Method for determining personalized optimization of pancreatic cancer treatment, and optimization determination kit
By integrating CA19-9, DUPAN-2 concentrations, and FUT2/3 genotypes, the method addresses the limitations of current markers, enabling precise prognosis prediction and optimal treatment planning for pancreatic cancer.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- NAT UNIV CORP TOKAI NAT HIGHER EDUCATION & RES SYST
- Filing Date
- 2026-01-19
- Publication Date
- 2026-07-23
Smart Images

Figure JP2026001515_23072026_PF_FP_ABST
Abstract
Description
Method for individually optimizing determination of pancreatic cancer treatment, and optimization determination kit
[0001] It relates to diagnostic markers / prognosis prediction markers for selecting a treatment method for pancreatic cancer, and tests. In particular, it relates to diagnostic markers and tests for determining the appropriateness of conversion surgery in combination with chemotherapy.
[0002] The number of new pancreatic cancer patients in Japan is about 45,000, making it a cancer with a relatively large number of patients. Pancreatic cancer rarely shows symptoms in its early stages, and due to the lack of appropriate diagnostic markers, early detection is not easy. As a result, it is often discovered after progression, and the 5-year relative survival rate is 8.5%, making it a cancer with a poor prognosis.
[0003] As described above, pancreatic cancer is often discovered after progression, and at the time of initial diagnosis, it is often judged to be an unresectable cancer that cannot be surgically removed, such as locally advanced pancreatic cancer where the main pancreatic tumor has locally progressed and cannot be technically resected, or distant metastatic pancreatic cancer where resection does not result in a cure even with distant metastasis. However, multidisciplinary treatment methods such as multi-drug combination therapy and adjuvant radiotherapy have been developed, and in recent years, cases suitable for conversion surgery where the tumor shrinks or distant metastasis disappears and resection becomes possible have been increasing.
[0004] However, the criteria for determining the applicability of conversion surgery for pancreatic cancer are ambiguous, and there are often difficulties in making a judgment. Currently, the determination of resectability is based on the conventionally used pancreatic cancer tumor markers CA19-9 and DU-PAN-2, as well as the size and location of the tumor. CA19-9 (sialyl Lewis-a) is the most widely used marker for pancreatic cancer. However, it is known to depend on the functions of fucosyltransferase-2 (FUT2) and fucosyltransferase-3 (FUT3).
[0005] It is known that CA19-9 levels are affected when a patient has a homozygous mutation in the FUT3 gene (FUT3-null) because they cannot synthesize the CA19-9 antigen. Approximately 10% of the population has FUT3-null, meaning that FUT3 is not functional, and they are "Lewis-negative," meaning their CA19-9 levels are undetectable or relatively low. Therefore, it is known that in the FUT3-null group, CA19-9 levels are undetectable or low even when tumors are present. On the other hand, some patients have relatively high CA19-9 levels throughout the course of chemotherapy. It has been suggested that some patients with high CA19-9 levels may have a homozygous mutation in the FUT2 gene (FUT2-null), which prevents the synthesis of the Lewis-b antigen and leads to high CA19-9 expression (Non-Patent Literature 1). The CA19-9 value alone suggests that the state of pancreatic cancer is unclear.
[0006] DUPAN-2 (syalyl Lewis-c) is a precursor of CA19-9 and is produced at relatively high levels in Lewis-negative individuals. Non-patent document 2 suggests that a combination of DUPAN-2, CA19-9, and FUT2 / 3 may improve the diagnostic rate of early pancreatic cancer. However, it does not show the effects on advanced pancreatic cancer or the course of chemotherapy, nor does it disclose or suggest its potential use in predicting prognosis or determining the appropriateness of conversion surgery.
[0007] In addition to CA19-9 and DUPAN-2, numerous other new pancreatic cancer markers have been proposed. For example, Patent Document 1 proposes a partial sequence of the fibrinogen β chain and a partial sequence of the α-2-HS glycoprotein, while Patent Document 2 proposes a nucleic acid that can specifically bind to the miR-4486 polynucleotide as a novel pancreatic cancer detection marker. However, while these novel pancreatic cancer markers may have the potential to detect pancreatic cancer at an early stage, their effects on advanced pancreatic cancer and the progression after chemotherapy have not been studied, and their usefulness in predicting prognosis and determining the appropriateness of conversion surgery remains unclear.
[0008] In other words, currently, the only publicly known indicators provide no way to predict the prognosis of patients with advanced pancreatic cancer or to determine the appropriate timing for conversion surgery. This means that postoperative prognosis cannot be accurately predicted, potentially leading to missed opportunities for surgery or, conversely, unnecessary surgeries. Surgery for advanced pancreatic cancer is highly invasive, and unnecessary surgeries not only reduce the patient's quality of life but also decrease their tolerance to chemotherapy in the event of recurrence, potentially worsening the prognosis even further. In short, indicators for selecting treatment methods, including the timing of conversion surgery, are extremely important for pancreatic cancer patients, but no such methods have yet been reported.
[0009] Japanese Patent Publication No. 2024-117521 Japanese Patent Publication No. 2024-075722
[0010] Narimatsu, H, etal., Cancer Res. 1998, Vol.58, pp.512-8.Ando, Y, et al. J. Clin. Oncol.2024, Volume 42, Number 18DOI:10.1200 / JCO.23.01573, JCO2301573.
[0011] As mentioned above, although numerous markers for detecting pancreatic cancer have been reported, there are currently no reported prognostic markers that can determine the feasibility of conversion surgery. Currently, surgical indications are determined based on the normalization of tumor markers CA19-9 and DUPAN-2, as well as the size and location of the tumor. The present invention aims to provide a method for accurately predicting prognosis and supporting the determination of the appropriateness of conversion surgery when evaluating the values of the pancreatic cancer markers CA19-9 and DUPAN-2 when considering conversion surgery.
[0012] This invention relates to the following diagnostic support method and prognostic marker: (1) A diagnostic support method for predicting the prognosis of pancreatic cancer based on the CA19-9 concentration, DUPAN-2 concentration, and FUT2 / 3 genotype in a sample obtained from a subject. CA19-9 and DUPAN-2 are conventionally used tumor markers for pancreatic cancer, but these two markers and other indicators such as tumor size alone have not always been sufficient to accurately predict the prognosis. The inventors have found that by using the FUT2 / 3 genotype in addition to the CA19-9 concentration and DUPAN-2 concentration in the blood, the prognosis of pancreatic cancer patients can be accurately predicted, making it possible to provide more appropriate treatment to individual patients. This also makes it possible to appropriately determine the suitability and timing of conversion surgery.
[0013] This examination support method allows for more accurate prognosis prediction (predicting the prognosis of pancreatic cancer patients when conversion surgery is performed by appropriately evaluating the disease progression of pancreatic cancer patients), and can therefore be used in determining the treatment strategy for patients, for example, whether conversion surgery is appropriate (i.e., whether to perform conversion surgery at the time of the examination or to continue non-surgical treatment such as combination therapy or adjuvant radiotherapy), for example, in the following examination methods and surgical decisions: (I) A prognosis prediction method characterized by analyzing the CA19-9 concentration, DUPAN-2 concentration, and FUT2 / 3 genotype in a sample obtained from a subject who is a pancreatic cancer patient, predicting the subject's prognosis, and using it to determine the appropriateness of conversion surgery. (II) A method for predicting the prognosis according to (I), characterized in that the FUT2 / 3 genotype is classified into FUT3-null, FUT2-null, and FUT-intact, and the prognosis after conversion surgery is predicted and the appropriateness of conversion surgery is determined by the cutoff values of the CA19-9 concentration and DUPAN-2 concentration in the sample for each genotype. In the examples shown below, the cutoff value was set to the value that minimizes the P value for CA19-9 and DUPAN-2, respectively, and the hazard ratio was maximized in most cases. The method for setting the cutoff value can be a known method, for example, the minimum P value method as in this case may be used, or it may be determined using an ROC curve. (III) A treatment method in which, when determining the suitability of conversion surgery for a patient with pancreatic cancer, the CA19-9 concentration, DUPAN-2 concentration, and FUT2 / 3 genotype in a sample obtained from the patient are analyzed, and the FUT2 / 3 genotype is classified into FUT3-null, FUT2-null, and FUT-intact. The prognosis of the patient if they undergo conversion surgery is predicted based on the cutoff values of the CA19-9 concentration and DUPAN-2 concentration in the sample for each genotype, and if the prognosis is judged to be good, conversion surgery is applied. Regardless of the genotype, if both the CA19-9 concentration and DUPAN-2 concentration in the sample of the patient are lower than the cutoff values for CA19-9 concentration and DUPAN-2 concentration set in advance for each genotype, the patient is eligible for conversion surgery.(IV) A treatment method for determining the suitability of conversion surgery for a patient with pancreatic cancer, in which the CA19-9 concentration, DUPAN-2 concentration, and FUT2 / 3 genotype in a sample obtained from the patient are analyzed, the FUT2 / 3 genotype is classified into FUT3-null, FUT2-null, and FUT-intact, and the prognosis of the patient who undergoes conversion surgery is predicted based on the cutoff values of the CA19-9 concentration and DUPAN-2 concentration in the sample for each genotype, and if the prognosis is judged to be poor, drug therapy or radiotherapy is applied. If the prognosis is judged to be good with conversion surgery, surgery is indicated, and if the prognosis with surgery is judged to be poor, other non-surgical treatment methods such as chemotherapy and radiotherapy are selected, thereby enabling appropriate treatment for each patient. According to the present invention, it is possible to contribute to the individualized treatment of pancreatic cancer patients.
[0014] (2) A prognostic marker for pancreatic cancer consisting of the CA19-9, DUPAN-2, and FUT2 / 3 genotypes. By examining the CA19-9, DUPAN-2, and FUT2 / 3 genotypes, the prognosis of pancreatic cancer patients can be appropriately determined. Therefore, these three together can be used as a prognostic marker for pancreatic cancer.
[0015] (3) A kit for determining the prognosis of pancreatic cancer, characterized by comprising reagents for measuring the genotypes of CA19-9, DUPAN-2, and FUT2 / 3. Since the genotypes of CA19-9, DUPAN-2, and FUT2 / 3 are markers for predicting the prognosis of pancreatic cancer, reagents for measuring CA19-9 and DUPAN-2, such as reagents for measurement by ELISA, and reagents for measuring the genotype of FUT2 / 3, such as PCR reagents, are useful as a kit for determining the prognosis of pancreatic cancer.
[0016] Figures showing CA19-9 and DUPAN-2 values at diagnosis (at initiation) and at surgery (at surgery) in patients stratified by resectableness. Figures showing CA19-9 and DUPAN-2 values at diagnosis and at surgery in patients stratified by FUT2 / 3 genotype. Figures showing survival curves for patients stratified by resectableness. Figures showing survival curves for patients stratified by FUT2 / 3 genotype. Figures showing survival curves for patients stratified by FUT2 / 3 genotype in the group of patients classified by resectableness who were judged to be unresectable. Figures showing an outline of the construction of a tumor marker gene model (TMGM) for CA19-9 and DUPAN-2 tumor markers stratified by FUT2 / 3 genotype. Figure 1 shows survival curves using the Kaplan-Meier method for three groups stratified by CA19-9, DUPAN-2, and TMGM. Figure 2 shows survival curves using the Kaplan-Meier method for patients who were deemed unresectable at diagnosis and underwent conversion surgery, stratified by each marker. Figure 3 shows the changes in CA19-9 and DUPAN-2 classified by FUT2 / 3 genotype in patients who underwent conversion surgery.
[0017] As shown below, retrospective analysis of a multicenter observational cohort revealed the influence of FUT2 / 3 gene polymorphisms on CA19-9 and DUPAN-2 levels, enabling us to establish criteria for predicting the prognosis of pancreatic cancer patients and for evaluating conversion surgery.
[0018] Specifically, as shown in the example below, we found that for CA19-9, the cutoff value is FUT2-null > FUT-intact > FUT3-null, and for DUPAN-2, it is FUT3-null > FUT2-null > FUT-intact. By setting these values, we found that it is possible to decide whether to perform conversion surgery if the value falls below this value, or to continue chemotherapy if the value is above this value.
[0019] [Patient Selection] Between January 2012 and December 2021, we analyzed data from 347 patients who underwent curative pancreatectomy after neoadjuvant treatment for pancreatic cancer at three facilities, and whose frozen specimens (excluding tumors) or formalin-fixed paraffin-embedded (FFPE) tissues, specifically lymphocytes, duodenum, and spleen specimens, were preserved. Ultimately, two patients with duodenal papillary cancer or neuroendocrine tumors were excluded, and the analysis continued with 345 patients. Of the analyzed patients, four patients for whom genotyping could not be determined were excluded, leaving 341 patients for analysis.
[0020] Clinical information, including the gender, age, and other oncological attributes of the subjects, was collected from the electronic medical records of the medical institutions. Furthermore, the resectable potential of pancreatic cancer was determined by a radiologist using dynamic CT at the initial consultation, based on the latest version of the NCCN (National Comprehensive Cancer Network) guidelines at that time (the NCCN is a guideline-developing organization formed by 31 leading cancer centers across the United States, providing guidelines for diagnosis, treatment, etc.).
[0021] In this analysis, locally advanced lesions and metastatic lesions were determined to be unresectable. 135 cases were classified as resectable, 118 as borderline resectable, and 88 as unresectable. The 88 unresectable cases were further classified as unresectable due to locally advanced lesions (UR-LA) and unresectable due to metastatic lesions (UR-M). Table 1 shows the characteristics of the patients analyzed.
[0022]
[0023] The CA19-9 and DUPAN-2 values shown below at the time of diagnosis are those obtained after biliary drainage for obstructive jaundice. CA19-9 values were measured in the clinical laboratory of each facility, and there were no missing data from the time of surgery. DUPAN-2 test values were measured by SRL Co., Ltd. using the DUPAN-2 enzyme immunoassay kit Determiner-DUPAN-2 N (Minaris Medical). The minimum and maximum ranges of the kit's calibration curve are 25 U / ml and 1600 U / ml, respectively. DUPAN-2 values at the time of surgery were missing in 41 cases.
[0024] In the following explanation, the cutoff values for CA19-9 and DUPAN-2 are determined. These are cutoff values obtained under specific reagents or conditions, and the values may vary slightly depending on the measurement kit used. However, it goes without saying that the values of the above markers will show similar trends even when using other measurement kits and methods.
[0025] [Determination of FUT2 / 3 genotypes] Genomic DNA was extracted from frozen normal tissue or lymphocytes using the QIAmp DNA mini kit (Qiagen), and from formalin-fixed specimens using the QIAmp DNA FFPE Tissue Kit. Based on TOGO-VAR, the three loci of the FUT2 / 3 genes in 345 pancreatic cancer patients were analyzed, taking into account the frequency of mutant alleles in the Japanese population. Three different TaqMan genotyping assays were used to determine the three loci of the FUT2 / 3 genes (Table 2).
[0026]
[0027] Of the three mutations, two were examined using existing testing methods (Assay ID, C_8832449_10: FUT2 gene A385T, C_8832450_10: FUT2 gene C357T (both Thermo Scientific)). For the detection of FUT3 gene T59G, the following primers were used: Forward primer: ATGGCGCCGCTGTCT (SEQ ID NO: 1) Reverse primer: GCAGGTAGGGAGAAAACACACA (SEQ ID NO: 2) Wild-type probe (5'VIC dye labeled, 3'NFQ-MGB added): CTGAAAATAGCCAGTGCGC (SEQ ID NO: 3) Mutant probe (5'FAM dye labeling, 3'NFQ-MGB addition): CTGAAAATAGCCCGTGCGCG (SEQ ID NO: 4) PCR was performed using TaqMan Genotyping Master Mix (Thermo Scientific), with polymerase activation at 95°C for 10 minutes, followed by denaturation at 95°C for 15 seconds, and annealing and extension at 60°C (58°C for analysis of FUT3 gene T59G) for 1 minute for 40 cycles. Results were obtained from a single assay unless the results were unclear or there was no amplification.
[0028] The genotypes of FUT2 and FUT3 were classified into the following three groups based on the presence of mutants: FUT3-null: Homozygous mutant of T59G regardless of the state of the FUT2 gene; FUT2-null: Homozygous mutant of both FUT2 A385T and FUT2 C357T; FUT-intact: All others.
[0029] [Statistical Analysis] Significance of differences between variables was assessed using Student's t-test, and the Mann-Whitney test was used to evaluate differences between two groups. To analyze differences between three or more groups, paired t-tests or Kruskal-Wallis tests were used. The following data are presented as standard deviation (SD) or median and interquartile range (IQR). Categorical data for two groups were analyzed using Fisher's exact test. Overall survival (OS) was defined as the period from the date of surgery to the final follow-up date or death date. Survival curves were created using the Kaplan-Meier method and evaluated using the log-rank method adjusted with the Benjamini-Hochberg method to compare three groups. Survival analyses, including Cox proportional hazards regression and the Concordance index (c-index), were calculated using the survival package (version 3.5.3; Therneau). To develop prognostic models specific to each FUT2 / 3 genotype, the cutoff values for CA19-9 and DUPAN-2 were set using the minimum p-value method. All statistical analyses were performed using R software version 4.2.3 (The R Foundation for Statistical Computing).
[0030] [Characteristics of Tumor Markers Considering Genotype and Resectability] Genotype determination was successful in 341 out of 345 cases. FUT2-null, FUT2 and FUT3-intact (FUT-intact), and FUT3-null were represented in 49, 258, and 34 cases, respectively. The characteristics of patients stratified by resecability are shown in Table 1. In the cohort as a whole, 135 cases were resectable, 118 cases were borderline resectable, and 88 cases were unresectable. The median age of patients at surgery was 67.2 years, and 68.9% underwent pancreaticoduodenectomy. Similar to the two markers at surgery, there were significant differences in treatment and treatment efficacy depending on resecability. In advanced cases, radiological and pathological responses were observed, and many vascular resections were performed in combination.
[0031] Figure 1 shows the CA19-9 and DUPAN-2 values at diagnosis (at initiation) and surgery (at surgery), stratified by resectable potential. In the figure, R indicates resectable, BR indicates borderline resectable, and UR indicates unresectable. Both CA19-9 and DUPAN-2 decreased with preoperative treatment, and tended to show low median values at surgery. The cutoff values for CA19-9 and DUPAN-2, which are tumor markers for pancreatic cancer, are set at 37 U / ml and 150 U / ml, respectively.
[0032] When differences were examined in patients stratified by FUT2 / 3 genotype, the distribution of CA19-9 and DUPAN-2 differed significantly depending on the FUT2 / 3 genotype (Figure 2). The median CA19-9 levels at surgery were 95.0, 33.5, and ≤2 (P < 0.001) for the FUT2-null (F2N), FUT-intact (INT), and FUT3-null (F3N) groups, respectively. The median DUPAN-2 levels at surgery were 47.0, 33.5, and 590 (P < 0.001) for the FUT2-null, FUT-intact, and FUT3-null groups, respectively. CA19-9 levels decreased after preoperative treatment regardless of genotype. Furthermore, while CA19-9 levels at diagnosis were generally low in FUT3-null patients, only 11 out of 32 cases had levels below 2 U / ml. Moreover, 7 out of 32 FUT3-null patients had levels higher than 2 U / ml. In other words, even in FUT3-null (Lewis antigen negative) cases, CA19-9 levels at the start of treatment are not necessarily low, below 2 U / ml. DUPAN-2 levels in FUT3-null patients were high, in contrast to CA19-9 levels. On the other hand, in the FUT2-null group, CA19-9 levels did not normalize (below 37 U / ml) at the time of surgery in 40 out of 48 patients who underwent surgery.
[0033] [Survival Analysis and Tumor Marker Gene Model] The median OS for patients with resectable, borderline resectable, and unresectable tumors was 55.0 months, 38.6 months, and 34.6 months, respectively, with no significant differences between the groups (P=0.39, Figure 3A). When OS was stratified by FUT2 / 3 genotype, the OS for the FUT2-null, FUT-intact (FUT-2 / 3 intact), and FUT3-null groups was 61.3 months, 46.1 months, and 27.4 months, respectively (P=0.18, Figure 3B).
[0034] Subgroup analysis based on resectableness revealed that, although no significant differences were observed between the resectable and borderline resectable groups (data not shown here), there was a significant correlation between the unresectable group and the FUT2 / 3 genotype. The median survival time (MST) for the FUT2-null, FUT-intact, and FUT3-null groups was 67.0, 34.5, and 18.1 months, respectively (P=0.002), showing a significant difference. In the unresectable group, the FUT3-null group had a significantly worse prognosis compared to the FUT2-null and FUT-intact groups (Figure 3C). The hazard ratio (HR) was 7.94; 95% CI, 2.13–29.6 (P=0.001) for the FUT2-null group, and 3.38; 95% CI, 1.40–8.18 (P=0.009) for the FUT-intact group.
[0035] Next, in the unresectable group (n=88), we analyzed the optimal cutoff values for two markers after preoperative treatment. The characteristics of patients in the unresectable group were similar across FUT2 / 3 genotypes, except for CA19-9 and DUPAN-2 values (Table 3).
[0036] These results suggest that if FUT2 / FUT3 gene analysis reveals that CA19-9 and DUPAN-2 levels fall below the cutoff values corresponding to each patient type, conversion surgery may be possible. If these levels are not reached, continuing chemotherapy or other treatments should serve as a guideline for treatment.
[0037] This is expected to reduce cases where patients were deemed ineligible for conversion surgery due to high levels of CA19-9 or DUPAN-2, thus missing the optimal timing for surgery, or where patients who should have continued chemotherapy were subjected to surgery because their CA19-9 or DUPAN-2 levels had decreased, resulting in inappropriate treatment.
[0038]
[0039] The cutoff values for CA19-9 were set using the minimum p-value method. The cutoff values for CA19-9 were 150 U / ml for the FUT2-null group, 50 U / ml for the FUT-intact group, and 2 U / ml for the FUT3-null group, unless CA19-9 was 2 U / ml or less at both diagnosis and surgery. The cutoff values for DUPAN-2 were 170, 120, and 200 U / ml, respectively (Figure 4).
[0040] In the example shown in Figure 4, the cutoff values for CA19-9 are 150 U / ml and for DUPAN-2 are 170 U / ml in the FUT2-null group, 50 U / ml and 120 U / ml in the FUT-intact group, and 200 U / ml for DUPAN-2 in the FUT3-null group, unless CA19-9 is 2 U / ml or less at both diagnosis and surgery. The cutoff values for CA19-9 are 2 U / ml and for DUPAN-2 are 200 U / ml, respectively. As the number of cases increases in the future, and depending on the kit used to measure CA19-9 and DUPAN-2 concentrations, the cutoff values are expected to fluctuate somewhat, but are thought to fall within a range of ±30% of the above values.
[0041] Using the cutoff values of CA19-9 and DUPAN-2 stratified by these FUT2 / 3 genotypes, a tumor marker gene model (TMGM) was created, and the unresectable group was classified into the following three groups. Patient group with low values of CA19-9 and DUPAN-2 (both markers are low, Both-low): 64 cases (72.7%) Patient group with high values of CA19-9 or DUPAN-2 (one is high, Either-low): 12 cases (13.6%) Patient group with high values of CA19-9 and DUPAN-2 (both markers are high, Both-high): 12 cases (13.6%)
[0042] OS was better in the group with low values of both markers compared to the group with high values of both markers, and the MSTs were 47.4 months and 16.2 months, respectively (P < 0.001) (Figure 5). Next, the group with low values of both markers was classified as the TMGM-low group, and the other groups were classified as the TMGM-high group. For the unresectable group, a uniform cutoff value of 37 U / ml for CA19-9 and 150 U / ml for DUPAN-2 was set unless CA19-9 was less than 2 U / ml at both the time of diagnosis and surgery.
[0043] It was revealed that TMGM stratified by FUT2 / 3 genotype can predict the prognosis more accurately compared to the case of using only CA19-9 or only DUPAN-2 (upper part of Figure 6) (lower right part of Figure 6, P < 0.0001, HR = 4.47). Comparing TMGM, which predicts the prognosis accurately, with the DUPAN-2 single cutoff model, TMGM was superior in the Harrell's Concordance index (C statistic), which is an index showing the degree of agreement between the predicted survival time and the actual measured value (the C statistics of TMGM and DUPAN-2 were 0.674 and 0.569, respectively).
[0044] The TMG-M low-value group had a better prognosis compared to the TMG-M high-value group (the MST [95% CI] of the TMG-M low-value group was 47.4 months [34.6 - NA], while in the TMG-M high-value group it was 16.2 months [12.6 - 23.6] (P < 0.0001)). In the analysis by the Cox proportional hazard model using covariates such as age and gender, high TMG-M was an independent prognostic factor (Table 4, high TMG-M, HR = 4.56 (2.44 - 8.59) P < 0.0001).
[0045]
[0046] Furthermore, a study was conducted to examine whether TMG-M can be an effective indicator for determining the appropriate timing of conversion surgery. The trends of the two markers in each genotype were analyzed using 26 representative cases that underwent preoperative treatment for 8 to 12 months. In the 26 cases, the changes in the two markers were plotted (Figure 7). When stratified by genotype, it was observed that CA19-9 shifted to more normal values with preoperative treatment compared to DU-PAN-2.
[0047] Based on the above analysis results, it became clear that the CA19-9 and DU-PAN-2 values in preoperative therapy are greatly affected by the FUT2 / 3 genotype. Therefore, for pancreatic cancer patients judged to be unresectable at the time of diagnosis, using cut-off values adjusted by the FUT2 / 3 genotype rather than judging the appropriateness of conversion surgery based on the conventional uniform cut-off values of CA19-9 and DU-PAN-2 values showed superior postoperative survival rates.
Claims
1. A test support method for predicting the prognosis of pancreatic cancer based on the CA19-9 concentration, DUPAN-2 concentration, and FUT2 / 3 genotype in a sample obtained from a subject.
2. The testing support method according to claim 1, characterized in that the FUT2 / 3 genotypes are classified into FUT3-null, FUT2-null, and FUT-intact, and predetermined CA19-9 and DUPAN-2 reference values are set for each genotype.
3. The FUT2 / 3 genotype is determined by the mutations of rs1047781, rs281377, and rs28362459, according to claim 1.
4. The test support method according to claim 1, wherein the concentrations of CA19-9 and DUPAN-2 are measured by measuring their concentrations in the blood.
5. The examination support method according to claims 1 to 4, used when considering the suitability of conversion surgery.
6. A prognostic marker for pancreatic cancer consisting of the CA19-9, DUPAN-2, and FUT2 / 3 genotypes.
7. The prognostic marker according to claim 6, which is used to determine the suitability of conversion surgery.
8. A kit for predicting the prognosis of pancreatic cancer, characterized by comprising reagents for measuring the genotypes of CA19-9, DUPAN-2, and FUT2 / 3.
9. The kit for determining the prognosis of pancreatic cancer according to claim 8, wherein the reagents for measuring CA19-9 and DUPAN-2 are reagents for measurement by ELISA for measuring CA19-9 and DUPAN-2 in blood, and the reagent for measuring the FUT2 / 3 genotype is a reagent for measurement by PCR.
10. A kit for determining prognosis according to claim 8 or 9, which is used to determine the suitability of conversion surgery.