments, the plurality comprises at least 2, at least 3, at least 5, at least 10, at least 20, at least 50, at least 100, or more than 100 elements.
[0184] In some embodiments, the disclosed inspection systems comprise any one of the biosensor chip systems disclosed by the present disclosure as defined above.
[0185] Another aspect of the present disclosure refers to a method for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample. The method comprising the following steps: In step (a), contacting the at least one sample with a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same. The at least oneworking electrode is connected to at least one nucleic acid-based target-binding and / or affinity moiety. The nucleic acid-based target-binding and / or affinity moiety specifically recognizes and binds the at least one nucleic acid sequence. In step (b) applying one or more voltage signals between the at least one working electrode and said at least one reference electrode, and determining electrical current between the electrodes in response to the one or more voltage signals; and (c) determining one or more relations between electrical current response and the one or more voltage signals; and determining data indicative of presence and / or quantity of said at least one target nucleic acid sequence in the sample in accordance with the one or more relations. In some embodiments, the applying one or more voltage signals comprises applying one or more voltage signals in a selected number of one or more signal frequencies, and wherein said determining one or more relations comprises determining data indicative of impedance between the at least one working electrode and the at least one counter electrode wherein impedance variation being indicative of presence and / or quantity of said at least one target nucleic acid sequence of at least one microbial target in the sample.
[0186] In some embodiments, the applying one or more voltage signals comprises applying one of more signal comprising cyclic voltage variation, and wherein the determining one or more relations comprises determining current transmission in relation to the cyclic voltage variation, the current transmission with respect to the cyclic voltage variation being indicative of presence and / or quantity of the at least one target nucleic acid sequence of at least one microbial target in said sample.
[0187] In some embodiments, said applying one or more voltage signals comprises applying one of more signals of one or more selected voltages and determining current transmission in response; and wherein relations between current transmission and the one or more selected voltages being indicative of presence and / or quantity of said at least one target nucleic acid sequence of at least one microbial target in the sample.
[0188] In some embodiments, the contacting step of (a) is via continuous flow of the sample through the plurality of electrodes. The term "continuous flow" refers herein to a process where the microbial targets within the sample move steadily through the plurality of electrodes.
[0189] In some embodiments, the method for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample further comprising prior to step (a), at least one of the following steps: (i) nucleic acid extraction from said at least one sample; (ii) fragmentation of the nucleic acids extracted from the sample; and (iii) sample purification. "Nucleic acid extraction" may be performed by any standard methodology.Still further, DNA extraction also refers to crude extraction processes such as heating, sonication, microwave, as well as to chemical extraction. Non-limiting examples include phenol -chloroform extraction, alkaline lysis, guanidinium thiocyanate-phenol-chloroform extraction, chelex extraction, silica-based extraction, magnetic bead-based purification, CsCl density gradient centrifugation, column-based purification.
[0190] Still further, fragmentation of the nucleic acids extracted from the sample, as used herein, encompasses fragmentation of the entire extracted nuclei acid sequences to fragments in the length of about 500bp to about 200bp. Still further, fragmentation of the nucleic acids extracted from the sample, as used herein, refers to a process by which intact or high-molecular-weight nucleic acid molecules are intentionally cleaved such that all or substantially all of the extracted nucleic acid sequences are converted into smaller nucleic acid fragments. In certain embodiments, the fragmentation results in nucleic acid fragments having an average or target length of about 500 base pairs (bp) to about 200 bp, inclusive, and combinations thereof.
[0191] In some embodiments, fragmentation is defined by a length ratio between the original nucleic acid molecules and the resulting fragments. For example, the extracted nucleic acids may initially have a length of at least 1,000 bp, at least 2,000 bp, at least 5,000 bp, or at least 10,000 bp (10 kb), and fragmentation reduces such nucleic acids to fragments having an average length of about 200-500 bp, corresponding to a size reduction ratio of at least 2:1, 5:1, 10:1, 20:1, 50:1, or greater. In particular embodiments, nucleic acids having lengths on the order of kilobases (kb) are fragmented to sub-kilobase fragments, including fragments of less than 1,000 bp, less than 750 bp, less than 500 bp, less than 400 bp, less than 300 bp, or less than 200 bp.
[0192] In specific embodiments, the fragmented nucleic acids comprise fragments having a maximum length of 1,000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, or 200 bp, and / or an average fragment length within any range defined by two of the foregoing values. In certain embodiments, at least 70%, 80%, 90%, or 95% of the fragmented nucleic acids fall within the range of about 200 bp to about 500 bp.
[0193] Fragmentation may be achieved using physical, mechanical, enzymatic, thermal, or chemical methods, alone or in combination. Exemplary physical or mechanical fragmentation methods include sonication, acoustic shearing, hydrodynamic shearing, nebulization, or repeated passage through a narrow-gauge orifice. In particular embodiments, as described in detail in Example 7, sonication is employed, wherein high-frequency acoustic energy is applied to the nucleic acid sample for a defined duration and intensity to generate fragments within a desired size distribution. More specifically, in some particular embodiments, sonication procedure as used herein maycomprise sonication of Imin, followed by 30 seconds on ice, repeated 5 times. Enzymatic fragmentation methods may include treatment with endonucleases, DNase I, RNase, restriction enzymes, or transposase-based fragmentation systems, under conditions selected to produce fragments of a predetermined length. Chemical fragmentation methods may include exposure to divalent metal ions, heat, or alkaline conditions sufficient to cleave phosphodiester bonds in a controlled manner.
[0194] " Sample purification" refers to the process of isolating a target substance of interest (biomolecules (e.g., proteins, DNA, RNA), small molecules (e.g., metabolites), cells, or inorganic compounds) from a complex mixture, such as biological, chemical, or environmental samples, while removing unwanted contaminants or impurities. This process may include the use of various techniques such as Chromatography, Centrifugation, Filtration, Precipitation, and Electrophoresis.
[0195] Still further, in some embodiments, step (a) of the disclosed methods, specifically incubation of the sample with the biosensor, comprises contacting the sample with the plurality of electrodes for about 20 to 50 minutes, specifically, As used herein, “incubation with the sample” refers to a process in which a nucleic acid, reagent, or other agent is maintained in contact with a biological sample under defined conditions, including temperature, buffer composition, and other environmental parameters, for a specified duration sufficient to allow a desired biochemical or molecular interaction to occur. In certain embodiments, the incubation time is about 20 minutes to about 50 minutes, inclusive.
[0196] In specific embodiments, the incubation time may be about 20, 21, 22, 23, 24, or 25 minutes, about 26, 27, 28, 29, or 30 minutes, about 31, 32, 33, 34, or 35 minutes, about 36, 37, 38, 39, or 40 minutes, about 41, 42, 43, 44, or 45 minutes, or about 46, 47, 48, 49, or 50 minutes. Each such time-point is expressly contemplated as an independent embodiment. In some embodiments, the incubation time may be described in sub-ranges, such as about 20-25 minutes, about 25-30 minutes, about 30-35 minutes, about 35-40 minutes, about 40-45 minutes, or about 45-50 minutes, wherein each endpoint corresponds to one of the expressly disclosed time values. These sub-ranges are intended to provide flexibility in optimizing the interaction kinetics while remaining within the scope of the invention. In some specific embodiments, the incubation time may be about 30-35 minutes.
[0197] In some embodiments, the method further comprising the step for enrichment of at least one microbial target under suitable condition(s) in the sample prior to step (a).
[0198] In the context of bacterial growth, "enrichment" refers to the process of increasing the proportion of a specific type of microbial target within a sample. This is achieved by providing suitableconditions that favor the growth of the desired microbial target, resulting in increased abundance relative to non-target microbes (i.e. higher signal to noise ration).
[0199] The term "suitable conditions)" as used herein refers to specific conditions necessary to facilitate the proliferation of a specific microbial target. Non-limiting examples of such conditions include incubation of the sample at a specified controlled temperature, for specified period of time, at a specified humidity, at a specified oxygen level, in a specified media. The specified media may comprise specific nutrients, and / or antibiotics or other chemicals that inhibit the growth of unwanted microbial targets (e.g. sensitive bacteria) but not the target species. Alternatively, or in addition, conditions like oxygen availability, pH, or temperature can also be adjusted to favor the target microbial targets.
[0200] In some embodiments the reagents suitable for enrichment comprise growth media, such as Luria-Bertani (LB) Broth, Tryptic Soy Broth (TSB), Brain Heart Infusion (BHI), Blood Broth and / or other growth medium. Such growth media may be supplemented with universal broth components such as peptone and sodium chloride (NaCl). In other embodiments, the reagents suitable for enrichment may comprise and / or supplemented with selective components, such as selective antibiotics, lactose, bile salts and / or soil components. Enrichment can be conducted for different durations ranging from 30 min to 24 hours, where enrichment incubation times can be applied to stimulate specific signals (i.e. bacteria, genes etc.). Enrichment can be conducted using different incubation temperature, pH and oxygen saturation (aerobic or anaerobic conditions).
[0201] It should be noted that the term "incubation" or "incubating" as used herein refers to creating conditions that allow the pathogen to multiply within the media it resides in.
[0202] It should be noted, that for the enrichment step, both automated continuous flow mode and a manual mode are supported. In the manual mode, the nucleic acid-functionalized biochip system is intended for single use, wherein following the enrichment step (and optionally the extraction step and sample processing), the biochip is measured and disposed. Alternatively, in an automated continuous flow mode, the biochip is measured and then recycled by dissociating the bound nucleic acid. Dissociation of the bound nucleic acid may be performed by applying a negative voltage bias on the working electrode versus the reference electrode such that a repulsive electrostatic potential drives a dissociation reaction (i.e., melting) and results in the unbinding of a double-stranded helix. Alternatively, dissociation may proceed by raising the temperature inside the reaction chamber (thermal cycling) allowing for a melting reaction and the regeneration of the nucleic acid-functionalized biochip device.In some specific embodiments, the enrichment step comprises incubating the sample at a suitable temperature allowing the growth of the microbial target.
[0203] In more specific embodiments, the desired temperature is between about 0°C to 150°C. In some other embodiments, the desired temperature may be between about 0°C to 100°C, 0°C to 60°C, 0°C to 20°C, 15°C to 40°C 15°C to 60°C, 15°C to 100°C, 15°C to 150°C.
[0204] In yet some further specific embodiments, the enrichment step comprises incubating the sample for a suitable time period allowing the growth of the microbial target. In more specific embodiments, the suitable time period may range between is between about 10 minutes to 48hrs. More specifically, between 30 minutes to 24hrs, specifically, 30 minutes, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours, 7 hours, 7.5 hours, 8 hours, 8.5 hours, 9 hours, 9.5 hours, 10 hours, 10.5 hours, 11 hours, 11.5 hours, 12 hours, 12.5 hours, 13 hours, 13.5 hours, 14 hours, 14.5 hours, 15 hours, 15.5 hours, 16 hours, 16.5 hours, 17 hours, 17.5 hours, 18 hours, 18.5 hours, 19 hours, 19.5 hours, 20 hours, 20.5 hours, 21 hours, 21.5 hours, 22 hours, 22.5 hours, 23 hours, 23.5 hours, and 24 hours.
[0205] In some more specific embodiment, the suitable temperature is between 30°C to 44°C.
[0206] In further specific embodiments, the desired temperature may be about 44°C.
[0207] As mentioned above, the methods of the present disclosure comprise in step (a) contacting the at least one sample with a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same. In some embodiments, the plurality of electrodes is connectable to a detection circuit adapted for performing at least one electrical analysis.
[0208] In some other embodiments, the least one electrical analysis comprises at least one of electrochemical impedance spectroscopy (EIS) analysis, voltammetry analysis, and amperometry analysis.
[0209] In some specific embodiments, at least one electrical analysis comprises spectroscopy (EIS) analysis.
[0210] The systems, methods and kit of the present disclosure are used for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample. In some embodiments, the microbial target comprises at least one of bacteria, archaea, fungi, microalgae, protist, parasites, viruses and bacteriophages.
[0211] "Bacteria" , as used herein, include Gram positive, Gram negative and Gram variable bacteria and intracellular bacteria. The term "archaea" , as used herein, refers to one of the three domains of living organisms: Archaea, Bacteria and Eukaryota. Archaea include metabolic oddities,methanogens and sulphur-dependent extreme thermophiles. The term "fungi" (or a “fungus”), as used herein, refers to a division of eukaryotic unicellular organisms including for example, fungi that cause diseases such as ringworm, histoplasmosis, blastomycosis, aspergillosis, cryptococcosis, sporotrichosis, coccidioidomycosis, paracoccidio-idoinycosis, and candidiasis. Alternatively, this can refer to but is not limited to fungi that cause food spoilage, such as bread mold (Rhizopus) on bakery products, blue mold (Penicillium) on citrus fruits, black mold (Aspergillus) on grains and nuts, and white mold (Mucor) in dairy products like yogurt; or plant diseases, such as wheat rust in cereal crops, rice blast in paddy fields, potato late blight in tubers, and powdery mildew on a wide variety of garden vegetables and fruits. The term "microalgae", as used herein, refers to a group of microscopic, unicellular organisms capable of photosynthesis, similar to plants. They are found in diverse aquatic environments, including freshwater, marine, and brackish waters, as well as in damp terrestrial habitats. Microalgae include various groups such as green algae (Chlorophyta), diatoms (Bacillariophyceae), cyanobacteria (often referred to as blue-green algae but technically bacteria), and dinoflagellates (Dinophyta). "Protists" are any eukaryotic organism that is not an animal, plant, or fungus. Protists do not form a natural group, or clade, but an artificial grouping of several independent clades that evolved from the last eukaryotic common ancestor. The term "parasite" includes, but not limited to, infections caused by somatic tapeworms, blood flukes, tissue roundworms, amoeba, and Plasmodium, Trypanosoma, Leishmania, and Toxoplasma species. "Viruses" are infectious agents that replicate only inside the living cells of an organism. As used herein this term encompasses enveloped or naked, DNA or RNA, single strand or double strand viruses of any family or genera, for example, poxviruses, herpesviruses, picomaviruses, parvoviruses, hepadnaviruses, picornaviruses, flaviviruses, retroviruses, hepadnaviruses, coronaviruses, arenaviruses, bunyaviruses, and the like. A "bacteriophage" , also known informally as a phage, is a duplodnaviria virus that infects and replicates within bacteria and archaea. In some specific embodiments, the bacteriophage applicable in the present disclosure may specifically refer to bacteriophages specific to bacterial pathogens such as E. coli, Salmonella, and Listeria monocytogenes .
[0212] In some embodiments, the microbial target comprises at least one bacterium.
[0213] In some specific embodiments, the bacteria comprise at least one bacterium selected from at least one of the phyla Pseudomonadota, Bacillota, Actinomycetota and Bacteroidota.
[0214] " Pseudomonadota" is a phylum encompassing a diverse group of Gram-negative bacteria characterized by their metabolic versatility. As a predominant phylum within the bacterial domain, members of Pseudomonadota exhibit a wide range of ecological niches, including both pathogenicand free-living lifestyles. Notably, they play crucial roles in biogeochemical cycles through processes such as nitrogen fixation, carbon dioxide fixation, and decomposition. Non-limiting examples of bacteria that belong to the phylum Pseudomonadota include Escherichia coli. Pseudomonas, Salmonella, Vibrio, Neisseria, Burkholderia, Bordetella, Agrobacterium, Caulobacter .
[0215] "Bacillota" is a phylum of bacteria predominantly characterized by a Gram-positive cell wall structure. This phylum encompasses a wide range of microorganisms exhibiting diverse metabolic strategies, including aerobic, anaerobic, and facultative anaerobic lifestyles. A notable characteristic of many Bacillota is their ability to form endospores, highly resistant structures that enable survival under extreme environmental conditions. This phylum includes both free-living and pathogenic species, with significant implications for human health, agriculture, and environmental processes. Non-limiting examples of bacteria that belong to the phylum Bacillota include Bacillus, Staphylococcus, Streptococcus, Listeria, Clostridium, Lactobacillus.
[0216] " Actinomycetota" is a phylum of Gram-positive bacteria distinguished by a high guanine-cytosine content in their DNA. These microorganisms exhibit a diverse morphology, ranging from cocci to filamentous forms, and are ubiquitous in terrestrial and aquatic environments. Known for their significant contribution to soil ecosystems, Actinomycetota play crucial roles in nutrient cycling and organic matter decomposition. Moreover, this phylum represents a prolific source of bioactive compounds, including a vast array of antibiotics, demonstrating their immense importance in human health and medicine. Non limiting examples of bacteria that belong to the phylum Actinomycetota include Streptomyces, Mycobacterium, Corynebacterium, Actinomyces, Nocardia, Rhodococcus.
[0217] " Bacteroidota" is a phylum of Gram-negative, typically anaerobic bacteria characterized by their role in diverse ecosystems. Predominant members of the human gut microbiome, Bacteroidota species are essential for nutrient acquisition and energy metabolism. These bacteria possess a versatile metabolic capacity, enabling them to degrade complex polysaccharides and other substrates. Beyond the human gut, Bacteroidota can be found in various environments, including soil, water, and the rhizosphere, where they contribute to nutrient cycling and organic matter decomposition. Non limiting examples of bacteria that belong to the phylum Bacteroidota include Bacteroides, Prevotella, Parabacteroides, Alistipes, Porphyromonas, Tanner ella, Odoribacter . Bacteria of particular interest may be any bacteria involved in nosocomial infections or any mixture of such bacteria. The term "Nosocomial Infections" refers to Hospital-acquired infections, namely, an infection whose development is favored by a hospital environment, such as surfacesand / or medical personnel, and is acquired by a patient during hospitalization. Nosocomial infections are infections that are potentially caused by organisms resistant to antibiotics.
[0218] Nosocomial infections have an impact on morbidity and mortality and pose a significant economic burden. In view of the rising levels of antibiotic resistance and the increasing severity of illness of hospital in-patients, this problem needs an urgent solution. Non limiting examples of common nosocomial organisms include resistant Enter obacteriaceae, vancomycin-resistant Enteroccocci, Clostridium difficile, methicillin-resistant Staphylococcus aureus, coagulase-negative Staphylococci, Pseudomonas aeruginosa, Acinetobacter and Stenotrophomonas maltophilia. "ESKAPE" pathogens may be of particular interest. Those pathogens cause the majority of nosocomial infections and effectively escape the effects of antibiotics. These pathogens include but are not limited to Enterococcus faecium, Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumanii, Pseudomonas aeruginosa, and Enterobacter.
[0219] More specifically, the nosocomial-infection pathogens may be Gram-negative rod-shaped organisms (e.g. Escherichia coli, Klebsiella pneumonia, Klebsiella oxytoca, Proteus aeruginosa, Serratia spp.), Gram-negative bacilli (e.g. Enterobacter aerogenes, Enterobacter cloacae), aerobic Gram -negative coccobacilli (e.g. Acinetobacter baumanii, Stenotrophomonas maltophilia) and Gram-negative aerobic bacillus (e.g. Stenotrophomonas maltophilia, previously known as Pseudomonas maltophilia). Among many others Pseudomonas aeruginosa is an extremely important nosocomial Gram-negative aerobic rod pathogen.
[0220] In further embodiments, the bacteria as referred to herein by the invention may include Yersinia enter ocolitica, Yersinia pseudotuberculosis, Salmonella typhi, Pseudomonas aeruginosa, Vibrio cholerae, Shigella sonnei, Bordetella Pertussis, Plasmodium falciparum, Chlamydia trachomatis, Bacillus anthracis, Helicobacter pylori and Listeria monocytogens .
[0221] A lower eukaryotic organism includes a yeast or fungus such as but not limited to Pneumocystis carinii, Candida albicans, Aspergillus, Histoplasma capsulatum, Blastomyces dermatitidis, Cryptococcus neoformans, Trichophyton and Microsporum.
[0222] A complex eukaryotic organism includes worms, insects, arachnids, nematodes, aemobe, Entamoeba histolytica, Giardia lamblia, Trichomonas vaginalis, Trypanosoma brucei gambiense, Trypanosoma cruzi, Balantidium coli, Toxoplasma gondii, Cryptosporidium or Leishmania. In some further embodiments, viral pathogen / s may be detected and / or quantified by the biosensor chip of the present disclosure. The term “viruses” is used in its broadest sense to include viruses of the families adenoviruses, papovaviruses, herpesviruses: simplex, varicella-zoster, Epstein-Barr, CMV, poxviruses: smallpox, vaccinia, hepatitis B, rhinoviruses, coronaviruses, retroviruses,zika virus, Ebola virus, hepatitis A, poliovirus, rubella virus, hepatitis C, arboviruses, rabies virus, influenza viruses A and B, measles virus, mumps virus, HIV, HTLV I and II.
[0223] The term "fungi" includes for example, fungi that cause diseases such as ringworm, histoplasmosis, blastomycosis, aspergillosis, cryptococcosis, sporotrichosis, coccidioidomycosis, paracoccidio-idoinycosis, and candidiasis.
[0224] In some specific embodiments, the bacteria are of the family Enter obacteriaceae .
[0225] "Enterobacteriaceae" is a family of Gram -negative, facultatively anaerobic, rod-shaped bacteria. These microorganisms are typically found in the gastrointestinal tracts of animals, including humans, but can also inhabit various environments. Characterized by their ability to ferment glucose, reduce nitrates to nitrites, and produce catalase, Enterobacteriaceae exhibit a diverse metabolic profile. This family encompasses a wide range of species, including both commensal and pathogenic organisms, with significant implications for human health and disease. Non limiting examples of bacteria that belong to the family Enterobacteriaceae include Escherichia (e.g. Escherichia coli (E. coli , Salmonella, Shigella, Klebsiella, Enterobacter, Citrobacter, Proteus, Serratia.
[0226] In more specific embodiments, the bacteria are of the species Escherichia coli.
[0227] "Escherichia coli" is a Gram-negative, facultatively anaerobic, rod-shaped bacterium belonging to the family Enterobacteriaceae. Typically, commensal within the gastrointestinal tract of warmblooded organisms, E. coli plays a crucial role in gut microbiota homeostasis. However, certain pathogenic strains harbor virulence factors enabling extraintestinal infections, manifesting in diverse clinical presentations including urinary tract infections, bacteremia, and gastrointestinal diseases.
[0228] E. Coli belongs to the Escherichia genus, the Enterobacteriaceae family, the Enterobacterales order and the Pseudomonadota phylum.
[0229] In some embodiments of the present disclosure, the bacteria of interest may be any E.coli strain. In some other embodiments, the E.coli trains may include any one of 0157:H7, enteroaggregative (EAEC), enterohemorrhagic (EHEC), enteroinvasive (EIEC), enteropathogenic (EPEC), enterotoxigenic (ETEC) and diffuse adherent (DAEC) E. coli.
[0230] As mentioned above, the systems, methods and kit of the present disclosure may be used for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample. In some embodiments, the target nucleic acid sequence comprises at least one of: antibiotic resistance gene, a virulence gene, specifically a gene encoding at least one virulence factor that may be any target nucleic acid sequence encoding aproduct (e.g., a protein product) comprising and / or associated with at least one of colonization, invasion, adhesion, biofilm formation, immune-response inhibitors and toxins.
[0231] In some specific embodiments, the target nucleic acid sequence is at least one antibiotic resistance gene. In more specific embodiments, the at least one antibiotic resistance gene refers to betalactamases resistant genes, specifically, CTX-M, TEM, as well as carbapenemase encoding genes such as NDM, KPC, VIM, OXA-48 and IMP.
[0232] "CTX-M" refers to a group of extended-spectrum beta-lactamases (ESBLs). These enzymes confer resistance to a broad spectrum of beta-lactam antibiotics, including cephalosporins, rendering bacterial infections difficult to treat. CTX-M enzymes are prevalent in various Enterobacteriaceae species, notably Escherichia coli and Klebsiella pneumoniae. The CTX-M family is characterized by its dynamic nature, with new members constantly being identified. Non limiting examples of members within this group include: CTX-M- 1 (which includes many prevalent CTX-M enzymes, such as CTX-M-15, CTX-M-27, and CTX-M-32), CTX-M-2 (which includes less common enzymes like CTX-M-2 and CTX-M-9) and CTX-M-9 (which includes enzymes like CTX-M-8 and CTX-M-25).
[0233] Similarly, "TEM" (an acronym for Temoneira) , refers to a class of beta-lactamase enzymes commonly found in Gram-negative bacteria. These enzymes confer resistance to a variety of betalactam antibiotics, including penicillins and early -generation cephalosporins, by hydrolyzing the beta-lactam ring structure. TEM enzymes have undergone extensive mutation and dissemination, leading to the emergence of numerous variants with varying substrate profiles and inhibitor susceptibility. Non limiting examples of members within this group include TEM-1 (which includes the original TEM-1 enzyme and its closely related variants) and TEM-2.
[0234] In some specific embodiments, the at least one antibiotic resistance gene comprises CTX-M1. In some other embodiments, the at least one antibiotic resistance gene comprises TEM.
[0235] In some specific embodiments, the at least one antibiotic resistance gene comprises NDM. More specifically, New Delhi Metallo-P-lactamase, that renders resistance to a wide range of P-lactam antibiotics, including carbapenems.
[0236] In some specific embodiments, the at least one antibiotic resistance gene comprises KPC. Specifically, Klebsiella pneumoniae carbapenemase, that confers resistance to carbapenem antibiotics, as well as other P-lactam antibiotics.
[0237] In some specific embodiments, the at least one antibiotic resistance gene comprises VIM. More specifically, Verona Integron-encoded Metallo-P-lactamase, that confers resistance to a broadspectrum of P-lactam antibiotics, including carbapenems. VIM is associated with multidrugresistant Gram -negative pathogens.
[0238] Still further, in some specific embodiments, the at least one antibiotic resistance gene comprises OXA-48. More specifically, OXA-48 belongs to the class D p-lactamases, also known as oxacillinases, that confer resistance to a wide range of P-lactam antibiotics, including carbapenems.
[0239] In some specific embodiments, the at least one antibiotic resistance gene comprises the IMP enzymes that hydrolyze the P-lactam ring in penicillins, cephalosporins, and carbapenems, rendering these antibiotics ineffective.
[0240] In some embodiments, the target-binding moiety used by the disclosed methods comprises at least one nucleic acid sequence complementary to a target sequence in at least one of the 5' and / or the 3' end of at least one fragment of the target nucleic acid sequence. In yet some further alternative or additional embodiments, the at least one nucleic acid-based target-binding moiety of the biosensor chip system used by the methods of the present disclosure, may comprise at least one nucleic acid sequence complementary to a sequence in the 5' end of a fragment of the target sequence in a forward 5' to 3' orientation and / or at least one nucleic acid sequence complementary to a sequence in the 3' end of the fragment of the target sequence in a reverse 3' to 5' orientation. In yet some further specific embodiments, the at least one fragment of the target sequence is in the length of between about 50 to about 150 base pairs (bp).
[0241] In some embodiments, multiple nucleic acid probes targeting different genetic regions of a single target organism are imbedded on a single biochip in order to increase the sensitivity of the sensor when hybridizing fragmented target nucleic acids.
[0242] Using the systems, methods and kit of the present disclosure, the at least one target nucleic acid sequence of at least one microbial target is identified in at least one sample.
[0243] In some particular and non-limiting embodiments, the target-binding moiety used by the disclosed biosensor chip, kits, and methods, may comprise the nucleic acid sequence as denoted by at least one of SEQ ID NO: 5, 6, 7 (detection of ESBL-CTXM), SEQ ID NO: 11-16 (detection of food spoilage microorganisms), SEQ ID NOs: 17, 18, 19, 20 (5. enterica hilA and invA139, respectively), and SEQ ID NOs: 21, 22, 23, 24 (L. monocytogenes hly LM1, LM2, iapMonoA and MonoB, respectively), and any mixture or combinations thereof.
[0244] The terms "sample", "test sample" and "specimen", ” biological sample” are used interchangeably in the present specification and claims and are used in its broadest sense. They are meant to includeboth biological (e.g. clinical) and environmental (including food) samples. This term refers to any media that may contain the microbial target.
[0245] Still further, " Environmental samples” include environmental material such as any media, specifically, a liquid media (such as treated wastewater, sewage), or liquidized samples, surface matter, earth, soil, air and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items, surfaces in medical health centers, elderly houses and any industrial facility. These examples are not to be construed as limiting the sample types applicable to the present disclosure. Typically, substances and samples or specimens that are a priori not liquid may be contacted with a liquid media which is contacted with the biosensor chip device of the invention. In some embodiments, the sample may be derived from an environmental water source. Non limiting examples of "natural environmental water source" include surface water such as lakes, rivers, streams, wetlands and oceans, as well as groundwater, glaciers, snowpack, and atmospheric moisture. Non limiting examples of "artificial water reservoir" include sewage, water supply (e.g. source of water for drinking, irrigation, and industrial uses), swimming pools, dammed reservoirs and off-stream reservoirs.
[0246] In some embodiments, the environmental water source refers to reclaimed water. "Reclaimed water" or also sometimes called recycled water or wastewater reuse is wastewater that has been treated to a specific standard to make it suitable for various purposes other than drinking. The reclaimed water doesn't meet the standards for drinking water, but it can be used for a variety of purposes where clean but not potable water is needed, such as irrigation, industrial processes, toilet flushing, etc.
[0247] In some embodiments, the environmental water source refers to treated wastewater.
[0248] " Treated wastewater" refers to wastewater that has undergone a process to remove contaminants, making it less harmful to the environment. Unlike reclaimed water, treated wastewater is generally not considered suitable for reuse due to the presence of some residual contaminants. It's typically discharged into rivers, streams, or the ocean, but with the expectation that the environment can further cleanse it.
[0249] In some embodiments, the environmental water source refers to sewage. "Sewage” refers to wastewater that comes from a variety of sources, primarily human waste and household use. Sewage typically flows from buildings through a plumbing system into a sewer system. Sewage may be for example a mixture of Blackwater (water used to flush toilets and contains human waste) and Greywater (used water from sinks, showers, bathtubs, washing machines, and dishwashers).In other embodiments, the sample and may include any biological sample, for example, any body fluids (urine, blood, milk, cerebrospinal fluid, rinse fluid obtained from wash of body cavities, phlegm, pus), samples taken from various body regions (throat, vagina, ear, eye, skin, sores), food products (both solids and fluids) and swabs taken from medicinal instruments, apparatus, materials), as well as substances in which controlled chemical reactions are being carried out. As noted above, the biosensor chip, systems, kits and methods of the present disclosure may be also applicable for monitoring and quality check of food products, thus, in some embodiments, a sample may be food samples. As used herein, the term "food sample" means any sample obtained from, derived from, or representative of a food (or food product) and / or a food-related matrix, collected for purposes of testing, screening, quality control, process monitoring, and / or regulatory compliance. A food sample may comprise a solid, semi-solid, liquid, or powdered material and may be raw, cooked, pasteurized, fermented, frozen, chilled, dried, concentrated, reconstituted, or otherwise processed. Non-limiting examples of food samples include portions of food products (for example, meat, poultry, seafood, dairy, eggs, fruits, vegetables, grains, ready-to-eat foods, sauces, and beverages), ingredients and raw materials, intermediate and in-process materials, finished packaged goods, and composite samples. A food sample may further include extracts, filtrates, homogenates, swabs, rinsates, wash fluids, drips, brines, marinades, reconstitution water, and other fluids associated with food production, storage, transport, and / or preparation, and may optionally include concentrates, enrichments, lysates, or purified nucleic acid preparations derived therefrom.
[0250] A food sample may further encompass samples obtained from, or representative of, food preparation, processing, packaging, storage, handling, distribution, and / or retail facilities, including samples collected from food-contact surfaces and food-contact equipment (for example, conveyors, cutting tools, grinders, mixers, tanks, valves, and packaging lines), non-food-contact surfaces within the same environment, and facility environmental samples such as swabs, wipes, rinses, condensate, process water, ice, air or aerosol samples, drain and floor samples, and wastewater, to the extent such samples are collected for assessing contamination that may affect a food product.
[0251] In some particular embodiments, the sample useful in the disclosed methods is an environmental sample.
[0252] In some specific embodiments, the environmental sample comprises at least one sample obtained from at least one environmental source, for example, any water source.In some other embodiments, the environmental water source comprises at least one of natural water reservoir, artificial water reservoir, reclaimed water, treated wastewater and sewage.
[0253] Other embodiments of the present disclosure relate to the method as described above, for use in monitoring and evaluating quality and / or the pathogenic exposure potential in at least one environmental source. The method comprising repeating steps (a) to (c) as described above for at least two temporally separated samples obtained from the environmental source periodically. The term "quality" as used herein refers to the suitability of a specific environmental source for a particular use, determined by its physical, chemical, and biological characteristics. More specifically, the term quality encompasses factors such as the presence and / or concentration of contaminants and / or virulent genes and / or antibiotic resistant genes.
[0254] The term "pathogenic exposure potential" refers herein to the likelihood for encountering a pathogenic microbial target within a specific environmental source. This assessment encompasses factors such as the prevalence of the pathogen, as well as other factors, such as the organism's susceptibility to infection, and the opportunities for pathogen transmission.
[0255] "Environmental source" as used herein refers to any source from which an environmental sample may be obtained. This includes for example as detailed above any source of media (such as treated wastewater, sewage), surface matter, earth, soil, air and industrial, as well as any source of food and dairy processing instruments (eggs, meat, fish), apparatus, equipment, utensils, disposable and non-disposable items.
[0256] In order to monitor and evaluate the quality and / or the pathogenic exposure potential of at least one environmental source, at least two temporally-separated test samples must be collected from the environmental source periodically.
[0257] The number of samples collected and used for evaluation of the sample, for example, samples obtained from any biological or industrial source, and in particular of an environmental source, may change according to the frequency with which they are collected. For example, the samples may be collected at least every hour, every two hours, every six hours, every 12 hours, every day, every two days, every four days, every week, every two weeks, every two weeks, every month, every two months, every three months every four months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every year or even more. Furthermore, to assess the environmental source condition, it is understood that the change in presence and / or quantity of the at least one target nucleic acid sequence of the at least one microbial target, may be calculated as an average change over at least three samples taken in different time points, or the change may be calculated for every two samples collected at adjacenttime points. It should be appreciated that the sample may be obtained from the environmental source in the indicated time intervals for a period of several months or several years. More specifically, for a period of 1 year, for a period of 2 years, for a period of 3 years, for a period of 4 years, for a period of 5 years, for a period of 6 years, for a period of 7 years, for a period of 8 years, for a period of 9 years, for a period of 10 years, for a period of 11 years, for a period of 12 years, for a period of 13 years, for a period of 14 years, for a period of 15 years, for a period of 20 years, for a period of 50 years or more.
[0258] In some embodiments, the method of the present disclosure is for use in monitoring and evaluating the quality of food and / or the pathogenic exposure potential of at least one food source, the method comprising repeating steps (a) to (c), for at least two temporally separated samples obtained from the food source periodically. In some other embodiments, the method of the present disclosure is for use in monitoring and evaluating the pathogenic exposure potential of at least one clinical -related source, the method comprising repeating steps (a) to (c), for at least two temporally separated samples obtained from said clinical-related source periodically.
[0259] A "clinical-related source" as used herein, refers to any entity, material, or surface, directly connected to the healthcare or medical domain. It refers to any source from which a biological sample may be obtained. This encompasses a broad spectrum, including for example patients, healthcare providers, medical facilities. More specifically, the term further encompasses for examples, body fluids (urine, blood, milk, cerebrospinal fluid, rinse fluid obtained from wash of body cavities, phlegm, pus), samples taken from various body regions (throat, vagina, ear, eye, skin, sores), food products (both solids and fluids) and swabs taken from medicinal instruments, apparatus, materials), as well as substances in which controlled chemical reactions are being carried out.
[0260] In some embodiments, the methods of the present disclosure are applicable for use in monitoring and evaluating quality and / or the pathogenic exposure potential of at least one environmental water source. The method comprising repeating steps (a) to (c), for at least two time points during a continuous flow of the sample through the plurality of electrodes.
[0261] Another aspect of the present disclosure relates to a method for monitoring and evaluating quality and / or pathogenic exposure potential of an environmental water source, by continuous electrical analysis of at least one sample of the environmental water source. The method comprising the following steps: In step (a), contacting the at least one sample with a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip deviceor system comprising the same. The at least one working electrode is connected to at least one nucleic acid-based target-binding and / or affinity moiety, wherein said contacting is via continuous flow of the sample through said plurality of electrodes. The nucleic acid-based target-binding and / or affinity moiety specifically recognizes and binds at least one target nucleic acid sequence of at least one microbial target in the sample. In step (b), applying one or more voltage signals between said at least one working electrode and said at least one reference electrode, and determining electrical current between said electrodes in response to said one or more voltage signals. In step (c), determining one or more relations between electrical current response and the one or more voltage signals; and determining data indicative of presence and / or quantity of the at least one target nucleic acid sequence in the sample in accordance with the one or more relations. In step (d), repeating steps (a) to (c) for at least two temporally separated samples obtained from the environmental water source.
[0262] In some embodiments of the disclosed methods, the applying one or more voltage signals comprises applying one or more voltage signals in a selected number of one or more signal frequencies, and wherein the determining one or more relations comprises determining data indicative of impedance between the at least one working electrode and the at least one counter electrode wherein impedance variation being indicative of presence and / or quantity of the at least one target nucleic acid sequence of at least one microbial target in the sample.
[0263] In yet some further embodiments of the disclosed methods, the applying one or more voltage signals comprises applying one of more signal comprising cyclic voltage variation, and wherein the determining one or more relations comprises determining current transmission in relation to the cyclic voltage variation, the current transmission with respect to the cyclic voltage variation being indicative of presence and / or quantity of the at least one target nucleic acid sequence of at least one microbial target in the sample.
[0264] Still further, in some embodiments of the disclosed methods, applying one or more voltage signals comprises applying one of more signals of one or more selected voltages and determining current transmission in response; and wherein relations between current transmission and the one or more selected voltages being indicative of presence and / or quantity of the at least one target nucleic acid sequence of at least one microbial target in the sample.
[0265] In some embodiments, the method further comprises prior to step (a), at least one of the following steps: (i) nucleic acid extraction and / or preparation, specifically, DNA extraction from the at least one sample; (ii) fragmentation of the nucleic acids extracted from said sample and (iii) samplepurification. Still further, in some embodiments, step (a) of the disclosed methods comprises contacting the sample with the plurality of electrodes for about 20 to 50 minutes, specifically, for about 30 to about 35 minutes.
[0266] In some embodiments, the plurality of electrodes of the system used in the disclosed methods is located within a channel enabling flow of a sample therethrough. The sample used in this method is a fluid or fluidized sample. The fluid or fluidized sample is in contact with the plurality of electrodes when flowing through the channel.
[0267] In some embodiments, the plurality of electrodes is connectable to a detection circuit adapted for performing electrical analysis through the plurality of electrodes.
[0268] In some embodiments, the method further comprises the step for enrichment of at least one microbial target in the sample prior to step (a).
[0269] Another aspect of the present disclosure relates to a kit comprising: a biosensor chip system usable for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in a sample. The system comprising (i) a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same. The at least one working electrode is connected to at least one nucleic acid-based target-binding (or affinity) moiety. The plurality of electrodes is configured for electrical analysis of the sample.
[0270] In some optional embodiments, the kit may further comprise at least one of the following: (ii) reagents suitable for enrichment of the microbial target in the sample; and / or (iii) a dissociation module adapted to apply voltage biases that are suitable to drive a nucleic acid dissociation are employed by the system; and (iv) a temperature-control mode.
[0271] A "reagent" refers herein to a substance or compound added to the system to facilitate growth of at least one specific microbial target. Non limiting examples include culture media (which provides essential nutrients for microbial growth), elective agents (which inhibit the growth of unwanted microorganisms, such as antibiotics, dyes, salts, bile salts, etc.), differential agents (which allow for the visual differentiation of target microorganisms from others, such as lactose, pH indicators), buffering agents (to maintain a suitable pH, such as phosphate buffers, HEPES buffer, etc.) and reducing agents (to create anaerobic conditions for anaerobic organisms, such as sodium thioglycollate, cysteine, etc.).
[0272] A "temperature control mode" refers to the operational setting of a system or device that regulates temperature.In some embodiments, the plurality of electrodes of the biosensor chip system comprised in the disclosed kit is located within a channel enabling flow of a sample therethrough. The sample is a fluid or fluidized sample. The fluid or fluidized sample is in contact with the plurality of electrodes when flowing through the channel.
[0273] In some other embodiments, the plurality of electrodes is connectable to an incubation container. In some further embodiments, the plurality of electrodes is connectable to a detection circuit adapted for performing electrical analysis through said plurality of electrodes.
[0274] In some embodiments, the kit is adapted for performing any of the methods as defined by any of the aspects of the present disclosure as specified above.
[0275] The present disclosure demonstrates that the described electrochemical biosensor and methods achieve exceptionally high analytical performance, enabling reliable detection of nucleic acid targets at concentrations as low as 1 nM. The multiplexed biosensor exhibits both high sensitivity, with a clear, linear response across a broad concentration range, and high specificity, effectively distinguishing complementary target sequences from non-specific or unrelated DNA. The target-binding moieties of the biosensors of the present disclosure were designed in some embodiments to recognize two distinct regions of the target nucleic acid sequence, designated as the forward strand and reverse strand, allowing for dual-site binding and improved binding performance that further enhances detection specificity. These characteristics confirm the suitability of the disclosed platform for precise and rapid molecular detection in both laboratory and environmental applications.
[0276] It should be appreciated that any definitions, terms, and interpretations provided herein with respect to one aspect, embodiment, system, kit, or method of the present disclosure apply equally to, and are intended to govern, the use, construction, and interpretation of the biosensor chip system and its components in any and all other aspects, embodiments, systems, kits, and methods described herein, unless the context clearly indicates otherwise.
[0277] The term "about" as used herein indicates values that may deviate up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to 20% higher or lower than the value referred to, the deviation range including integer values, and, if applicable, non-integer values as well, constituting a continuous range. Thus, as used herein the term "about" refers to ± 10 %.
[0278] The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to". This term encompasses the terms "consisting of' and "consisting essentially of. The phrase "consisting essentially of' means that the composition or method mayinclude additional ingredients and / or steps, and / or parts, but only if the additional ingredients and / or steps do not materially alter the basic and novel characteristics of the claimed composition or method. Throughout this specification and the Examples and claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. It should be noted that various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging / ranges between" a first indicate number and a second indicate number and "ranging / ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals there between. As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0279] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub combination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0280] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.Disclosed and described, it is to be understood that this invention is not limited to the particular examples, methods steps, and compositions disclosed herein as such methods steps and compositions may vary somewhat. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only and not intended to be limiting since the scope of the present invention will be limited only by the appended claims and equivalents thereof.
[0281] It must be noted that, as used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise.
[0282] EXAMPLES
[0283] Experimental procedures
[0284] Design and fabrication of electrochemical biochips
[0285] The biochips developed for electrochemical (EC) biosensing experiments were based on a planar three-electrode configuration equipped with a measurement chamber. Two low-cost biochip versions were designed: a single-cell configuration (Version 1) and a multiplexed (multi-array) configuration (Version 2). Both versions of EC cells were comprised of a planar gold working electrode (WE), gold counter electrode (CE), and a silver / silver chloride (Ag / AgCl) reference electrode (RE) photolithographically defined and deposited on a silicon (Si / SiC>2) substrate. The chips were fabricated on silicon using a "lift-off1process. This process was carried out in a microfabrication facility (clean room) that provided a controlled atmosphere under 'class 100' conditions. The substrate used was a 4-inch silicon wafer with a thermally grown oxide layer of 300 nm on the front side of the wafer. For the version 1, a wafer-scaled fabrication process yields a wafer with thirty-one chips, each comprising three gold electrodes, while the multi array chips yields a wafer with eight chips, each containing forty-eight cells comprising three gold electrodes. REs were generated by electroplating Ag / AgCl on the designated electrode in each cell chip. All electrodes were simultaneously electroplated. Finally, the wafer was diced into individual chips. The electroplated Ag / AgCl RE and EC chips were characterized independently.
[0286] Fabrication of Single-Cell Biochips (Version 1)
[0287] Microelectronic fabrication techniques, specifically photolithography and sputtering, were employed to fabricate the biochips. The EC chips were manufactured using a photolithography process in which a photomask was used to define the pattern layer. The photomask was aligned using a mask aligner, and following light exposure, the pattern was projected onto the wafer.The silicon wafer was first cleaned using acetone (ACT), isopropanol (IP A), and deionized water (DIW). A layer of photoresist (PR) was spin-coated onto the wafer, followed by soft baking. The desired electrode patterns were transferred to the wafer using a photomask and UV exposure. After development, the unexposed photoresist was removed. After development, the next step was gold deposition by evaporation or sputtering. An adhesion layer of ~10nm Cr (or lOnm Ti) was deposited prior to 80nm gold deposition. The final step was Tift off where the photoresist under the gold layer was dissolved by an organic solvent, removing the gold layer on top of it and leaving only the gold defining the electrode pattern. The Tift off process yields a wafer with thirty -one chips, each containing three gold electrodes.
[0288] Fabrication of Multi-Array Biochips (Version 2)
[0289] The multi-array chips were fabricated using a combination of photolithography and sputtering. The process began by cleaning the wafer using either Plasma Preen for 5 minutes followed by baking at 110°C for 10 minutes, or by washing with ACT, IP A, and DIW. A layer of LOR5A was spin-coated at 500 rpm for 10 seconds, followed by 3000 rpm for 40 seconds. This was followed by the spin-coating of AZ1518, a positive photoresist, at 500 rpm for 10 seconds and 4000 rpm for 40 seconds. A soft bake was then performed at 110°C for 90 seconds. The wafer was exposed using the Mask Aligner MA6 GEN4, and the pattern was developed by immersing the wafer in AZ726 developer for 90 seconds, followed by rinsing with DIW and drying with nitrogen gas (N2). Thin metal layers (10 nm chromium / titanium and 80 nm gold) were deposited using the Magnetron Sputtering Vinci system, a physical vapor deposition method. The lift-off process was employed to remove undesired gold and PR, leaving only the electrode pattern.
[0290] Following lift-off, 100 nm silicon nitride (SislSU) passivation layer was deposited across the entire wafer using Plasma Enhanced Chemical Vapor Deposition (PECVD) via the PlasmaTherm system. A second lithography step using an image reversal photoresist was then performed to open the electrode areas and connectors and also for subsequent electroplating. This process utilized a special crosslinking agent that became active at temperatures above 110°C in exposed areas, forming an insoluble polymer, while unexposed areas remained light-sensitive and behaved like a positive photoresist. A flood exposure rendered the unexposed areas soluble in the developer, producing a negative image of the mask pattern suitable for etching. So, the wafer was exposed to UV light, reversal baked at 120°C for 60 seconds, and flood-exposed to define a negative mask pattern, and then transferred into the developer. Following development, the silicon nitride was etched using Reactive Ion Etching (RIE) with the Oerlikon system to remove the passivation layerand expose the electrodes (measurement chamber) and connectors. The wafer was then prepared for electroplating.
[0291] Electroplating of Quasi-Ag / AgCl Reference Electrodes
[0292] Silver was electroplated onto the square-shaped gold electrodes designated as REs, followed by anodic oxidation to form a silver chloride (AgCl) layer. The REs shared a common contact to enable simultaneous Ag / AgCl electroplating.
[0293] Before electroplating, the wafer was cleaned with ACT, IP A, and DIW, then dried with N2. Nail enamel was applied to insulate the areas outside the electrodes and prevent unwanted deposition. Once hardened, the wafer was positioned in a custom plating setup that included a Perspex™ container and specialized holders for the wafer and electrodes. The common contact of the electrodes was connected to the WE of a potentiostat, while the reference and counter terminals were short-circuited and connected to a silver plate anode.
[0294] Electroplating was performed under conducted under galvanostatic control (chronopotentiometry) for 600 seconds at a fixed current using potentiostat. A uniform white, lustrous silver layer formed on the REs. The wafer was then rinsed with DIW and dried with N2, preparing it for AgCl anodization. To generate the AgCl layer, the silver-coated electrodes were anodized in a 0.1 M HC1 solution using a potentiostatic process (chronoamperometry) at 0.22 V. The process duration was determined by the charge passed through the electrodes, corresponding to one-third to one-fourth of the deposited silver layer. Once the desired charge was achieved, the process was terminated. After anodization, nail enamel was removed with ACT and IP A, and the wafers were cleaned with DIW and dried with N2.
[0295] Reference electrode characterization
[0296] Upon the completion of the biochip fabrication process each quasi-Ag / AgCl RE was characterized by checking its Nernstian response. This RE verification was carried out by measuring the potential between the RE of the chip and a commercial Ag / AgCl in KC1 calibration solutions prepared by logarithmic dilutions. Briefly, NaCl solutions of 3 M (saturated), 0.6 M (5 times diluted which was 0.12 of saturated), 0.12 M (0.04 of saturated) and 0.024 M (0.08 of saturated) were prepared in beakers. The chip and the commercial Ag / AgCl were soaked in each solution and potential was measured and recorded by a DVM (digital voltmeter). The potentials were plotted as a function of the log of KC1 concentration.
[0297] Electrochemical characterization of biochips
[0298] Prior to electrochemical measurements each biochip was characterized by determining the redox behavior of the ferri- and ferrocyanide redox couple (lUFelCNk / I FelCNf,) in a cyclicvoltammetry analysis. Two measured parameters of interest on these i-E curves (voltammograms) were the ratio of anodic to cathodic peak currents, ipa / ipc, and the separation of peak potentials, Epa-EPc. For a voltammetric “Nernstian” wave with a stable product, ipa / iPc = 1 regardless of scan rate and diffusion coefficients. Deviation of the ratio ipa / ipcfrom unity is indicative of homogeneous kinetic or other complications in the electrode process. The peak current for a reversible process is given by the Randles-Sevick equation: ip= (2.69 x 105) n3 / 2AD1 / 2Cv1 / 2. At 25°C, A is the electrode surface area (cm2), D is the diffusion coefficient (cm2 / s), C is the concentration of the electroactive species (mol / cm3) and v is the scan rate (V / sec). Therefore, ipis proportional to C and proportional to v1 / 2.
[0299] Chip Cleaning
[0300] 1.1. Prepare Piranha Solution:
[0301] 1. Mix sulfuric acid and hydrogen peroxide 30% in a ratio of 3 parts sulfuric acid to 1 part hydrogen peroxide.
[0302] 2. Transfer 500 microliters of the freshly prepared piranha solution into separate tubes. 3. Prepare the same number of tubes as piranha solution tubes.
[0303] 4. Fill each tube with 500 microliters of water.
[0304] 5. Immerse the chips into the piranha solution.
[0305] 6. Wait for 10 minutes while the chips are immersed in the piranha solution.
[0306] 7. Carefully remove the chips from the piranha solution.
[0307] 8. Rinse the chips thoroughly with deionized water.
[0308] 9. Insert the cleaned chips into the prepared water tubes.
[0309] 1.2. stripping:
[0310] 10. Prepare a small beaker and fill it with 2.5 ml of 0.5 mM H2SO4 solution.
[0311] 11. use external reference for this procedure.
[0312] 12. Open the stripping setting on the computer.
[0313] 13. Run the stripping procedure individually for each chip according to the established parameters.
[0314] 14. After stripping, rinse the chips thoroughly with deionized water to remove any residual stripping solution or contaminants.
[0315] 15. Ensure the chips are clean before proceeding to the next step.
[0316] 16. Transfer the washed chips into closed tubes for further usage.SAM solution preparation '.
[0317] 1. Weigh the required amount of SAM powder (11 -amino 1 -undecane thiol) using an accurate balance.
[0318] 2. Calculate the volume of dilution liquid needed to dilute the SAM powder to achieve a concentration of 5 mM.
[0319] 3. Prepare a solution consisting of 10% ammonium hydroxide and 90% ethanol.
[0320] 4. Add the calculated volume of dilution liquid to the SAM powder in a suitable tube.
[0321] 5. Mix thoroughly until the SAM powder is completely dissolved.
[0322] 6. Subject the tube to sonication for 10 minutes to ensure uniform mixing and dissolution of the SAM solution.
[0323] Platform usage '.
[0324] 1. Verify that both the platform and the PDMS cubes are clean. If not, wash the platform with ethanol and water, and sonicate the PDMS cubes for 10 minutes to remove any contaminants.
[0325] 2. Place the chips inside the designated positions on the platform, ensuring each chip is correctly positioned.
[0326] 3. Position a PDMS cube on top of each chip, ensuring that the hole on the cube aligns precisely with the working electrode (WE) area of the chip.
[0327] 4. Secure the upper part of the platform evenly and tightly.
[0328] 5. Load 70 pL of the SAM solution into each cell of the platform
[0329] 6. Carefully inspect each cell to ensure there are no air bubbles present. Air bubbles can interfere with the experiment and should be removed if found.
[0330] 7. Seal each cell with a suitable sealing sticker to prevent evaporation during the incubation.
[0331] 8. Place the sealed platform in a dark environment at room temperature for a minimum of 24 hours to allow the SAM molecules to self-assemble on the chip surface.
[0332] Post-SAM Incubation Treatment'.
[0333] 1. After the SAM incubation period, release the upper part of the platform.
[0334] 2. Wash the chips with ethanol followed by water.
[0335] 3. Dry the chips with N2.
[0336] 4. Measure the chips inside a small beaker containing 10 mM FeCN6 solution.
[0337] 5. Wash and dry the chips again to remove any residues.
[0338] 6. Thaw the probe DNA by placing it in a hot bath with agitation for about 10 minutes at 56 degrees Celsius.7. In a separate tube, mix the appropriate amount of probe DNA with 0.1% glutaraldehyde diluted in PBS 7.4. Maintain a ratio of 5: 1 in favor of the probe DNA.
[0339] 8. Transfer the chips into a 6-well plate for probe DNA loading.
[0340] 9. In each well, load 5 pL of the prepared probe DNA solution onto the chips. Ensure that the probe DNA targets only the working electrode (WE) surface of the chips.
[0341] 10. Close the 6-well plate with the chips.
[0342] 11. Place the plate in a dark environment and leave it undisturbed for 2 hours.
[0343] Post-Probe Incubation Treatment:
[0344] 1. After the probe DNA incubation period, rinse the chips with PBS 7.4.
[0345] 2. Do not dry the chips; allow them to air dry on their own.
[0346] 3. If measurements need to be taken immediately after the probe DNA incubation, proceed according to sections (34-35) of the protocol.
[0347] 4. Prepare a 1 mM solution of 6-mercaptohexanol (MCH) in ethanol.
[0348] 5. Transfer 500 microliters of the prepared MCH solution to tubes, according to the number of chips you have.
[0349] 6. Insert the chips into the tubes containing the MCH solution.
[0350] 7. Incubate the chips for 1 hour at room temperature.
[0351] 8. Thaw the target DNA by placing it in a hot bath with agitation, following the same procedure as done for the probe DNA earlier (Step 36).
[0352] 9. Load the appropriate concentration of target DNA onto the chips inside a 6-well plate.
[0353] 10. After the target DNA incubation period, rinse the chips with PBS 7.4.
[0354] 11. Do not dry the chips; allow them to air dry on their own.
[0355] 12. Measure the chips inside a small beaker containing 10 mM FeCN6 solution.
[0356] DNA sequences
[0357] Aminated probe:
[0358] 57AmMC6 / AAAAAAAAATTGCAGCCGAGCCATGC / 3’, as denoted by SEQ ID NO: 3. Complementary Target:
[0359] 57 GCATGGCTCGGCTGCAATT / 3’, as denoted by SEQ ID NO: 1.
[0360] Non-complementary target:
[0361] 57TCGTGACGACTGTCGAGCT / 3’, as denoted by SEQ ID NO: 4.
[0362] SAM
[0363] 11-Amino-l -undecanethiol hydrochloride:
[0364] HSCH2(CH2)9CH2NH2 HC1Blocking:
[0365] 6-Mercapto-l -hexanol: HS(CH2)eOH
[0366] Sampling and processing of water samples
[0367] A grab sample of 250ml of treated wastewater effluent or effluent-receiving surface water was collected in sterile PP plastic collection tubes and filtered through 0.45 pm nitrocellulose membranes. Membranes were transferred to 15 ml sterile culture tubes containing either 10 ml of 0.9% saline for direct DNA extraction, or 10 ml of brain heart infusion broth (BHI; Himedia cat#M210) for enrichment, as described below. Both sample types were vortexed vigorously to release biomass from the filter into liquid.
[0368] Surface samples
[0369] A surface swabbing protocol using a sterile swab or sponge to vigorously rub a defined surface area (e.g., lOxlOcm for swabs, larger for sponges) in multiple directions (vertical, horizontal, diagonal) to collect bacteria, then placing it in 15 ml sterile culture tubes containing either 10 ml of 0.9% saline for direct DNA extraction, or 10 ml of brain heart infusion broth (BHI; Himedia cat#M210) for enrichment, as described below. Both sample types were vortexed vigorously to release biomass from the filter into liquid.
[0370] Aqueous samples
[0371] A grab sample of 250ml of aqueous sample (water, urine, treated wastewater effluent, etc.) was collected in sterile PP plastic collection tubes and filtered through 0.45 pm nitrocellulose membranes. Membranes were transferred to 15 ml sterile culture tubes containing either 10 ml of 0.9% saline for direct DNA extraction, or 10 ml of brain heart infusion broth (BHI; Himedia cat#M210) for enrichment, as described below. Both sample types were vortexed vigorously to release biomass from the filter into liquid.
[0372] DNA extraction
[0373] Sample were centrifuged at 5,000 x g for 5 minutes. Supernatants were removed and pellets were suspended in 300 pL of TENT buffer (10 mM Tris-HCl, 0.1 M NaCl, 1 mM EDTA, 5% [v / v] Triton X100, pH 8.0) [Hassanzadeh et al. Iranian Journal of Public Health; Tehran Vol. 45, Iss. 8, (Aug 2016): 1093-1095] and subsequently subjected to one of the three following lysis strategies: (i) Heating (95°C for 15 minutes); (ii) Microwave digestion (30% power for 20 seconds, followed by 30 seconds on ice); or (iii) Sonication (Imin, followed by 30 seconds on ice, repeat 5 times). Samples were then centrifuged at 5,000 x g for 5 minutes, and supernatants were transferred into a new sterile tube, which was amended with 2-volumes of cold 95% ethanol, and incubated at -20 °C for 20 min. Tubes were then centrifuged at 5,000 x g for 5 minutes, afterwhich supernatants were removed, and the DNA-containing pellet was dissolved in 50 pl sterile distilled water. A total of 5 pl DNA solution was used in the biosensor analysis.
[0374] Enrichment
[0375] To increase signal to noise ratio (i.e. relative abundance of pathogen associated bacterial taxa and associated antibiotic resistant genes), BHI broth samples described above were diluted 1:10 in fresh BHI broth and incubated at 37°C at 180 rpm shaking for 1-4.5 hours. DNA was extracted from these samples as described above.
[0376] EXAMPLE 1
[0377] Design of the electrochemical biosensor
[0378] The inventors have previously designed electrochemical (EC) biosensors, consisting of a biochip containing a miniaturized EC cell configured with a micro-working electrode array and interfacing a USB-stick potentiostat. These microelectrodes are individually addressable and are therefore capable of a highly multiplexed target detection when functionalized with specific antibodies, enzymes, receptors, or DNA probes.
[0379] The miniaturized EC cell array was designed and fabricated on a Si / SiC>2 substrate by a combination of photolithography and physical vapor deposition. Two photolithography masks were designed: the first was used for EC chips patterning through positive photoresist, and the second for insulation of connectors through negative photoresist. An example of a multiplexed electrochemical cell array chip comprising 12 individual electrochemical chips, or 48 individual electrochemical chips is shown in Figure 1A and Figure 7, respectively. Gold microelectrodes (150 pm) were deposited, and Ag / AgCl reference electrodes were electroplated. Electrode topography was characterized by optical microscopy, scanning electron microscopy (SEM), and atomic force microscopy (AFM). The chips’ EC cells were configured with micro-working, counter and reference electrodes, contacted through a commercially available chip carrier to a multi-potentiostat circuit. Prior to functionalization, the chips are thoroughly cleaned by a combination of chemical, “Piranha” etching and electrochemical stripping, as follows: Piranha solution is prepared by mixing sulfuric acid and hydrogen peroxide 30% in a ratio of 3 parts sulfuric acid to 1-part hydrogen peroxide. Chips are immersed for 10 min in the Piranha solution and then carefully removed and thoroughly rinsed with deionized water. Subsequently the chips undergo a stripping procedure that continuous voltage cycling in a 0.5 mM sulfuric acid solution until a “flat” voltammogram is visible, indicating no active moieties on the electrodes surface. Self-assembled Monolayer preparation: 5 mM of 11-amino 1-undecane thiol(HSCH2(CH2)9CH2NH2 • HC1) are prepared in 90% ethanol and 10% ammonium hydroxide. The solution is mixed until SAM powder is completely dissolved. The solution is then sonicated for 10 min to ensure uniform mixing and dissolution of the SAM solution. The generation of SAM on the chips’ electrode surface is carried out in a designated Teflon platform: chips are placed inside the designated positions on the platform, and a PDMS cube is stamped on top of each chip, exposing the surface are of the working electrode. The SAM solution is loaded onto each working electrode and the platform is sealed to prevent evaporation. The chips are thus incubated overnight in the dark at room temperature to allow the SAM molecules to self-assemble on the electrode surface. Following incubation, the chips were characterized by cyclic voltammetry and electrochemical impedance spectroscopy.
[0380] The micro-working electrodes were functionalized with ssDNA oligomer probes that target selected virulence and ARG markers. The strategy for covalent binding of the probes relies on well-established thiol-gold chemistry and self-assembled monolayers (SAM). This process involves two key steps, illustrated in Figure 2A. First, the working electrode surface is modified with alkane thiol using gold-thiol chemistry, as previously described. This enables subsequent bioconjugation of capture probes. An example of the probe functionalization process is schematically illustrated in Figure 2B. Specific capture probes targeting blaCTX-M, a gene encoding a class A extended- spectrum P-lactamase (ESBL):
[0381] 57 Am MC6 / AAAAAAAAATTGCAGCCGAGCCATGC / 3’, as denoted by SEQ ID NO: 3, that is complementary to the target 5 ’-GCA TGG CTC GGC TGC AAT T-3’, as denoted by SEQ ID NO: 1, are synthesized, featuring amine modification at the 5’ end. The probe DNA was thawed in a hot bath with agitation for about 10 minutes at 56 degrees Celsius. The aminated probes are then mixed with a 0.1% glutaraldehyde solution (10:1 v / v) and applied onto SAM-modified electrodes, to complete the cross-linking process. Following probe DNA incubation for 2 hours in room temperature, chips are rinsed with PBS 7.4. An additional electrode surface blocking step is performed by a 1-hour incubation of a solution containing 1 mM 6-mercaptohexanol (MCH, HS(CH2)6OH) in ethanol on the chips, followed by rinsing, as previously described. Careful finetuning of the immobilization reaction was required to ensure ssDNA accessibility. Electrode functionalization was characterized and verified by using fluorescently labeled probes (or DNA intercalating dyes), as shown in Figure 1A. Furthermore, hybridization of DNA target with the probe was similarly verified as shown in Figure 4. An intense green emission from the chips functionalized with fluorescently labeled ssDNA probe (probe-FAM) is shown in Figure 4B, indicating successful probe DNA immobilization. This fluorescence was visible even afterrigorous rinsing of the electrodes. Strong red fluorescence, as seen in Figure 4C, following hybridization with the Cy5-labeled DNA target (target ssDNA labeled with the fluorescent dye Cy5) confirms the efficient functionalization and hybridization on the EC chip. Figure 4D shows the overlay of green and red fluorescence, demonstrating the on-chip hybridization of the tagged probe and target oligonucleotides. Surface coverage density and layer thickness were further studied using AFM, XPS, and electroanalytical techniques. The covalently immobilized oligomers remained bound to the electrode surface even after vigorous rinsing, as seen by microscopic analysis of attached fluorescently labelled oligomers (Figure 1A, right).
[0382] The electrochemical response of SAM-modified and oligo probe DNA-functionalized electrodes was characterized using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). CV analysis (Figure 3A) showed a gradual decrease in redox current peaks (Ip) corresponding to the organic layers added to the electrode surface.
[0383] Functionalization with oligomers (Figure IB) significantly increased the RCT compared with non-specifically adsorbed oligomers used as a control (Figure 1C). The RCT change was shown to be concentration-dependent (Figure ID). Immobilization of a ssDNA probe resulted in more than a 300% increase in RCT, compared with a bare electrode, as shown in Figure 3B and Figure 3C.
[0384] Finally, hybridization with a complementary target sequence (Figure IE and Figure 3D), resulted in a significant RCT increase (900%) compared with a bare electrode. The total assay time was < 30 min.
[0385] EXAMPLE 2
[0386] Design and manufacture of a measurement platform
[0387] Impedance methods are capable of characterizing physicochemical processes by measuring the relationship between the current and the applied potential difference by sampling current within a frequency range. Typically, hybridization of surface-immobilized and complementary strands impedes the electron transfer of a redox probe on the electrode surface, resulting in changes in charge transfer resistance (Ref). Electroanalytical parameters such as scan rates, sampling frequencies, and voltage amplitudes may be adjusted. The effect of ionic strength, pH, and temperature on the resulting impedance signal and signal -to-noise ratio (SNR) may be explored. Calibration curves can be generated and the LOD and dynamic range determined.
[0388] Expanding the multiplexed biosensor to include additional “target” indicators: different microelectrodes in the array are segmented to ‘biosensing regions’ and all electrodes in each region are then functionalized with each probe from the exhaustive list provided by thorough analysis.Design and manufacture of a measurement platform
[0389] A compact measurement platform consists of a package accommodating the biochip, containing electrolyte and reservoir chambers and also provides electrical contacts and an interface with a compact, hand-held multi-potentiostat device. This platform also enables hydrodynamic measurements.
[0390] Calibration of biosensor with multiple targets
[0391] Concentration-dependent signal characteristics were studied (in order to calibrate the biosensor with multiple target genomic sequences at different concentrations). The targets are acquired by standard DNA extraction and purification from bacteria. Finally, EC detection of pathogen indicators and ARG markers in anthropogenically impacted environmental samples including raw sewage and effluent samples is enabled. In an effort to optimize for minimal pre-treatment and sample handling, the effect of sample processing (i.e. DNA extraction procedures) on the SNR is explored and measurement techniques are optimized to achieve the highest possible SNR with minimal sample pre-treatment. The goal is to demonstrate the detection of multiple target sequences from a sample containing disrupted bacteria cells. A schematic illustration of the biosensor platform is shown in Figure 5.
[0392] EXAMPLE 3
[0393] Fluorescence characterization of probe conjugation
[0394] Functionalization proceeded through self-assembled monolayer modification of the working electrode followed by covalent immobilization of activated ssDNA oligomer probe. Capture probe immobilization and target DNA hybridization were investigated using fluorescence microscopy. The 3’ end of the amine-terminated probe was modified with Fluorescein amidites ( / 5-Amine / AAA AAA AAA TTG CAG CCG AGC CAT GC / -3-6-FAM, as denoted by SEQ ID NO: 3). Hybridization with Cyanine5 (Cy5)- tagged target DNA (5-Cy5 / GCA TGG CTC GGC TGC AAT T, as denoted by SEQ ID NO: 1) was observed under excitation at 493 nm and emission at 517 nm for probe DNA-FAM, and 651 nm excitation with emission at 670 nm for target DNA-Cy5. Fluorescence labeling of the probe and the target (using different fluorophores: FAM-tagged probe and Cy5-tagged target) yielded the results shown in Figure 4. As seen in Figure 4, following probe immobilization and target incubation, the emission of both fluorescent tags is visible. More Specifically, the optical image of Fig. 4A, shows the working electrode in bright field. Fig.
[0395] 4B depicts intense green emission from probe-FAM functionalized chips, indicating successfulprobe DNA immobilization. This fluorescence was visible even after rigorous rinsing of the electrodes. Strong red fluorescence, as seen in Fig. 4C, following hybridization with the Cy5-labeled DNA- target confirms the efficient functionalization and hybridization on the EC chip. Fig. 4D shows the overlay of green and red fluorescence, demonstrating the on-chip hybridization of the tagged probe and target oligonucleotides
[0396] Following incubation with target DNA, a concentration dependent increase in charge trasfer resistance is observed, as shown in Figure 8 and in Figure 2A (right panel).
[0397] EXAMPLE 4
[0398] A prototype chip design and development
[0399] Design
[0400] A prototype chip was fabricated according to the design shown in Figure 6 and Figure 7A. The chip contains 48 individual electrochemical cells arranged in 2 segments (Figure 6A Figure 7A).
[0401] The chip is contacted thru a Printed circuit board (Figure 6B) and held inside a package (Figure 6C) that also contains a flow cell, as shown in the scheme in Figure 6D.
[0402] Development of a prototype EC biosensor
[0403] A multiplexed electrochemical chip was designed and fabricated, consisting of 48 individual electrochemical cells, each configured with a planar three -el ectrode system. Unlike conventional microarray electrodes, each miniaturized cell contains its own working, counter, and reference electrodes, enabling true multiplexing and allowing each cell to operate independently within a single integrated platform. It should be noted that such multiplexed electrochemical chip may be designed with any number of electrochemical cells, and that the number of 48 individual cells is selected for the specific biosensor and is a none limiting example. The chips were fabricated using standard microfabrication processes on p-doped Si / SiO2 substrates with a 285nm thermally grown oxide layer. Photolithography defined the electrode patterns, followed by gold deposition (100 nm thick Au) via sputtering. The wafer-scale process yielded 8 individual chips, each comprising 48 EC cells with three gold electrodes and contact pads. To generate on-chip quasi-reference electrodes, Ag / AgCl was electroplated onto all perspective reference electrodes. After fabrication, the wafers were diced into individual chips (Fig.9A). A dedicated, in-house measurement platform was custom-designed, manufactured, and assembled, serving as the essential interface for parallel electrochemical analysis. The platform was built around a custom socket (a commercially available chip carrier) within a custom-built chip chamber, where the 48-cell multiplexed chip is securely positioned (Fig. 9B). A printed circuit board (PCB) connects the chip's contact pads tothe external circuit. Each electrode on the chip is routed to individual outlets through the PCB, ensuring independent and stable electrical access. This design guarantees that all 48 cells (or any other number of cells used in the device) can be addressed individually without compromising measurement integrity.
[0404] To facilitate solution handling, a newly designed microfluidic setup was developed using PDMS (polydimethylsiloxane) molds (Fig. 9C), and two complementary modules were prepared and tested. The first module utilized a pool-like geometry, allowing bulk solution to cover the chip surface during static measurements in a uniform environment. The second module incorporated a microfluidic channel, enabling controlled delivery and dynamic flow of solutions across the electrodes. These complementary designs provide flexibility for different experimental requirements, from static measurements in a uniform environment to dynamic assays under flow conditions.
[0405] The robust electrical interface ensures low-noise, reproducible recordings. The platform was designed to integrate seamlessly with an external multi-channel potentiostat: by wiring each electrode outlet from the socket to external connectors, the system enables direct parallel measurements across multiple cells (Fig. 9D). This configuration eliminates the need for sequential testing of electrodes, significantly reduces experimental time, and improves data consistency by allowing measurements under identical conditions, thereby establishing the foundation for high-throughput multiplexed assays.
[0406] EXAMPLE 5
[0407] Probe immobilization and functionalization
[0408] Targeting multiple regions within a single gene provides increased specificity and confidence in detection. Therefore, the P-lactamase gene was selected, and two distinct regions, at the 5' and 3' ends of the coding sequence, were chosen. These were designated as the forward strand and reverse strand, allowing for dual-site binding and improved probe performance.
[0409] The blaCTX-M P-lactamase gene was the first ARG integrated into the biochip, due to its clinical relevance and recent results from the Cytryn lab that underlined that it is abundant in low quality effluent and associated irrigated crops. To enhance specificity, two probes corresponding to previously published forward and reverse PCR primers were used. Surface immobilization of the forward and reverse probes targeting the 5’-di-thiol-modified oligonucleotides were used. Each probe was specific to a distinct region, either the 5' or 3' end of the gene. Prior to immobilization, the probes (50 pM final concentration) were activated using the reducing agent TCEP (Tris(2-carboxy ethyl) phosphine) at a 1 : 100 ratio and incubated for 1 hour at room temperature to reduce disulfide bonds and expose free thiol groups. Following activation, 5 pL of the probe solution was applied to the surface of the pre-cleaned gold working electrodes on the chip, which had been mounted on a PDMS platform. The chip was then incubated at 37 °C for 2 hours to allow selfassembly of the thiolated DNA onto the gold surface. Unbound sites were subsequently passivated using 1 mM 6-mercaptohexanol (6-MCH) to minimize nonspecific adsorption. Fig. 10 presents a schematic illustration of the functionalization mechanism.
[0410] For target detection, the hybridization behavior was studied using complementary short targets specific to each strand independently, as well as using a single long synthetic 100-mer target containing both complementary sequences at its 5’ and 3’ ends. This approach allowed to evaluate both individual probe performance and cooperative binding effects when both regions of the gene are simultaneously recognized. To support future optimization and integration into the multiplexed chip platform, further characterization of probe immobilization and hybridization efficiency are followed, using fluorescence imaging, Raman spectroscopy, and electrochemical methods as previously established.
[0411] EXAMPLE 6
[0412] Calibration with Synthetic DNA
[0413] Different concentrations of the ESBL CTXM target gene (SEQ ID NO; 1, at 1, 10, 100, 1000, and 50000 nM in 10 mM Tris-EDTA buffer, pH 7.4) were measured along with a negative (non-complementary) control probe (50 pM: 5'-AACACGACGTCAGCGTACG-3', SEQ ID NO; 10) with the probe-functionalized biochip (GE-probe-blocking) by hybridizing at 37°C for 1 hour in a humidity chamber. Electrochemical impedance spectroscopy (EIS) was then performed using a potential amplitude of 5 mV and a frequency range of 100 kHz to 10 Hz in 10 mM K3[Fe(CN)e], The obtained Nyquist plots were fitted to the corresponding Randles equivalent circuit (Randles 1947) (Fig. 11 A, inset), and the percent change in charge transfer resistance RCT) was determined. The values were normalized after subtracting the background RCT (GE-Probe-blocking denoted Rcro) using the following equation: A RC = (RCT - RCTO / RCTO X 100%.
[0414] Figure 11 shows the Nyquist plots obtained for different concentrations of the 19mer ESBL CTXM target (ranging from 1 nM to 50 pM), along with the negative control (50 pM). The corresponding increase in charge transfer resistance (RCT in ohms) is summarized in the bar graph in Figure 11B. Figure 3C presents a bar graph illustrating the dose-dependent response of RCT(%) against target DNA concentrations, demonstrating a good linear fit.These results confirm that the developed EIS biosensor responds to different target DNA concentrations and enables sensitive detection of the ESBL CTXM DNA target, with a detection limit as low as 1 nM.
[0415] The capacity of the chip to detect longer fragments (lOOmer) of blaCTX-M DNA targets, was next evaluated employing different types of custom-synthesized thiol-modified oligo probes. The details of these probes and their corresponding targets are summarized in Table 1 and graphically represented in Figure 12A. Figure 12B shows the Nyquist plots obtained for different concentrations of the lOOmer blaCTX-M target (ranging from 1 nM to 100 nM), along with the negative control (50 pM), using a reverse oligo probe (CTX-MR)-functionalized biochip. The corresponding increase in charge transfer resistance (ACT in ohms) is summarized in the bar graph in Figure 4C. The bar graph in Figure 4D illustrates the dose-dependent response of 1 RCT (%) against target DNA concentrations, demonstrating a good linear fit. These results confirm that the developed EIS biosensor can distinguish between different concentrations of a longer fragment of the blaCTX-M DNA target and enables sensitive detection with a limit as low as 1 nM.
[0416]
[0417] Table 1. blaCTX-M specific probes and their target sequences
[0418] Similarly, the detection of a lOOmer blaCTX-M target was carried out using a forward probe (bla CTX-MF)-functionalized EC biochip. Figure 13A shows the Nyquist plots obtained for different concentrations of 100-mer target (0.001, 0.01, 0.1, 1, 10, and 50 pM) along with negative control (50 pM). The corresponding increase in charge transfer resistance (Rcrm ' ohms) is summarized in the bar graph in Figure 13B. The bar graph in Figure 3C illustrates the dose-dependent response of Rcr (%) against target DNA concentrations, demonstrating a good linear fit. These results confirm that longer fragments of the forward blaCTX-M DNA target can also be detected by thedeveloped EIS biosensor with a detection limit as low as 1 nM. These forward and reverse probes can effectively detect the blaCTX-M target even at very low concentrations. Importantly, these probes can be used for bi-functionalization of an EC biochip to enhance detection sensitivity and efficiency.
[0419] EXAMPLE 7
[0420] Measurement of purified targets from E.coli and blaCTX-M in synthetic wastewater Two parallel lines of investigation were established. First the sensor’s capacity to detect longer DNA strands, was evaluated by adjusting hybridization conditions and probe design. Second, rapid, low-cost fragmentation protocols (thermal, sonication, enzymatic) that will reliably reduce genomic DNA to short (<200 nt) fragments are developed and optimized.
[0421] Moving towards validation, a wastewater model spiked with selected targets at different lengths was used. A synthetic wastewater model (SWW) was prepared using a previously reported method [Lim S. et al. (2012) Desalination 287, 209-215] as follows (g / L): glucose, 1.0; yeast extract, 0.05; bactopeptone, 0.05; (NH^SC , 0.5; K2H2PO4, 0.3; KH2PO4, 0.3; MgSCN, 0.009; FeCL, 0.0002; NaCl, 0.007; CaCE, 0.0002; and NaHCCh, 0.15, all dissolved in sterile Milli-Q water. The SWW was then spiked separately with 100 nM of blaCTX-M target DNA (19mer and lOOmer) for further validation studies.
[0422] For validation, ESBL and blaCTX-M-specific oligo probes (ESBL CTX-M 5'-SH 19mer and blaCTX-M R-5'-SH 20mer) were functionalized onto a biochip. The functionalized biochip was then used to validate the EIS biosensor's ability to detect the ESBL CTXM and blaCTX-M target DNAs (19mer and lOOmer, respectively) following the method described above.
[0423] Figure 14A shows the Nyquist plot validating the EIS biosensor for detecting blaCTX-M gene fragments (19mer and lOOmer, 100 nM) in SWW, along with the control SWW. The results show a significant increase in resistance in the blaCTX-M target DNA-spiked SWW compared to the control SWW spiked with non-specific DNA. The corresponding Rcr values are shown in the bar graph in Figure 14B, confirming the same trend. The bar graph in Figure 14C shows a significant increase in A / c / (%) for EIS detection of blaCTX-M target DNA (19mer and lOOmer) in spiked SWW compared to the SWW control. These results confirm that the developed EIS biosensor is capable of detecting different lengths of blaCTX-M DNA targets in a complex wastewater-like matrix.Validation with non-specific target DNA.
[0424] The developed EIS biosensor for the ESBL CTXM probe-target system was further crossvalidated against the E. coli uidA probe-target system using both forward and reverse probes.
[0425] Figures 17A and 15B and present bar graphs demonstrating significantly higher ARcr (%) values for both ESBL CTXM probes with their respective targets, as well as for E. coli uidA probes with their corresponding targets. In contrast, markedly lower ARcr (%) values were observed during cross-hybridization experiments, where ESBL CTXM probes were tested against E. coli uidA targets and vice versa. These findings highlight that the developed EIS biosensor exhibits excellent sequence specificity, as it is able to clearly discriminate between complementary and non-complementary targets.
[0426] EXAMPLE 8
[0427] Kinetic Study with Purified Targets
[0428] DNA hybridization kinetics experiments were performed using electrochemical (EC) biochips functionalized with a thiolated blaCTX-M F-5'-SH probe. The 19bp and lOObp (also referred to herein as 19-mer, 100-mer) target DNA strand (10 pM) was incubated with the functionalized EC biochips at 37 °C for varying time intervals: 0, 15, 30, 45, 60, 75, and 90 minutes. Electrochemical impedance spectroscopy (EIS) was employed to measure the hybridization response, and the relative change in charge transfer resistance (A / c / %) was calculated and analyzed. As shown in Figure 16A, the Nyquist plots demonstrate a time-dependent increase in impedance following hybridization with the target DNA. Quantitative analysis Figures 16B, 16C reveals that ERCT % increases with incubation time, reaching a maximum hybridization value of around 60 minutes and then stabilizing through to 90 minutes. These findings suggest that the maximum hybridization efficiency occurs within the first 30-35 minutes of incubation.-n - EXAMPLE 9
[0429] DNA extraction protocols that concentrate and shear environmental DNA to increase the binding efficiency and the signal to noise ratio of the sensor
[0430] Biosensors for the detection of pathogens in environmental samples (such as wastewater) require high-quality DNA inputs. Two factors are critical for the limit of detection (LOD) and sensitivity of such devices:
[0431] 1. DNA Concentration: Higher concentrations generally yield stronger signals.
[0432] 2. Fragment Size: DNA fragments optimally below 1000 base pairs (bp) are required to ensure steric freedom and optimal hybridization kinetics on chip-based sensors.
[0433] For evaluation of sample-processing conditions compatible with the described DNA biosensor analysis, eleven lysis / DNA-fragmentation protocols were compared using a 6-log culture of a multidrug-resistant, wastewater-derived Escherichia coli strain harboring blaCTX-M. The tested procedures included simple thermal treatments (boiling at 95 °C for 5 min and 45 min), two microwave regimens (30% power, short and extended repeats), bath and probe (tip) sonication variants (multiple durations and cycles, including pulsed probe sonication at 40% power), and two commercial kits (GeneAll Exgene™ Cell SV and InviPrep Fast Lysis Buffer) used per manufacturers' instructions. For all non-kit procedures, cells were grown overnight in LB (37 °C, 250 rpm), diluted to 6 log in 10 mL, pelleted (6,000 x g, 10 min, RT), and resuspended in 300 pL TENT23 buffer prior to lysis. Following lysis, an ethanol precipitation was performed and samples were eluted in 50 pL ddELO. Total DNA yields measured by Qubit or Nanodrop ranged from 5.21 to 346 ng pL"1, as demonstrated in Figure 17.
[0434] Fragment size distributions were determined on an Agilent DI 000 TapeStation. Probe (tip) sonication procedures (procedures 7-9) produced substantially higher DNA concentrations than the other tested methods and generated the smallest median fragment sizes among the initial protocols (shortest observed median -1.26 kb; GeneAll kit produced the longest median fragments at 2,541 bp). Modulation of probe- sonication time affected fragment length: increasing probe sonication from 5 to 15 min produced comparable fragment distributions (-1.32 kb), indicating a limit to passive fragmentation under those conditions; however, applying 10 min probe sonication to DNA previously extracted with the GeneAll kit reduced fragments to -50 bp (data not shown). Quantification of blaCTX-M copy number across extracted samples (including DNA from rawand tertiary treated sewage) showed the highest target abundance in probe-sonicated material (Figure 18).
[0435] On the basis of yield, fragment-size control, and target-gene recovery, probe (tip) sonication was selected as the preferred sample-processing protocol for downstream DNA biosensor analysis. Probe sonication provided superior DNA concentration, reproducible and tunable shearing characteristics for downstream assay compatibility, and maximal recovery of the target across tested matrices; these attributes informed its selection for the embodiments and experimental procedures described herein.
[0436] EXAMPLE 10
[0437] Short term enrichment to enhance signal to noise ratio
[0438] One potential obstacle to environmental surveillance using the AMR biosensor is the issue of low signal to noise ratio. A potential solution is to expose samples to short term incubations that increase the relative abundance of pathogen and ARG targets (e.g., E. coli and / CTX-M) prior to analysis using the biochip. The inventors performed a time-lapse enrichment experiment to evaluate the time required to increase the signal of target bacterial and ARG indicators that are part of the biochip. Briefly, wastewater (influent) was sampled, diluted 1 : 10 in LB medium in four replicates, and incubated at 44°C for 0, 3, 6, 9, 12 and 24 h with constant shaking. The bacterial and ARG composition at each time-point were evaluated using conventional isolation (selective E. coli medium) and molecular cultivation independent (16S rRNA gene amplicon sequencing and quantitative PCR (qPCR)) methods.
[0439] The non-inoculated (Oh) wastewater microbiome contained high abundance of Arcobacter, Aeromonas, Acinetobacter, and multiple bacterial families with low relative abundance. However, after 3 hr. of incubation, the relative abundance of the Escherichia-Shigella family increased from almost not being detected, to close to 10% of the characterized microbiome (Figure 19). This clearly shows how very short (3 hr.) incubation under the tested conditions can significantly increase the relative fraction of E. coli in the sample. An even more substantial increase in the relative abundance of E. coli was observed after 6 hr. incubation, but the relative abundance of E. coli decreased in the incubations thereafter.
[0440] DNA used for microbiome analysis described above was subjected to qPCR analysis, to quantify the abundance of 16S rRNA genes (a marker of total bacterial abundance); uid a gene marker specific for E. coli, and two ARGs ( / CTX-MI and / TEM) that confer resistance to beta-lactamantibiotics. Similar to the results described in Figure 19, 3 hr. incubation facilitated a ~2-fold increase in abundance of E. coli as well as in the two targeted ARGs, but only a slight increase in the abundance of total bacteria (16S rRNA gene) (Figure 20). After 6 hr. incubation, total bacterial abundance decreased, but the abundance of E. coli and the two ARGs further increased.
[0441] Finally, the inventors evaluated the abundance of total, cefotaxime-, and meropenem-resistant E. coli in the original wastewater samples and the selected enrichment timepoints (Figure 21). The abundance of total and cefotaxime-resistant isolates increased by close to two orders of magnitude after 3 hr. incubation (meropenem-resistant isolates could be considered below limits of quantification), and further increased after 6 hr. of incubation, but did not continue to increase thereafter, supporting the results described in Figure 19 and Figure 20. Collectively, using three independent analytical methods, the inventors show the capacity of 3 hR incubation to not only significantly increase the abundance of E. coli and clinically relevant ARGs, but also to enhance the signal to noise ratio, which may be crucial as pre-treatments in future biosensor configurations.
[0442] EXAMPLE 11
[0443] Multiplexed Detection of Foodborne Pathogens in Fresh and Processed Food Matrices The disclosed biosensor is next further configured for the rapid, multiplexed identification of high-risk foodborne pathogens from a variety of complex food matrices. This embodiment utilizes a short-term enrichment protocol coupled with a multiplexed biochip to enhance detection sensitivity and specificity.
[0444] A diverse range of food samples, comprising various street food products such as hummus spread (e.g., street-vended salads), leafy greens, eggs, and fish, are procured for analysis. Microbial material is liberated from the food matrices using mechanical homogenization, such as a stomacher homogenizer, according to established protocols.
[0445] Following homogenization, samples were processed via two parallel pipelines:
[0446] Direct Processing: Immediate nucleic acid extraction from the homogenate.
[0447] Enrichment: Culturing in Brain Heart Infusion (BHI) broth under both aerobic and anaerobic conditions (to simulate enteric environments). The validity of these pipelines is confirmed via shotgun metagenomic analysis using a previously described protocol [Davidovich C. t al., The ISME Journal, Volume 19, Issue 1, January 2025], which identified detectable concentrations of Escherichia coli, Salmonella enterica, and Listeria monocytogenes in the enriched samples.Biosensor Integration and Probe Selection
[0448] The multiplexed biosensor configuration is functionalized with a library of species-specific oligonucleotide probes. In addition to uidA probes utilized for the detection of E. coh. the biochip is further functionalized with high-specificity probes targeting:
[0449] • S. enterica (e.g., sequences derived from hilA or invA genes as described by Guo X. et al., (2000) [Applied and Environmental Microbiology, 66(12), 5248-525], specifically:
[0450] hilA-F: CTG CCG CAG TGT TAA GGA TA, as denoted by SEQ ID NO: 17;
[0451] hilA-R: CTG TCG CCT TAA TCG CAT GT, as denoted by SEQ ID NO: 18; and Malomy B. et al., (2003) [Applied and Environmental Microbiology, 69(1), 290-296, specifically: invA139 (F): GTG AAA TTA TCG CCA CGT TCG GGC AA , as denoted by SEQ ID NO: 19; and 141(R): TCA TCG CAC CGT CAA AGG AAC C, as denoted by SEQ ID NO: 20.
[0452] • L. monocytogenes (e.g., sequences derived from hly or iap genes as described by Bassler, H. A., et al. (1995) [Applied and Environmental Microbiology, 61(10), 3724-3728], specifically: hly LM1 (F): CCT AAG ACG CCA ATC GAA, as denoted by SEQ ID NO: 21.
[0453] LM2 (R): AAG CGC TTG CAA CTG CTC, as denoted by SEQ ID NO: 22; and Bubert et al., (1992) [Applied and Environmental Microbiology, 58(8), 2625-2632], specifically:
[0454] iapMonoA (F): CAG TTG CAA GCG CTT GGA GT, as denoted by SEQ ID NO: 23.
[0455] MonoB (R): GCA ACG TAT CCT CCA GAG TG, as denoted by SEQ ID NO: 24.
[0456] EXAMPLE 12
[0457] Detection and Analysis of Food Spoilage Microorganisms in Food Production Environments The disclosed biosensor and associated methods are utilized for the detection of spoilage-inducing microorganisms within food production facilities, including but not limited to production line surfaces and process wash water. Given that bacterial and fungal-mediated spoilage results in substantial economic loss and adverse brand reputation, the present disclosure provides an automated early-warning diagnostic tool for industrial food safety.
[0458] Analytes comprising genomic material are obtained via environmental sampling, such as surface swabbing of production equipment or the collection of liquid volumes from production line wash water. Nucleic acids (e.g., DNA or RNA) are subsequently extracted and purified from these samples according to the extraction protocols described in the preceding examples.
[0459] To facilitate high-throughput monitoring, a plurality of multiplexed biochips are fabricated, each functionalized with a library of oligonucleotide probes characterized by high sequence specificityfor spoilage-associated taxa. Exemplary bacterial and fungal targets, along with their respective probe sequences, are provided in Table 2 below.
[0460] The biosensor may be deployed in various operational configurations to suit facility requirements:
[0461] • Batch Mode: For periodic testing of specific lots or localized equipment swabs.
[0462] • Continuous Mode: Integrated directly into fluidic systems for real-time monitoring of wash water or liquid ingredients.
[0463] " "
[0464]
[0465] Table 2: Probes that target food spoilage microorganisms
Claims
CLAIMS:
1. A biosensor chip system usable for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample; the system comprising:a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same, wherein said at least one working electrode is connected to at least one nucleic acid-based target-binding moiety, capable of specifically recognizing and binding said at least one target nucleic acid sequence, and wherein said plurality of electrodes is configured for at least one electrical analysis of said sample.
2. The biosensor chip of claim 1, wherein said plurality of electrodes is located within a channel enabling flow of a sample therethrough, and wherein said sample is a fluid or fluidized sample, said fluid or fluidized sample is in contact with said plurality of electrodes when flowing through the channel.
3. The biosensor chip of claim 1 or 2, wherein said plurality of electrodes is connectable to an incubation container.
4. The biosensor chip of any one of claims 1 to 3, wherein said plurality of electrodes is connectable to a detection circuit adapted for performing at least one electrical analysis through said plurality of electrodes.
5. The biosensor chip of any one of claims 1 to 4, wherein said microbial target comprises at least one microbial pathogen.
6. The biosensor chip of any one of claims 1 to 5, wherein said target nucleic acid sequence comprises at least one antibiotic resistance gene and / or at least one pathogenic factor.
7. The biosensor chip of any one of claims 1 to 6, wherein said target nucleic acid sequence comprises at least one nucleic acid sequence encoding at least one product comprising and / or associated with at least one of colonization, invasion, adhesion, biofilm formation, immune-response inhibitors and toxins.
8. The biosensor chip of any one of claims 1 to 7, wherein at least one of:(a) said at least one nucleic acid-based target-binding moiety comprises at least one nucleic acid sequence complementary to a target sequence in at least one of the 5' and / or the 3' end of at least one fragment of said target nucleic acid sequence;(b) said at least one nucleic acid-based target-binding moiety comprises at least one nucleic acid sequence complementary to a sequence in the 5' end of a fragment of said target sequence in a forward 5' to 3' orientation and / or at least one nucleic acid sequence complementary to a sequence in the 3' end of said fragment of the target sequence in a reverse 3' to 5' orientation; and(c) said at least one fragment of the target sequence is in the length of between about 50 to about 150 base pairs (bp).
9. The biosensor chip of any one of claims 1 to 8, wherein said at least one electrical analysis comprises at least one of: electrochemical impedance spectroscopy (EIS) analysis, cyclic voltammetry analysis, amperometry analysis, square-wave voltammetry analysis, differentialpulse voltammetry analysis, linear sweep voltammetry analysis, potentiometry analysis, Osteryoung Square Wave Voltammetry (OSWV), pulsed voltammetric methods, and chronoamperometry .
10. The biosensor chip of claim 9, wherein said at least one electrical analysis comprises electrochemical impedance spectroscopy (EIS) analysis.
11. A sample inspection system and / or array comprising:(i) a plurality of biosensor chips, wherein each biosensor chip comprising at least one working electrode and at least one reference electrode, or a plurality of any chip device or system comprising the same, wherein said at least one working electrode is connected to at least one nucleic acid-based target-binding moiety, capable of specifically recognizing and binding at least one target nucleic acid sequence of at least one microbial target, and wherein said plurality of electrodes is configured for at least one electrical analysis of said sample, and, optionally, (ii) a channel arrangement adapted to pass fluid sample in a plurality of channels, wherein said fluid or fluidized sample is in contact with plurality of electrodes of said plurality of biosensor chips.
12. The sample inspection system (array) of claim 11, wherein said biosensor chip is as defined in any one of claims 1 to 10.
13. A method for identifying and / or quantifying and / or monitoring at least one target nucleic acid sequence of at least one microbial target in at least one sample, the method comprising: a. contacting said at least one sample with a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same, wherein said at least one working electrode is connected to at least one nucleic acidbased target-binding moiety, and wherein said nucleic acid-based target-binding moiety specifically recognizes and binds said at least one target nucleic acid sequence;b. applying one or more voltage signals between said at least one working electrode and said at least one reference electrode, and determining electrical current between said electrodes in response to said one or more voltage signals; andc. determining one or more relations between electrical current response and the one or more voltage signals; and determining data indicative of presence and / or quantity of said at least one target nucleic acid sequence in said sample in accordance with said one or more relations.
14. The method of claim 13, wherein said applying one or more voltage signals comprises applying one or more voltage signals in a selected number of one or more signal frequencies, and wherein said determining one or more relations comprises determining data indicative of impedance between the at least one working electrode and the at least one counter electrode wherein impedance variation being indicative of presence and / or quantity of said at least one target nucleic acid sequence of at least one microbial target in said sample.
15. The method of claim 13, wherein said applying one or more voltage signals comprises applying one of more signals comprising cyclic voltage variation, and wherein said determining one or more relations comprises determining current transmission in relation to the cyclic voltage variation, said current transmission with respect to the cyclic voltage variation being indicative of presence and / or quantity of said at least one target nucleic acid sequence of at least one microbial target in said sample.
16. The method of claim 13, wherein said applying one or more voltage signals comprises applying one of more signals of one or more selected voltages and determining currenttransmission in response; and wherein relations between current transmission and the one or more selected voltages being indicative of presence and / or quantity of said at least one target nucleic acid sequence of at least one microbial target in said sample.
17. The method of any one of claims 13 to 16, wherein said contacting step is via continuous flow of said sample through said plurality of electrodes.
18. The method of any one of claims 13 to 17, further comprising at least one of:(I) prior to step (a), at least one of the following steps:(i) nucleic acid extraction from said at least one sample;(ii) fragmentation of the nucleic acids extracted from said sample; and(iii) sample purification; and(II) wherein step (a) comprises contacting the sample with the plurality of electrodes for about 20 to 50 minutes.
19. The method of any one of claims 13 to 18, further comprising the step for enrichment of at least one microbial target under suitable condition(s) in said sample prior to step (a).
20. The method of claim 19, wherein said enrichment step comprises incubating said sample at a suitable temperature, and / or for a suitable time period, allowing the growth of said microbial target.
21. The method of claim 20, wherein said suitable temperature is between 30°C to 44°C, and / or wherein said suitable time period is between about 30 minutes to 24 hours.
22. The method of any one of claims 13 to 21, wherein said plurality of electrodes is connectable to a detection circuit adapted for performing at least one electrical analysis.
23. The method of claim 22, wherein said at least one electrical analysis comprises at least one of: electrochemical impedance spectroscopy (EIS) analysis, voltammetry analysis, and amperometry analysis.
24. The method of claim 23, wherein said at least one electrical analysis comprises spectroscopy (EIS) analysis.
25. The method of any one of claims 13 to 24, wherein said microbial target comprises at least one of: bacteria, archaea, fungi, algae, protist, parasites, viruses and bacteriophages.
26. The method of any one of claims 13 to 25, wherein said microbial target comprises at least one bacteria.
27. The method of claim 26, wherein said bacteria comprises at least one bacterium selected from at least one of the phyla Pseudomonadota, Bacillota, Actinomycetota and Bacteroidota.
28. The method of any one of claims 22 and 27, wherein said bacteria are of the family Enterobacteriaceae.
29. The method of claim 28, wherein said bacteria are of the species Escherichia coli.
30. The method of claims 13 to 29, wherein said target nucleic acid sequence comprises at least one of: antibiotic resistance gene and at least one virulence gene, wherein said virulence gene comprising nucleic acid sequence encoding at least one product comprising and / or associated with at least one of colonization, invasion, adhesion, biofilm formation, immune-response inhibitors and toxins.
31. The method according to claim 30, wherein said target nucleic acid sequence is at least one antibiotic resistance gene.
32. The method of claims 13 to 31, wherein at least one of:(a) said at least one nucleic acid-based target-binding moiety comprises at least one nucleic acid sequence complementary to a target sequence in at least one of the 5' and / or the 3' end of at least one fragment of said target nucleic acid sequence;(b) said at least one nucleic acid-based target-binding moiety comprises at least one nucleic acid sequence complementary to a sequence in the 5' end of a fragment of said target sequence in a forward 5' to 3' orientation and / or at least one nucleic acid sequencecomplementary to a sequence in the 3' end of said fragment of the target sequence in a reverse 3' to 5' orientation; and(c) said at least one fragment of the target sequence is in the length of between about 50 to about 150 base pairs (bp).
33. The method of any one of claims 13 to 31, wherein said sample is an environmental sample.
34. The method of claim 33, wherein said environmental sample comprises at least one sample obtained from at least one environmental source.
35. The method of claim 34, wherein said environmental source comprises at least one water source, optionally, said water source comprising at least one of natural water reservoir, artificial water reservoir, reclaimed water, treated wastewater and sewage.
36. The method of any one of claims 13 to 35, for use in monitoring and evaluating quality and / or the pathogenic exposure potential of at least one environmental source, the method comprising repeating steps (a) to (c), for at least two temporally separated samples obtained from said environmental source periodically.
37. The method of any one of claims 13 to 35, for use in monitoring and evaluating quality and / or the pathogenic exposure potential of at least one environmental water source, the method comprising repeating steps (a) to (c), for at least two time points during a continuous flow of said sample through said plurality of electrodes.
38. A method for monitoring and evaluating quality and / or pathogenic exposure potential of an environmental water source, by continuous electrical analysis of at least one sample of said environmental water source, the method comprising:a. contacting said at least one sample with a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same, wherein said at least one working electrode is connected to at least one nucleic acidbased target-binding moiety, wherein said contacting is via continuous flow of said sample through said plurality of electrodes, and wherein said nucleic acid-based target-binding moiety specificallyrecognizes and binds at least one target nucleic acid sequence of at least one microbial target in said sample.b. applying one or more voltage signals between said at least one working electrode and said at least one reference electrode, and determining electrical current between said electrodes in response to said one or more voltage signals; andc. determining one or more relations between electrical current response and the one or more voltage signals; and determining data indicative of presence and / or quantity of said at least one target nucleic acid sequence in said sample in accordance with said one or more relations. d. repeating steps (a) to (c) for at least two temporally separated samples obtained from said environmental water source.
39. The method of claim 38, wherein said applying one or more voltage signals comprises applying one or more voltage signals in a selected number of one or more signal frequencies, and wherein said determining one or more relations comprises determining data indicative of impedance between the at least one working electrode and the at least one counter electrode wherein impedance variation being indicative of presence and / or quantity of said at least one target nucleic acid sequence of at least one microbial target in said sample.
40. The method of claim 38, wherein said applying one or more voltage signals comprises applying one of more signals comprising cyclic voltage variation, and wherein said determining one or more relations comprises determining current transmission in relation to the cyclic voltage variation, said current transmission with respect to the cyclic voltage variation being indicative of presence and / or quantity of said at least one target nucleic acid sequence of at least one microbial target in said sample.
41. The method of claim 38, wherein said applying one or more voltage signals comprises applying one of more signals of one or more selected voltages and determining current transmission in response; and wherein relations between current transmission and the one or more selected voltages being indicative of presence and / or quantity of said at least one target nucleic acid sequence of at least one microbial target in said sample.
42. The method of any one of claims 38 to 41, further comprising at least one of:(I) prior to step (a), at least one of the following steps:(i) nucleic acid extraction from said at least one sample;(ii) fragmentation of the nucleic acids extracted from said sample; and(iii) sample purification; and(II) wherein step (a) comprises contacting the sample with the plurality of electrodes for about 20 to 50 minutes.
43. The method of any one of claims 38 to 42, wherein said plurality of electrodes is located within a channel enabling flow of a sample therethrough, and wherein said sample is a fluid or fluidized sample, said fluid or fluidized sample is in contact with said plurality of electrodes when flowing through the channel.
44. The method of any one of claims 38 to 43, wherein said plurality of electrodes is connectable to a detection circuit adapted for performing electrical analysis through said plurality of electrodes.
45. The method of any one of claims 38 to 44, further comprising the step for enrichment of at least one microbial target in said sample prior to step (a).
46. The method of claims 38 to 44, wherein at least one of:(a) said at least one nucleic acid-based target-binding moiety comprises at least one nucleic acid sequence complementary to a target sequence in at least one of the 5' and / or the 3' end of at least one fragment of said target nucleic acid sequence;(b) said at least one nucleic acid-based target-binding moiety comprises at least one nucleic acid sequence complementary to a sequence in the 5' end of a fragment of said target sequence in a forward 5' to 3' orientation and / or at least one nucleic acid sequence complementary to a sequence in the 3' end of said fragment of the target sequence in a reverse 3' to 5' orientation; and(c) said at least one fragment of the target sequence is in the length of between about 50 to about 150 base pairs (bp).
47. A kit comprising: a biosensor chip system usable for identifying and / or quantifying and / or monitoring at least one nucleic acid sequence of at least one microbial target in a sample; the system comprising:(i) a plurality of electrodes comprising at least one working electrode and at least one reference electrode, or any chip device or system comprising the same, wherein said at least one working electrode is connected to at least one nucleic acid-based target-binding (or affinity) moiety, and wherein said plurality of electrodes is configured for electrical analysis of said sample; optionally, said kit further comprises at least one of:(ii) reagents suitable for enrichment of the microbial target in said sample;(iii) a dissociation module adapted to apply voltage biases that are suitable to drive a nucleic acid dissociation are employed by the system,(iv) a temperature-control mode.
48. The kit of claim 47, wherein said plurality of electrodes is located within a channel enabling flow of a sample therethrough, and wherein said sample is a fluid or fluidized sample, said fluid or fluidized sample is in contact with said plurality of electrodes when flowing through the channel.
49. The kit of any one of claims 47 and 48, wherein at least one of:(a) said plurality of electrodes is connectable to an incubation container; and(b) said plurality of electrodes is connectable to a detection circuit adapted for performing electrical analysis through said plurality of electrodes.
50. The kit of any one of claims 47 to 49, adapted for performing the method of any one of claims 13 to 46.