ISG15 binders and uses thereof
Patent Information
- Application Number
- PCT/EP2026/054892
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-21
- Filing Date
- 2026-02-23
- Publication Date
- 2026-08-27
Smart Images

Figure IMGF000103_0001 
Figure IMGF000114_0001 
Figure IMGF000082_0001_TABLE
Abstract
Description
[0001] Frlmp / ISG15_Nbs / 873
[0002] ISG15 BINDERSAND USES THEREOF
[0003] FIELD OF THE INVENTION
[0004] This invention pertains to polypeptide agents that specifically bind to human Interferon-stimulated gene 15 (ISG15). In particular, it describes immunoglobulin single variable domains (ISVDs) that bind to human ISG15, thereby modulating various immune-related activities of the ISG15 protein. The invention further encompasses vectors and nucleic acids encoding these ISVD-based modulators, as well as pharmaceutical compositions containing such ISVD modulators. The ISG15-specific modulator polypeptides, particularly the ISVDs and compositions described herein, may be used for the prevention and / or treatment of immune-related disorders, including bacterial and viral infections, as well as autoimmune diseases.
[0005] BACKGROUND
[0006] The interferon-stimulated gene 15 kDa (ISG15) is a protein composed of two ubiquitin-like (Ubl) domains1 2. The N-terminal and C-terminal domains of ISG15 exhibit 27% and 37% sequence similarity to ubiquitin (Ub), respectively3. In humans, ISG15 is initially synthesized as a 17 kDa precursor, which undergoes post-translational processing, including the removal of its N-terminal methionine4and the cleavage of eight C-terminal amino acids, yieldingthe mature and functional protein5.
[0007] Similar to other interferon-stimulated genes (ISGs), ISG15 expression is upregulated in response to cellular stress, particularly during bacterial6and viral7infections. These stress signals activate transcription factors involved in interferon (IFN) signalling, primarily IRF3 and ISGF389, which subsequently drive ISG15 expression. Notably, ISG15 is among the most strongly induced genes in response to IFNs10. Studies using type I IFN receptor R1 knockout mice and cells show that ISG15 expression is significantly reduced followingtreatmentwith LPSor upon viral infection11, confirming that bacterial and viral activation of type I IFN signalling is crucial for ISG15 induction.
[0008] Functionally, ISG15 is primarily recognized for its role in host defence against viral, bacterial, and fungal pathogens12. Its activity is mediated through three key molecular mechanisms: (1) ISGylation - a ubiquitin-like modification of intracellular proteins13 14, (2) negative control of interferon-a / -p signalingas a free intracellular molecule15 16, and (3) induction of IFN-y secretion as an extracellular cytokine17.
[0009] ISGylation (Function 1) is a posttranslational modification that regulates protein activity, stability, interactions, and / or degradation18. It occurs through a three-step enzymatic cascade involvingFrlmp / ISG15_Nbs / 873
[0010] UBE1 L (UBA7), UBCH8 (UBE2L6), and an E3 ligase6. ISGylation plays a key role in innate immunity by modifying proteins involved in bacterial and viral defences1920. Notably, some viruses, like SARS-CoV, have evolved mechanisms to counteract ISGylation to evade immune responses21-23.
[0011] Ubiquitin-specific protease 18 (USP18) plays a dual regulatory role in immune signalling. Firstly, it serves as the primary deconjugating enzyme for ISG15, controlling ISGylation levels by cleaving ISG15 from its target proteins24. Moreover, USP18 negatively regulates type I IFN signalling by competing with Janus kinase 1 (JAK1) at the IFN receptor25. In humans and some other species, USP18 stability is directly dependent on free intracellular ISG15 (Function 2). Without ISG15, USP18 becomes unstable, leading to excessive type I IFN activity2627, which is associated with autoinflammatory responses28. Moreover, interactions with the C-terminal tail of ISG15, independent of USP18 stabilization, playa critical role in USP18’s negative regulation of type I IFN activity29. Of note, type I IFNs are widely expressed by all nucleated cells following viral infection30. ISG15 also acts as an extracellular cytokine that stimulates IFN-y secretion by binding to the LFA-1 integrin receptor on leukocytes (Function 3)31. This function is further amplified in synergy with IL-12, promoting proinflammatory immune responses32. Given that IFN-y is a key driver of Th1-mediated immune activity33, its overproduction is closely linked to the pathogenesis of autoimmune diseases such as systemic lupus erythematosus (SLE)34. Studies in animal models have demonstrated IFN-y’s essential role in both spontaneous and induced lupus, highlighting its significance in disease progression35.
[0012] Host-directed therapy (HDT) is an emerging strategy in infectious disease treatment. Rather than directly targeting pathogens, HDT modulates host factors essential for pathogen replication or persistence, enhances protective immune responses, mitigates excessive inflammation, and / or restores immune balance at sites of infection36. Unlike conventional anti-infectives, HDT-based approaches are less susceptible to resistance, as pathogens would need to alter their reliance on specific host factors, adapt alternative replication mechanisms, or evade activated host defense pathways for resistance to develop. Given that many of the host factors are evolutionarily conserved, a pathogen would need to undergo significant genetic adaptations to successfully evade them3637. Notably, HDTs have the potential to act across multiple pathogen species, offering broad-spectrum therapeutic options38.
[0013] Infectious diseases continue to be a leading global cause of morbidity and mortality. Even in high-income countries with advanced healthcare systems and access to antibiotics, respiratory tract infections remain among the top causes of death3940. Additionally, effective infection treatment and prevention are essential for maintaining high-quality maternal and child health, managingFrlmp / ISG15_Nbs / 873
[0014] immunocompromised patients, and ensuring the safety of surgical procedures. Given these challenges, the development of new HDTs is critical to expanding the range of available treatments for infectious agents, while minimizingtheside effectsand resistance associated with antibiotics41. Furthermore, the management and treatment of autoimmune diseases remain significant unmet medical needs. Current and emerging therapeutic approaches often lack specificity, pose high toxicity risks, and compromise patient safety42. Therefore, there is a critical need for target-specific modulators of autoimmune pathways.
[0015] SUMMARY OF THE INVENTION
[0016] The present invention addresses the aforementioned challenges by introducing novel polypeptide agents that specifically bind to ISG15 and modulate its activity, state, and / orfunction. In particular, the molecules disclosed herein can influence various immune-related activities of ISG15, and are thus designated as therapeutic agents for infections, including bacterial and viral infections, or autoimmune conditions.
[0017] One aspect of this invention relates to modulator polypeptides that specifically bind the human ISG15 protein and modulate its immune activity upon binding.
[0018] In one embodiment, the modulator polypeptide may be an antibody, active antibody fragment, immunoglobulin single variable domain (ISVD), single domain antibody, a VHH antibody or a Nanobody, as defined herewith.
[0019] According to another aspect, the ISG15-specific modulator polypeptide disclosed herein binds to ISG15 and alters its interaction with USP18 upon binding. In a specific embodiment, the ISG15-specific modulator disclosed herein reduces the interaction between ISG15 and USP18 relative to the interaction observed in the absence of the modulator. In one embodiment, the impact of the ISG15-specific modulatoron ISG15-USP18 binding can be assessed usinga nanoBRET assay. In further embodiments, the ISG15-specific modulator polypeptide of the invention comprises an ISVD comprising or consisting of an amino acid sequence that includes 4 framework regions (FR) and 3 complementarity-determining-regions (CDRs), according to the formula: FR1-CDR1-FR2-CDR2-FR3-CDR-FR4, or any suitable fragment thereof.
[0020] In one embodiment, the ISG15-specific modulator polypeptide comprises or consists of an ISVD comprising the CDRs of the VHH molecules as present in SEQ ID NOs: 01, 05, 09, 13, 17, 21, 25, 29, 33, 37, or 41 , wherein the CDRs are annotated according to the annotation described herein, and as used in Table 1 , i.e.,:Frlmp / ISG15_Nbs / 873
[0021] i) CDR1 comprises SEQ ID NO: 02, CDR2 comprises SEQ ID NO: 03, and CDR3 comprises SEQ ID NO: 04; or
[0022] ii) CDR1 comprises SEQ ID NO: 06, CDR2 comprises SEQ ID NO: 07, and CDR3 comprises SEQ ID NO: 08; or
[0023] iii) CDR1 comprises SEQ ID NO: 10, CDR2 comprises SEQ ID NO: 11 , and CDR3 comprises SEQ ID NO: 12; or
[0024] iv) CDR1 comprises SEQ ID NO: 14, CDR2 comprises SEQ ID NO: 15, and CDR3 comprises SEQ ID NO: 16; or
[0025] v) CDR1 comprises SEQ ID NO: 18, CDR2 comprises SEQ ID NO: 19, and CDR3 comprises SEQ ID NO: 20; or
[0026] vi) CDR1 comprises SEQ ID NO: 22, CDR2 comprises SEQ ID NO: 23, and CDR3 comprises SEQ ID NO: 24; or
[0027] vii) CDR1 comprises SEQ ID NO: 26, CDR2 comprises SEQ ID NO: 27, and CDR3 comprises SEQ ID NO: 28; or
[0028] viii) CDR1 comprises SEQ ID NO: 30, CDR2 comprises SEQ ID NO: 31 , and CDR3 comprises SEQ ID NO: 32; or
[0029] ix) CDR1 comprises SEQ ID NO: 34, CDR2 comprises SEQ ID NO: 35, and CDR3 comprises SEQ ID NO: 36; or
[0030] x) CDR1 comprises SEQ ID NO: 38, CDR2 comprises SEQ ID NO: 39, and CDR3 comprises SEQ ID NO: 40; or
[0031] xi) CDR1 comprises SEQ ID NO: 42, CDR2 comprises SEQ ID NO: 43, and CDR3 comprises SEQ ID NO: 44;
[0032] or according to Kabat, MacCallum, IMGT, AbM, or Chothia numbering systems, as known in the art and as further referred to herein.
[0033] In a further aspect, the invention pertains to an ISG15-specific modulator polypeptide that, upon binding to ISG15, reduces the delSGylation of ISG15 target proteins.
[0034] Furthermore, the invention relates to an ISG15-specific modulator polypeptide that comprises an ISVD with a sequence selected from the group of SEQ ID NOs: 01 , 05, 13, 17, 21 , 25, 29, 33, 37, or 41. The invention also encompasses a humanized variant derived from any of these sequences, as further described herein.
[0035] According to another aspect, the modulator polypeptide of this invention exerts its ISG15-modulating function by interacting with specific residues of the ISG15 protein (designated herein as the protein defined in SEQ ID NO: 45). In a preferred embodiment, the modulator polypeptideFrlmp / ISG15_Nbs / 873
[0036] specifically binds to ISG15 at a binding site that includes the amino acid residues R92, S93, S94, T95, Y96, E97, Q102, H106, Q109, Q110, S112, G113, L114, E115, G116, V117, Q118, D119, and D120, with numbering based on the wild-type ISG15 sequence of SEQ ID NO: 45. Alternatively, the binding site may encompass the corresponding residues of an ISG15 homologue and / or mutant and / or variant, such as a pathological mutant or an ISG15 variant known to exhibit altered properties relative to wild-type ISG15, as described in the literature, so as part of the common general knowledge and known to the skilled person.
[0037] According to another aspect, the ISG15-specific modulator polypeptide detailed here can be fused with a moiety. In one embodiment, the moiety is a functional moiety, preferably a therapeutic moiety, or a half-life-extending moiety. In another embodiment, the moiety is a targeting moiety, or a detectable moiety.
[0038] The invention further relates to ISG15 modulator polypeptides that are multivalent and / or multispecific, preferably comprisingat least two ISG15-bindingmoieties. In a particularly preferred embodiment, these multivalent and / or multispecific modulators include or consist of a minimum of two ISG15-specific ISVDs, which may be identical or distinct in sequence.
[0039] This application also relates to a nucleic acid molecule containing a polynucleotide sequence that encodes any one the ISG15-specific modulator polypeptides described herewith, along with a vector that contains this nucleic acid molecule.
[0040] Also envisaged is a pharmaceutical composition comprising any one of the ISG15-specific modulator polypeptides according to this invention, or the nucleic acid molecule or the vector encoding any one of said modulators, as described herewith.
[0041] Furthermore, the invention relates to the above-described ISG15-binding modulator polypeptides, pharmaceutical composition(s), nucleic acid(s) and / or vector(s), for use as a medicament, for instance in the prevention and / or treatment of immune-related disorders. One specific embodiment involves utilizing the ISG15-binding modulator polypeptide(s), pharmaceutical composition(s), nucleic acid(s), and / or vector(s) detailed herein as a therapeutic or preventive measure for infections, including bacterial infections and viral infections. In one embodiment, the aforementioned ISG15-binding modulator polypeptides, pharmaceutical compositions, nucleic acids, and / or vectors may be utilized in methods for treating infections caused by Gram-positive and / or intracellular bacteria. In a preferred embodiment, the infection is caused by bacteria of the genus Listeria, such as Listeria monocytogenes.Frlmp / ISG15_Nbs / 873
[0042] Another embodiment involves utilizing the ISG15-binding modulator polypeptide(s), pharmaceutical composition(s), nucleic acid(s), and / or vector(s) detailed herein as a therapeutic or preventive measure for autoimmune / autoinflammatory diseases.
[0043] Objects of the present invention are presented in more detail in the following Description and Examples.
[0044] DESCRIPTION OF THE FIGURES
[0045] The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes.
[0046] Figure 1. A panel of 57 anti-human ISG15 (hlSG15) nanobodies was tested for hlSG15 binding, leading to the selection of 14 Nbs for further characterization.
[0047] (A) The phylogenetic tree of the isolated anti-ISG15 nanobodies was constructed using the maximum likelihood criterion after performing multiple sequence alignment in MAFFT43. The nanobodies selected for functional characterization are highlighted in yellow.
[0048] (B) A periplasmic extract (PE) ELISA screen demonstrates specific binding of the selected nanobodies to ISG15.The ELISAsignal(OD450 nm) is presented for ISG15 in comparison to a blank control (bovine serum albumin, BSA).
[0049] (C) PE-BLI sensorgrams measuring the apparent binding affinity of the selected nanobodies to immobilized ISG15-biotin. The data were fitted to a 1 :1 binding model to calculate the Koffrate for each nanobody.
[0050] Figure 2. Expression, purification and further characterization of ISG15-binding nanobodies. (A) Fourteen nanobodies were expressed in the periplasm of E. coli and purified by immobilized metal affinity chromatography (IMAC) using a Nickel-Sepharose matrix. Eluted proteins were separated by non-reducing SDS-PAGE and visualized using Coomassie staining.
[0051] (B) An aliquot of the eluted fraction was further analyzed by intact mass spectrometry. The experimentally determined monoisotopic mass is shown versus the theoretical mass of the nanobody in Dalton (Da).
[0052] Figure 3. Biophysical characterization of anti-ISG15 nanobodies.
[0053] (A) Pulldown assay of anti-ISG15 nanobodies with purified GST-hlSG15 immobilized on glutathione agarose beads. Purified GST was included as a negative control. Binding was detected by SDS- PAGE.Frlmp / ISG15_Nbs / 873
[0054] (B) Pulldown assay of purified untagged hlSG15 with His-tagged anti-ISG15 nanobodies coated on Ni-NTA agarose beads. A nanobody against GFP was included as a control. ISG15 and the nanobodies were blotted and detected by anti-ISG15 and anti-His antibody, respectively.
[0055] (C) Reactivity of anti-ISG15 nanobodies against human and mouse ISG15 in an enzyme-linked immunosorbent assay (ELISA). A nanobody against GFP was included as a control (grey). Datapoints represent the mean of three replicates and error bars represent the standard errors of the mean. The affinity constants for binding ISG15 are shown as 95% confidence intervals. Only the nanobodies with nanomolar affinity are shown.
[0056] Figure 4. Anti-ISG15 nanobodies reduce the intracellular ISG15-USP18 interaction, as demonstrated in a nanoBRET assay.
[0057] (A) HEK293T cells were transfected with constructs expressing an ISG15-USP18 NanoBRET pair and anti-ISG15 nanobody. Forty-eight hours after transfection, the BRET signal was measured and cells were monitored forexpression of the nanobody. Mock plasmid and anti-GFP nanobody were included as negative controls while HA-ISG15 served as a positive control. The nanoBRET ratio was calculated using the average of three technical replicates followed by subtraction of a no-Halo control. The nanoBRET ratio is shown relative to the ratio obtained for the anti-GFP nanobody control and expressed as %USP18-ISG15 binding (mean ± SD, n=3 independent experiments, oneway ANOVA). Asterisks indicate p values, with **** p <0.0001.
[0058] (B) Representative blot showing expression of the ISG15-specific nanobodies and controls used in the ISG15-USP18 nanoBRET assay.
[0059] Figure 5. Anti-ISG15 nanobodies counteract Listeria infection in vitro.
[0060] HeLa cells were infected with Listeria monocytogenes EGD (Listeria) for 20h at MOI 25. Twenty-four hours prior to infection, HeLa cells were transfected with plasmids encoding nanobodies against ISG15 or with an anti-GFP nanobody control. Intracellular Listeria were quantified by counting colony-forming units (CFUs) after serial dilution in a gentamycin assay. The percentage of intracellular bacteria relative to anti-GFP nanobody-expressing cells is shown (mean ±SD, n = 3 independent experiments, one-way ANOVA). Asterisks indicate p values, with * p<0.05, *** p<0.001.
[0061] Figure 6. Selected Nanobodies reduce the delSGylating activity of USP18 in vitro.
[0062] Cleavage of ISG15-rhodamine by recombinant USP18 was measured over time in the presence of anti-ISG15 nanobodies. Initial velocities were calculated and normalized to the fluorescence signal obtained from the anti-GFP nanobody control condition (mean ± SEM, n=3 independent repeats).Frlmp / ISG15_Nbs / 873
[0063] Statistical analysis was performed using a one-way ANOVA followed by a post hoc Dunnett’s multiple comparison test using the NbGFP condition as the reference condition. Asterisks indicate p values, with * p<0.05, *** p<0.001 , **** p<0.0001.
[0064] Figure 7. Structural data forthe Nb61-ISG15 complex.
[0065] (A) The asymmetric unit of the Nb61-ISG15 crystals contains 2 Nb61-ISG15C complexes. All proteins are shown in cartoon representation. Symmetry- related molecules are shown in grayscale. ISG15C denotes only the C-terminal domain of ISG15.
[0066] (B)
[0067] Upper panel:
[0068] Residues of the 3 CDR loops of Nb61 are involved in ISG15 binding. The top panels show an overview of the interaction between Nb61 and ISG15. In both panels, the proteins are shown in cartoon representation. In the right-side panel, the Nb61 residues interacting with ISG15 are additionally shown in stick and surface representation. The bottom panel displays the interaction details, with the interacting residues of both molecules shown in stick representation, colored by atom type, and highlighting the hydrogen bonds formed between the two molecules with yellow dashed lines.
[0069] Lower panel:
[0070] Left: Structure of the complex shown in cartoon representation, with Nb61 depicted in light blue and ISG15 in green. The complementarity-determining region (CDR) loops of Nb61 are highlighted in progressively darker shades of blue. Residues forming the binding interface are shown in stick representation and labeled by residue number (ISG15 residues in italic typeface, Nb61 residues in bold typeface). Hydrogen bonds are depicted as yellow dashed lines.
[0071] Central: The same structure as in panel (A), rotated by 180°.
[0072] Right: Enlarged view restricted to interface residues involved in hydrogen-bond formation, with hydrogen bonds indicated as yellow dashed lines.
[0073] (C) Nb61 interferes with ISG15-USP18 binding. Overlay of the Nb61 -ISG15C and USP18-ISG15 (PDB code 5CHV) structures. In the left-side panel, Nb61 is shown in surface representation, while the other proteins are depicted in cartoon representation. The right-side panel shows a zoom-in of the clash between the Nb61 CDR2 and USP18. All molecules are shown in cartoon representation. USP18 residues 222-224 are shown in stick representation, colored by atom type.Frlmp / ISG15_Nbs / 873
[0074] Figure 8. ISG15-specific nanobodies reduce IFN-Y secretion from PBMCs.
[0075] (A) Human PBMCs were treated with recombinant ISG15, IL-12 and anti-ISG15 nanobodies as indicated. IFN-y secretion was measured by IFN-y ELISA and compared against the “I LI 2 + ISG15” condition (mean ± SD, n=3, one-way ANOVA). Asterisks indicate p values, with * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. ns, non-significant.
[0076] (B) Establishing an IFN-y assay to screen for nanobodies that interfere with ISG15-mediated IFN-y secretion. Human PBMCs were treated with recombinant ISG15, IL-12 and anti-ISG15 antibodies as indicated. The following monoclonal anti-ISG15 antibodies were used: i) 703654, ThermoFisher Scientific, 6 g / mL, or ii) 703131 , ThermoFisher Scientific, 6 g / mL. IFN-y secretion was measured by IFN-y ELISA and compared to the “IL12+ISG15” condition (mean ±SD, n=3, one-way ANOVA). Asterisks indicate p values, with ** p<0.01 , *** p<0.001 , **** p<0.0001.
[0077] Figure 9. Anti ISG15 Nb61 potentially interferes with ISG15-LFA1 binding.
[0078] (A) Overlay of the ISG15C-Nb61 structure with the ISG15-CD11 a Boltz 2 model. Nb61 is shown in surface representation, and ISG15 and CD11a are shown in cartoon representation.
[0079] (B)Zoom in view of the steric clash between Nb61 (surface) and the CD11a al domain (cartoon with secondary structure annotations). Nb61 overlaps with the a1 and a2 helices and the 01 , 02, 03, 04 and 05 strands of the CD11a a I domain.
[0080] (C) Same clash as shown in panel (B), after a 180° rotation.
[0081] Figure 10. Boltz 2 structural model of the CD11a-ISG15 interaction.
[0082] (A) Overview of the modelled interaction between human ISG15 and human CD11 a. Both proteins are displayed in cartoon representation with the domain architecture of CD11a indicated. The C terminal domain of ISG15 is positioned against the a I domain of CD11a, consistent with previously reported mutagenesis and pulldown data. Structural models were generated using the Boltz 2 algorithm on Rowan44, based on the sequences corresponding to ISG15 (residues 1-155) (PDB 1Z2M) and CD11a (1-795) (PDB 5E6U). Unforced pocket restraints were applied to ISG15 at residues previously implicated in IFNy signalling and LFA 1 binding (Tyr96, Arg99, Thr101 , Gin 102, Thr103)45. CD11a restraints comprised surface exposed a I domain residues (Met140, Gln143, Ser176, Tyr177, Lys178, Leu203) identified by SPPIDER9, excluding classical MIDAS residues mediating ICAM 1 binding, which are not required for ISG15 binding as reported previously45. Model performance metrics were: pTM = 0.71 , ipTM = 0.629, confidence score = 0.835, and average pLDDT = 0.887.Frlmp / ISG15_Nbs / 873
[0083] (B) Focused view of ISG15 bound to the a I domain of CD11a. Proteins are shown in cartoon representation with annotated secondary structure elements. The modelled interface involves residues from the ISG15 (34— [31 ' loop, (32' strand, a1 helix, and the 02'-a1 connecting loop, and residues from CD11 a located in loops connecting the 01 strand to the a1 helix, the 02 to 03 strand, and the 03 strand to the a1 helix. The calculated buried surface area of the interface is 517.2 A2.
[0084] (C) Same view as in panel (B), with CD11a residues participating in the interface displayed in surface representation.
[0085] (D) Detailed representation of interacting residues. Residues from each protein are shown in stick representation, coloured by atom type, with hydrogen bonds depicted as yellow dashed lines. A hydrogen bond is observed between the ISG15 Glu97 side chain (02') and the backbone of CD11a Leu205 (03-a1 loop).
[0086] (E) Interaction details shown after a 180° rotation relative to panel (D).
[0087] Figure 11. BLI competition assay for ISG15-specific nanobodies against Nb61.
[0088] (A) Outline of the experiment showing the expected signals at each step. After an initial baseline reading, biotinylated ISG15 is loaded onto a streptavidin sensor, followed by a second baseline measurement. The first nanobody is then associated with the antigen. A second nanobody is introduced, resultingin two possible outcomes: no competition, where the second nanobody binds the antigen and generates a strong signal, or competition, where the signal increase is minimal or absent.
[0089] (B) Binding traces from a competitive BLI experiment against Nb61, comparing the competitive nanobody Nb32 and the non-competitive nanobody Nb51 for bindingto biotinylated human ISG15 on a streptavidin sensor. The assay was conducted in two directions: (1 ) Nb32 or Nb51 was first associated, followed by a mixture of the same nanobody with Nb61; (2) Nb61 was first associated, followed by a mixture of Nb61 with either Nb32 or Nb51.
[0090] (C) A bar chart displaying the results of the competitive BLI experiment for seven ISG15-binding nanobodies against Nb61. As expected, Nb61 fully inhibits its own bindingto ISG15. Additionally, Nb32 competes with Nb61 for ISG15 binding, indicative of an overlapping epitope.
[0091] (D) Heatmap showing the competition of individual Nbs (rows) against Nb61 (column) for binding to human ISG15. Each value reflects the degree to which a given nanobody inhibits Nb61 binding, with higher values indicating stronger competition and lower values indicating minimal or no competition. Color intensity corresponds to the magnitude of competition. Nanobodies that did not bind immobilized bioti n- ISG15 were excluded from the analysis. Notably, Nb32 competes with Nb61 for ISG15 binding, indicative of an overlapping epitope.Frlmp / ISG15_Nbs / 873
[0092] Figure 12. Nb61 amino acid sequence and illustration of the different CDR annotations referred to in this application.
[0093] CDR annotations according to MacCallum, AbM, Chothia, Kabat and IMGT numbering systems are shown in colored boxes corresponding to the sequence of Nb61 (SEQ ID NO: 33). Foramino acid residue numberingof the VHH sequence, the Kabat numberingwas applied.
[0094] Figure 13. Kinetic analysis of Nb61 and ISG15 interaction by BLI.
[0095] Sensorgrams from biolayer interferometry (BLI) analysis showing the binding of Nb61 at defined concentrations (1.25 - 10 nM) to immobilized ISG15 on streptavidin sensors. Experimental association and dissociation data (dots) are overlaid with globally fitted binding model curves (solid lines). The data were used to calculate the equilibrium dissociation constant (KD), association rate constant (kon), and dissociation rate constant (koff).
[0096] Figure 14. Anti-ISG15 nanobodies bind to intracellular ISG15.
[0097] (A) Co-immunoprecipitation assay performed in HEK293T cells transiently transfected with expression plasmids encoding FLAG-tagged ISG15 and HA-tagged anti-ISG15 nanobodies. A mock plasmid, FLAG-GFP, and an HA-tagged anti-GFP nanobody NbGFP were included as negative controls. Cell lysates were subjected to immunoprecipitation using anti-FLAG affinity beads. Input lysates and immunoprecipitated material were analyzed by immunoblotting using anti-FLAG and anti-HA antibodies. Anti-tubulin (Tuba) antibody was used as a loading control for input samples.
[0098] (B) Co-immunoprecipitation assay performed in HeLa cells transiently transfected with plasmids encoding FLAG-tagged anti-ISG15 nanobody Nb61 or FLAG-tagged anti-GFP nanobody (NbGFP) as a negative control. Cells were treated with or without interferon-a (IFNa) to induce ISGylation. Cell lysates were subjected to immunoprecipitation using anti-FLAG affinity beads. Input lysates and immunoprecipitated material were analyzed by immunoblotting with anti-FLAG and anti-ISG15 antibodies. Anti-GAPDH antibody was used as a loading control for input samples.
[0099] (C) Pulldown assay performed using lysates from interferon-a (IFNa)-treated and untreated HeLa cells. Recombinant FLAG-tagged nanobody Nb61 was immobilized on anti-FLAG affinity beads and incubated with the lysates. Anti-FLAG beads without immobilized nanobody were used as aFrlmp / ISG15_Nbs / 873
[0100] control. Input lysates and pulldown fractions were analyzed by immunoblotting using anti-FLAG and anti-ISG15 antibodies. Anti-GAPDH antibody was used as a loading control for input samples.
[0101] Figure 15. Anti-ISG15 Nb61 fused to a nuclear localization signal drives ISG15 accumulation in the nucleus.
[0102] (A) Representative fluorescence microscopy images of HEK293T cells transfected with (i) an empty vector control (mock) together with a GFP ISG15 expression construct or (ii) a V5 tagged Nb61 nanobody fused to an SV40 nuclear localization sequence (Nb61 NLS) together with GFP ISG15. Nuclei are visualized using DAPI staining. GFP ISG15 fluorescence is shown in the green channel. Nb61 NLS expression is detected using an anti V5 primary antibody followed by an Alexa Fluor 568 secondary antibody (magenta). Individual channels and merged images are shown. Scale bars: 10 pm.
[0103] (B) Quantification of the proportion of GFP ISG15 fluorescence intensity detected within the nuclear compartment and cytoplasmic compartment of HEK293T cells transfected with GFP-ISG15 and either the mock control or the Nb61 NLS construct. Each data point corresponds to one field of view(n=29).
[0104] (C) Quantification of the ratio of nuclear GFP ISG15 fluorescence intensity to cytoplasmic GFP ISG15 fluorescence intensity for cells transfected GFP-ISG15 together with the mock control versus the Nb61 NLS construct. Each data point corresponds to one field of view (n=29). Statistical comparison between conditions was performed using a Mann-Whitney U test. Asterisks indicate p values, with **** p<0.0001.
[0105] Figure 16. Effect of anti-ISG15 nanobody Nb61 on USP18 stability and interferon signalling. (A) HEK293T cells were transfected with combinations of expression constructs encoding GFP-tagged human USP18, FLAG-tagged human ISG15, and an HA-tagged anti-ISG15 nanobody (Nb61) or, as a non-targeting control, an HA-tagged anti-GFP nanobody (NbGFP). After a 48-hour expression period, cell lysates were subjected to immunoblot analysis to determine the relative abundance of GFP-USP18. Expression levels of each construct were verified using antibodies specific for GFP, FLAG, and HA. GAPDH was detected as an internal loading control.
[0106] (B) Quantification of the relative abundance of GFP-USP18 in (A) (mean ± SEM, n = 4 independent repeats, two-tailed paired t-test). Asterisks indicate p values, with * p<0.05 and ** p<0.01.
[0107] (C) HeLa cells engineered to stably express an HA-tagged anti-ISG15 nanobody (Nb61) or, as a non-targeting control, an HA-tagged anti-GFP nanobody (NbGFP) were either left untreated or subjected to a priming step with 1 ,000 U / mL IFNa for 24 hours. After priming, cells were washed and maintained for an additional 24 hours in medium lacking IFNa. Cells were then re-stimulatedFrlmp / ISG15_Nbs / 873
[0108] with 100 or 1 ,000 U / mL IFNa for 30 minutes. Whole-cell lysates were analysed by immunoblotting using antibodies recognizing phospho-STAT1 (Tyr701), HA, and a-tubulin as a loading control. (D) IFNa-induced signalling following primingwas quantified by comparing phospho-STAT1 levels in primed versus non-primed cells for each nanobody-expressing line (mean ± SEM, n = 3 independent repeats; two-tailed unpaired t-test). Asterisks indicate p values, with * p<0.05.
[0109] Figure 17. Anti-ISG15 nanobody Nb61 counteracts Mycobacterium tuberculosis infection in vitro.
[0110] THP-1 macrophages were infected with DsRed-expressing Mycobacterium tuberculosis (Mtb-DsRed) for 3 hours at a multiplicity of infection (MOI) of 2. Following infection, cells were transfected with mRNA-lipid nanoparticles (mRNA-LNPs) encoding either an anti-GFP nanobody (NbGFP), an anti-ISG15 nanobody (Nb61), or were left untransfected. After a total infection period of 48 hours, cells were lysed and intracellular bacteria were quantified by flow-cytometric measurement of Mtb-derived DsRed mean fluorescence intensity (MFI). For visualization, intracellular bacterial load is expressed as the percentage of the signal observed in untransfected cells (mean ± SEM, n = 3 independent repeats). Statistical analysis was performed on the non-normalized raw MFI values using a linear mixed-effects model followed by Dunnett-type post-hoc comparisons. Asterisks indicate p values, with * p<0.05.
[0111] Figure 18. Anti-ISG15 nanobodies counteract SARS-CoV-2 infection in vitro.
[0112] HeLa hACE2 cells were transfected with an anti GFP nanobody (NbGFP) or anti-ISG15 nanobodies Nb32 or Nb61. After 24 hours, the cells were infected with SARS CoV 2 at MOI 0.1 for 24 hours. Viral RNA levels were quantified by qPCR targeting the SARS CoV 2 E gene, using HPRT as the reference gene. Data are presented as fold change values relative to the NbGFP infected condition (mean ± SEM, n = 5 independent repeats). Statistical analysis was performed on ACt values using a linear mixed effects model with Dunnett type post hoc comparisons. Asterisks indicate p values, with * p<0.05 and ** p<0.01.
[0113] Figure 19. Nb61-Fc modulates ISG15-driven cytokine secretion in human PBMCs.
[0114] Human PBMCs were stimulated with IL-12 and ISG15 for 48 hours in the presence or absence of anti-ISG15 Nb61-Fc. Cytokine levels (IFN-y, TNF, IL-6, IL-10) in supernatants were measured using a multiplex cytokine assay (mean ± SEM, n = 3). Statistical significance was determined by one-way ANOVA with Dunnett’s post-hoc test comparing each condition to the “IL-12+ISG15” condition. Asterisks indicate p values, with **** p<0.0001 , ** p<0.01 and * p < 0.05.
[0115] Figure 20. Nb88 binds the N-terminal domain of ISG15.
[0116] The interaction involves the three CDR loops and some framework 3 residues. Both protein molecules are shown in cartoon representation, Nb88 in light pink and ISG15 in green, respectively.Frlmp / ISG15_Nbs / 873
[0117] On Nb88, the CDR loops are colored in different shades of pink. In the right hand panel, the CDR loops are shown in surface representation.
[0118] Figure 21. Nb88-ISG15 interaction details.
[0119] (A) Structure of the complex shown in cartoon representation, with Nb88 depicted in light pink and ISG15 in green. The complementarity-determining region (CDR) loops of Nb88 are highlighted in progressively darker shades of pink. Residues forming the binding interface are shown in stick representation and labeled by residue number (ISG15 residues in italic typeface, Nb88 residues in bold typeface). Hydrogen bonds are depicted as yellow dashed lines.
[0120] (B)The same structure as in panel (A), rotated by 180°.
[0121] (C) Enlarged view restricted to interface residues involved in hydrogen-bond formation, with hydrogen bonds indicated as yellow dashed lines.
[0122] DESCRIPTION
[0123] Reference will now be made in detail to representative embodiments of the invention. While the invention will be described in conjunction with the enumerated embodiments, it shall be understood that the subject matter of this invention is not intended to be limited to those embodiments. On the contrary, the invention is intended to include all possible alternatives, modifications, and equivalents that may fall under the scope of the present disclosure, as defined by the claims.
[0124] The invention will be described with respect to specific embodiments and with reference to certain drawings; however, it should be understood that the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope of the invention. It is to be understood that not necessarily all aspects or advantages may be achieved in accordance with any particular embodiment of the invention. Thus, those skilled in the art will recognize that the invention maybe embodied or carried out in a manner that achieves or optimizes one advantage or a group of advantages as taught herein without necessarily achieving other aspects or advantages as may be taught or suggested herein.
[0125] The invention, encompassing its nature, organization and method of operation, as well as its featuresand advantages, can be best comprehended by referringto the detailed description below, preferably read in conjunction with the accompanying drawings. The aspects and advantages of the invention will become apparent and clarified through references to the embodiments described hereinafter. Throughout this specification, references to “one embodiment”, “an embodiment” or “a specific embodiment” mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention.Frlmp / ISG15_Nbs / 873
[0126] Thus, occurrences of the phrases “in one embodiment”, “in an embodiment” or “in a specific embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment; however, they may also refer to the same embodiment.
[0127] Definitions
[0128] Where an indefinite or definite article is used when referring to a singular noun, e.g., “a” or “an”, “the”, this includes a plural of that noun unless something else is specifically stated. Where the term “comprising” is used in the current description and claims, it does not exclude the presence of other elements and / or steps. Furthermore, the terms “first”, “second”, “third” and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein. The following terms or definitions are provided solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used in this document have the same meaning as they would to a person skilled in the art of the present invention.
[0129] For definitions and terms of the art, practitioners are particularly directed to the following sources: i) “Molecular Biology”, 3rdEdition (2019), by Clark D., Pazdernik N. and McGehee R.46; ii) “Molecular Cloning: A Laboratory Manual”, 4thEdition (2012), by Sambrook J. and Green M.47; iii) “Advances in Protein Molecular and Structural Biology Methods”, 1stEdition (2022), by Tripathi T. and Dubey VK.48; iv) “Fundamentals of Molecular Structural Biology”, 1stEdition (2019), by Pal S.49; and v) “Cellular and Molecular Immunology”, 10thEdition (2022), by Abbas AK., Lichtman A. and Pillai S.50. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art (e.g. in molecular biology, biochemistry, structural biology, immunology and / or computational biology).
[0130] In describing and claiming the embodiments of the invention, the following terminology is used.
[0131] Modulator
[0132] In the context of the present invention, the terms “modulator”, “binding agent” or “binder” can be used interchangeably. These terms refer to a substance, compound, molecule, chemical species or biological particle that, upon specifically binding to a target molecule, affects, alters or changes: i) the physical state or conformation of said target molecule, and / or ii) the function, activity or reactivity of said target molecule, and / or iii) the quantity or expression level of said target molecule and / or iv) the intra- and / or extracellular localization of the target molecule. These changes areFrlmp / ISG15_Nbs / 873
[0133] assessed relative to the absence of the modulator / binding agent / binder or compared to a vehicle or non-binding substitute control.
[0134] A target molecule, to which a modulator of this invention binds, is human interferon-stimulated gene 15 (ISG15), also known as G1P2, IFI15, IP17, UCRP, hUCRP, IMD38, or ISG15 ubiquitin-like modifier. For instance, the modulator may bind to ISG15 and interfere with the interaction between ISG15 and other proteins, such as USP18, affecting ISG15’s state and activity.
[0135] A modulator / binding agent / binder may be selected from the group comprising, without any limitation, a polypeptide, an antibody or any fragment derived thereof, such as a fragment antigen-binding(Fab), a disulfide-bonded fragmentantigen-binding(F(ab')2), an Fd fragment, a single-chain variable fragment (scFv), a single-chain antibody, a disulfide-stabilized Fv (dsFv), a diabody, and antibody fragments comprising either a VL or VH domain, including a heavy chain antibody (hcAb), a single domain antibody (sdAb), a minibody, a variable domain derived from camelid heavy chain antibodies (VHH or Nanobody®), and a variable domain of the new antigen receptors derived from shark antibodies (VNAR). Furthermore, a modulator / binding agent / binder may be an antibody mimetic, including affibody molecules, affilins, affimers (adhirons), affitins, alphabodies, anticalins, avimers, designed ankyrin repeat proteins (DARPins), fynomers, gastrobodies, Kunitz domain peptides, monobodies, nanoCLAMPs (clostridal antibody mimetic proteins), optimers, repebodies, pronectins, centyrins, and OBodies. A modulator / binding agent / binder may also be selected from various protein scaffolds, such as protein A, protein G, fibronectin type III repeats, inhibitor cysteine knots (knottins), and engineered CH2 domains (nanoantibodies).
[0136] To modulate
[0137] The terms “modulate”, “modulating”, “modulator” or “modulation” referto inducing a change from the baseline or existing state, particularly involving positive or negative regulation or adjustment of normal functioning or activity relative to a reference, control or normal state. This results in a change in function or activity compared to the control condition (i.e., in the absence of the modulator or compared to a non-modulating control). In the context of this invention, these terms encompass various actions, including altering, increasing, decreasing, masking, overriding, or restoring the normal activity of ISG15, particularly its role in immune regulation. For example, the modulator described in this invention may bind to ISG15 and, upon binding, inhibit or reduce the interaction of ISG15 with USP18 inside a cell. This, in turn, may decrease USP18-mediated delSGylation, thereby modulating the function and / or state of proteins involved in innate immune pathways, relative to the absence of the modulator described herewith.Frlmp / ISG15_Nbs / 873
[0138] Immune function
[0139] The term “immune function” or “immune activity” refers to the biological processes and mechanisms by which the immune system detects, responds to, and eliminates pathogens, abnormal cells, or foreign substances to maintain homeostasis and protect the host organism. Immune function encompasses both innate and adaptive immune responses, involving a network of immune cells (e.g., macrophages, dendritic cells, T cells, B cells, and natural killer cells), signaling molecules (e.g., cytokines, chemokines, and complement proteins), and effector mechanisms (e.g., phagocytosis, antigen presentation, antibody production, and cytotoxicity). Additionally, “immune function” includes inflammatory responses, which are activated in response to infection, tissue damage, or stress, and involve the recruitment of immune cells and the release of pro-inflammatory mediators to restore homeostasis. Dysregulation of immune function can lead to pathological conditions such as chronic inflammation and autoimmune diseases, in which the immune system aberrantly targets self-antigens, resulting in tissue damage and dysfunction. The assessment of immune function or activity may include measuring immune cell proliferation, cytokine secretion, antigen recognition, pathogen clearance, inflammatory marker levels, or autoreactive immune responses under specific conditions.
[0140] To bind
[0141] The terms “bind”, “bound”, “binding,” and their derivatives refer to non-covalent interactions between two or more molecules, such as proteins or theirfragments, resulting in the association of the interacting molecules. In this context, the term “epitope” or “binding site” refers to an antigenic determinant of a polypeptide, constituting a binding site or binding pocket on a target molecule, such as on human ISG15. Such epitopes may include at least one amino acid that is crucialforbindingtoa bindingagent (e.g., to a Nanobody), but preferably contain at least two amino acids arranged in a spatial conformation unique to the epitope, forming a “conformational epitope”. Typically, an epitope consists of at least 4, 5, 6, or 7 amino acids, and more commonly, it contains at least 8, 9, or 10 amino acids.
[0142] A “conformational epitope” denotes an epitope composed of amino acids arranged in a spatial conformation that is specific to the folded three-dimensional (3D) structure of a protein. Typically, a conformational epitope consists of amino acids that are not adjacent in the linear sequence but are brought together in the folded (native) 3D structure of the protein. However, it can also consist of a continuous sequence of amino acids that adopts a unique conformation in the folded state of the protein, which is not resent when the protein is denatured. Methods for determining the spatial conformation of amino acids are well-established and include techniques such as X-rayFrlmp / ISG15_Nbs / 873
[0143] crystallography, multi-dimensional nuclear magnetic resonance (NMR), cryo-EM, and other structural methodologies.
[0144] To specifically bind
[0145] Molecular recognition refers to the process by which biological molecules, such as proteins or polypeptides, bind with each other through noncovalent interactions to form specific complexes. This process is characterized by two key features: (i) specificity, which relates to the degree of preference towards a particular target; and (ii) affinity, which is the measure of the binding strength between the interacting partners. Aspecific binding partnerwith high affinity remains bound even in the presence of high concentrations of less specific partners characterized by lower affinity for the target51.
[0146] In this context, the term “specifically binds”, or its equivalents, describes the ability of a modulator / binding agent, as defined in this application, to bind to a specific target with high degree of recognition and association, while displaying lower, limited or no recognition and / or binding to other targets. Yet, specific binding does not necessarily imply exclusive binding, as the modulator may still interact with other molecules to some extent. However, a modulator that specifically binds to a defined target demonstrates a significantly stronger preference for that target compared to other targets. For example, the modulator polypeptide of the current invention exhibits specific binding to human ISG15.
[0147] Protein
[0148] Proteins are essential building blocks of living organisms, made up of polypeptide chains composed of amino acids, which translate the genetic information stored in DNA. Specifically, the term “protein” denotes one or more polypeptides functioning as a discrete unit. When a single polypeptide operates autonomously without requiring permanent or transient physical interaction with other polypeptides to form a functional entity, the terms “polypeptide” and “protein” are used interchangeably. Conversely, if the discrete functional unit comprises multiple polypeptides that physically interact, the term “protein” encompasses the assembly of polypeptides that are physically associated and operate collectively as a functional unit. In this context, the term “polypeptide” refers to any chain or chains of two or more amino acids, irrespective of the molecule’s length, wherein the amino acid residues are linked by covalent peptide bonds (i.e. amide bonds linking the amine of one amino acid to the carboxyl of another amino acid). Hence, “peptide”, “polypeptide”, “amino acid chain”, or any other term used to describe a chain or chains of two or more amino acids fall under the definition of a “protein”. A “protein” or “polypeptide” mayFrlmp / ISG15_Nbs / 873
[0149] also refer to a partial amino acid sequence derived from its original molecule, for instance after enzymatic digestion (such as tryptic digestion).
[0150] Of note, polypeptide-forming amino acids may include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, amino acid isomers, unnatural amino acids, synthetic amino acid analogues, and variants thereof. Furthermore, the term “protein” is also intended to encompass products resulting from post-translational modifications of a polypeptide. Examples of such modifications include, but are not limited to, acetylation, acylation, adenylation, alkylation, amidation, arginylation, beta-lysine addition, biotinylation, butyrylation, carbamylation, carbonylation, citrullination, C-linked glycosylation, crotonylation, deamidation, diphthamide formation, eliminylation, ethanolamine phosphoglycerol attachment, farnesylation, flavinylation, formylation, gamma-carboxylation, geranylgeranylation, glutarylation, glutathionylation, glypiation, hydroxylation, hypusine formation, iodination, ISGylation, isoaspartate formation, isopeptide bond formation, isoprenylation, lipoylation, malonylation, methylation, myristylation, neddylation, nitration, N-linked glycosylation, nucleotide addition, O-GlcN Acylation, O-linked glycosylation, oxidation, palmitoylation, PARylation, PEGylation, phosphate ester (O-linked) or phosphoramidate (N-linked) formation, phosphopantetheinylation, phosphorylation, polyglutamylation, polyglycylation, prenylation, propionylation, protein splicing, proteolytic cleavage, pupylation, pyroglutamate formation, racemization, retinylidene Schiff base formation, S-nitrosylation, stearoylation, sulfation, sumoylation and ubiquitination. Finally, a polypeptide can originate from a natural biological source or be produced using recombinant methods, without necessarily being translated from a predetermined nucleic acid sequence. It can be produced using various methods, including chemical synthesis techniques such as solid-phase peptide synthesis (SPPS), thioester-forming ligation, oxime and hydrazone-forming ligation, thiazolidine / oxazolidine-forming ligation, and ligation by disulfide exchange (thioacid-capture ligation), among others.
[0151] Antibody
[0152] The term “antibody” refers to an immunoglobulin (Ig) molecule or a molecule containing an Ig domain, which specifically binds with an antigen, including multimers thereof. In humans, antibodies are naturally generated by plasma cells as part of the adaptive immune response, mediating the defense against invading pathogens.
[0153] Antibodies exist as one or more copies of a Y-shaped unit composed of four polypeptide chains. Each Y unit contains two identical heavy chains (H) and two identical light chains (L), which differ in their sequence and length. The top of the Y shape contains the variable region (V), also known asFrlmp / ISG15_Nbs / 873
[0154] the fragment antigen-binding region (F(ab)), which binds tightly to a specific part of an antigen called an epitope. The base of the antibody consists of constant domains (C) that form the fragment crystallizable (Fc) region. This Fc region is essential for the antibody's function during an immune response. The Y-shape of an antibody can be cleaved into three fragments by the proteolytic enzyme pepsin: two F(ab) regionsand one Fc region. The F(ab) regions contain the variable domains that bind to specific antigens. The Fc fragment provides a binding site for endogenous Fc receptors on the surface of lymphocytes and secondary antibodies. The type of heavy chain defines the overall class or isotype of an antibody. Mammals have five types of immunoglobulin (Ig) heavy chains, denoted by the Greek letters a, 6, s, y, and . These correspond to the IgA, IgD, IgE, IgG, and IgM antibodies, respectively. Heavy chains vary in size and composition: a and y chains have approximately 450 amino acids each, while and s chains are composed of about 550 amino acids each. Each heavy chain comprises two regions: a constant region (CH) and a variable region (VH). The constant region is identical in all antibodies of the same isotype but differs among different isotypes. The y, a, and 5 heavy chains have a constant region composed of three tandem Ig domains — CH1 , CH2, and CH3 — and include a hinge region for added flexibility. In contrast, the p and s heavy chains have a constant region composed of four Ig domains. The variable region (VH) of each heavy chain differs based on the specific B cell that produced it but remains identical for all antibodies produced by a single B cell or B cell clone. The variable region is approximately 110 amino acids long and consists of a single Ig domain.
[0155] Mammals have two types of light chains, lambda (A) and kappa (K), which differ slightly in their polypeptide sequences. Each light chain consists of two domains: a constant domain (CL) and a variable domain (VL). The length of a light chain ranges from approximately 211 to 217 amino acids. An antibody contains two identical light chains. Other types of light chains, such as the iota (i) chain, are found in lower vertebrates like Chondrichthyes and Teleostei. The F(ab) region of an antibody contains the antigen-binding site known as the paratope. The paratope binds to a specific part of an antigen called the epitope, which is a small segment of the antigen, sometimes just a few amino acids in length. The paratope and epitope are held together by complementary shapes and intermolecular interactions, including Van der Waals forces, hydrogen bonds, electrostatic interactions, and hydrophobic interactions. The strength of these forces determines the antibody's affinity for the antigen.
[0156] In the context of this application, antibodies can be intact immunoglobulins or immunoreactive portions of intact immunoglobulins. The term encompasses antibodies produced naturally, recombinantly, semi-synthetically, or synthetically. For instance, an antibody can be naturally present in or isolated from biological sources, such as being produced or expressed endogenouslyFrlmp / ISG15_Nbs / 873
[0157] bya cell ortissue and optionally isolated therefrom. Alternatively, an antibody can be recombinant, produced through recombinant DNA technology, and / or synthesized chemically or biochemically, either partially or in its entirety.
[0158] Active antibody fragment
[0159] The terms “active antibody fragment”, “antibody fragment”, “antigen-binding fragment”, and “functional antibody fragment" refer to a portion of any antibody or antibody-like structure that by itself has high affinity for an antigenic determinant, or epitope, and contains one or more complementarity-determining-regions (CDRs) accounting for such specificity. Non-limiting examples include immunoglobulin domains, Fab, F(ab)'2, scFv, heavy-light chain dimers, immunoglobulin single variable domains, Nanobodies, domain antibodies (dAbs), and single chain structures, such as a complete light chain or complete heavy chain.
[0160] Immunoglobulin (Ig) single variable domain (ISVD)
[0161] The term “immunoglobulin single variable domain” (“ISVD”), as used herein, refers to a protein with an amino acid sequence comprising 4 Framework regions (FR) and 3 complementary determining regions (CDR) accordingto the format: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. An “immunoglobulin domain” in the context of this invention also refers to an “immunoglobulin single variable domain” (“ISVD”), which is synonymous with the term “single variable domain.” This defines molecules in which the antigen-binding site is located within and formed by a single immunoglobulin domain. This distinguishes ISVDs from conventional immunoglobulins or their fragments, where two immunoglobulin domains — specifically, two variable domains — interact to form an antigen-binding site. In contrast, the binding site of an ISVD is formed entirely by a single VH / VHH or VL domain. Hence, the antigen binding site of an immunoglobulin single variable domain is formed by no more than three CDR’s. Thus, the single variable domain may be a light chain variable domain sequence (VL sequence) or a suitable fragment thereof, or a heavy chain variable domain sequence (VH or VHH sequence) or a suitable fragment thereof, provided that it can form a single functional antigenbinding unit. In other words, said antigen-binding unit must function independently, without requiring interaction with another variable domain to achieve antigen recognition.
[0162] In particular, the immunoglobulin single variable domain may be a Nanobody® (also referred to as “Nanobody”, “nanobody” or “Nb”), as defined herein, or a suitable fragment thereof. Of note, Nanobody®, Nanobodies® and Nanoclone® are registered trademarks of Ablynx N.V. (a Sanofi Company). For a general description of nanobodies, reference is made to the detailed explanation below and the prior art cited herein, such as W02008 / 020079. “VHH domains”, also known asFrlmp / ISG15_Nbs / 873
[0163] VHHs, VHH domains, VHH antibody fragments, and VHH antibodies, have originally been described as the antigen binding immunoglobulin (Ig) (variable) domains of “heavy chain antibodies (HCAbs)” (i . e. , of antibodies devoid of light chains)52. These HCAbs, which are naturally present in camelids, as defined herein, lack the first domain of the constant region (CH1), which exists in the genome but is spliced out during mRNA processing. The antigen-bindingsite of HCAbs is com osed of a single variable domain (i.e., a VHH), resembling the heavy chain variable domain (VH) of conventional antibodies, albeit with remarkable sequence differences at the second framework (FR2) and the third complementarity-determining region (CDR3). The differences include amino acid substitutions at specific positions, such as V37F (Vai at position 37 in the VH to Phe in the VHH), or V37Y, G44E, L45R or L45C, and W47G (numbers refer to the amino acid positions numbered according to Kabat et al., 199153). In the conventional VHs, these FR2 amino acids interact with the variable domain of the light chain (VL) and are conserved during evolution. The CDR3 of the VHH domain is typically longer than that of a VH domain and is often stabilized by an interloop disulfide bond. These characteristics allow HCAbs to recognize a wide range of epitopes, including those that may be inaccessible or undetectable by conventional antibodies composed of both heavy and light chains. As a result, HCAbs offer a versatile and valuable tool for various applications in research, diagnostics, and therapy, especially where traditional antibodies may face challenges in epitope recognition oraccessibility. Ahigh titerand a diverse repertoire of HCAbs can be generated from immunized or infected dromedaries or llamas54.
[0164] Following, the term “VHH domain” has been chosen to distinguish these variable domains from the heavy chain variable domains that are present in conventional 4-chain antibodies (which are referred to herein as “VH domains”) and from the light chain variable domains that are present in conventional 4-chain antibodies (which are referred to herein as “VL domains”). For a further description of VHHs and nanobodies, we refer to the review articles by Muyldermans555-, as well as to the patents within the following patent families: WO94 / 04678, WC95 / 04079 and WO96 / 34103 of the Vrije Universiteit Brussel; WO94 / 25591, WO99 / 37681, WC00 / 40968, WC00 / 43507, WC00 / 65057, WC01 / 40310, W001 / 44301, EP1134231 and WO2 / 48193 of Unilever; WO97 / 49805, WO01 / 21817, WC03 / 035694, WC03 / 054016 and WC03 / 055527 of the Vlaams Instituut voor Biotechnologie (VIB); WC03 / 050531 of Algonomics N.V. and Ablynx N.V.; WC01 / 90190 by the National Research Council of Canada; WC03 / 025020 (EP1433793) by the Institute of Antibodies; as well as WC04 / 041867, WC04 / 041862, WC04 / 041865, WC04 / 041863, WC04 / 062551, WC05 / 044858, WC06 / 40153, WC06 / 079372, WC06 / 122786, WC06 / 122787 and WC06 / 122825 by Ablynx N.V., and the further published patent applications by Ablynx N.V. As described in these references, a nanobody / Nb (in particular a VHH sequence and a partially humanized nanobody)Frlmp / ISG15_Nbs / 873
[0165] can be characterized by the presence of one or more “hallmark residues” in one or more of the framework sequences. A further description of nanobodies, including humanization and / or camelization of nanobodies, as well as of other modifications, parts or fragments, derivatives or “nanobody fusions”, multivalent or multispecific constructs (including some non-limiting examples of linker sequences) and various modifications aimed at increasing nanobody half-life, along with their preparations, can be found in W008 / 101985 and WO08 / 142164. among other documents. Nanobodies form the smallest antigen binding fragment that completely retains the binding affinity and specificity of a full-length antibody. Nanobodies possess exceptionally long complementarity-determining region 3 (CDR3) loops and a convex paratope, which allow them to penetrate into hidden cavities of target antigens.
[0166] Determination of CDR regions may be performed using different methods, such as the designation based on contact analysis and binding site topography as described in MacCallum et al., 1996s7. Alternatively, the annotation of CDRs may be done according to AbM (AbM is Oxford Molecular Ltd.'s antibody modelling package as described at http: / / www.bioinf.org.uk / abs / index.html58, Chothia59, Kabat5360, or IMGT61. These annotations further include the delineation of CDRs and framework regions (FRs) within immunoglobulin-domain-containing proteins. Such annotations are well-established methods and systems familiar to a skilled artisan, who can apply these annotations to any immunoglobulin protein sequences without undue burden. Although these annotations may vary slightly, they each aim to encompass the regions of the loops involved in bindingthe target.
[0167] Immunoglobulin single variable domains, such as “domain antibodies” and “nanobodies” (including VHH domains), can be subjected to humanization. This process is aimed at increasing the degree of sequence identity with the closest human germline sequence62. In particular, humanized immunoglobulin single variable domains, such as nanobodies / Nbs (including VHH domains) may be immunoglobulin single variable domains in which at least one amino acid residue is present (and in particular, at least one framework residue) that is and / or that corresponds to a humanizing substitution (as defined further herein). Potential humanizing substitutions can be identified by comparing the framework regions of a naturally occurring VHH sequence with the corresponding framework sequence of one or more closely related human VH sequences. Based on this comparison, potentially useful humanizing substitutions (or combinations thereof) can be introduced into the VHH sequence (using any known method, as further described herein). The resulting humanized VHH sequences can then be tested for properties such as affinity for the target, stability, expression levels, and / or other desired characteristics. In this way, by means of a limited degree of trial and error, other suitable humanizing substitutions (or suitable combinationsFrlmp / ISG15_Nbs / 873
[0168] thereof) can be determined by the skilled person. Also, based on what is described before, (the framework regions of) an immunoglobulin single variable domain, such as a Nanobody® (including VHH domains) may be partially humanized orfully humanized.
[0169] Humanized immunoglobulin single variable domains, particularly Nanobodies®, offer several advantages, such as reduced immunogenicity, when compared to the corresponding naturally occurring VHH domains. The term “humanized” refers to mutations made to the domain so that its immunogenicity upon administration to human patients is either minimal or non-existent. The humanizing substitutions should be selected in a way that ensures the resulting humanized amino acid sequence and / or VHH retains the favorable properties of the original VHH, such as its antigenbinding capacity. Based on the description provided herein, a skilled person will be able to choose humanizing substitutions or suitable combinations of such substitutions that optimize or achieve a desired balance between the favorable properties conferred by the humanizing substitutions and the favorable properties of naturally occurring VHH domains. Such methods are known by the skilled person. A human consensus sequence can be used as target sequence for humanization, but also other means are known in the art. One approach involves aligning multi le human germline alleles, such as IGHV3 alleles, to identify residues suitable for humanization in the target sequence. Another method is to align a subset of human germline alleles most homologous to the target sequence as a starting point for identifying suitable humanization residues. Alternatively, the VHH can be analyzed to identify its closest human homologue, which can then be used to design a humanization construct. A humanization technique applied to Camelidae VHHs may also be performed by a method comprising the replacement of specific amino acids, either alone or in combination. The replacements may be selected based on existing literature, prior humanization efforts, or by comparing human consensus sequences with the natural VHH sequences, as well as by analyzing the human alleles most similar to the VHH sequence of interest. As can be seen from the data on the VHH entropy and VHH variability given in Tables A5-A8 of W008 / 020079, some amino acid residues in the framework regions are more conserved between humans and Camelidae than others. Generally, although the invention in its broadest sense is not limited thereto, any substitutions, deletions or insertions are preferably made at positions that are less conserved. Also, generally, amino acid substitutions are preferred over amino acid deletions or insertions. For example, a human-like class of Camelidae single-domain antibodies contains the hydrophobic FR2 residues typically found in conventional antibodies of human origin or from other species. However, this loss in hydrophilicity is compensated by substitutions at position 103, which replaces the conserved tryptophan residue found in VH domains of double-chain antibodies. As such, peptides belonging to these two classes show a high amino acid sequence homology toFrlmp / ISG15_Nbs / 873
[0170] human VH framework regions and said peptides might be administered to a human directly without expectation of an unwanted immune response therefrom, and without the burden of further humanization. Indeed, some Camelidae VHH sequences display a high sequence homology to human VH framework regions and therefore said VHHs might be administered to patients directly without expectation of an immune response therefrom, and without the additional burden of humanization.
[0171] Suitable mutations, particularly substitutions, can be introduced during humanization to create a polypeptide with reduced binding to pre-existing antibodies (as referenced in WO2012 / 175741 and WO2015 / 173325). These mutations can be applied to at least one of the following positions to achieve the desired effect: 11 , 13, 14, 15, 40, 41 , 42, 82, 82a, 82b, 83, 84, 85, 87, 88, 89, 103, or 108. The amino acid sequences and / or VHHs of the invention may be suitably humanized at any framework residue(s), such as at one or more Hallmark residues (as defined below) or at one or more other framework residues (i.e. non-Hallmark residues) or any suitable combination thereof. Depending on the host organism used to express the amino acid sequence, VHH, or polypeptide of the invention, deletions and / or substitutions can be designed to remove one or more sites for post-translational modifications (such as glycosylation sites), which would be within the capability of a skilled person in the art. Alternatively, substitutions or insertions can be designed to introduce one or more sites for the attachment of functional groups (as described herein), for example, to enable site-specific pegylation.
[0172] In some cases, at least one of the typical Camelidae hallmark residues with hydrophilic characteristics at position 37, 44, 45 and / or 47 is replaced (see W02008 / 020079, Table A03). Another example of humanization includes substitution of residues in FR1, such as position 1, 5, 11, 14, 16, and / or 28; in FR3, such as position 73, 74, 75, 76, 78, 79, 82b, 83, 84, 93 and / or 94; and in FR4, such as position 103, 104, 108 and / or 111 (see W02008 / 020079, Tables A05-A08; all numbering accordingto the Kabat).
[0173] VHHs or Nbs are frequently categorized into various sequence families or even superfamilies to cluster clonally related sequences originating from the same progenitor during B cell maturation63. This classification is commonly established according to the CDR sequences of the Nbs. For example, each Nb family is typically defined as a cluster of clonally related sequences with a sequence identity threshold applied to the CDR3 region64. Within a single VHH family defined herein, the CDR3 sequence is thus identical or very similar in amino acid composition, preferably with at least 80% identity, or at least 85% identity, or at least 90% identity in the CDR3 sequence, resulting in Nbs of the same family binding to the same binding site, having the same effect or functional impact.Frlmp / ISG15_Nbs / 873
[0174] “Antigen-binding proteins” or “antigen-binding domains” may be derived from an antibody or from alternative antigen-binding proteins with different folds. These alternative binding proteins include, but are not limited to, avimers, DARPins, alphabodies, affitins, nanofitins, anticalins, monobodies, and lipocalins.
[0175] The term “Fc-fusion”, as used herein, refers to the genetic linking or fusion of proteins or protein domains, such as antigen-binding fragments or antigen-binding domains, with an Fc constant domain to form dimers that can create an antibody structure when expressed in a recombinant host. In particular, antibody fragments or single domain antibodies, such as ISVDs, may be C-terminally fused to the N-terminus of an Fc domain, preferably via a linker or hinge region. Alternatively, antibody fragments or single domain antibodies, such as ISVDs, may be fused at the N-terminus to the C-terminal end of an Fc domain, preferably via a linker or hinge region. These single domain antibodies or ISVDs fused to the Fc domain may comprise one or more VHHs or Nbs, as described herein.
[0176] Inside a cell
[0177] The term “inside a cell” refers to the spatial region enclosed by the cell membrane, encompassing all intracellular compartments and structures, including the cytoplasm, organelles (such as the nucleus, mitochondria, endoplasmic reticulum, and Golgi apparatus), and any subcellular components contained within the cell's boundaries. This term is used to describe processes, interactions or events that occur within the cell's interior, excluding those that take place in the extracellular space or outside the cell membrane.
[0178] Absence
[0179] The term “absence”, as used herein, refers to the state or condition in which a specific substance, component, or agent, such as the modulator polypeptide of this invention, is not present within a given sample, system, or condition. Thus, the term denotes the non-involvement of the modulator polypeptide of this invention, underthe specified conditions.
[0180] Measured
[0181] The term “measured” refers to the act of quantitatively determining or assessing a particular characteristic, property, value, or parameter of an object, sample, substance, or system using a defined method, instrument, and / or technique. Said particular characteristic, property, value, or parameter is “measured” in a process of obtaining data that is accurate, reproducible, and calibrated according to established standards, protocols, and units of measurement. The termFrlmp / ISG15_Nbs / 873
[0182] “measured” implies that the value or outcome has been objectively determined through direct observation, instrumentation, and / or calculation.
[0183] nanoBRET assay
[0184] The term “nanoBRET assay”65refers to a bioluminescence resonance energy transfer (BRET) assay utilizing a donor molecule (typically a luciferase) and a near-infrared acceptor molecule that is capable of emitting light in the nanometer range upon energy transfer. The nanoBRET assay is used to study molecular interactions within living cells by detecting the transfer of energy between the donor and acceptor molecules, which occurs only when the two are in close proximity (usually less than 10 nm). This technique is particularly useful for studying rotein- rotein interactions, receptor-ligand binding, and other cellular events in real-time, with high sensitivity and minimal background noise due to the near-infrared emission.
[0185] To comprise
[0186] In the context of this invention, the terms “comprising” (and its variations, such as “comprise” or “comprises”), “having” (and its variations, such as “have” and “has”), “including” (and its variations, such as “includes” and “include”), or “containing” (and its variations, such as “contains” or “contain”), are inclusive and open-ended. Therefore, they may encompass additional elements or method steps which may not be explicitly listed in this application.
[0187] Homologue
[0188] The term “homologue”, as used herein, refers to a protein (amino acid) sequence that is distinct but exhibits a statistically significant degree of similarity with another protein (amino acid) sequence, indicating a common origin between the compared proteins. “Homologue” or “homologues” of a protein encompass peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and / or insertions relative to the unmodified protein in question and having similar biological and / or functional activity as the unmodified protein from which they are derived. Typically, two proteins are considered homologous if they share a minimum of 70% amino acid sequence identity. Percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determiningthe number of positions at which the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Vai, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met, also indicated in one-letter code herein) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of
[0189] 1Frlmp / ISG15_Nbs / 873
[0190] comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. Preferably, the percentage of identity is calculated over a window that spans the entire length of the sequence in question.
[0191] In this context, the term “amino acid” encompasses all natural a-amino acids of the L or D series, each having the following “side chain”: H for glycine, CH3 for alanine, CH(CH3)2 for valine, CH2CH(CH3)2 for leucine, CH(CH3)CH2CH3 for isoleucine, CH2OH for serine, CH(OH)CH3 for threonine, CH2SH for cysteine, CH2CH2SCH3 for methionine, CH2-(phenyl) for phenylalanine, CH2-(phenyl)-OH for tyrosine, CH2-(indole) for tryptophan, CH2COOH for aspartic acid, CH2C(O)(NH2) for asparagine, CH2CH2COOH for glutamic acid, CH2CH2C(O)NH2 for glutamine, CH2CH2CH2-N(H)C(NH2)NH for arginine, CH2-(imidazole) for histidine, CH2(CH2)3NH2 for lysine, and NH(CH2)3CHCOOH for proline. This includes the same side chains of amino acids with suitable protecting groups. Additionally, the term “amino acid” encompasses non-natural amino acids such as ornithine (Orn), norleucine (Nle), norvaline (NVa), 0-alanine, L or D a- henylglycine (Phg), diaminopropionic acid, diaminobutyric acid, aminohydroxybutyric acid, and other synthetic amino acids known in the field of peptide chemistry. Table 2 lists amino acid names and their abbreviations used in this application.
[0192] Mutant
[0193] The term “mutant” or “variant” refers to a gene or its corresponding protein product that has undergone modifications from its wild-type (WT) form. These modifications can include changes in the sequence of amino acids (point mutations, deletions, or insertions), alterations in post-translational modifications (such as phosphorylation, glycosylation, or ubiquitination), or changes in the functional properties of the gene product. The “mutant” or “variant” may exhibit differences in its structure, stability, activity, or interactions with other molecules, compared to the naturally occurring WT version of the gene or protein. It is noted that naturally occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the WT gene or gene product. In the context of this invention, “ISG15 mutants” refer to variants of the ISG15 protein that may be bound and modulated by the agents or modulators disclosed in this application. These mutants include, but are not limited to, ISG15 variants that have been previously reported in the literature66-68. Such mutants can include point mutations, deletions, insertions, and other modifications to the native ISG15 protein that alter its structure and / or function.
[0194] DelSGylation
[0195] The term “delSGylation” refers to the enzymatic removal of ISG15 (Interferon-Stimulated Gene 15), a ubiquitin-like protein, from target proteins. This process is catalyzed by specific delSGylatingFrlmp / ISG15_Nbs / 873
[0196] enzymes, such as USP18 (Ubiquitin-Specific Peptidase 18), which cleave the ISG15 modification from conjugated substrates. DelSGylation plays a critical role in regulating innate immune responses, modulating antiviral defense mechanisms, and controlling protein stability and function. It is involved in the reversal of ISG15-dependent post-translational modifications, thereby influencing pathways such as interferon signaling, protein degradation, and host-pathogen interactions.
[0197] Nucleic acid
[0198] The term “nucleic acid” refers to a class of biopolymers made up of nucleotides, which carry genetic information and play critical roles in cellular processes. The two main types of nucleic acids are DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid). DNA is a double-stranded molecule that stores and transmits genetic information in cells, with its structure composed of nucleotides containing adenine (A), thymine (T), cytosine (C), and guanine (G). RNA, which is usually singlestranded, is involved in protein synthesis and includes types such as messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA), with uracil (U) replacing thymine (T). Additionally, other forms of RNA like small interfering RNA (siRNA), microRNA (miRNA), and long non-coding RNA (IncRNA) also perform specialized functions in gene regulation and cellular mechanisms. Nucleic acids are central to the processes of replication, transcription, and translation, and they can be manipulated in biotechnology, genetic engineering, and diagnostic applications.
[0199] Pharmaceutical composition
[0200] In the context of the present invention, the term “pharmaceutical composition” or “medicinal composition” pertains to a mixture comprising one or more specific substances aimed at providing pharmacological activity or exerting a direct effect in the cure, mitigation, treatment, or prevention of a disease or pathological condition. Furthermore, a “pharmaceutical composition” administered to a subject / individual may directly influence the restoration, correction, or modification of physiological functions in said subject / individual. Accordingly, a pharmaceutical or medicinal composition comprises any formulation created through the mixing of an active ingredient (such as a Nb binding human ISG15, or its pharmaceutically acceptable salt), active ingredient dispersion or composite, additional active ingredient(s), and / or pharmaceutically acceptable excipients, carriers and / or excipients.
[0201] A “pharmaceutical composition” as referred to herein further relates to a therapeutically active composition comprising the one or more agents or therapeutically active agents or therapeutically active compositions and optionally comprising a carrier, diluent or excipient. A “carrier” or “adjuvant”, particularly a “pharmaceutically acceptable carrier” or “pharmaceutically acceptableFrlmp / ISG15_Nbs / 873
[0202] adjuvant”, refers to any appropriate excipient, diluent, carrier, or adjuvant that, on its own, does not trigger the production of harmful antibodies in the individual receiving the composition, nor does it elicit protective responses. The term “pharmaceutically acceptable” refers to a material that is not biologically or otherwise harmful. In other words, it can be administered to an individual alongside the compound without causing any undesirable biological effects or interacting negatively with any other components of the pharmaceutical composition in which it is included. A pharmaceutically acceptable carrier is ideally one that is relatively non-toxic and harmless to a patient at concentrations that are consistent with the effective activity of the active ingredient. This ensures that any side effects associated with the carrier do not diminish the beneficial effects of the active ingredient. Preferably, a pharmaceutically acceptable carrier or adjuvant enhances the immune response elicited by an antigen. Suitable carriers or adjuvants typically comprise one or more of the compounds included in the following non-exhaustive list: large slowly metabolized molecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactive virus particles.
[0203] Following, the term “carrier” or “excipient”, as utilized herein, encompasses any substance that, while not possessing therapeutic properties itself, serves as a medium, diluent, adjuvant, transporter, or vehicle for delivering a therapeutic agent to a subject / individual. Moreover, a “carrier” or “excipient” may be included in a pharmaceutical formulation to improve its handling or storage characteristics or to facilitate the formation of a dose unit into a discrete entity suitable for oral administration, such as a capsule or tablet. Suitable carriers or excipients are commonly recognized by individuals skilled in the art of pharmaceutical formulation and manufacturing, and may include, but are not limited to, buffers, diluents, disintegrants, binding agents, adhesives, wetting agents, polymers, lubricants, glidants, substances utilized to mask or neutralize undesirable taste or odour, flavours, dyes, fragrances, and substances employed to improve the appearance of a composition.
[0204] The term “excipient”, as used herein, is intended to include all substances which may be present in a pharmaceutical composition and which are not active ingredients, such as salts, binders (e.g., lactose, dextrose, sucrose, trehalose, sorbitol, mannitol), lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffer substances, stabilizing agents, flavoring agents or colorants. A "diluent" includes vehicles such as water, saline, physiological salt solutions, glycerol, ethanol, etc. Auxiliary substances such as wetting or emulsifying agents, pH buffering substances, or preservatives may be included in such vehicles.Frlmp / ISG15_Nbs / 873
[0205] A pharmaceutically effective amount of binders (such as polypeptides), or conjugates of the invention and a pharmaceutically acceptable carrier is preferably that amount which produces a result or exerts an influence on the particular condition being treated. For therapeutic purposes, the pharmaceutical composition of the invention can be administered to any patient using standard or approved techniques. The administration may occur through any suitable route, including orally, parenterally, topically, nasally, ophthalmically, intrathecally, intracerebroventricularly, sublingually, rectally, vaginally, or other appropriate methods. Additional formulation techniques, such as nanotechnology, aerosol delivery, and inhalant methods, are also included within the scope of this invention. The dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counter-indications and other parameters to be taken into account by the clinician.
[0206] The pharmaceutical composition of this invention can be lyophilized for storage and reconstituted in a suitable carrier prior to use. When the pharmaceutical composition is prepared in lyophilized or liquid form, it is necessary to incorporate a physiologically acceptable carrier, excipient, and / or stabilizer into the formulation (“Remington: The Science and Practice of Pharmacy”, 23rdEdition (2020), edited by Adeboye A.69). The dosage and concentration of the carrier, excipient, and stabilizer must be selected in such a way that they are safe for the treated subject, which could be a human or other mammal. This concerns buffers such as phosphate, citrate, and other organic acids; antioxidants such as vitamin C, small polypeptides, proteins such as serum albumin, gelatin or immunoglobulin; hydrophilic polymers such as PVP, amino acids such as amino acetate, glutamate, asparagine, arginine, lysine; glycose, disaccharide, and other carbohydrates such as glucose, mannose or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol, and sorbitol; counterions such as Na+, and / or surfactant such as TWEEN™, PLURONICS™ or PEG and the like.
[0207] A “pharmaceutically acceptable salt” of an agent / modulator of this disclosure refers to a compound that possesses the desired pharmacological activity of the parent compound and includes either:
[0208] i) an acid addition salt, formed with an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or formed with an organic acid such as acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1 ,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-Frlmp / ISG15_Nbs / 873
[0209] toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2.2.2]oct-2-ene-1 -yl carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, 3-hydroxy-2-naphthoic acid, salicylic acid, stearic acid, muconic acid, and the like; or
[0210] ii) a salt formed when an acidic proton present in the parent compound is either replaced by an inorganic ion (e.g., an alkali metal ion such as Na+, K+or Li+, an alkaline earth ion such as Ca2+or Mg2+, an aluminum ion, or an ammonium ion) or coordinates with an organic base (e.g., ethanolamine, diethanolamine, triethanolamine, N-methylglucamine, morpholine, piperidine, dimethylamine, diethylamine, and the like).
[0211] In this context, the term “diluent” denotes a vehicle comprising an inactive solvent in which the described compound (such as a Nb bindingto human ISG15) or pharmaceutical composition may be deconcentrated or dissolved. A “diluent” can encompass various substances, including those that function as solubilizing agents, buffers, isotonic agents, or a combination thereof. Both liquid and solid forms of diluents are possible. Non-limiting examples of liquid diluents include water, solvents, and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, cyclodextrins, various oils (such as almond oil, apricot kernel oil, argan oil, avocado oil, black cumin seed oil, borage oil, castor oil, coconut oil, corn oil, cottonseed oil, corn oil, evening primrose oil, flaxseed oil, grape seed oil, groundnut oil, hazelnut oil, hemp seed oil, jojoba oil, macadamia nut oil, mineral oil, olive oil, palm oil, peanut oil, rice bran oil, sesame oil, soybean oil, sunflower oil, wheat germ oil, glycerol, tetra hydrofurfuryl alcohol, polyethylene glycols, and fatty acid esters of sorbitan, as well as 1 ,3-butanediol. Solid diluents may include substances such as calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulphate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, or powdered sugar, among others.
[0212] Notably, each “carrier”, “diluent” or “excipient” must adhere to the criteria of acceptability, ensuring com atibility with other ingredients within the harmaceutical / medicinal formulation and non-injurious properties towards the subject / individual administered with said formulation.
[0213] Medicament
[0214] The term “medicament” refers to any substance or combination of substances designated for treating, preventing, or diagnosing a disease, injury, or pathological condition in humans or nonhuman animals. This includes a wide range of formulations and delivery methods, such as oralFrlmp / ISG15_Nbs / 873
[0215] medicaments, which can be i) biopharmaceuticals like insulin and monoclonal antibodies (e.g., adalimumab), ii) natural compounds like plant extracts (e.g., digitalis) and microbial metabolites (e.g., penicillin), iii) synthetic compounds like acetaminophen and ibuprofen, and iv) semisynthetic compounds like iv) amoxicillin. Furthermore, topical medicaments encompass i) ointments (e.g., hydrocortisone cream), ii) creams and gels (e.g., clotrimazole), and iii) lotions (e.g., calamine lotion). Inhalable medicaments include i) aerosols and sprays (e.g., albuterol inhaler), and ii) nebulizers. Injectable medicaments encompass i) intravenous injections (e.g., vancomycin), and ii) intramuscular and subcutaneous injections (e.g., vaccines and insulin). Transdermal medicaments include adhesive patches (e.g., nicotine patches and fentanyl patches). Rectal, urethral and vaginal medicaments comprise suppositories (e.g., glycerin suppositories and miconazole). Ophthalmic and otic medicaments involve eye drops and ointments (e.g., ciprofloxacin), and ear drops (e.g., ofloxacin). Thus, the term “medicament” broadly encompasses various therapeutic agents designed for different routes of administration, each tailored to deliver specific therapeutic effects (such as pharmacologic effects) to treat, prevent, or diagnose diseases, injuries, or pathological conditions. Additionally, the term covers pharmaceutically acceptable salts, esters, solvates, and hydrates of pharmaceutically active substances, among other modifications used in the field.
[0216] Treatment
[0217] The terms “treatment” “treating” and “treat” collectively denote any indication of success in therapy, alleviation, or prevention of an injury, disease, or pathological condition. This encompasses both objective and subjective parameters, such as reduction, remission, or alleviation of symptoms, and / or rendering the injury, disease, or pathological condition more manageable for the affected subject or individual. These terms also include decelerating the rate of progression, degeneration, and / or decline associated with an injury, disease, or pathological condition, mitigating the severity of the final degenerative outcome, and enhancing the affected individual's or subject's physical and / or mental well-being. The treatment or alleviation of symptoms may rely on objective or subjective criteria, including findings from diagnostic tests, physical examinations, neuropsychiatric assessments, and / or psychological evaluations. Moreover, the term “treating” and its variations may encompass preventive or prophylactic measures against an injury, disease, or pathological condition. In essence, the term “treatment,” as employed herein, encompasses any method aimed at curing, ameliorating, or preventing a disease, injury, or pathological state. Treatment interventions may serve to prevent the onset of the disease, impede its progression, alleviate its manifestations and / or symptoms, fully or partiallyFrlmp / ISG15_Nbs / 873
[0218] eradicate the disease's underlying cause, reduce the duration of the disease, or achieve a combination of some or all of these objectives.
[0219] Disease
[0220] The term “disease” or “condition” or “disorder” refers to a pathological state that adversely affects the structure and / or function of an organism or its part, typically characterized by specific physical or psychological / mental symptoms and / or molecular or biochemical abnormalities. Diseases can arise from various causes, including genetic mutations, infections, environmental factors, or lifestyle choices, leading to disturbances in normal physiological processes. There are two primary categories of diseases: communicable and non-communicable. Communicable diseases, also known as infectious diseases, can be transmitted from one organism to another through various means, such as direct contact, airborne droplets, and / or contaminated surfaces. They typically involve infectious agents such as bacteria, viruses, fungi, or parasites. Examples of communicable diseases include influenza, tuberculosis, AIDS, malaria, and COVID-19. On the other hand, non-communicable diseases are conditions that cannot be transmitted from one organism to another. They often result from a complex interplay of genetic, environmental, and lifestyle factors. These conditions tend to develop over time and include cardiovascular diseases, neurodegenerative disorders like Alzheimer's and Parkinson's disease, psychiatric diseases, malignancies, and autoimmune conditions, among others. Treatment of a disease involves medical interventions designed to alleviate or eliminate symptoms, manage complications, and / or target underlying causes to restore health and well-being in an affected organism.
[0221] Infectious disease
[0222] The term “infectious disease” refers to a pathological condition resulting from the invasion, colonization, and replication of pathogenic microorganisms, including bacteria, viruses, fungi, and parasites, within a host organism. These diseases can be transmitted through various routes, including direct contact, inhalation of airborne particles, ingestion of contaminated food or water, vector-mediated transfer, or exposure to infected bodily fluids. Infectious diseases can range from localized to systemic infections and may elicit immune responses that influence disease progression, severity, and clinical outcome.
[0223] Bacterial infectious diseases are caused by pathogenic bacteria that invade host tissues, produce toxins, or trigger immune responses leading to tissue damage. These infections can manifest as localized or systemic diseases and are often treatable with antibiotics, although antimicrobial resistance poses a significant challenge. Examples include tuberculosis (MycobacteriumFrlmp / ISG15_Nbs / 873
[0224] tuberculosis), pneumonia (Streptococcus pneumoniae), and foodborne illnesses (Salmonella spp.).
[0225] Viral infectious diseases result from the entry and replication of viruses within host cells, often leading to cellular damage, immune evasion, and systemic effects. Viruses rely on host cellular machinery for replication and can spread through various routes, such as respiratory droplets, blood, or direct contact. Examples include influenza, human immunodeficiency virus (HIV) infection, and COVID-19 (SARS-CoV-2). Antiviral therapies and vaccines play a crucial role in controllingviral infections.
[0226] Fungal infectious diseases, or mycoses, arise from the overgrowth or opportunistic invasion of pathogenic fungi. These infections can be superficial, affecting the skin and mucosal surfaces, or systemic, particularly in immunocompromised individuals. Common fungal pathogens include Candida spp., responsible for candidiasis, Aspergillus spp., which can cause pulmonary aspergillosis, and Cryptococcus spp., associated with meningitis. Antifungal agents are used for treatment, though drug resistance and host immune status influence disease outcomes.
[0227] Autoimmune disease
[0228] The terms “autoimmune disease”, “autoimmune condition”, “autoimmune disorder”, “autoreactive disease”, “autoreactive condition” and “autoreactive disorder” all refer to a group of chronic ailments / pathologies that develop in humans when the immune system attacks the host's organs, tissues, and / or cells. This immune response manifests as inflammation, which may lead to tissue damage and organ failure. Autoimmune responses bear similarity to conventional immune reactions against pathogens, as they are prompted by the presence of specific antigens. However, in autoimmune responses, these antigens are “self-antigens” or “autoantigens”, i.e., molecules or substances naturally present in cells or tissues of an affected individual, which are mistakenly identified as foreign or harmful; this misidentification leads to an immune response against the body's own components. Autoantigens can encompass diverse molecular constituents, including peptides, proteins, carbohydrates, nucleic acids, and complexes and / or fragments thereof. For example, p53 has been described as an autoantigen in several autoimmune diseases, including lupus and scleroderma, TPO (thyroid peroxidase) is a major autoantigen in autoimmune thyroid diseases such as Hashimoto's thyroiditis, whereas antibodies targeting glutamic acid decarboxylase (GAD) are distinctive markers associated with Moersch-Woltman syndrome (stiff person syndrome).
[0229] Autoreactive B cells play a crucial role in driving pathogenic processes in autoimmune diseases through their production of autoantibodies, secretion of cytokines, and presentation ofFrlmp / ISG15_Nbs / 873
[0230] autoantigens to T cells70. On the other hand, self-reactive T cells, particularly CD4+T cells, are implicated in mediating various aspects of autoimmune inflammation71; in some diseases, they may function as effector cells directly involved in the killing of cells expressing their target autoantigens. In this context, “autoreactivity” is reflected in the affinity between theT cell receptor (TOR) and self-antigens, as well as the concentration of self-antigens in the tissues72.
[0231] Numerous autoimmune diseases in humans are linked to variations or mutations in the human leukocyte antigen (HLA) locus73. This supports the notion that T cells play a major role in the development of these disorders. To become autoreactive, T cells need to be activated by three types of signals provided by antigen-presenting cells (APCs), such as dendritic cells (DCs). These signals encompass: i) antigen-specific stimulation of the TCR via recognition of specific peptide-major histocompatibility complex (MHC) multimers on APCs; ii) ligand-mediated activation of one or more co-stimulatory receptors (such as ICOS, CD28, CD40 and 0X-40) promoting T cell differentiation and proliferation; and iii) stimulation with cytokines7475.
[0232] On the other hand, co-inhibitory receptors (such as PD-1, TIM-3, TIGIT, CTLA-4 and LAG-3) transduce signals that counteract T cell activation and suppress immune responses against (auto)antigens76. Notably, the expression of co-inhibitory receptors is often induced upon T cell costimulation; this hints at the presence of a negative feedback loop that finely tunes immune system activation under physiological conditions77. Indeed, excessive co-stimulation and / or inadequate co-inhibition result in aberrant T cell activation, potentially causing a breakdown of self-tolerance by stimulating and expanding autoreactive T cells76.
[0233] Autoreactivity associated with autoimmune conditions, as referred to herein, stems from various maladaptive molecular mechanisms, including: i) insufficient central tolerance (self-reactive lymphocytes evade deletion in the thymus and enter the peripheral circulation); ii) defective peripheral tolerance (peripheral mechanisms like anergy, regulatory T cells, and immune privilege fail to suppress self-reactive lymphocytes); iii) molecular mimicry (auto-antigens structurally resemble pathogenic antigens, leading to immune responses due to cross-reactivity); iv) epitope spreading (initial immune responses expose additional epitopes, triggering an autoimmune reaction); v) genetic susceptibility (specific genetic factors, such as HLA alleles, increase the risk of autoimmune responses); and / or vi) environmental triggers (external factors like pathogens, toxins, or UV radiation provoke or exacerbate autoimmune responses).
[0234] Autoimmune conditions as referred to herein can affect any organ system in any individual, although women are up to four times more likely to develop these diseases compared to men78. Despite common underlying mechanisms, the clinical presentations of autoimmunity are markedlyFrlmp / ISG15_Nbs / 873
[0235] diverse; the manifestations span from subtle laboratory irregularities that evade detection to acute, potentially life-threatening organ dysfunction79. Indeed, autoreactivity exists on a spectrum, ranging from a basal physiological level essential for lymphocyte selection and the maintenance of immune system homeostasis80, through an intermediate level characterized by the presence of circulating autoantibodies and immune tissue infiltrates unassociated with clinical symptoms, to pathogenic autoimmunity linked with immune-mediated dysfunction and / or tissue damage81. In this context, the symptoms of autoimmune diseases often vary significantly, primarily depending on the specific type of condition and the affected areas within the body. However, these symptoms commonly appear intermittently and can vary widely in their severity.
[0236] The most prevalent human autoimmune diseases include: Addison’s disease, ankylosing spondylitis, coeliac disease, childhood-onset type 1 diabetes, Graves’ disease, Hashimoto’s thyroiditis, inflammatory bowel disease (Crohn’s disease or ulcerative colitis), multiple sclerosis, myasthenia gravis, pernicious anemia, polymyalgia rheumatica, primary biliary cholangitis, psoriasis, rheumatoid arthritis (including its specific subtypes, such as Still disease, Caplan syndrome, rheumatoid spondylitis, and others), Sjogren’s syndrome, systemic lupus erythematosus, systemic sclerosis, vasculitis, and vitiligo82. Notably, the list of autoimmune diseases provided above is not exhaustive.
[0237] Fc fusion
[0238] The term "Fc-fusion", as used herein, refers to the genetic fusion of one or more proteins or protein domains, such as antigen-binding fragments or antigen-binding domains, with an Fc constant domain, resulting in a dimeric structure that resembles an antibody when expressed in a recombinant host. Specifically, antibody fragments or single domain antibodies, such as ISVDs, may be fused at their C-terminus to the N-terminus of an Fc domain, preferably through a linker or hinge region. Alternatively, these antibody fragments or single domain antibodies, including ISVDs, may be fused at their N-terminus to the C-terminal end of an Fc domain or Fc tail, as used interchangeably herein, also preferably via a linker or hinge region. Such Fc-fusion constructs may include one or more VHHs or nanobodies, as described herein, and may combine the antigenbinding specificity of the single domain antibodies with the effector functions and extended halflife conferred by the Fc domain.
[0239] Detailed description
[0240] The present invention stems from efforts to develop methods for modulating ISG15 activity, aiming to identify novel therapeutics for infectious diseases and autoimmune disorders. Specifically, thisFrlmp / ISG15_Nbs / 873
[0241] disclosure introduces polypeptides that bind to ISG15, thereby modulating its function and / or state - such as its capacity to remain covalently bound to target proteins through ISGylation or its ability to induce IFN-y secretion from cells. These polypeptides thus represent a novel class of functional ISG15 binders with demonstrated therapeutic potential.
[0242] In the first aspect, the disclosure provides modulator or binder polypeptides with specificity towards human Interferon-stimulated gene 15 (ISG15), a protein encoded bythe / SG75gene.These modulator polypeptides alter the immune-related activity, function, or state of the ISG15 protein upon binding to it. In this context, ISG15 is recognized for its role in defending against viral, bacterial, and fungal pathogens12. Its activity is mediated through three key molecular mechanisms: (1) ISGylation -a ubiquitin-like modification of intracellular proteins13 14, (2) negative control of interferon-a / -p signaling as a free intracellular molecule15 16, and (3) induction of IFN-y secretion as an extracellular cytokine17.
[0243] ISGylation (Function 1) is a posttranslational modification that influences protein activity, stability, molecular interactions, and degradation pathways18. Numerous ISG15 substrates and their roles in cellular processes have been identified83-89. Similar to ubiquitination, ISGylation occurs through a three-step enzymatic cascade. First, ISG15 is activated by the E1 -activating enzyme UBE1L (UBA7) in an ATP-dependent manner, forming a thioester bond with UBE1 L (UBA7). The activated ISG15 is then transferred to the active-site cysteine of the E2 conjugating enzyme UBCH8 (UBE2L6) before being covalently attached to a target protein with the assistance of an E3 ligase, such as HHARI (ARIH1), TRIM25, or HERC56. Notably, nearly all components of the ISG15 conjugation system, including ISG15 itself, as well as its conjugating and deconjugating enzymes, are upregulated in response to IFN.
[0244] Functionally, ISGylation plays a crucial role in innate immunity. For example, it has been shown to counteract bacterial infections by modifying proteins such as MAGT1 and RTN490and to inhibit viral pathogens by conjugating to proteins like Nedd4,TSG101 , and CHMP590. Moreover, ISG15 has been shown to enhance the innate antiviral response by inhibiting the degradation of I RF-3 through ISG15 modification8991. Interestingly, SARS-CoV and several other viruses, including nairoviruses and arteriviruses, have evolved delSGylation mechanisms to evade this host defense strategy21-23. Ubiquitin-specific protease 18 (USP18), also known as UBP43, is a key ISG15 deconjugating enzyme responsible for removing ISG15 from its target proteins24. USP18's specificity for ISG15 is dictated by two distinct regions within its sequence, termed ISG15-binding box1 and box222. While other proteases, such as USP2192and USP1693, have also been reported to deconjugate ISG15, USP18 is considered the primary delSGylating enzyme94. This is supported by a study showing thatFrlmp / ISG15_Nbs / 873
[0245] USP18-deficient mouse macrophages exhibit a global accumulation of ISGylated proteins95(p3)whereas USP18 overexpression leads to a significant reduction in protein ISGylation94.
[0246] Further, USP18-deficient mice display high constitutive as well as IFN-inducible ISGylation, without any changes in ubiquitination, in contrast to WT mice96. Like other components of the ISG15 pathway, USP18 expression is induced by type I interferons95(p3). The interplay between ISGylation and delSGylation, regulated by ISG15 and USP18, respectively, plays a critical role in the host responses to infection97.
[0247] Beyond its delSGylating function, USP18 also serves as a key negative regulator of type I IFN signaling by binding to the IFN-a / p receptor 2 (IFNAR2) complex, where it competes with Janus kinase 1 (JAK1) and thereby inhibits downstream receptor signaling25. In the absence of USP18, macrophages exhibit heightened sensitivity to type I IFN stimulation, leading to prolonged phosphorylation of STAT1 and STAT2, as well as increased expression of ISGs essential for antiviral defense25.
[0248] Notably, in certain species, including humans, rhesus macaques, pigs, and canines, USP18 stability depends on free intracellular ISG15 (Function 2), which protects it from S-phase kinase-associated protein 2 (SKP2)-mediated degradation2627. Consequently, ISG15-deficient patients exhibit cellular, immunological, and clinical signs of excessive IFN-a / p activity, resembling Mendelian autoimmune interferonopathies, such as Aicardi-Goutieres syndrome and spondyloenchondrodysplasia29’98’99"’100. The absence of intracellular ISG15 in these patients prevents the accumulation of USP18, leading to prolonged and amplified type I IFN responses16. In contrast, mice lack the ISG15-USP18 interaction and regulate type I IFN signaling through alternative mechanisms15.
[0249] ISG15 is also found in the extracellular space, where it functions as an immunomodulatory molecule, stimulating the secretion of interferon-gamma (IFN-y) — the sole member of the type II interferon family31(Function 3). While granulocytes store ISG15 in secretory granules, various other cell types, including fibroblasts and epithelial cells, have also been shown to release ISG15 into the extracellular environment32. The extracellular role of ISG15 was demonstrated in human leukocytes, where WT cells produced IFN-y in response to a live-attenuated Bacillus-Calmette-Guerin (BCG) tuberculosis strain, whereas ISG15-deficient leukocytes failed to do so32. Furthermore, the addition of purified ISG15 in combination with interleukin-12 (IL-12) to culture media synergistically enhanced IFN-y secretion from natural killer (NK) cells and, to a lesserextent, T cells101. A biochemical screen identified the cell surface receptor for extracellular ISG15 as LFA-1 integrin (CD11a / CD18, aL / p2 integrin)45. Downstream of LFA-1, Src family kinases (SFKs) wereFrlmp / ISG15_Nbs / 873
[0250] found to be key mediators of ISG15-induced IFN-y secretion in NK cells. The proposed mechanism for ISG15 and IL-12 synergy suggests that IL-12 transcriptionally activates the IFN-y gene, while ISG15 acts post-transcriptionally, likely at the level of cytokine-containing secretory vesicles, facilitating SFK-dependent IFN-y secretion102.
[0251] Traditionally, IFN-y is recognized as a proinflammatory cytokine and a hallmark of Th1 -driven autoimmune responses33. Notably, IFN-y plays a pivotal role in both the development and severity of systemic autoimmunity, particularly in systemic lupus erythematosus (SLE)34. This is further supported by animal studies, where IFN-y has been shown to be essential in both spontaneous and induced models of lupus35. MRL-Faslpr mice, which carry the homozygous Faslpr mutation, develop a lupus-like syndrome, mirroring key clinical features of SLE, including glomerulonephritis, anti-dsDNA autoantibodies, anti-nuclear autoantibodies, and proteinuria103. These mice exhibit high IFN-y levels, and deletion of the IFN-y gene has been shown to reduce disease severity and mouse mortality104. Interestingly, the loss of the LFA-1 receptor in MRL-Faslpr mice also led to improved disease outcomes105. Furthermore, the identification of ISG15-secreting plasma cells in patients with active SLE106underscores the potential role of ISG15 in lupus pathogenesis.
[0252] Interestingly, ISG15's influence on cytokine secretion extends beyond IFN-y. IL-12 and ISG15 have also been shown to synergistically enhance the secretion of IL-1045, and a recent study reported that ISG15 induces the release of several other cytokines, including IL-1 , IL-6, and TNF107. Beyond its immunomodulatory functions, extracellular ISG15 has been found to restrict viral infections of Respiratory Syncytial Virus (RSV) and SARS-CoV-2 in vitro, independently of IFN signaling108. Mechanistically, extracellular ISG15 was shown to interact with a501 integrin on the cell surface, triggering the induction of intracellular ISG15 expression and ISGylation in target cells through an integrin-Focal Adhesion Kinase (FAK) pathway. These findings highlight extracellular ISG15 as a cytokine-like protein that serves as a critical link between IFN-y-driven immune responses and early innate immunity.
[0253] Overall, the modulator polypeptide of this invention may modify, enhance, or suppress any of the immune functions of ISG15 described herein, as well as its other immune-related activities, relative to the state / condition when said modulator polypeptide is not present, and / or in the presence of a negative control or vehicle.
[0254] According to a preferred embodiment, the modulator polypeptide of this invention are derived from the innate or adaptive immune system. Specifically, these binding agents are preferably derived from immunoglobulins, with antibodies or antibody fragments being particularly preferred. The term “antibody” (Ab), as defined herein, broadly refers to a polypeptide encoded by anFrlmp / ISG15_Nbs / 873
[0255] immunoglobulin gene or a functional fragment thereof that specifically binds and recognizes an antigen, as understood by those skilled in the art. An antibody encompasses conventional four-chain immunoglobulins composed of two identical pairs of polypeptide chains, each pair consisting of one “light” chain (approximately 25 kDa) and one “heavy” chain (approximately 50 kDa). Typically, in conventional immunoglobulins, a heavy chain variable domain (VH) and a light chain variable domain (VL) interact to form an antigen-binding site. The term “antibody” also includes whole antibodies, including single-chain whole antibodies, as well as antigen-binding fragments. Antigen-binding fragments may include, but are not limited to, Fab, Fab', and F(ab')2 fragments, Fd fragments, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (dsFv), fragments comprising or consisting of either a VL or VH domain, and any combination thereof or any other functional portion of an immunoglobulin peptide capable of binding to the target antigen. The term “antibodies” also encompasses heavy chain antibodies or fragments thereof, including immunoglobulin single variable domains, as further defined in this application. According to a particularly preferred embodiment, the binding agent disclosed herein is an immunoglobulin single variable domain, specifically a Nanobody (Nb), which includes, but is not limited to, a VHH. As defined in this application, the term “Nanobody” Nb refers to a single-domain antigen-binding fragment derived from naturally occurring heavy-chain antibodies. This single variable domain is well recognized in the field by those skilled in structural biology.
[0256] In another aspect, the modulator polypeptide of this invention may also be modified and / or may comprise (or can be fused to) other moieties. Examples of modifications, as well as examples of amino acid residues within the modulator of the invention that can be modified (e.g., on the protein backbone or on the side chain), methods and techniques that can be used to introduce such modifications and the potential uses and advantages of such modifications will be clear to the skilled person. For example, such a modification may involve the introduction (e.g., by covalent linking or in another suitable manner) of one or more functional groups, residues or moieties into or onto the modulator polypeptide. Examples of such functional moieties or groups and of techniques for introducing them will be clear to the skilled person, and can generally comprise all functional groups and techniques mentioned in the art as well as the functional groups and techniques known perse forthe modification of pharmaceutical proteins, and in particular for the modification of antibodies or antibody fragments (including ScFv and single domain antibodies), for which reference is for example made to “Remington: The Science and Practice of Pharmacy”, 23rdEdition (2020), edited byAdeboye A69. Such functional grou s or moieties may be linked directly (for exam le covalently) to the modulator polypeptide, or, optionally, via a suitable linker or spacer, as will again be clear to the skilled person.Frlmp / ISG15_Nbs / 873
[0257] In cases where a modulator polypeptide demonstrates potentialtherapeutic value, one of the most commonly employed strategies to enhance its half-life and minimize immunogenicity in pharmaceutical applications involves conjugation with a functional moiety provided as a pharmacologically acceptable polymer, such as poly(ethylene glycol) (PEG) or its derivatives (e.g., methoxypoly(ethylene glycol) or mPEG). Various forms of pegylation, similar to those utilized in antibody and antibody fragment engineering (including single-domain antibodies and ScFv), can be applied109-111. Preferably, site-directed pegylation via a cysteine residue is employed112. This may involve attaching PEG to a naturally occurring cysteine residue in the binding agent, modifying the binding agent to introduce one or more cysteine residues for PEG attachment, or fusing an amino acid sequence containing cysteine residues for PEG attachment to the N- and / or C-terminus of the binding agent. These techniques are well-known to those skilled in protein engineering.
[0258] For the modulator polypeptide of this invention, PEGs with molecular weights exceeding 5,000 are preferred, particularly those ranging from 10,000 to 200,000, with an optimal range of 20,000 to 80,000. Alternative strategies to extend the half-life of the binding agent include N-linked or O-linked glycosylation, which occur as co-translational and / or post-translational modifications, depending on the host cell used for expressing the immunoglobulin single variable domain or polypeptide.
[0259] Another strategy to extend the half-life of a modulator polypeptide involves engineering bifunctional constructs, such as fusing a NanobodytargetinglSG15 with another Na nobody specific for a serum protein like albumin or incorporating peptides that enhance serum retention, such as albuminbinding peptides. Additionally, modifications like N-linked or O-linked glycosylation can be introduced as part of co-translational and / or post-translational processing, depending on the host cell used for expressing the selected binding agents.
[0260] Yet another modification may comprise the introduction of one or more detectable labels or other signal-generating groups or moieties, depending on the intended use of the labeled binding agent. Suitable labels and techniques for attaching, using and detecting them will be clear to the skilled person, and for example include, but are not limited to, fluorescent labels, (such as IRDye800, VivoTag800, fluorescein, isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allo hycocyanin, o-phthalaldehyde, and fluorescamine and fluorescent metals such as Eu or others metals from the lanthanide series), phosphorescent labels, chemiluminescent labels or bioluminescent labels (such as luminal, isoluminol, theromatic acridinium ester, imidazole, acridinium salts, oxalate ester, dioxetane or GFP and its analogs), radio-isotopes, metals, metals chelates or metallic cations or other metals or metallic cations that are particularly suited for useFrlmp / ISG15_Nbs / 873
[0261] in in vivo, in vitro or in situ diagnosis and imaging, as well as chromophores and enzymes (such as malate dehydrogenase, staphylococcal nuclease, delta- V- steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, biotinavidin peroxidase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase and acetylcholine esterase). Other suitable labels will be clear to the skilled person, and for example include moieties that can be detected using NMR or ESR spectroscopy. Such labeled binding agents of the invention may for example be used for in vitro, in vivo or in situ assays (including immunoassays known per se such as ELISA, RIA, EIA and other “sandwich assays”, etc.) as well as in vivo diagnostic and imaging purposes, depending on the choice of the specific label. As will be clear to the skilled person, another modification may involve the introduction of a chelating group, for example to chelate one of the metals or metallic cations referred to above. Suitable chelating groups include, without limitation, 2,2',2"-(10-(2-((2,5-dioxopyrrolidin-1-yl)oxy)-2-oxoethyl)-1,4,7,10-tetraazacyclododecane-1 ,4,7-triyl)triacetic acid (DOTA), 2,2'-(7-(2-((2,5-dioxopyrrolidin-1 -yl)oxy)-2-oxoethyl)-1 ,4,7-triazonane-1 ,4-diyl)diacetic acid (NOTA), diethyl-enetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0262] Yet another modification involves introducing a functional group or moiety that forms one part of a specific binding pair, such as the biotin-(strept)avidin system. This functional group enables the modulator polypeptide to be linked to another protein, polypeptide, or chemical compound that carries the complementary binding partner, facilitating targeted conjugation through the formation of the binding pair. For example, a modulator polypeptide of the invention may be conjugated to biotin, and linked to another protein, polypeptide, compound or carrier conjugated to avidin or streptavidin. Without limitation, such a conjugated modulator polypeptide may be used as a reporter, for example in a diagnostic system where a detectable signal-producing agent is conjugated to avidin or streptavidin. Such binding pairs may for example also be used to bind the modulator polypeptide of the invention to a carrier, including carriers suitable for pharmaceutical purposes. One non-limiting example is the liposomal formulations described by Cao Yand Suresh MR, 2000''3. Such binding pairs may also be used to link a therapeutically active agent to the modulator polypeptide of the invention.
[0263] In cases where modulator polypeptides are modified by linking specific functional groups, residues, or moieties (as described herein), linker molecules are often employed. Preferred “linker molecules” or “linkers” are peptides of 1 to 200 amino acids length, and are typically, but not necessarily, chosen or designed to be unstructured and flexible. For instance, one can chooseFrlmp / ISG15_Nbs / 873
[0264] amino acids that form no particular secondary structure. Alternatively, amino acids can be chosen so that they do not form a stable tertiary structure. Alternatively, the amino acid linkers may form a random coil. Such linkers include, but are not limited to, synthetic peptides rich in Gly, Ser, Thr, Gin, Glu or further amino acids that are frequently associated with unstructured regions in natural proteins114. Non-limiting examples of suitable linker sequences include GlySer linkers such as (GS)5 (GSGSGSGSGS; SEQ ID NO: 52), (GS)10 (GSGSGSGSGSGSGSGSGSGS; SEQ ID NO: 53), (G4S)3 (GGGGSGGGGSGGGGS; SEQ ID NO: 54), or variants thereof, or linkers based on hinge region sequences of Immunoglobulins (Igs), such as llama lgG2 hinge (AHHSEDPSSKAPKAPMA; SEQ ID NO: 55) and human IgA hinge (SPSTPPTPSPSTPPAS; SEQ ID NO: 56), or variants thereof. For certain applications, it may be advantageous that the linker molecule comprises or consists of one or more particular sequence motifs. Forexample, a proteolytic cleavage site can be introduced into the linker molecule such that detectable label or moiety can be released. Useful cleavage sites are known in the art, and include a protease cleavage site such as Factor Xa cleavage site having the sequence IEGR (SEQ ID NO: 57), the thrombin cleavage site having the sequence LVPR (SEQ ID NO: 58), the enterokinase cleavage site having the sequence DDDDK(SEQ ID NO: 59), or the PreScission protease cleavage site having the sequence LEVLFQGP (SEQ ID NO: 60).
[0265] Alternatively, if the modulator polypeptide is linked to a detectable label or moiety using chemoenzymatic methods for protein modification, the linker moiety may consist of various chemical entities, depending on the enzymes or synthetic chemistry used to produce the covalently coupled molecule in vivo or in vitro"5.
[0266] In yet another embodiment, ISG15-specific modulator polypeptide described herein comprises an ISVD that is conjugated to a further functional moiety, wherein the functional moiety is a molecule or a component which performs an additional function for the modulator polypeptide when used for a specific purpose. Said purpose may include therapeutic use, half-life extension, targeted delivery, and others. So the functional moiety conjugated to the ISG15-specific modulator polypeptide may for instance comprise a therapeutic moiety, a half-life extension, a smallmolecule compound, an enzyme, an antibody, a genome-editing component, such as a nuclease, a nucleic acid molecule, or a nanoparticle such as a liposome, among others.
[0267] In a specific aspect, the composition or modulator polypeptide(s) of the invention, as described herein, may appear in a “multivalent” or “multispecific” format and thus be formed by bonding, chemically or by recombinant DNA techniques, together two or more identical or different binding agents. Said multivalent forms may be formed by connecting the building block directly or via a linker, or by fusing it with an Fc domain-encoding sequence. Non-limiting examples of multivalentFrlmp / ISG15_Nbs / 873
[0268] constructs include “bivalent” constructs, “trivalent” constructs, “tetravalent” constructs, and so on. The immunoglobulin single variable domains comprised within a multivalent construct may be identical or different, preferably binding to the same or overlapping binding site. In a particular embodiment, the modulator polypeptides of the invention are in a “multispecific” form and comprise at least two moieties specifically binding ISG15, or comprise at least two ISG15-specific ISVDs. Non-limiting examples of multispecific constructs include “bispecific” constructs, “trispecific” constructs, “tetraspecific” constructs, and so on. To illustrate this further, any multivalent or multispecific ISVD of the invention may be suitably directed against two or more different epitopes on the same ISG15 antigen, or may be directed against two or more different antigens. For example, one of them may target human ISG15, and one of them may serve as a halflife extension by binding to serum albumin, or another specified target. Multivalent or multi-specific ISVDs of the invention may also have (or be engineered and / or selected for) any desired property or combination of desired properties that may be obtained by the use of such multivalent or multispecific immunoglobulin single variable domains.
[0269] Moreover, the ISG15-specific binder of this invention, or any of its humanized or optimized variants, may be genetically or chemically fused - eitherdirectlyorvia a suitable linker- to generate bivalent or multivalent constructs. Such constructs may include tandem repeats or head-to-tail fusions, terms used interchangeably herein. Alternatively, the VHH or its variant may be fused to an Fc domain, particularly a human IgGI Fc tail (also referred to herein as an IgG-fusion or IgGFc-fusion), thereby providing an Fc-fusion construct. An “Fc domain” as used herein refers to the fragment crystallizable region of an antibody, which corresponds to the tail region known to interact with cell surface Fc receptors and certain proteins of the complement system. This Fc domain is composed of two identical protein fragments derived from the second and third constant domains of the antibody’s heavy chains. While all conventional antibodies contain an Fc domain, the Fc domain fusion described herein may comprise an Fc region derived from, or a variant of, IgG, IgA, or IgD antibody Fc regions - more specifically, IgGI , lgG2, or lgG4 subclasses. The hinge region of lgG2 may be replaced by that of human IgGI to generate ISVD fusion constructs, and vice versa. Fc fusions may include linker moieties of varying lengths, as exemplified herein, though not limited to the examples provided. Additionally, Fc variants known to extend half-life may be incorporated, such as the M257Y / S259T / T261 E triple mutation (known as YTE) or the LS variant (M428L combined with N434S). These mutations enhance binding of the Fc domain to the neonatal Fc receptor (FcRn). Moreover, Fc mutants characterized by reduced Fc-mediated effector functions, such as the LALAPG mutant (SEQ ID NO: 71 ), may also be used.Frlmp / ISG15_Nbs / 873
[0270] The Fc-fusion may confer additional desirable properties, including but not limited to extended serum half-life, improved biodistribution, enhanced or decreased effector function through enhanced or decreased Fc receptor binding, and facilitation of purification via protein A / G affinity methods.
[0271] In some embodiments, the Fc region is engineered to include “knob” and “hole” mutations that promote the preferential formation of heterodimers between two distinct Fc-containing polypeptide chains when co-expressed in a suitable host cell system (see, e.g., U.S. Pat. No.
[0272] 7,695,963). This "knob-into-hole" (KiH) strategy enables the assembly of bispecific or multispecific molecules byfavoringthe pairingof two different heavy chains while disfavoring homodimerization. Hence, the ISVD-comprising modulator of this invention may be provided in the format of a knob-into-hole (KiH) fusion construct. In this configuration, the modulator consists of two polypeptides, each comprising a VHH with a distinct specificity and a constant region composed of a hinge, CH2, and CH3 domains. The constant regions of the two polypeptides are engineered with knob-into-hole mutations that promote preferential heterodimerization over homodimerization. The term “knob-into-hole” (KiH), as used herein, refersto a protein engineeringtechnologydesigned to guide the pairing of two polypeptides either in vitro or in vivo. This is achieved by introducing a protuberance ("knob") into one polypeptide and a compensatory cavity ("hole") into the other, precisely at their interface. The “knob” typically consists of one or more amino acid side chains that extend from the surface of the first polypeptide, fitting into the “hole” engineered in the second polypeptide. This geometric complementarity enhances the stability of the resulting heterodimer while disfavoring homodimer formation. The KiH technology is a well-established strategy for producing multispecific antibodies, particularly those with distinct binding domains. In the context of this invention, multispecific ISVD-based molecules may incorporate KiH mutations in their Fc domains and carry one or more distinct ISVDs fused to each Fc arm, enabling targeted allosteric modulation.
[0273] In yet another as ect, the invention provides nucleic acid molecules such as isolated nucleic acids, (isolated) chimeric gene constructs, expression cassettes, recombinant vectors (such as expression or cloning vectors) comprising a nucleotide sequence, such a coding sequence, that encodes the ISG15-specific modulator polypeptide as described herein.
[0274] A further aspect of the invention pertains to a pharmaceutical composition comprising the modulator polypeptide as described herein, or a nucleic acid encoding said modulator polypeptide. Specifically, the pharmaceutical composition is a pharmaceutically acceptableFrlmp / ISG15_Nbs / 873
[0275] formulation, which may, in various embodiments, further include a pharmaceutically suitable carrier, diluent, and / or stabilizer, as described and defined herein.
[0276] In a further aspect, the use of the ISG15-specifc modulator polypeptide or nucleic acid encoding it, as described herein, or the use of a pharmaceutical composition comprising the modulator polypeptide, nucleic acid encoding it, and / or a recombinant vector containing such nucleic acid, is anticipated for medicinal purposes. In particular, the composition, ISG15-specifc modulator polypeptide, or nucleic acid encoding it, as described herein, or the medicament or pharmaceutical composition comprising said modulator polypeptide, nucleic acid encoding it, and / or a recombinant vector comprising such nucleic acid, is envisioned for use in treating a subject with an infectious disease. In one embodiment, said infectious disease is a bacterial disease. In a preferred embodiment, said bacterial infection is caused by a gram-positive bacteria. In another preferred embodiment, said bacterial infection is caused by an intracellular bacteria. In another preferred embodiment, said bacterial infection is caused by bacteria from the genus Listeria.
[0277] In other embodiments, said bacterial infection may be caused by any of the following bacteria: Acinetobacter baumannii, Actinomyces israelii, Aeromonas hydrophila, Anaplasma phagocytop hilum, Bacillus anthracis, Bacillus cereus, Bartonella bacilliformis, Bartonella henselae, Bartonella quintana, Bifidobacterium dentium, Bordetella bronchiseptica, Bordetella parapertussis, Bordetella pertussis, Borrelia afzelii, Borrelia burgdorferi, Borrelia garinii, Borrelia recurrentis, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, Burkholderia cepacia, Burkholderia mallei, Burkholderia pseudomallei, Campylobacter coli, Campylobacter fetus, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridioides difficile, Clostridium botulinum, Clostridium perfringens, Clostridium septicum, Clostridium tetani, Corynebacterium diphtheriae, Corynebacterium jeikeium, Corynebacterium striatum, Coxiella burnetii, Cutibacterium acnes, Edwardsiella tarda, Enterobacter aerogenes, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Ehrlichia chaffeensis, Ehrlichia ewingii, Escherichia coli, Francisella tularensis, Fusobacterium necrophorum, Fusobacterium nucleatum, Gardnerella vaginalis, Haemophilus ducreyi, Haemophilus influenzae, Haemophilus parainfluenzae, Helicobacter cinaedi, Helicobacter fennelliae, Helicobacter pylori, Klebsiella aerogenes, Klebsiella oxytoca, Klebsiella pneumoniae, Lactobacillus rhamnosus, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Mobiluncus curtisii, Mobiluncus mulieris, Morganella morganii, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium bovis, Mycobacterium fortuitum, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, MycobacteriumFrlmp / ISG15_Nbs / 873
[0278] tuberculosis, Mycoplasma genitalium, Mycoplasma hominis, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Nocardia brasiliensis, Pasteurella multocida, Peptostreptococcus anaerobius, Porphyromonas gingivalis, Prevotella intermedia, Proteus mirabilis, Proteus vulgaris, Providencia rettgeri, Providencia stuartii, Pseudomonas aeruginosa, Rickettsia akari, Rickettsia prowazekii, Rickettsia rickettsii, Rickettsia typhi, Rothia dentocariosa, Salmonella enterica, Salmonella Paratyphi A, Salmonella Paratyphi B, Salmonella Typhi, Serratia marcescens, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus lugdunensis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus anginosus, Streptococcus bovis, Streptococcus dysgalactiae, Streptococcus equisimilis, Streptococcus gallolyticus, Streptococcus intermedius, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus salivarius, Streptococcus sanguinis, Treponema pallidum, Ureaplasma parvum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis.
[0279] In another embodiment, said infectious disease is a viral disease. In various embodiments, said viral infection may be caused by any of the following viruses: Adenovirus, Alphavirus encephalitis virus, Andes virus, Arenavirus, Astrovirus, Banna virus, Banna reovirus, Batai virus, BK polyomavirus, Borna disease virus, Buffalopox virus, Calicivirus, California encephalitis virus, Camelpox virus, Chapare virus, Chikungunya virus, Chilungunya virus, Coronavirus 229E, Coronavirus HKU1, Coronavirus NL63, Coronavirus OC43, Crimean-Congo hemorrhagic fever virus, Coxsackievirus A, Coxsackievirus B, Cytomegalovirus (CMV), Dengue virus, Dobrava-Belgrade virus, Duck hepatitis virus, Echovirus, Eastern equine encephalitis virus, Ebola virus, Enterovirus 70, Enterovirus 71, Epstein-Barr virus (EBV), European bat lyssavirus 1, European bat lyssavirus 2, Feline calicivirus, Feline coronavirus, Feline immunodeficiency virus (FIV), Feline leukemia virus (FeLV), Feline panleukopenia virus, Foot-and-mouth disease virus, GB virus C, Guama virus, Guinea pig cytomegalovirus, Guinea pig herpesvirus 1, Guinea pig parainfluenza virus 5, Guinea pig papillomavirus, Hantaan virus, Hendra virus, Hepatitis A virus (HAV), Hepatitis B virus (HBV), Hepatitis C virus (HCV), Hepatitis D virus (HDV), Hepatitis E virus (HEV), Herpes simplex virus 1 (HSV-1), Herpes simplex virus 2 (HSV-2), Human bocavirus, Human coronavirus HKU1, Human coronavirus NL63, Human coronavirus OC43, Human enterovirus A, Human enterovirus B, Human enterovirus C, Human enterovirus D, Human herpesvirus 6A (HHV-6A), Human herpesvirus GB (HHV-6B), Human herpesvirus 7 (HHV-7), Human herpesvirus 8 (HHV-8, Kaposi’s sarcoma-associated herpesvirus), Human immunodeficiency virus type 1 (HIV-1), Human immunodeficiencyFrlmp / ISG15_Nbs / 873
[0280] virus type 2 (HIV-2), Human mastadenovirus A, Human mastadenovirus B, Human mastadenovirus C, Human mastadenovirus D, Human mastadenovirus E, Human mastadenovirus F, Human metapneumovirus (hMPV), Human papillomavirus (HPV) types 1, 2, 6, 11, 16, 18, 31, 33, 45, 52, 58, Human parainfluenza virus 1, Human parainfluenza virus 2, Human parainfluenza virus 3, Human parainfluenza virus 4, Human parechovirus, Human polyomavirus JC (JC virus), Human polyomavirus BK (BK virus), Human respiratory syncytial virus (RSV), Human rhinovirus A, Human rhinovirus B, Human rhinovirus C, Human T-lymphotropic virus type 1 (HTLV-1), Human T-lymphotropic virus type 2 (HTLV-2), Influenza A virus, Influenza B virus, Influenza C virus, Isavirus (infectious salmon anemia virus), Japanese encephalitis virus, Junin virus, Kaposi’s sarcoma-associated herpesvirus (HHV-8), Kyasanur forest disease virus, Lassa virus, Louping ill virus, Lujo virus, Lymphocytic choriomeningitis virus (LCMV), Machupo virus, Marburg virus, Measles virus, Merkel cell polyomavirus (MCPyV), Molluscum contagiosum virus, Mumps virus, Murid herpesvirus 4, Murray Valley encephalitis virus, Nipah virus, Norovirus, Omsk hemorrhagic fever virus, Orf virus, Oropouche virus, Parvovirus B19, Parainfluenza virus 1, Parainfluenza virus 2, Parainfluenza virus 3, Parainfluenza virus 4, Parechovirus, Pestivirus (bovine viral diarrhea virus), Pichinde virus, Polyomavirus, Poxvirus, Puumala virus, Rabies virus, Rift Valley fever virus, Rotavirus A, Rotavirus B, Rotavirus C, Rubella virus, Sabia virus, Sapporo virus, SARS-CoV (severe acute respiratory syndrome coronavirus), SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2, COVID-19 virus), Seoul virus, Sindbis virus, Smallpox virus (Variola virus), St. Louis encephalitis virus, Tacaribe virus, TBEV (tick-borne encephalitis virus), Teschovirus, Theiler’s murine encephalomyelitis virus, Toscana virus, TTV (Torque teno virus), Usutu virus, Vaccinia virus, Venezuelan equine encephalitis virus, Vesicular stomatitis virus (VSV), West Nile virus (WNV), Western equine encephalitis virus, Yellow fever virus, Zika virus.
[0281] In another aspect, the composition, ISG15-specifc modulator polypeptide, or nucleic acid encoding it, as described herein, or the medicament or pharmaceutical composition comprising said modulator polypeptide, nucleic acid encoding it, and / or a recombinant vector comprising such nucleic acid, is envisioned for use in treating a subject with an autoimmune disease, as defined herein. A non exhaustive list of autoimmune diseases includes: rheumatoid arthritis, lupus (systemic lupus erythematosus), type 1 diabetes (insulin-dependent diabetes), psoriasis, multiple sclerosis, Crohn's disease, ulcerative colitis, Hashimoto's thyroiditis, Graves' disease, Addison's disease, vitiligo, pernicious anemia, celiac disease (gluten-sensitive enteropathy), Sjogren's syndrome, myasthenia gravis, polymyalgia rheumatica, giant cell arteritis, pemphigus, pemphigoid, dermatomyositis, polymyositis, ankylosing spondylitis, Goodpasture syndrome, primary biliary cholangitis (autoimmune cholangitis), autoimmune hepatitis, idiopathicFrlmp / ISG15_Nbs / 873
[0282] thrombocytopenic purpura (ITP), Guillain-Barre syndrome, chronic inflammatory demyelinating polyneuropathy (CIDP), sarcoidosis, Wegener's granulomatosis (granulomatosis with polyangiitis), Churg-Strauss syndrome (eosinophilic granulomatosis with polyangiitis), autoimmune pancreatitis, relapsing polychondritis, Behqet's disease, primary sclerosing cholangitis, mixed connective tissue disease, juvenile idiopathic arthritis (juvenile rheumatoid arthritis), Takayasu's arteritis, polyarteritis nodosa, eosinophilic esophagitis, IgA nephropathy (Berger's disease), chronic urticaria, bullous pemphigoid, cold agglutinin disease, Raynaud's phenomenon, relapsing polychondritis, chronic atrophic gastritis, paraneoplastic syndromes, membranous nephropathy, stiff person syndrome, acquired hemophilia, chronic recurrent multifocal osteomyelitis (CRMO), autoimmune inner ear disease, autoimmune retinopathy, autoimmune encephalitis, autoimmune polyendocrine syndrome type 1 and type 2, chronic mucocutaneous candidiasis, pemphigoid gestationis, autoimmune hemolytic anemia (AIHA), autoimmune polyglandular syndrome, chronic autoimmune hepatitis, lgG4-related disease, primary autoimmune neutropenia, immune thrombocytopenia (formerly known as idiopathic thrombocytopenic purpura), autoimmune thyroid disease (including Graves' disease and Hashimoto's thyroiditis), autoimmune lymphoproliferative syndrome (ALPS), autoimmune enteropathy, autoimmune blistering diseases (including epidermolysis bullosa acquisita and linear IgA dermatosis), autoimmune chronic active hepatitis, autoimmune limbic encephalitis, paroxysmal nocturnal hemoglobinuria (PNH), autoimmune angioedema, autoimmune polyendocrine syndrome type 3, lupus nephritis, seronegative spondyloarthropathy, adult-onset Still's disease, chronic periaortitis, and autoimmune autonomic ganglionopathy.
[0283] It should be noted that while specific embodiments, configurations, materials, and / or molecules have been discussed herein for the products and their use according to the disclosure, various changes or modifications in form and detail may be made without departingfrom the scope of this invention. The following examples are provided to further illustrate particular embodiments and should not be construed as limiting the application. The scope of the application is defined solely by the claims.
[0284] Table 1. Amino acid sequences of peptides and polypeptides used and / or mentioned in this application.
[0285]
[0286] Frlmp / ISG15_Nbs / 873
[0287]
[0288] Frlmp / ISG15_Nbs / 873
[0289]
[0290] Frlmp / ISG15_Nbs / 873
[0291]
[0292] Frlmp / ISG15_Nbs / 873
[0293]
[0294] Frlmp / ISG15_Nbs / 873
[0295]
[0296] Table 2. Amino acid names and their codes used throughout this application.
[0297]
[0298] Frlmp / ISG15_Nbs / 873
[0299]
[0300] EXAMPLES
[0301] General materials and methods
[0302] Cell lines, culture reagents and materials
[0303] All culture media, supplements and cell culture plastics were obtained from ThermoFisher Scientific unless otherwise stated. The human embryonic kidney cell line HEK293T (CRL-3216, ATCC), HeLa cell line (CCL-2, ATCC), HeLa-hACE2, HeLa-NbGFP and HeLa-Nb61 cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM, 31966047, ThermoFisher Scientific) supplemented with 10% fetal bovine serum (FBS, 10270106, ThermoFisher Scientific). The THP-1 cell line was cultured in RPMI 1640 medium (11875093, ThermoFisher Scientific) supplemented with 10% fetal bovine serum. The HEKS cell line was cultured in a 1 :1 mix of serum-free Freestyle-293 medium (12338018, Thermofisher Scientific) and Ex-Cell 293 medium (14571C, Sigma). All cultures were incubated in a humidified environment at 37 °C with 5% CO2, except HEKS cells, which were maintained at 8% CO2. Prior to in-house expansion, all cell lines were tested for mycoplasma infection and confirmed to be negative. Additional tests were conducted if symptoms such as slow growth or increased cell death after transfection were observed.
[0304] Generation of stable HeLa cell lines expressing ISG15 nanobodies
[0305] Stable HeLa cell lines expressing anti-GFP (NbGFP) or anti-ISG15 (Nb61) nanobodies were generated by lentiviral transduction. Briefly, HA-tagged nanobody expression cassettes were assembled by cloning synthetic gBlocks (IDT) into the pLVX-IRES-Puro vector of the Lenti-X™Frlmp / ISG15_Nbs / 873
[0306] Bicistronic Expression System (632183, Takara Bio), according to the manufacturer’s instructions. Lentiviral particles were produced using Lenti-X™ Packaging single Shots (631275, Takara Bio). Viral supernatants were collected 48h post-transfection, clarified by low-speed centrifugation, and passed through 0.45 pm filters prior to use.
[0307] For stable cell line generation, HeLa cells were seeded at 3 * 105cells per well in 6-well plates. Transduction was performed in 1.5 mL of infection medium consisting of DM EM supplemented with 10%FBSand 10 pg / mL polybrene. Lentiviral particles were added ata multiplicity of infection (MOI) of 5, assuming a functional titer of 1 * 108transducing units (TU) / mL. Parallel wells without lentiviral vector were maintained as selection controls. After 24h, the infection medium was replaced with fresh culture medium containing 2 pg / mL puromycin. Selection medium was renewed every 2-3 days, and cells were passaged upon reaching confluency. Puromycin selection was continued for at least two weeks, during which the control cells were fully eliminated, confirming effective selection. Expression of HA-tagged nanobodies in the resulting stable cell populations was verified by Western blotting using anti-HA antibody.
[0308] Plasmid transfections
[0309] Plasmid transfection into HEKT, HEKS or HeLa cells was performed with polyethylenimine (PEI, #23966-1 , Polysciences) as transfection reagent at a DNA:PEI ratio of 1 :2.6 (w / w), unless otherwise stated. The following plasmids were used: pDEST-C-HA-Nb4, pDEST-C-HA-Nb8, pDEST-C-HA-Nb24, pDEST-C-HA-Nb32, pDEST-C-HA-Nb37, pDEST-C-HA-Nb42, pDEST-C-HA-Nb51 , pDEST-C-HA-Nb54, pDEST-C-HA-Nb57, pDEST-C-HA-Nb61 , pDEST-C-FLAG-Nb61 , pcDNA3.1 -V5-Nb61 -NLS, pcDNA3.4-Nb61-Fc, pDEST-C-HA-Nb68, pDEST-C-HA-Nb85, pDEST-C-HA-Nb88, pDEST-C-HA-Nb95, pDEST-C-HA-NbGFP, pDEST-C-FLAG-NbGFP, pcDNA3.1-FLAG-ISG15, pcDNA3.1 -GFP-ISG15, pcDNA3.1-HA-ISG15, pFN21 A-Halo-hlSG15, pFN31 K-Nano-hUSP18, pmHGFP-USP18, pMET7-FLAG-eGFP and pSVsport mock plasmid. Plasmid transformation in E. coli was performed with electroporation or heat-shock transformation per manufacterer’s instructions. The following plasmid backbones containingthe nanobody sequence inserts were used: pMECS-GG, pVDS101, pVDS105, pDNORTM 221, pCSF107mT-GATEWAY-3’-3HA, pCSF107mT-GATEWAY-3'-FLAG.
[0310] Western blot
[0311] Cleared cell lysates were prepared for SDS-PAGE in 4x Laemmli Sample Buffer (J63615.AC, ThermoFisher Scientific) supplemented with 100 mM dithiothreitol (DTT). Samples were heated at 95°C for 10 min before loading onto 4-20% Bis-Tris SurePAGE™ Gels (M00657, Genscript). Approximately 20 pg of protein sample was loaded of each sample. Precision Plus Protein™ All Blue Standard (1610373EDU, Bio-Rad) was loaded as a molecular weight standard. The gel was run forFrlmp / ISG15_Nbs / 873
[0312] 70 minutes at 140V in 1x Tris-MOPS-SDS Running Buffer (M00138, GenScript) using the mini-PROTEAN™ Tetra Cell and PowerPac™ Basic Power Supply (Bio-Rad). Proteins separated by SDS-PAGE were transferred to an lmmobilon®-FL PVDF membrane (IPFL00010, Merck) using the Criterion™ Blotter (Bio-Rad) according to manufacturer’s instructions. After transfer at 100V for 30 minutes, the membrane was blocked in Odyssey® blocking buffer (927-60001 , Li-COR) for 1 h at room temperature (RT). After blocking, the membrane was rinsed 3 times with demineralized water (ddH2O) followed by 1 wash of 5 minutes in TBS with 0.05% Tween (TBS-T) while shaking. Next, the membrane was incubated with rimaryantibodyovernightat4°C. The following day, the membrane was rinsed three times with ddH2O followed by three washes of 5 minutes with TBS-T. After washing, the mem brane was incubated with secondary antibody for 1 h at RT and washed two times in TBS-T and onetime in TBS for 3x5’ in total. Blots were imaged using the Odyssey® Infrared Imaging System (Li-COR).
[0313] The following primary antibodies, diluted at a final concentration of 1 :1 ,000 in Odyssey® blocking buffer (Li-COR), were used for Western Blot analysis: mouse anti-ISG15 antibody (F-9, Santa Cruz), rabbit anti-HA antibody (H6908, Sigma), mouse anti-FLAG antibody (F3165, Sigma-Aldrich), mouse anti-GFP antibody (B-2, Santa Cruz), mouse anti-His antibody (sc-53073, Santa Cruz), rabbit anti-pSTATI antibody (#9167, Cell Signaling Technology), mouse anti-tubulin-a antibody (T6074, Sigma), rabbit anti-tubulin-a antibody (ab18251, Abeam) and rabbit anti-GAPDH antibody (PA1-987, ThermoFisher Scientific). Secondary antibodies for Western Blot, diluted at a final concentration of 1:10,000 in Odyssey® blocking buffer (Li-COR), include: goat anti-mouse-IgG (IRDye® 800CW, Li-COR), goat anti-rabbit-IgG (IRDye® 800CW, Li-COR), goat anti-mouse-IgG (IRDye®680RD, Li-COR) and goat anti-rabbit-IgG (IRDye® 680RD, Li-COR).
[0314] Co-immunoprecipitation assays of nanobodies and ISG15
[0315] Co immunoprecipitation experiments were performed in HEK293T and HeLa cells by FLAG tag affinity purification of nanobody-ISG15 complexes. HEK293T cells were seeded at a density of 4.4 x 106cells in 100 mm dishes and transfected the following day with plasmids encoding individual HA tagged anti ISG15 nanobodies, an anti GFP nanobody, or a mock plasmid, together with either FLAG ISG15 or FLAG GFP. HeLa cells were seeded at a density of 2.2 * 106cells in 100 mm dishes and transfected after 24 h with plasmids expressing FLAG tagged Nb61 or FLAG NbGFP. Twenty four hours after transfection, HeLa cells were either left untreated or stimulated with 1000 U / mL IFN a (11343504, Immunotools) for an additional 24 h before lysis, whereas HEK293T cells were harvested 48 h post transfection.Frlmp / ISG15_Nbs / 873
[0316] Cells were lysed in IP lysis buffer containing 50 mM Tris HCl pH 7.5, 150 mM NaCl, 1% Triton X 100, 1 mM PMSF (ThermoFisher Scientific) and 1* protease inhibitor cocktail (Roche). Lysates were incubated for 30 min at 4°C with end over end rotation and subsequently clarified by centrifugation at 16,000 g for 10 min at 4°C. Supernatants were collected, and aliquots were reserved as input samples for Western blotting. The remaining lysate was incubated for 2 h at 4°C with anti FLAG M2 magnetic beads (Merck), which had been equilibrated in IP wash buffer (50 mM Tris HCl pH 7.5, 150 mM NaCl, 1% Triton X 100). Following incubation, the beads were washed five times with IP wash buffer. Bound proteins were eluted by adding 2* Laemmli sample buffer supplemented with 50 mM DTT and boiling the samples at 95°C for 10 min with shaking (1250 rpm). After magnetic separation, eluates were collected and analyzed together with input samples by Western blot.
[0317] Pulldown of ISGylated proteins using recombinant nanobody
[0318] HeLa cells were seeded at a density of 2.2 * 106cells in 100 mm dishes (ThermoFisher Scientific). The following day, cells were either treated with 1000 U / mL IFN a (11343504, ImmunoTools) or left untreated. After 48 h, cells were lysed in IP lysis buffer (50 mM Tris HCl pH 7.5, 150 mM NaCl, 1% Triton X 100, 1 mM PMSF (ThermoFisher Scientific), and 1* protease inhibitor cocktail (Roche). Lysates were incubated for 30 min at 4°C with end over end rotation and subsequently clarified by centrifugation at 16,000 g for 10 min at 4°C. Supernatants were collected, and aliquots were reserved as input samples for Western blot analysis.
[0319] The remaining lysates were incubated for 2 h at 4°C with anti FLAG M2 magnetic beads (Merck), equilibrated in IP wash buffer (50 mMTris HCl pH 7.5, 150 mM NaCl, 1 % Triton X 100) and pre loaded with 10 pg recombinant FLAG tagged nanobody 61 or left unloaded (control). Beads were washed five times with IP wash buffer, and bound proteins were eluted by addition of 2* Laemmli sample buffer supplemented with 50 mM DTT, followed by heating at 95°C for 10 min with shaking (1250 rpm). After magnetic separation, eluates were collected and analyzed by Western blot alongside input samples.
[0320] Nanobody-ISG15 delocalization assay
[0321] HEK293T cells were seeded at 10,000 cells per well in p-Slide 8-well chambered coverslips (80806, Ibidi) and transfected the following day with plasmids encoding a V5 tagged nanobody fused to an SV40 nuclear localization sequence (Nb61 NLS), an ISG15 eGFP fusion protein, or empty vector control using PEI. At 24h post transfection, cells were fixed with 4% paraformaldehyde, washed, and permeabilized with 0.2% Triton X 100 for 10 min at room temperature. Next, samples were incubated for 30 min in blocking buffer (PBS containing 0.5% bovine serum albumin, 0.02% Triton X 100, and 1% donkey serum), after which mouse anti V5 primary antibody (1:500) (R960-25,Frlmp / ISG15_Nbs / 873
[0322] ThermoFisher Scientific) was applied in blocking buffer overnight at 4 °C. Following PBS washes, cells were incubated with donkey anti mouse Alexa Fluor 568 secondary antibody (1 :500) for 1 h at room temperature, and nuclei were counterstained with DAPI (1:1000) for 15 min. Samples were mounted in DABCO PVA mounting medium and cured overnight at room temperature protected from light.
[0323] Image data sets were acquired on a LSM980 Airyscan 2 (Carl Zeiss) with a plan-apochromat 63x / 1.4 oil immersion objective, and the 405-, 488-, and 561 -nm lasers using the operating software ZEN Blue 3.10. Representative data sets were collected using the Airyscan 2 detector in the Multiplex Super Resolution (SR-4Y) mode, using the corresponding filter sets BP 420-480, BP 500-545, BP 570-620. For quantification purposes, Z-stacks covering the whole cell volume were recorded at the optimal voxel size (according to the Nyquist criterium) of 35 x35 x 140 nm using a 2xscan zoom, and resulting in a field of view of 66.92 x 66.92 nm. A pixel reassignment and a 3D Wiener deconvolution step were carried out post-acquisition in the Zen Blue 3.10. software.
[0324] Overlap analysis to measure the percentage of ISG15 signal and nanobody signal found in the nuclei was performed using the Arivis Pro 4.4 software (Carl Zeiss). The analysis pipeline used can be briefly described as follows: the channel displaying the nuclei signal (405 channel) was first denoised using a “median” method (matrix diameter of 1 pm) to homogenize their shape and facilitate their segmentation. The denoised nuclei signal (405 channel), the ISG15 signal (488 channel) and the nanobody signal (561 channel) were segmented using an intensity-based threshold segmenter with a threshold value set at 350, 75, and 400, respectively. For all three segmentations, an object feature filter was used to exclude false positive objects and artefactual detections smaller than 3.106 voxel counts (~500 m3). The cell outlines were segmented the same way using the ISG15 signal (488 channel) at a lower threshold (50) to encompass the whole cell volume. The cytoplasmic compartments were identified by subtraction of the nuclei compartments from the total cell outlines. The percentage of ISG15 and nanobody found in the nuclei was calculated as the ratio between the sum of intensities of voxels from the respective channel in the nuclei compartment and the sum of intensities of voxels from the respective channel in the total cell outline. The same procedure was followed for the cytoplasmic compartment. For this analysis, a total of 37 and 40 cells were analysed for the “mock”- and the “Nb61 -NLS”-treated conditions, respectively. For quantification, measurements from multiple co transfected cells within the same image were averaged, yielding one independent value per field of view.Frlmp / ISG15_Nbs / 873
[0325] USP18 destabilization assay
[0326] HEK293T cells were seeded at a density of 6 * 105cells per well in 6 well tissue culture plates. After 24 h, cells were transfected with the indicated combinations of plasmids encoding GFP-USP18, FLAG-ISG15, HA tagged anti GFP nanobody (NbGFP), or HA tagged anti ISG15 nanobody (Nb61) using PEI. Transfected cells were incubated for 48 h prior to lysis. Cells were harvested in physiological lysis buffer composed of 50 mM Tris HCl (pH 7.5), 150 mM NaCl, 1% Triton X 100, 1 mM PMSF (Thermo Fisher Scientific) and 1* protease inhibitor cocktail (Roche). Lysates were incubated on ice for 20 min with intermittent vortexing, followed by clarification by centrifugation at 16,000 g for 10 min at 4°C. Supernatants were collected and prepared for SDS-PAGE and immunoblot analysis. Quantification of immunoblot signals was performed in ImageJ. GFP-USP18 band intensities were normalized to GAPDH levels for each sample. Relative GFP-USP18 abundance was compared between NbGFP and Nb61 expressing conditions across four independent repeats.
[0327] Interferon desensitization assay
[0328] HeLa cells stably expressing an HA tagged anti ISG15 nanobody (Nb61) or HA tagged anti GFP nanobody (NbGFP) were seeded ata density of 3 x 105cells per well in 6 well plates. After 24 h, cells were either left untreated or primed with 1,000 U / mL IFN a for 24 h. Cells were then washed three times in PBS and incubated for an additional 24 h in IFN free medium to allow desensitization. Following the resting period, cells were re stimulated with IFN aatO, 100, or 1,000 U / mL for 30 min. Cells were then lysed in physiological lysis buffer (50 mM Tris HCl pH 7.5, 150 mM NaCl, 1% Triton X 100, 1 mM PMSF (ThermoFisher Scientific) and 1 x protease inhibitor cocktail (Roche)). Lysates were incubated on ice for 20 min with periodic vortexing and clarified by centrifugation at 16,000 g for 10 min at 4°C. Supernatants were collected for SDS-PAGE and Western Blot analysis. Immunoblot band intensities were quantified using ImageJ. pSTATI signals were normalized to GAPDH for each condition. For each cell line, the relative IFN response was calculated by comparing pSTATI levels in primed versus unprimed cells. These values were then compared between NbGFP and Nb61 expressing cells across three independent experiments.
[0329] mRNA production for mRNA-LNPs
[0330] Double-stranded DNA fragments encoding either anti-ISG15 nanobody Nb61 oranti-GFP nanobody NbGFP were synthesized as gBlocks (Integrated DNA Technologies, IDT). These DNA fragments were cloned into the pLMCT plasmid vector (kindly provided by Prof. K. Breckpot, Vrije Universiteit Brussel) using Gibson Assembly (New England Biolabs, NEB) following linearization of the vector with Ncol and Xhol restriction enzymes (NEB). The assembled constructs were transformed intoFrlmp / ISG15_Nbs / 873
[0331] NEB 5-a High Efficiency Escherichia coli competent cells (C2987, NEB). Plasmid DNA from selected bacterial clones was sequence-verified (Eurofins Genomics) and amplified using QIAGEN MIDI plasmid purification kits (Qiagen) according to the manufacturer’s instructions. Purified plasmids were linearized overnight by restriction enzyme digestion with BfuAI (NEB) to generate linear DNA templates suitable for in vitro transcription (IVT). Linearized DNA was subsequently purified using a PCR purification kit (Qiagen).
[0332] IVT reactions were performed usingT7 RNA polymerase (ThermoFisher Scientific) in the presence of RNase inhibitor (Promega) and inorganic pyrophosphatase (ThermoFisher Scientific). The transcription reaction mixture contained CleanCap AG reagent (TriLink Biotechnologies) at a final concentration of 10 mM to enable co-transcriptional 5' capping, and 10 mM of each ribonucleotide triphosphate (ATP, GTP, CTP, and UTP; Thermo Fisher Scientific). For uridine modification, UTPwas substituted with N1 -methylpseudouridine (N1 me J; Jena Bioscience). Transcription reactions were incubated at 37 °C for 2 h.
[0333] Following transcription, residual DNA template was removed by treatment with DNase I (10 U; ThermoFisher Scientific) for 15 min at 37 °C. The resulting mRNA was purified by lithium chloride (LiCl) precipitation through the addition of three reaction volumes of LiCl precipitation solution (7.5 M lithium chloride, 50 mM EDTA;ThermoFisherScientific) and an equal volume of RNase-free water (ThermoFisher Scientific), followed by incubation at -20 °C overnight. Samples were centrifuged for 15 min at 14,000 rpm, and the RNA pellet was washed with 70% ethanol (Sigma-Aldrich) before resuspension in RNase-free water. Purified mRNA was subjected to quality control analyses, including spectrophotometric determination of RNA concentration and purity based on absorbance at 260 nm and the A260 / A280 ratio. Transcript integrity and expected length were assessed by agarose gel electrophoresis using 1 % agarose gels (Ultra Pure Agarose, Invitrogen). mRNA-LNP production
[0334] Lipid nanoparticles (LNPs) were formulated using the ionizable lipid SM-102, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and 1 ,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000). SM-102 was obtained from BroadPharm, and DSPC, cholesterol, and DMG-PEG 2000 were purchased from Avanti Polar Lipids (Alabaster, USA). LNPs encapsulating mRNA were prepared as previously described116. Lipid components (SM-102, DSPC, cholesterol, and DMG-PEG 2000) were dissolved in ethanol at a molar ratio of approximately 50:10:38.5:1.5, respectively, to obtain a total lipid concentration of 5-10 mM. Separately, mRNA was diluted in 25 mM sodium acetate buffer (pH 4.0) to achieve a final SM-102-to-mRNA weight ratio of 20:1. The ethanolic lipid solution and aqueous mRNA solution were combined using a T-Frlmp / ISG15_Nbs / 873
[0335] junction mixer at a volumetric flow ratio of 1 :3 (ethanol:aqueous) and a total flow rate of 20 mL min-1. Following mixing, the resulting LNP suspension was allowed to equilibrate and subsequently dialyzed against a 200- to 500-fold excess volume of 20 mM Tris buffer containing 9% (w / v) sucrose at pH 7.4. Particle size and zeta potential were determined using a Zetasizer Nano ZS (Malvern Instruments Ltd., Worcestershire, UK). LNP samples were diluted 1 :50 in 20 mM HEPES buffer (pH 7.4) prior to analysis.
[0336] mRNA encapsulation efficiency and concentration were assessed using the Quant-iT RiboGreen RNA Assay (ThermoFisher Scientific) according to the manufacturer’s instructions. For determination of total encapsulated mRNA, LNPs were diluted in TE buffer containing 1% (v / v) Triton X-100 (Sigma-Aldrich) and incubated for 10 min at 37 °C to disrupt the lipid particles and release the mRNA. Free (non-encapsulated) mRNA was quantified directly following dilution of intact LNPs in TE buffer. Formulated mRNA-LNPs were concentrated to final mRNA concentrations of 50-90 pg mL-1using centrifugal ultrafiltration devices with a 100 kDa molecular weight cut-off (Amicon). Concentrated formulations were aliquoted and stored at -80 °C until further use.
[0337] Mycobacterium tuberculosis infection in TH P-1 cells
[0338] THP-1 cells were seeded at 300,000 cells per well and differentiated into macrophages by incubation with 20 ng / mL PMA in THP-1 medium for 48 h, followed by a 2-day resting period. Differentiated macrophages were infected with DsRed-expressing Mycobacterium tuberculosis (Mtb-DsRed) at a multiplicity of infection of 2:1. After 3 h, extracellular bacteria were removed by washing the cells with warm PBS, the culture medium was replaced, and, where indicated, 1 pg of mRNA-lipid nanoparticles (mRNA-LNPs) encoding either an anti-GFP nanobody (NbGFP) or an anti-ISG15 nanobody (Nb61) was added. Control cells were left untransfected. After a total infection time of 48 h, cells were trypsinized, washed twice with cold PBS, and subjected to live / dead staining followed by two additional PBS washes. Flow cytometry was then performed to quantify the DsRed signal, and mean fluorescence intensity (MFI) was determined within the live-cell population as defined by the viability stain.
[0339] Bio-layer interferometry (BLi)
[0340] Bio-layer interferometry experiments were performed on an Octet R8 instrument (Sartorius) using Streptavidin (SA) biosensors (Sartorius, #18-5019). Assays were conducted at 25 °C in kinetics buffer (PBS pH 7.2, 0.1% BSA and 0.02% Tween-20). Biosensors were hydrated in BLI buffer for 10 min prior to use. Human ISG15 was prepared as previouslydescribed, with the addition of an AviTag for site-specific biotinylation. In vivo biotinylation was performed using an E. coli biotinylation kit (BPS BioScience, #27461) following the manufacturer’s protocol.Frlmp / ISG15_Nbs / 873
[0341] For kinetic analysis, SA biosensors were loaded with N-terminally biotinylated human ISG15 (C78S) and equilibrated in BLI buffer. Association was measured by exposing biosensors to Nb61 at concentrations ranging from 1.25 to 10 nM for 300 s, followed by dissociation in BLI buffer for 1000 s. Sensorgrams were reference-subtracted and fitted using a 1:1 binding model to determine equilibrium dissociation constants (KD) with Octet Analysis software (Sartorius). For the competition assay, biotinylated ISG15-loaded biosensors were exposed to an individual nanobody (1000 nM) for 240s to reach saturation, followed by a second association step of 240 s with a mixture containing the same nanobody (400 nM) and Nb61 (400 nM). Kinetics buffer served as the negative control. Real-time binding responses were recorded throughout the experiment. Binding responses of the nanobodies to ISG15 were compared to the negative control, and competitive or non-competitive interactions were determined as previously described. Nanobodies with a binding signal below 0.1 nm were excluded from the analysis. Data visualization was performed in GraphPad Prism 9.0.
[0342] EXAMPLE 1. Nanobody generation and selection.
[0343] Llama immunizations, nanobody library generation, phage display and selection assays were performed by VIB Nanobody Core as follows. A llama was subcutaneously injected on days 0, 7, 14, 21, 28 and 35, with 130 pg recombinant human ISG15, SEQ ID NO: 46 (amino acids 2-157 with C78S mutation of mature human ISG15). The adjuvant used was Gerbu adjuvant P (3111 , Gerbu). On day 40, 100 ml anticoagulated blood was collected from the llama for lymphocyte preparation. Total RNA from peripheral blood lymphocytes was extracted and used as template for first strand cDNA synthesis with an oligo(dT) primer. Usingthis cDNA, the nanobody-encodingsequences were amplified by PCR, digested with SAPI, and cloned into the SAPI sites of the phagemid vector pMECS-GG. Electro-competent E. coli G cells were transformed with the recombinant pMECS-GG vector resulting in a nanobody library of 3x108independent transformants.
[0344] The resulting TG1 library stock was infected with VCS M13 helper phages to obtain a library of nanobody-presenting phages. The library was panned on solid-phase coated recombinant human ISG15 (100 pg / ml in 100 mM NaHCO3(pH 8.2)) for 3 rounds. The enrichment for antigen-specific phages was assessed after each round of panning by comparing the number of phagemid particles eluted from antigen-coated wells with the number of phagemid particles eluted from negative control (uncoated blocked) wells. Enrichment after each panning round was determined by infecting TG1 cells with 10-fold serial dilutions of the collected phages after which the bacteria were plated on LB agar plates with 100 mg / mL ampicillin and 1% glucose. In total, 190 colonies (95 from round 2 and 95 from round 3) were randomly selected and analyzed by ELISA for the presenceFrlmp / ISG15_Nbs / 873
[0345] of ISG15-specific nanobodies in their periplasmic extracts. Positive clones were selected for sequencing using the MP057 primer (5’-TTATGCTTCCGGCTCGTATG-3’, SEQ ID NO: 47), revealing 57 unique anti-ISG15 nanobodies across 41 distinct CDR3 groups (Figure 1A).
[0346] Periplasmic extracts from positive clones were further analyzed using bio-layer interferometry (BLI) to determine the nanobodies' Koffrates. Biotinylated recombinant human ISG15 (5 pg / mL), obtained via in vitro biotinylation with EZ-Link® NHS-Biotin as per manufacterer’s instructions (20217, ThermoFisher Scientific), was immobilized onto Octet streptavidin-coated (SA) tips (Sartorius) for 120s, yielding 1.8 nm units of immobilized protein. A 96-well black plate was prepared containing 200 pLof periplasmic extract per well mixed with 2 p Lof 10% Tween-20 in PBS. A blank sample (a periplasmic extract from an E. coli containing the empty pMECS-GG vector) was used as negative control. The plate was loaded into a Fortebio Octet Red (Sartorius) and brought into contact with the hlSG15-coated Octet tips. Following, the binding profile for each nanobody clone was determined. Using the Fortebio Data Analysis Software (Sartorius), the blanks were subtracted and the curves were aligned. Based on these curves, the Koffrates were calculated using a 1 :1 binding model. Data visualization was performed in GraphPad 9.0. Using this approach, 14 nanobodies (Figure 1B-C) were selected as prominent ISG15 binders for further characterization, based on a combination of properties such as low presence of PTM motifs, high PE-ELISA value, and low Koffrate. These nanobodies include Nb4, Nb8, Nb24, Nb32, Nb37, Nb42, Nb51, Nb54, Nb57, Nb61, Nb68, Nb85, Nb88, Nb95.
[0347] EXAMPLE 2. Purification of ISG15-binding nanobodies.
[0348] In order to expresstheanti-ISG15 nanobodies in E. coli, the nanobody DNA sequences were cloned into the pVDS105 expression vector (VIB Discovery Sciences). In this vector, the nanobody sequences contain a C-terminal 6xHis-tag under the control of the T7 / ac promotor and are fused in-frame with a pelB leader sequence for periplasmic targeting. The vector contains a kanamycin resistance marker for bacterial selection. The nanobody DNA sequences were synthesized as gBlocks™ Gene Fragments (IDT) after preliminary humanization and codon-optimization for E. coli expression. The sequences were amplified by PCR using the forward primer (5’-ACTTGAAGACCAATTGGTGGAGTCT-3’; SEQ ID NO: 48) and the reverse primer (5’-ACTTGAAGACCGGAGGAGACCGTGACCAGGGT-3’; SEQ ID NO: 49), then cloned into the pVDS105 vector using the GenBuilder™ Cloning Kit (L00701, Bio-Rad) according to the manufacturer's instructions. The recombinant vectors were transformed into E. coli TG1 DUO cells (60502-1, LGC Biosearch Technologies) by electroporation at 1800V using a Gene Pulser electroporator (Bio-Rad). Transformed cells were plated on LB agar plates (22700025, ThermoFisher Scientific)Frlmp / ISG15_Nbs / 873
[0349] supplemented with 2% glucose (w / v) and kanamycin (50 pg / mL) for selection. Sequence-verified clones were stored as glycerol stocks at -80°C until further use.
[0350] One clone of each construct was inoculated in 5 mL of TB medium (HP61.2, Carl Roth) supplemented with 0.8% glycerol (w / v) and kanamycin (50 pg / mL) and incubated overnight at 37°C while rotating at 250 rpm. The next day, the overnight culture was diluted 1 :50 in TB auto-induction medium (TB medium supplemented with 5% glycerol (w / v), 0.5% glucose (w / v), 2% lactose (w / v), 3 mM MgSO4) and incubated for 2h at 37°C while rotating at 250 rpm. The temperature was reduced to 30°C and the samples were incubated for an additional 26h while rotating (250 rpm). Cells were harvested by centrifugation at 4°C for 20’ at 4,000g and the pellets were stored overnight at -20°C. Periplasmic extracts were prepared after resuspending the pellet in PBS and incubating head-over-head at 4°C for 1 h. The peri lasmic extract was isolated after centrifugation at 4°C for 20’ at 10,000g and filtered over a 0.22 pm membrane using a Merck Steriflip™ Tube Top Vacuum Filter Unit (10304443, ThermoFisher Scientific).
[0351] For purification of the nanobodies, the periplasmic extracts were mixed 25:1 with binding buffer (20 mM NaH2PO4.H2O (pH 7.4), 500 mM Imidazole, 0.5 M NaCl) and loaded onto Nickel-Sepharose 6FF OPUS® RoboColumns® (29714914, Cytiva) for automated IMAC purification using the Flexible JANUS® G3 Automated Workstation (PerkinElmer). The columns were washed with 12 column volumes IMAC wash buffer (20 mM NaH2PO4.H2O (pH 7.4), 20 mM Imidazole, 0.5 M NaCl) and the bound nanobodies eluted with 2.4 column volumes IMAC elution buffer (20 mM NaH2PO4.H2O (pH 7.4), 250 mM Imidazole, 0.5 M NaCl). Fractions containing the nanobodies were pooled and desalted using PD MiniTrap™ G-25 columns (28-9180-07, VWR). The concentration was defined at 1 mg / mL or higher using Pierce™ Protein Concentrators PES 3K MWCO (88515, ThermoFisher Scientific).
[0352] The expression and monoisotopic mass of the purified nanobodies, as determined by intact mass spectrometry, are shown in Figure 2, from which we can conclude that all Nbs are highly pure and the mass is in correspondence with the expected theoretical mass for the monovalent Nb.
[0353] EXAMPLE 3. Binding properties of ISG15 nanobodies.
[0354] Nanobody cloning into a mammalian expression vector
[0355] In order to express the anti-ISG15 nanobodies in human cells, the nanobody DNA sequences were cloned into the pCSF107mT-GATEWAY-3’-3HA expression vector (67616, Addgene). In this vector, the nanobody sequences contain a C-terminal 3xHA-tag under the control of a constitutive CMV promotor. The vector contains an ampicillin resistance marker for bacterial selection. In addition, nanobody GFP and nanobody 61 DNA sequences were cloned into the pCSF107mT-GATEWAY-3'-Frlmp / ISG15_Nbs / 873
[0356] FLAG expression vector (67619, Addgene). In this vector, the nanobody sequences contain a C-terminal 3xFLAG-tag under the control of a constitutive CMV promotor. The vector contains an ampicillin resistance marker for selection in bacteria The nanobody DNA sequences were synthesized as gBlocksTM Gene Fragments (IDT) with 5’ and 3’ attB sites after preliminary humanization and codon-optimization for human expression. The sequences were amplified by PCR using the following forward (5’-GGGGAC AAGTTTGTACAAAAAAGCAGGCTCCGCCACCATGGAGGTGCAATTGGTGGAGTC-3’; SEQ ID NO: 50) and reverse (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTGAGGAGACGGTGACCAG-3’; SEQ ID NO: 51) primer and cloned sequentially into the pDNOR™ 221 entry vector (12536017, ThermoFisher Scientific) and pCSF107mT-GATEWAY-3’-3HA or or pCSF107mT-GATEWAY-3'-FLAG destination vector by Gateway™ cloning (12535029, ThermoFisher Scientific), following manufacturer’s instructions. The recombinant vectors were transformed into E. coli Stellar™ competent cells (636763, Takara Bio) by heat-shock transformation according to manufacturer’s instructions. Transformed cells were plated on LB agar plates (22700025, ThermoFisher Scientific) supplemented with kanamycin (50 pg / mL) or carbenicillin (50 pg / mL) for selection. Sequence-verified clones were stored as glycerol stocks at -80°C until further use. Plasmids were purified using the QIAprep Spin Miniprep Kit (27104, Qiagen).
[0357] GST-ISG15 pulldown of recombinant nanobodies
[0358] Pierce™ Glutathione Magnetic Agarose Beads (ThermoFisher Scientific) were coated with GST or GST-ISG15 for 2 hours at 4°C under agitation. The beads were washed three times in the pulldown buffer(PBS, pH=7), 0.5% Triton X-100, 1 mM PMSF(36978,ThermoFisherScientific), 1 mM protease inhibitor cocktail (4693132001 , Roche)) and incubated with 8 pg purified recombinant His-tagged nanobody overnight at 4°C in a rotator. Beads were recovered on a magnetic stand and washed three times in the pulldown buffer followed by elution in 2x Laemmli SDS sample buffer (ThermoFisher Scientific) supplemented with 50 mM DTT for 10’ at 95°C. Eluates were fractionated by SDS-PAGE and visualized using SimplyBlueTM SafeStain (LC6060, ThermoFisher Scientific). Nanobody pulldown of recombinant ISG15
[0359] Magnetic nickel-charged nitrilotriacetic acid agarose beads (Ni-NTA, 78605, ThermoFisher Scientific) were equilibrated in wash buffer (50 mM NaH2PO4(pH=8.4), 300 mM NaCl, 20 mM imidazole, 0.05% Tween 20) and mixed with 15 pg of His-tagged nanobody overnight at 4°C under agitation. Following immobilization, the beads were washed once in wash buffer and incubated with 15 pg of recombinant human ISG15 (VIB Protein Core) for 1 h at 4°C while rotating. Afterwards, the beads were washed three times with the wash buffer and mixed with 2x Laemmli SDS sampleFrlmp / ISG15_Nbs / 873
[0360] buffer (ThermoFisher Scientific) supplemented with 50 mM DTT for 10’ at 95°C. Finally, the beads were precipitated with a magnet and the supernatants were analyzed by immunoblotting.
[0361] Enzyme-linked immunosorbent assay (ELISA)
[0362] Wells of microtiter plates (type II, F96 MaxisorpTM, Nunc) were coated overnight at 4°C with 50 ng recombinant untagged human ISG15 (VIB Protein Core) or recombinant FLAG-tagged mouse ISG15 (prepared as described previously117in 100 mM NaHCO3(pH 8.2). Coated plates were blocked with 5% BSA in TBS-T (20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.05% Tween-20) for 1 h at RT. A dilution series of the nanobodies was added to the wells and incubated for 1 hour at RT. Binding was detected by incubating the plates sequentially with mouse anti-Histidine Tag antibody (1:1000, clone AD1.1.10, Bio-Rad) and horseradish peroxidase (HRP)-linked anti-mouse IgG (1:2000, 554066, BD Biosciences). The absorbance at 450 nM was measured with an iMark Microplate Absorbance Reader (Bio-Rad) after adding 40 pL of tetramethylbenzidine (TMB) substrate reagent (DY999, R&D Systems) and stopping the reaction with 30 pL 1M H2SO4(DY999, R&D Systems). Curve fitting and affinity constant determination (KD) were performed using non-linear regression (GraphPad 9.0).
[0363] Binding properties of the 14 selected nanobodies are shown in Figure 3. . From the pull down and ELISA we conclude that Nb4, Nb8, Nb24, Nb32, Nb37, Nb42, Nb51, Nb54, Nb57, Nb61, Nb68, Nb85, Nb88, Nb95 bind human ISG15. Any differences in Nb binding between the pulldown assay and ELISA may be attributed to the distinct mobilization requirements for each technique. Furthermore, kinetic properties of Nb61-ISG15 interaction were defined using BLI, confirmingthat Nb61 binds to ISG15 with a favorable profile (Figure 13).
[0364] EXAMPLE 4. Anti-ISG15 nanobodies reduce intracellular ISG15-USP18 interaction in a nanoBRET assay.
[0365] The nanoBRET protocol was performed according to manufacturer’s instructions with minor modifications (N1821 , Promega). Briefly, HEK293T cells were seeded ata density of 8 x 105cells per well of a 6-well plate (SDT-83.3920.300, JangoCell). The next day, cells were transfected with PEI using combinations of plasmids encoding NanoLuc®-hUSP18 and HaloTag®-ISG15 (acceptor-to-donor ratio of 0.3:1) and a plasmid encoding HA-ISG15, nanobody or mock control plasmid. Twenty-four hours after transfection, cells were trypsinized and resuspended in Opti-MEM™ I Reduced Serum Medium, without phenol red (11058021 , ThermoFisher Scientific) supplemented with 4% FBS and 1% penicillin / streptomycin (15070063, ThermoFisher Scientific) at a density of 2.2 x 105cells per mL. Cells were divided into two pools and either 100 nM HaloTag® NanoBRET™ 618 Ligand (G9801 , Promega) or 0.1% DMSO was added prior to re-plating the cells at a density of 2.2 xFrlmp / ISG15_Nbs / 873
[0366] 104cells per well in a white Nunc™ MicroWell™96-well plate (136101 , ThermoFisher Scientific). The next day, a 5x working solution of NanoBRET™ Nano-Gio® Substrate (N1571, Promega) was prepared in Opti-MEM™ I Reduced Serum Medium (no phenol red), and 25 pL was added to each well. The plate was mixed for 30” on an orbital shaker and analyzed on a Spark® multimode microplate reader(Tecan). Donor(460 nm)and acceptor(618 nm)emissionswere measured within 10 minutes of substrate addition. Raw nanoBRET ratios were determined by dividing the acceptor and donor emission values and multiplying by a factor of 1 ,000. For each experimental condition, the nanoBRET ratio was calculated using the average of three technical replicates followed by subtraction of a no-Halo control. The experiment was performed three times and the results were analyzed in GraphPad Prism 9.0 after normalizing the nanoBRET ratios to the mock control condition.
[0367] The following 9 nanobodies were shown to reduce the intracellular interaction between ISG15 and USP18: Nb61, Nb57, Nb88, Nb32, Nb37, Nb95, Nb4, Nb8, Nb42 (Figure 4).
[0368] In accordance with these data, all of these Nbs were shown to bind to intracellular ISG15 inside HEK293T cells using a co-immunoprecipitation assay (Figure 14A). Additionally, Nb61 was confirmed to bind to intracellular ISG15 inside HeLa cells treated with IFNato induce ISGylation (Figure 14B-C).
[0369] EXAMPLE 5. Selected ISG15-binding nanobodies counteract Listeria infection in vitro.
[0370] Listeria monocytogenes EGD (BUG600 strain) was grown in the brain heart infusion (BHI) medium at 37 °C. The strain was cultured overnight and then sub-cultured 1 :10 in BHI medium at 37 °C until GD600 ~1 was reached. Bacteria were washed three times in PBS (14040-133, ThermoFisher Scientific) and resuspended in medium without FBS prior to infection. Meanwhile, HeLa cells were seeded in 12-well tissue culture plates (ThermoFisher Scientific) at 150,000 cells / mL. On the next day, the cells were transfected with plasmids encoding HA-tagged nanobodies complexed by PEI. Twenty-four hours after transfection, the cells were infected with Listeria monocytogenes EGD at a multiplicity of infection (MOI) of 25. Bacterial entry was allowed for 1 h at 37°C. Afterwards, the cells were washed once and grown further in DMEM with GlutaMAX™-! (31966021, ThermoFisher Scientific) supplemented with 10% fetal bovine serum and 50 pg / mL gentamicin (15750037, ThermoFisher Scientific) to kill extracellular bacteria. Twenty hours after infection, cells were washed twice in PBS and lysed in sterile milliQ to release intracellular bacteria. Colony-forming units (CFUs) were determined by serial dilution and plating on BHI agar.Frlmp / ISG15_Nbs / 873
[0371] In this assay, the following 6 nanobodies were shown to counteract Listeria infection: Nb42, Nb32, Nb37, Nb61, Nb4, Nb95 (Figure 5), supporting their use in the treatment of bacterial infections, as defined herewith.
[0372] EXAMPLE 6. In vitro delSGylation assay.
[0373] hlSG15-rhodamine was used as a substrate of hUSP18 and the release of rhodamine was measured by increase of fluorescence (excitation / emission, 485 / 535 nm) on a 96-well Spark® multimode microplate reader (Tecan Group Ltd). Twenty-seven nM hlSG15-rhodamine was incubated with 2.025 M nanobody at 75x excess for 30’ in the assay buffer (20 mM Na2HPO4pH=7.4, 150 mM KCl, 10 mM NaCl, 5% glycerol, 0.2 mg / mL BSAand 5 mM DTT) prior to addition of 2.85 nM hUSP18. The reaction progression was measured over 1 hour, and the initial velocities of rhodamine release were calculated between 5 and 25 minutes. The initial velocity in the absence of nanobodies (mock) was set as the maximum activity of USP18 (100%), with all other conditions normalized to this value.
[0374] As shown in Figure 6, Nb61, Nb25 and Nb54 were able to significantly reduce USP18-mediated delSGylation.
[0375] EXAMPLE 7. Structural data forthe Nb61-ISG15 complex.
[0376] For crystallization, Nb61 was added to the recombinant human ISG15 (SEQ ID NO: 46; VIB Protein Core) in 1.2 times molar excess and the complexwas concentrated to 23 mg / ml using Amicon Ultra 10 kDa cut-off centrifugal filter devices (UFC801008, UFC501008, Sigma). Crystallization screens were set up using the siting drop vapor diffusion technique, mixing 0.1 pl Nb61-ISG15 and 0.1 pl bottom solution. Crystals were grown from the ProPlex™ HT-96 crystallization screen (MD1-42, Molecular Dimensions) in 0.1 M magnesium acetate tetrahydrate, 0.1 M MPOS pH=7.5 and 12% (w / v) PEG8000. For X-ray data collection, crystals were flash-frozen in liquid nitrogen. X-ray data were collected on the i24 beamline at the Diamond Light Source synchrotron facility (Didcot, UK). X-ray data were processed using autoPROC118. The structure of the Nb61-ISG15 complex was solved usingthe automatic molecular replacement workflow in the CCP4 cloud119. The initial model was further build manually in Coot120and refined using phenix. refine121from the Phenix crystallogra hic software suite122. Data collection parameters, as well as processing and refinement statistics are shown in Table 3. Visual representations of the crystal structures were generated in the PyMOL Molecular Graphics System, Version 3.0, Schrodinger, LLC.Frlmp / ISG15_Nbs / 873
[0377] Table 3. Data collection statistics and refinement parameters for Nb61-ISG15.
[0378] < >
[0379]
[0380] Fobsand Fcaic are observed and calculated structure factor amplitudes
[0381]
[0382] om subset of the data excluded from the refinement
[0383] (c)Data in brackets are for the highest resolution shellFrlmp / ISG15_Nbs / 873
[0384] The previously published crystal structure of human ISG15 (PDB code 1Z2M) shows that ISG15 contains 2 ubiquitin-like domains, connected by a flexible linker123. Whereas crystals were set up for Nb61 in complexwith full length ISG15, there is no electron density forthe N-terminal domain of ISG15. The Nb61 -ISG15 crystal structure contains only the C-terminal domain of ISG15 (ISG15C). The asymmetric unit of the Nb61 -ISG15 crystals contains 2 copies of Nb61 and 2 copies of ISG15C (Figure 7A). In the crystal packing, a strain swap occurs between the C-terminal strands of 2 symmetry- related Nb61 molecules (Figure 7A), thereby completing each other’s immunoglobulin fold.
[0385] The interface between Nb61 and ISG15C is formed by residues of the 3 Nb61 CDR loops and residues of the ISG15C p2 strand, a1 helix and the loop between a1 and the p3 strand (Figure 7B).
[0386] The total buried surface area between the two molecules is 665 A2. Hydrogen bonds are formed between Nb61 Thr33 (CDR1 ) and Gln110 in ISG15C a1 , the side chains of Nb61 Thr52, Asn53 and Ser56 (CDR2) and the backbone of the ISG15C p2 strand residues Thr95 and Glu97, between the side chains of Nb61 Asn58 (CDR2) and Tyr96(CDR3) and the backbone of Gly113 and Leu114 at the end of ISG15C a1 and between the backbone of Nb61 TrplOO and the side chain of ISG15C Seri 12, also in a1 (Figure 7B). In addition, a salt bridge is formed between Nb61 Arg102 (CDR3) and ISG115C Asp119 and As 120, in the loop between a1 and P3.
[0387] These data indicate that Nb61 interferes with the interaction between ISG15 and USP18. Overlay of the Nb61-ISG15C and USP18-ISG15 (PDB code 5CHV) structures shows that, despite the fact that USP18 binds on the other side of ISG15C, Nb61 CDR2 hinders the binding of the finger domain of USP18 to ISG15C (Figure 7C). Specifically, Nb61 CDR2 clashes with residues Ser222 and Asp223 of the USP18 finger domain.
[0388] EXAMPLE 8. Selective ISG15-specific nanobodies downregulate ISG15-mediated IFN-y secretion from immune cells in vitro.
[0389] Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats obtained from healthy donors through the Belgian Red Cross. Ethical approval for the study was granted by the institutional review board of the Medical Ethics Committee at Ghent University (reference number GNZ-2022-0070). Buffy coats were diluted 1 :2 with PBS (Ca2+ / Mg2+-free) at room temperature and transferred into Leucosep tubes (Greiner) preloaded with Ficoll-Paque Plus (#17-1440-02, GE Healthcare). The tubes were centrifuged at 800g for 15 minutes at room temperature with the brakes off to separate the PBMC layer. The PBMC layer at the interphase was carefully collected, washed with PBS, and centrifuged at 250g to remove residual Ficoll-Paque. The resulting cell pelletFrlmp / ISG15_Nbs / 873
[0390] was resuspended in pre-warmed CTL-Test medium (#CTLT-005, ImmunoSpot), quantified, and utilized for downstream analyses.
[0391] Figure 8A shows the effect of ISG15-specifc nanobodies on interferon gamma (IFN-y) secretion from human PBMCs isolated as described above. Herein, the PBMCs were rested overnight in the CTL-Test medium supplemented with 2 mM L-Glutamine (#25030081, ThermoFisher) at a concentration of 1x106cells / mL. Rested cells were treated with 5 ng / mL recombinant human IL-12 (554613, BD BioSciences) and 3.6 pg / mL recombinant human ISG15 (12729-HNAE1, SinoBiological) for 48h. Anti-ISG15 and control nanobodies (11 pg / mL) were used as indicated in the Figure 8A. After 48 hours, supernatants were collected by centrifugation at 1 ,000g for 1 minute and assayed for IFN-y secretion using an ELISA kit (DY285B-05, R&D Systems), according to the manufacturer's instructions.
[0392] In summary, Nb95, Nb88, Nb68, Nb85, Nb61, Nb37, Nb42, and Nb32 were effective in reducing IFN-y secretion, indicating their potential therapeutic application in the treatment of autoimmune conditions. The assay was established as shown in Figure 8B.
[0393] EXAMPLE 9. ISG15-specific Nb61 is implied to block the ISG15-LFA1 interaction.
[0394] Lymphocyte function-associated antigen 1 (LFA-1) is a heterodimer composed of CD11a and CD18124. Previous studies have shown that ISG15 binds to LFA1 through interactions with CD11a45. To predict the effect of Nb61 on the ISG15-LFA1 interaction, we superimposed the Nb61-ISG15 crystal structure onto the Boltz 2-predicted model of the ISG15-CD11 a complex (Figure 9), as no experimental structure was available.
[0395] CD11a interacts with the C-terminal domain of ISG15 at a site overlapping with the Nb61 binding interface, including Tyr96 and Q102, which were previously shown to be important for CD11a binding and subsequent IFN-y signaling45. Specifically, the epitope of Nb61 overlaps with the CD11a-ISG15 interaction interface at the following ISG15 (SEQ ID NO: 45) residues: Arg92, Ser93, Ser94, Thr95, Tyr96, Glu97, Gln102, His106, Gln109, Gln110, Seri 12, Gly113, Leu114, Glu115, and Gly116. When bound to ISG15, Nb61 prevents CD11a interaction by sterically clashing with the a1 and a2 helix, and the 01, 02, 03, 04 and 05 strands (Figure 10). The importance of ISG15 residue Y96 (and Q102)forCD11a bindingwas also demonstrated in a study that established the molecular basis of ISG15's extracellular function via the LFA-1 receptor45. Of note, both Y96 and Q102 are part of Nb61 ’s epitope on ISG15.
[0396] EXAMPLE 10. The competitive binding of Nb61 versus other ISG15-specific nanobodies assessed using biolayer interferometry (BLI).Frlmp / ISG15_Nbs / 873
[0397] All experiments were performed at 30°C with agitation at 1000 rpm in kinetics buffer (PBS pH 7.2, 0.1% BSAand 0.02% Tween-20). Human ISG15 was prepared as previously described117, with the addition of an AviTag for site-specific biotinylation. In vivo biotinylation was performed using an E. coli biotinylation kit (BPS BioScience, #27461) following the manufacturer’s protocol. Biotinylated ISG15 was immobilized onto Octet streptavidin-coated (SA) biosensors (18-5019, Sartorius) at a concentration of 2.5 g / mL for 100 s, yielding 1.8 nm units of immobilized protein. For the competition assay, the first nanobody (1000 nM) was loaded onto the biosensor for 240 sto reach saturation, followed by a mixture of Nb61 (400 nM)and the first nanobody (400 nM)for an additional 240 s. Kinetics buffer served as the negative control. The assay was also performed in reverse order, where Nb61 was loaded first, followed by a mixture of the competing nanobody and Nb61. Realtime binding responses were recorded throughout the experiment. Binding responses of the nanobodies to ISG15 were compared to the negative control, and competitive or noncompetitive interactions were determined as previously described125. Nanobodies with a binding signal below 0.1 nm were excluded from the analysis. Data visualization was performed in GraphPad Prism 9.0 (Figure 11A-D).
[0398] The data obtained in this example indicate that Nb32 competes with Nb61 for ISG15 binding, suggesting the existence of an overlapping epitope between these two nanobodies.
[0399] EXAMPLE 11. Intracellular Nb61-mediated redistribution of ISG15to the nucleus.
[0400] Human HEK293T cells were transfected with a construct encoding GFP-tagged ISG15 in combination with either: (a) an empty vector control (mock), or (b) a construct encoding a V5-tagged Nb61 fused to an SV40 nuclear localization sequence (Nb61-NLS). Following transfection, cells were processed for fluorescence microscopy as described herewith. Cell nuclei were visualized by DAPI staining. GFP ISG15 fluorescence was detected in the green fluorescence channel. Expression of the Nb61 NLS construct was detected by immunofluorescence using an anti V5 primary antibody and an Alexa Fluor 568 conjugated secondary antibody, yielding a magenta fluorescence signal.
[0401] In cells transfected with GFP-ISG15 together with the mock control vector, GFP-ISG15 fluorescence was detected equally in the nucleus and cytoplasm. In contrast, in cells co-transfected with GFP-ISG15 and the Nb61-NLS construct, GFP-ISG15 fluorescence was detected to a substantially greater extent within the nuclear compartment (Figure 15A-B).
[0402] Correspondingly, the ratio of nuclear to cytoplasmic GFP-ISG15 fluorescence intensity was significantly higher in the Nb61 -NLS condition than in the mock control condition (Figure 15C).Frlmp / ISG15_Nbs / 873
[0403] This example demonstrates that expression of an ISG15-binding nanobody of this invention fused to a nuclear localization sequence results in a redistribution of ISG15 toward the nuclear compartment in mammalian cells. Accordingly, the data provide experimental support for the use of anti-ISG15 nanobody constructs as subcellular targeting agents capable of modulating the intracellular localization of ISG15.
[0404] EXAMPLE 12. Effect of an ISG15-binding nanobody on USP18 abundance and interferon-a signalling.
[0405] HEK293T cells were transfected with combinations of expression constructs encoding GFP-tagged human USP18, FLAG-tagged human ISG15, and eitheran HA-tagged anti-ISG15 nanobody (Nb61) or, as a non-targeting control, an HA-tagged anti-GFP nanobody (NbGFP). After 48 h, cell lysates were analysed by immunoblotting to determine the relative abundance of GFP-USP18, with expression of the respective constructs verified using antibodies specific for GFP, FLAG, and HA, and GAPDH used as a loading control (Figure 16A). Quantification of GFP-USP18 abundance across four independent repeats demonstrated a reduction in GFP-USP18 levels in cells expressing Nb61 compared with cells expressing the NbGFP control (Figure 16B). The Nb61-mediated reduction in GFP-USP18 abundance was observed both when ISG15 was overexpressed and without ISG15 overexpression. These data are consistent with interference in ISG15-dependent stabilization of USP18126.
[0406] Next, HeLa cells engineered to stably express either the HA-tagged anti-ISG15 Nb61 or the HA-tagged anti-GFP nanobody NbGFP were analysed for IFNa-induced signalling. Cells were either left untreated or subjected to a priming step with IFNa for 24h, followed by a resting period in the absence of IFNa (also for 24h). Cells were subsequently re-stimulated with IFNa as described herewith, and whole-cell lysates were analysed by immunoblotting for phosphorylated STAT1 (Tyr701), with HA used to verify nanobody expression and a-tubulin as a loading control (Figure 16C). Quantitative comparison of phospho-STAT1 levels in primed versus non-primed cells across three independent repeats showed that Nb61 -expressing cells exhibited a stronger IFNa-induced STAT1 phosphorylation response than the NbGFP control cells following IFNa re-stimulation (Figure 16D).
[0407] In this Example, it is demonstrated that expression of the ISG15-binding nanobody Nb61 is associated with a reduction in cellular USP18 abundance relative to a non-targeting nanobody control. Expression of Nb61 is associated with enhanced cellular responsiveness to repeated IFNa stimulation, as reflected by increased STAT1 phosphorylation. Expression of the ISG15-binding nanobody Nb61 counteracts the inhibitory effect of endogenous ISG15 on interferon signalling,Frlmp / ISG15_Nbs / 873
[0408] thereby enhancing cellular responsiveness to repeated IFNa stimulation and resulting in a stronger IFN-induced signalling output29. This heightened responsiveness is consistent with reduced USP18 stability (as shown herewith) and the resulting impairment of USP18 mediated negative feedback on IFN signalling. Together, these data show that intracellular binding of ISG15 by a nanobody / binder / modulator of this disclosure can modulate USP18 abundance and IFNa signalling output in mammalian cells.
[0409] EXAMPLE 13. Effect of Nb61 on intracellular Mycobacterium tuberculosis burden.
[0410] THP 1 macrophages were infected with DsRed expressing Mycobacterium tuberculosis (Mtb DsRed) for 3 hours at a multiplicity of infection (MOI) of 2. Following infection, the cells were transfected with mRNA-lipid nanoparticles (mRNA-LNPs) encoding either an anti ISG15 nanobody (Nb61), an anti GFP nanobody (NbGFP) as a non targeting control, or were left untransfected. After a total infection period of 48 hours, cells were lysed and intracellular bacteria were quantified by flow cytometric measurement of Mtb derived DsRed mean fluorescence intensity (MFI). For visualization, intracellular bacterial load was expressed as the percentage of the signal observed in untransfected cells.
[0411] As shown in Figure 17, cells expressing Nb61 exhibited a reduced intracellular bacterial signal compared with both untransfected cells and cells expressingthe anti GFP control nanobody. These data demonstrate that intracellular expression of a Nb / modulator of this invention is associated with a reduction in intracellular bacteria burden.
[0412] EXAMPLE 14. Effect of ISG15-binding nanobodies on SARS-CoV-2 infection in vitro.
[0413] SARS-CoV2 infection in HeLa cells
[0414] SARS-CoV-2 virus was isolated from a nasopharyngeal sample of a patient and the isolated virus was confirmed as SARS-CoV-2 by sequencing (Genbank accession number MT093571 ). The virus titer was determined by qRT-PCR targeting the SARS-CoV-2 Envelope (E) gene using Takara PrimeDirect probe qRT-PCR mix (RR650A, Takara Bio) and the following forward primer (5’-ACAGGTACGTTAATAGTTAATAGCGT-3’, SEQ ID NO:61), reverse primer (5’-ATATTGCAGCAGTACGCACACA-3’, SEQ ID NO: 62) and probe (5’- [FAM]ACACTAGCCATCCTTACTGCGCTTCG[BHQ1]-3’) (Eurofins). Thermal cycling conditions comprised an initial denaturation step at 90°C for 3 minutes, reverse transcription at 60°C for 5 minutes, followed by 45 amplification cycles of 95°C for 5 seconds and 58°C for 30 seconds. Relative quantification of viral copies was done by comparing to the serially diluted stock virus. HeLa cells stably expressing human angiotensin-converting enzyme 2 (hACE2) were seeded at a density of 4 * 105cells per well in 6-well culture plates. The next day, cells were transfected with 1Frlmp / ISG15_Nbs / 873
[0415] pg of plasmid DNA encoding ISG15-specific nanobodies (Nb32 or Nb61) or an anti-GFP control nanobody (NbGFP) using Li ofectamine™ 3000 transfection reagent (L3000015, ThermoFisher Scientific) at a reagent-to-DNA ratio of 2:1 , according to the manufacturer’s instructions. Twenty-four hours post-transfection, cells were infected with SARS-CoV-2 at a multiplicity of infection (MOI) of 0.1 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (FBS) for 1 hour at 37°C. Following removal of the viral inoculum, cells were maintained in virus-free DMEM containing 10% FBS foran additional24 hours.
[0416] At 24 hours post-infection, cells were lysed in TRI Reagent® (R2050-1-200, Zymo Research), and total RNA was isolated using the Direct-zol™ RNA Miniprep Kit (R2052, Zymo Research) in accordance with the manufacturer’s protocol. Complementary DNA (cDNA) was synthesized from total RNA using the High-Capacity cDNA Reverse Transcription Kit (4368814, Applied Biosystems) with incubation at 25°C for 10 minutes, 37°C for 120 minutes, and 85°C for 5 minutes. Quantitative PCRwas performed using Power SYBR™ Green PCR Master Mix (4368577, Applied Biosystems) with 100 nM of each primer under the following cycling conditions: 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Melting curves were obtained at the end, with conditions set at 95 °C for 15 seconds, 60 °C for 20 seconds, 95 °C for 15 seconds, ramping from 60 °C to 95 °C at 1 °C / second.
[0417] The SARS-CoV-2 E gene was amplified using the forward primer 5'-ACAGGTACGTTAATAGTTAATAGCGT-3' (SEQ ID NO: 64) and the reverse primer 5'-ATATTGCAGCAGTACGCACACA-3' (SEQ ID NO: 65). The human hypoxanthine phosphoribosyltransferase (HPRT) reference gene was amplified using the forward primer 5'-TCAGTCAACGGGGGACATAAA-3' (SEQ ID NO: 66) and the reverse primer 5'-GGGGCTGTACTGCTTAACCAG-3' (SEQ ID NO: 67). Each sample was analyzed in three technical qPCR replicates, and the mean cycle threshold (Ct) value was used for subsequent calculations. Relative viral RNA levels were determined by normalization of E gene Ct values to HPRT Ct values (ACt), followed by comparison to the NbGFP-infected control condition (AACt), and conversion to fold change values using the formula 2A-AACt in accordance with the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines. Statistical analysis was conducted on ACt values derived from five independent biological repeats.
[0418] This example illustrates the effect of intracellular ISG15-binding nanobodies of this disclosure on SARS-CoV-2 infection in a human cell model. HeLa cells engineered to express human ACE2 (HeLa hACE2) were transfected with an anti-GFP nanobody (NbGFP) as a non-targeting control or with anti-ISG15 nanobodies Nb32 or Nb61. After 24 hours, the cells were infected with SARS-CoV-2 ata multiplicity of infection (MOI) of 0.1. Following infection, cells were incubated for an additional 24Frlmp / ISG15_Nbs / 873
[0419] h. Viral RNA levels were quantified by quantitative PCR (qPCR) targeting the SARS-CoV-2 E gene, using HPRT as the reference gene.
[0420] As shown in Figure 18, cells expressing the anti-ISG15 nanobodies Nb32 or Nb61 exhibited a reduction in SARS-CoV-2 E-gene expression relative to cells expressing the anti-GFP control nanobody, confirming the anti-viral properties of the Nanobodies / modulators of this disclosure.
[0421] EXAMPLE 15. Effect of the ISG15-binding Nb61-Fc fusion on ISG15-driven cytokine secretion in human PBMCs.
[0422] Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats and processed for downstream analysis as described above. The PBMCs were rested overnight in the CTL-Test medium supplemented with 2 mM L-Glutamine (25030081 , ThermoFisher) at a concentration of 1 x 106cells / mL. Rested cells were treated with 6.67 ng / mL recombinant human IL-12 (554613, BD BioSciences) and 6.67 pg / mL recombinant human ISG15 (12729-HNAE1, SinoBiological) for48h. Anti-ISG15 Nb61 -Fc fusion (SEQ ID NO: 72) (66.7 pg / mL) were used as indicated in Figure 19. After 48 hours, supernatants were collected by centrifugation at 1000 g for 1 minute and assayed for pro-inflammatory cytokine secretion using the LEGENDplex™ Human Inflammation Panel 1 with V-bottom Plate (740809, Biolegend) and analyzed with the LEGENDplex™ Data Analysis Software (Biolegend), according to the manufacturer’s instructions.
[0423] Construction and production of a Nb61-Fc fusion construct:
[0424] A nucleic acid construct encoding an Nb61 -Fc fusion protein was generated as follows. A synthetic double-stranded DNA fragment was designed comprising, in 5' to 3' orientation: (i) a consensus eukaryotic Kozak sequence, (ii) a mammalian secretion signal sequence corresponding to the murine IgK leader sequence (amino acid sequence: MGWSCIIFFLVATATGVHS, SEQ ID NO: 68), (iii) the coding sequence of Nb61 , (iv) a composite linker comprising three repeats of the amino acid sequence EAAAK (SEQ ID NO: 69) followed by three repeats of the amino acid sequence GGGGS (SEQ ID NO: 70), and (v) a human IgGI Fc domain. The Fc domain included L234A, L235A, and P329G substitutions (LALAPG, SEQ ID NO: 71 ) and a deletion of the hinge-region cysteine residue to reduce Fc-mediated effector function and prevent undesired interchain disulphide bond formation. The fusion construct was synthesized as a double-stranded DNA fragment (gBlock, IDT) and cloned into the pcDNA3.4 TOPO-TA expression vector using the pcDNA3.4 TOPO-TA Kit (A14697, ThermoFisher Scientific) in accordance with the manufacturer’s instructions, thereby generating a recombinant pcDNA3.4-Nb61 -Fc expression plasmid.
[0425] Nb-Fc fusions were expressed in HEK293S cells. Briefly, a 100 mL culture of 1.5 x 106cells per mL was transfected with 225 pg plasmid DNA encoding Nb61-Fc, using PEI at at a DNA:PEI ratio of 1 :3Frlmp / ISG15_Nbs / 873
[0426] (w / w). Productions were collected as soon as cell viability dropped below75% by pelletingthe cells and filtering the supernatant through a 0.22 pm bottle top filter. Cleared supernatants were stored at -20°C until further processing. For purification of the Nb-Fc fusions, supernatants were loaded on a 5 mL MAbSelect SuRe column (GE Healthcare). Unbound proteins were washed away with Mcllvaine buffer pH 7.2, and bound proteins were eluted using Mcllvaine buffer pH 3. Immediately after elution, protein-containing fractions were neutralized using a saturated (0.8M) Na3PO4solution. Next, these fractions were pooled, and loaded on a Superdex20016 / 600 column for buffer exchange to storage buffer (PBS pH 7.4). Purified Nb-Fc fusions were batched out, snap frozen in liquid N2and stored at -80°C until further use.
[0427] As shown in Figure 19, stimulation of PBMCs with IL-12 and ISG15 resulted in increased secretion of several proinflammatory cytokines, including IFN-y, TNF-a, IL-6, and IL-10, compared with untreated cells. Addition of the Nb61-Fc fusion protein downregulated the secretion of these cytokines under the tested conditions. These data demonstrate that Nanobodies / modulators disclosed herewith show efficacy in downregulating pro-inflammatory responses and therefore are suitable as therapeutic agents for inflammatory and autoimmune diseases.
[0428] Although IL-10 is classically regarded as an anti-inflammatory cytokine, it exerts pro-inflammatory functions in autoimmune settings, for example by sustaining extrafollicular humoral responses and, in interferon-primed milieus, by shifting toward STAT1 -biased activation programs127. In systemic lupus erythematosus (SLE), IL-10-producing CCR6+B helper CD4 T cells are expanded and provide IL-10-dependent help to B cells outside germinal centers, thereby promoting IgG production, including anti-dsDNA autoantibodies, and the generation of autoreactive plasma cells128. A SLE-focused review concluded that IL-10, while suppressing certain effector pathways, concomitantly drives extrafollicular B-cell differentiation and autoantibody production in lupus129. Accordingly, IL-10 may be considered a driver of B-cell responses in SLE. Further supporting this concept, in NZB / W F1 mice, continuous administration of anti-IL-10 antibodies delayed the onset of autoimmunity and improved survival, whereas exogenous IL-10 accelerated disease onset, providing direct evidence that IL-10 can be pathogenic in autoimmune conditions130. Clinically, serum IL-10 levels are elevated in SLE and are associated with both current and future disease activityin longitudinal cohorts131. Beyond SLE, IL-10can also facilitate pathogenic T-cell trafficking; for example, in autoimmune neuropathy, IL-10-STAT3 signaling upregulates S1 PR1 expression on CD4 T cells, enhancing lymph node egress and nerve infiltration and thereby exacerbating demyelinating disease132. Consistent organ-specific associations have also been reported, including elevated IL-10 levels in patients with intractable Graves’ disease, in line with IL-10-supported B-cell survival and class switching, as well as overexpression of IL-10 by mucosalFrlmp / ISG15_Nbs / 873
[0429] T cells in ulcerative colitis despite ongoing inflammation. Collectively, these observations underscore that the cellular source, interferon priming, and tissue context determine whether I L-10 mediates resolution or propagation of autoimmune pathology133134.
[0430] EXAMPLE 16. Structural data for the Nb88-ISG15 complex.
[0431] For crystallization, Nb88 was added to recombinant human ISG15 (SEQ ID NO: 46; VIB Protein Core) in 1.2 times molar excess and the complexwas concentrated to 22 mg / ml using Amicon Ultra 10 kDa cut-off centrifugal filter devices (UFC801008, UFC501008, Sigma). Crystallization screens were set up using the siting drop vapor diffusion technique, mixing 0.1 pl Nb88-ISG15 and 0.1 pl bottom solution. Crystals were grown at 20°C from the PACT Premier™ HT-96 crystallization screen (MD1-36, Molecular Dimensions) in 0.1 M PCTP buffer (sodium propionate, sodium cacodylate trihydrate, Bis-Tris propane) pH 9.0 and 25%(w / v) PEG1500. ForX-raydata collection, crystals were flash frozen in liquid nitrogen. X-ray data were collected on the Proxima 1 beamline at the Soleil synchrotron facility (Saint-Aubin, France). X-ray data were processed using autoPROC135’136135136. The structure of the Nb88-ISG15 complexwas solved by molecular replacement using the Phaser program138from the Phenix crystallographic software suite122. PDB 6QX4 was used as a model for Nb88, whereas PDB 3RT3 was used as a model for ISG15. The initial model was first build automatically using AutoBuild137from the Phenix crystallogra hic software suite and then further manually build in Coot120, and refined using phenix. refine121from the Phenix crystallographic software suite. Data collection parameters, as well as processing and refinement statistics are shown in Table 4. Visual representations of the crystal structures were generated in The PyMOL Molecular Graphics System, Version 3.0 Schrodinger, LLC.
[0432] Table 4. Data collection statistics and refinement parameters for Nb88-ISG15
[0433]
[0434] Frlmp / ISG15_Nbs / 873
[0435] < >
[0436]
[0437] Frlmp / ISG15_Nbs / 873
[0438] and Fcaicare observed and calculated structure factor amplitudes
[0439]
[0440] subset of the data excluded from the refinement
[0441] (c)Data in brackets are for the highest resolution shell
[0442] Nb88 binds the N-terminal domain of ISG15 (ISG15N). The interface is formed by residues of the three Nb88 CDR loops and framework 3 (FR3) residues in the loop between the p6 and p7 strands, and residues of the ISG15N pi and p2 strands, theal helix and the first residues of the linker to the ISG15 C-terminal domain (Figure 20). The total buried surface area between the two molecules is 661 A2. Hydrogen bonds are formed between the backbones of Nb88 Ile28 (CDR1) and Gln16 in ISG15N P2, the backbone of Nb88 Trp53 (CDR2) and the sidechain of Asn13 in the ISG15N P2 strand, between the side chain of Nb88 Asn77 (FR3) and the backbone of Alai 1 in the loop between the ISG15N pi and p2 strands, and between the sidechains of Nb88 Tyr106 (CDR3) and ISG15N Lys77 in the linker to the ISG15 C-terminal domain (Figure 21). The backbone of Nb88 Tyr106 is also H-bonded to the backbone of Ile36 in the ISG15N a1 helix. In addition, salt bridges are formed between Nb88 Glu29 (CDR1) and ISG115N Lys35, and Nb88 Arg27 (CDR1) and ISG15N Asp4. According to these data, the Nb88 binding epitope on human ISG15 (SEQ ID NO: 45) comprises the following amino acid residues: Asp4, Lys8, Met9, Leu10, Alai 1, Gly12, Asn13, Glu14, Phe15,Gln16, Val17, Ser18, Thr33, Gln34, Lys35, Ile36, Gly37, Val38, Val75, and Lys77. The paratope of Nb88 (SEQ ID NO: 37) involved in bindingto human ISG15 consists of the following amino acid residues: Arg27, 1 le28, Glu29, Asn30, Leu31 , Tyr32, Trp53, Ser54, Met57, Lys75, Asn77, Ala78, Asn80, Seri 04, Tyr105, Tyr106, Ser107, and Arg109.Frlmp / ISG15_Nbs / 873
[0443] REFERENCES
[0444] 1. ChangYG, YanXZ, Xie YY, etal. Different Roles for Two Ubiquitin-like Domains of ISG15 in Protein Modification *. Journal of Biological Chemistry. 2008;283(19):13370-13377. doi: 10.1074 / jbc.M800162200
[0445] 2. dos Santos PF, Mansur DS. Beyond ISGlylation: Functions of Free Intracellular and Extracellular ISG15. Journal of Interferon & Cytokine Research. 2017;37(6):246-253. doi:10.1089 / jir.2016.0103
[0446] 3. Molecular basis for ubiquitin and ISG15 cross-reactivity in viral ovarian tumor domains | PNAS. Accessed February 18, 2025. https: / / www.pnas.org / doi / full / 10.1073 / pnas.1015287108 4. Blomstrom DC, Fahey D, Kutny R, Korant BD, Knight E. Molecular characterization of the interferon-induced 15-kDa protein. Molecularcloningand nucleotide and amino acid sequence. J Biol Chem. 1986;261 (19) :8811 -8816.
[0447] 5. Knight E, Fahey D, Cordova B, et al. A 15-kDa interferon-induced protein is derived by COOH- terminal processing of a 17-kDa precursor. J Biol Chem. 1988;263(10):4520-4522.
[0448] 6. Kang JA, Kim YJ, Jeon YJ. The diverse repertoire of ISG15: more intricate than initially thought. Exp Mol Med. 2022;54(11 ):1779-1792. doi: 10.1038 / s12276-022-00872-3
[0449] 7. Yuan W, Krug RM. Influenza B virus NS1 protein inhibits conjugation of the interferon (IFN)- induced ubiquitin-like ISG15 protein. EMBOJ. 2001;20(3):362-371. doi:10.1093 / emboj / 20.3.362 8. Mossman KL, Macgregor PF, Rozmus JJ, Goryachev AB, Edwards AM, Smiley JR. Herpes simplex virus triggers and then disarms a host antiviral response. J Virol. 2001;75(2):750-758. doi:10.1128 / JVI.75.2.750-758.2001
[0450] 9. Nicholl MJ, Robinson LH, Preston CM. Activation of cellular interferon-responsive genes after infection of human cells with herpes simplex virus type 1. J Gen Virol. 2000;81(Pt 9):2215-2218. doi:10.1099 / 0022-1317-81-9-2215
[0451] 10. Malakhova OA, Yan M, Malakhov MP, et al. Protein ISGylation modulates the JAK-STAT signaling pathway. Genes Dev. 2003;17(4):455-460. doi: 10.1101 / gad.1056303
[0452] 11. Kim KI, Malakhova OA, Hoebe K, Yan M, Beutler B, Zhang DE. Enhanced antibacterial potential in UBP43-deficient mice against Salmonella typhimurium infection by up-regulating type I IFN signaling. J Immunol. 2005;175(2):847-854. doi:10.4049 / jimmunol.175.2.847 12. Perng YC, Lenschow DJ. ISG15 in antiviral immunity and beyond. Nat Rev Microbiol.
[0453] 2018;16(7):423-439. doi : 10.1038 / s41579-018-0020-5
[0454] 13. Haas AL, Ahrens P, Bright PM, Ankel H. Interferon induces a 15-kilodalton protein exhibiting marked homology to ubiquitin. J Biol Chem. 1987;262(23):11315-11323.
[0455] 14. Loeb KR, Haas AL. The interferon-inducible 15-kDa ubiquitin homolog conjugates to intracellular proteins. J Biol Chem. 1992;267(11):7806-7813.
[0456] 15. Speer SD, Li Z, Buta S, et al. ISG15 deficiency and increased viral resistance in humans but not mice. Nat Commun. 2016;7(1 ): 11496. doi:10.1038 / ncomms11496Frlmp / ISG15_Nbs / 873
[0457] 16. Zhang X, Bogunovic D, Payelle-Brogard B, et al. Human intracellular ISG15 prevents interferon-a / p over-amplification and auto-inflammation. Nature. 2015;517(7532):89-93. doi:10.1038 / nature13801
[0458] 17. Fan JB, Zhang DE. ISG15 regulates IFN-y immunity in human mycobacterial disease. Cell Res. 2013;23(2):173-175. doi:10.1038 / cr.2012.133
[0459] 18. Tecalco-Cruz AC, Zepeda-Cervantes J. Protein ISGylation: a posttranslational modification with implications for malignant neoplasms. Explor Target Antitumor Ther. 2023;4(4):699-715. doi:10.37349 / etat.2023.00162
[0460] 19. Radoshevich L, Impens F, Ribet D, et al. ISG15 counteracts Listeria monocytogenes infection. eLife. 4:e06848. doi:10.7554 / eLife.06848
[0461] 20. Morales DJ, Lenschow DJ. The Antiviral Activities of ISG15. J Mol Biol. 2013;425(24):4995- 5008. doi:10.1016 / j.jmb.2013.09.041
[0462] 21. Frias-Staheli N, Giannakopoulos NV, Kikkert M, et al. Ovarian Tumor Domain-Containing Viral Proteases Evade Ubiquitin- and ISG15-Dependent Innate Immune Responses. Cell Host& Microbe. 2007;2(6):404-416. doi:10.1016 / j.chom.2007.09.014
[0463] 22. Jimenez Fernandez D, Hess S, Knobeloch KP. Strategies to Target ISG15 and USP18 Toward Therapeutic Applications. Front Chem. 2020;7:923. doi:10.3389 / fchem.2019.00923
[0464] 23. Ratia K, Kilianski A, Baez-Santos YM, Baker SC, Mesecar A. Structural Basis for the Ubiquitin- Linkage Specificity and delSGylating Activity of SARS-CoVPa ain-Like Protease. PLOS Pathogens. 2014;10(5):e1004113. doi:10.1371 / journal.ppat.1004113
[0465] 24. Malakhov MP, Malakhova OA, Kim KI, Ritchie KJ, Zhang DE. UBP43 (USP18) specifically removes ISG15 from conjugated proteins. J Biol Chem. 2002;277(12):9976-9981. doi:10.1074 / jbc.M109078200
[0466] 25. Malakhova OA, Kim KII, Luo JK, et al. UBP43 is a novel regulator of interferon signaling independent of its ISG15 isopeptidase activity. EMBO J. 2006;25(11):2358-2367. doi:10.1038 / sj.emboj.7601149
[0467] 26. Qiu X, Taft J, Bogunovic D. Developing Broad-Spectrum Antivirals Using Porcine and Rhesus Macaque Models. J Infect Dis. 2020;221(6):890-894. doi: 10.1093 / infdis / jiz549
[0468] 27. Honke N, Shaabani N, Zhang DE, Hardt C, Lang KS. Multiple functions of USP18. Cell Death Dis. 2016;7(11):e2444. doi:10.1038 / cddis.2016.326
[0469] 28. Londe AC, Fernandez-Ruiz R, Julio PR, Appenzeller S, Niewold TB. Type I Interferons in Autoimmunity: Implications in Clinical Phenotypes and Treatment Response. The Journal of Rheumatology. 2023;50(9):1103-1113. doi:10.3899 / jrheum.2022-0827
[0470] 29. Vasou A, Nightingale K, Cetkovska V, et al. ISG15-Dependent Stabilisation of USP18 Is Necessary but Not Sufficient to Regulate Type I Interferon Signalling in Humans. Eur J Immunol.
[0471] 2025;55(2):e202451651. doi: 10.1002 / eji .202451651
[0472] 30. Isaacs A, Lindenmann J. Virus interference. I. The interferon. Proc R Soc Lond B Biol Sci.
[0473] 1957;147(927):258-267. doi:10.1098 / rspb.1957.0048Frlmp / ISG15_Nbs / 873
[0474] 31. Gray PW, Goeddel DV. Structure of the human immune interferon gene. Nature.
[0475] 1982;298(5877):859-863. doi:10.1038 / 298859a0
[0476] 32. Mycobacterial Disease and Impaired IFN-y Immunity in Humans with Inherited ISG15 Deficiency | Science. Accessed February 18, 2025. https: / / www.science.Org / doi / 10.1126 / science.1224026
[0477] 33. Kelchtermans H, Billiau A, Matthys P. How interferon-gamma keeps autoimmune diseases in check. Trends Immunol. 2008;29(10):479-486. doi:10.1016 / j.it.2008.07.002
[0478] 34. Pollard KM, Cauvi DM, Toomey CB, Morris KV, Kono DH. Interferon-y and Systemic Autoimmunity. DiscovMed. 2013;16(87):123-131.
[0479] 35. Theofilopoulos AN, Koundouris S, Kono DH, Lawson BR. The role of IFN-gamma in systemic lupus erythematosus: a challenge to theTh1 / Th2 paradigm in autoimmunity. Arthritis Research & Therapy. 2001;3(3):136. doi:10.1186 / ar290
[0480] 36. Kaufmann SHE, Dorhoi A, Hotchkiss RS, Bartenschlager R. Host-directed therapies for bacterial and viral infections. Nat Rev Drug Discov. 2018;17(1):35-56. doi:10.1038 / nrd.2017.162 37. Thom RE, D’Elia RV. Future applications of host direct therapies for infectious disease treatment. Front Immunol. 2024;15:1436557. doi:10.3389 / fimmu.2024.1436557
[0481] 38. Gholap AD, Khuspe PR, Pardeshi SR, et al. Achieving Optimal Health With Host-Directed Therapies (HDTs) in Infectious Diseases — A New Horizon. Advanced Therapeutics. n / a(n / a):2400169. doi : 10.1002 / adtp.202400169
[0482] 39. The top 10 causes of death. Accessed February 18, 2025. https: / / www.who.int / news- room / fact-sheets / detail / the-top-10-causes-of-death
[0483] 40. Baker RE, Mahmud AS, Miller IF, et al. Infectious disease in an era of global change. Nat Rev Microbiol. 2022;20(4):193-205. doi:10.1038 / s41579-021 -00639-z
[0484] 41. Goletti D, Ong CWM, Friedland JS. Host-directed therapies: old and new approaches for the treatment of infections. International Journal of Infectious Diseases. 2024; 146. doi:10.1016 / j.ijid.2024.107130
[0485] 42. Schett G, Mackensen A, Mougiakakos D. CAR T-cell therapy in autoimmune diseases. The Lancet. 2023;402(10416):2034-2044. doi : 10.1016 / S0140-6736(23)01126-1
[0486] 43. Lemoine F, Correia D, Lefort V, etal. NGPhylogeny.fr: new generation hylogenetic services for non-specialists. Nucleic Acids Res. 2019;47(W1):W260-W265. doi:10.1093 / nar / gkz303 44. Passaro S, Corso G, Wohlwend J, et al. Boltz-2: Towards Accurate and Efficient Binding Affinity Prediction. bioRxiv. Published online June 18, 2025:2025.06.14.659707. doi:10.1101 / 2025.06.14.659707
[0487] 45. Swaim CD, Scott AF, Canadeo LA, Huibregtse JM. Extracellular ISG15 Signals Cytokine Secretion Through the LFA-1 Integrin Receptor. Mol Cell. 2017;68(3):581-590.e5. doi:10.1016 / j.molcel.2017.10.003
[0488] 46. Clark DP, Pazdernik NJ, McGehee MR. Molecular Biology. 3rd ed. Academic Cell; 2018.Frlmp / ISG15_Nbs / 873
[0489] 47. Green MR, Sambrook J. Molecular Cloning: A Laboratory Manual (Fourth Edition), Volume 1, 2&3. 4th edition. Cold Spring Harbor Laboratory Press; 2012.
[0490] 48. Tripathi T, Du bey VK. Advances in Protein Molecular and Structural Biology Methods. 1st ed. Academic Press; 2022. https: / / doi.org / 10.1016 / C2020-0-03170-1
[0491] 49. Subrata P. Fundamentals of Molecular Structural Biology. 1sted. Elsevier Academic Press; 2020. https: / / doi.Org / 10.1016 / C2017-0-02189-4
[0492] 50. Abbas AK, Lichtman AH, Pillai S. Cellular and Molecular Immunology. 10th ed. Elsevier; 2021.
[0493] 51. Du X, Li Y, Xia YL, et al. Insights into Protein-Ligand Interactions: Mechanisms, Models, and Methods. IntJMolSci. 2016;17(2):144. doi:10.3390 / ijms17020144
[0494] 52. Hamers-Casterman C, Atarhouch T, Muyldermans S, et al. Naturally occurring antibodies devoid of light chains. Nature. 1993;363(6428):6428. doi:10.1038 / 363446a0
[0495] 53. Kabat EA, National Institutes of Health (U.S.), Columbia University, eds. Sequences of Proteins of Immunological Interest. 5th ed. U.S. Dept, of Health and Human Services, Public Health Service, National Institutes of Health; 1991.
[0496] 54. Nguyen VK, Hamers R, Wyns L, Muyldermans S. Camel heavy-chain antibodies: diverse germline VHH and specific mechanisms enlarge the antigen-binding repertoire. EMBO J.
[0497] 2000;19(5):921-930. doi:10.1093 / emboj / 19.5.921
[0498] 55. Muyldermans S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem.
[0499] 2013;82:775-797. doi:10.1146 / annurev-biochem-063011-092449
[0500] 56. Muyldermans S. Applications of Nanobodies. Annual Review of Animal Biosciences.
[0501] 2021 ;9(1):401 -421. doi:10.1146 / annurev-animal-021419-083831
[0502] 57. MacCallum RM, Martin AC, Thornton JM. Antibody-antigen interactions: contact analysis and binding site topography. J Mol Biol. 1996;262(5):732-745. doi:10.1006 / jmbi.1996.0548 58. bioinf.org.uk - Prof. Andrew C.R. Martin’s group at UCL. Accessed January 25, 2024. http: / / www.bioinf.org.uk / abs / index.html
[0503] 59. Chothia C, Lesk AM. Canonical structures for the hypervariable regions of immunoglobulins. J Mol Biol. 1987;196(4):901 -917. doi: 10.1016 / 0022-2836(87)90412-8 60. Abhinandan KR, Martin ACR. Analysis and improvements to Kabat and structurally correct numbering of antibody variable domains. Molecular Immunology. 2008;45(14):3832-3839. doi:10.1016 / j.molimm.2008.05.022
[0504] 61. Lefranc MP. Immunoglobulin and T Cell Receptor Genes: IMGT® and the Birth and Rise of Immunoinformatics. Frontiers in Immunology. 2014;5. Accessed January 25, 2024. https: / / www.frontiersin.org / articles / 10.3389 / fimmu.2014.00022
[0505] 62. Vincke C, Loris R, Saerens D, Martinez-Rodriguez S, Muyldermans S, Conrath K. General strategy to humanize a camelid single-domain antibody and identification of a universal humanized nanobody scaffold. J Biol Chem. 2009;284(5):3273-3284. doi: 10.1074 / jbc.M806889200Frlmp / ISG15_Nbs / 873
[0506] 63. Deschaght P, Vintem AP, Logghe M, et al. Large Diversity of Functional Nanobodies from a Camelid Immune Library Revealed by an Alternative Analysis of Next-Generation Sequencing Data. Frontiers in Immunology. 2017;8. Accessed January 29, 2024. https: / / www.frontiersin.org / articles / 10.3389 / fimmu.2017.00420
[0507] 64. Gaiotto T, Ramage W, Ball C, et al. Nanobodies mapped to cross-reactive and divergent epitopes on A(H7N9) influenza hemagglutinin using yeast display. Sci Rep. 2021 ;11:3126. doi: 10.1038 / S41598-021 -82356-4
[0508] 65. Dale NC, Johnstone EKM, White CW, Pfleger KDG. NanoBRET: The Bright Future of Proximity-Based Assays. Front Bioeng Biotechnol. 2019;7. doi:10.3389 / fbioe.2019.00056 66. Xu Q, Li W, Zhao Q, et al. A novel homozygous Y140X mutation of ISG15 causes diverse type I interferonopathies in sibling patients with cutaneous lesions or recurrent parenchymal pneumonia. Clin Immunol. 2023;257:109844. doi:10.1016 / j. clim.2023.109844
[0509] 67. Burleigh A, Moraitis E, Al Masroori E, et al. Case Report: ISG15 deficiency caused by novel variants in two families and effective treatment with Janus kinase inhibition. Front Immunol.
[0510] 2023;14. doi:10.3389 / fimmu.2023.1287258
[0511] 68. Martin-Fernandez M, Bravo Garcia-Morato M, Gruber C, et al. Systemic Type I IFN Inflammation in Human ISG15 Deficiency Leads to Necrotizing Skin Lesions. Cell Rep.
[0512] 2020;31 (6): 107633. doi: 10.1016 / j. celrep.2020.107633
[0513] 69. Adejare A, ed. Title page. In: Remington (Twenty-Third Edition). Academic Press; 2021 :i-iii. doi:10.1016 / B978-0-12-820007-0.00055-6
[0514] 70. Bonasia CG, Abdulahad WH, Rutgers A, Heeringa P, Bos NA. B Cell Activation and Escape of Tolerance Checkpoints: Recent Insights from Studying Autoreactive B Cells. Cells.
[0515] 2021 ;10(5):1190. doi:10.3390 / cells10051190
[0516] 71. Boehncke WH, Brembilla NC. Autoreactive T-Lymphocytes in Inflammatory Skin Diseases. Front Immunol. 2019; 10:1198. doi:10.3389 / fimmu.2019.01198
[0517] 72. Paprckova D, Stepanek O. Narcissistic T cells: reactivity to self makes a difference. The FEBS Journal. 2021 ;288(6): 1778-1788. doi: 10.1111 / febs.15498
[0518] 73. Cruz-Tapias P, Castiblanco J, Anaya JM. HLA Association with Autoimmune Diseases. In: Autoimmunity: From Bench to Bedside [Internet], El Rosario University Press; 2013. Accessed July 1, 2024. https: / / www.ncbi.nlm.nih.gov / books / NBK459459 /
[0519] 74. Schluck M, Eggermont LJ, Weiden J, et al. Dictating Phenotype, Function, and Fate of Human T Cells with Co-Stimulatory Antibodies Presented by Filamentous Immune Cell Mimics. Advanced Therapeutics. 2022;5(4):2200019. doi:10.1002 / adtp.202200019
[0520] 75. Wan YY, Flavell RA. How Diverse — CD4 Effector T Cells and their Functions. Journal of Molecular Cell Biology. 2009;1 (1 ):20-36. doi:10.1093 / jmcb / mjp001
[0521] 76. Zhang Q, Vignali DAA. Co-stimulatory and co-inhibitory pathways in autoimmunity. Immunity. 2016;44(5):1034-1051. doi:10.1016 / j.immuni.2O16.04.017Frlmp / ISG15_Nbs / 873
[0522] 77. Carbone F, Russo C, Colamatteo A, et al. Cellular and molecular signaling towards T cell immunological self-tolerance. Journal of Biological Chemistry. 2024;300(4):107134. doi:10.1016 / j.jbc.2024.107134
[0523] 78. Kronzer VL, Bridges SL, Davis JM. Why women have more autoimmune diseases than men: An evolutionary perspective. EvolAppl. 2020;14(3):629-633. doi:10.1111 / eva.13167
[0524] 79. Pisetsky DS. Pathogenesis of autoimmune disease. Nat Rev Nephrol. 2023;19(8):509-524. doi: 10.1038 / S41581 -023-00720-1
[0525] 80. Sogkas G, Atschekzei F, Adriawan IR, Dubrowinskaja N, Witte T, Schmidt RE. Cellular and molecular mechanisms breaking immune tolerance in inborn errors of immunity. Cell Mol Immunol. 2021 ;18(5):1122-1140. doi:10.1038 / s41423-020-00626-z
[0526] 81. Kono DH,Theofilopoulos AN. Chapter19- Autoimmunity. In: FiresteinGS, Budd RC, Gabriel SE, Mclnnes IB, O’Dell JR, eds. Kelley and Fi restein’s Textbook of Rheumatology (Tenth Edition). Elsevier; 2017:301 -317.e5. doi : 10.1016 / B978-0-323-31696-5.00019-X
[0527] 82. Conrad N, Misra S, Verbakel JY, et al. Incidence, prevalence, and co-occurrence of autoimmune disorders over time and by age, sex, and socioeconomic status: a populationbased cohort study of 22 million individuals in the UK. The Lancet. 2023;401(10391 ):1878-1890. doi: 10.1016 / S0140-6736(23)00457-9
[0528] 83. Okumura F, Zou W, Zhang DE. ISG15 modification of the elF4E cognate 4EHP enhances cap structure-binding activity of 4EHP. Genes Dev. 2007;21 (3):255-260. doi: 10.1101 / gad.1521607 84. Zhao C, Hsiang TY, Kuo RL, Krug RM. ISG15 conjugation system targets the viral NS1 protein in influenza A virus-infected cells. Proceedings of the National Academy of Sciences.
[0529] 2010;107(5):2253-2258. doi: 10.1073 / pnas.0909144107
[0530] 85. Zou W, Papov V, Malakhova O, et al. ISG15 modification of ubiquitin E2 Ubc13 disrupts its ability to form thioester bond with ubiquitin. Biochem Biophys Res Commun.2005;336(1 ):61 -68. doi:10.1016 / j.bbrc.2005.08.038
[0531] 86. Park JM, Yang SW, Yu KR, et al. Modification of PCNA by ISG15 plays a crucial role in termination of error-prone translesion DNA synthesis. Mol Cell. 2014;54(4):626-638. doi:10.1016 / j.molcel.2014.03.031
[0532] 87. Durfee LA, Lyon N, Seo K, Huibregtse JM. The ISG15 conjugation system broadly targets newly synthesized proteins: implications for the antiviral function of ISG15. Mol Cell.
[0533] 2010;38(5):722-732. doi:10.1016 / j.molcel.2010.05.002
[0534] 88. Jeon YJ, Jo MG, Yoo HM, et al. Chemosensitivity is controlled by p63 modification with ubiquitin-like protein ISG15.JC / / / 1 Invest. 2012;122(7):2622-2636. doi:10.1172 / JCI61762 89. Shi HX, Yang K, Liu X, et al. Positive regulation of interferon regulatory factor 3 activation by Herc5 via ISG15 modification. Mol Cell Biol. 2010;30(10):2424-2436. doi:10.1128 / MCB.01466- 09
[0535] 90. Villarroya-Beltri C, Guerra S, Sanchez-Madrid F. ISGylation - a key to lock the cell gates for preventing the spread of threats. Journal of Cell Science. 2017;130(18):2961 -2969. doi:10.1242 / jcs.205468Frlmp / ISG15_Nbs / 873
[0536] 91. Lu G, Reinert JT, Pitha-Rowe I, et al. ISG15 enhances the innate antiviral response by inhibition of IRF-3 degradation. Cell Mol Biol (Noisy-le-grand). 2006;52(1):29-41.
[0537] 92. YeY, Akutsu M, Reyes-Turcu F, EnchevRI, Wilkinson KD, KomanderD. Polyubiquitin binding and cross-reactivity in the USP domain deubiquitinase USP21. EMBO Rep. 2011;12(4):350-357. doi:10.1038 / embor.2011.17
[0538] 93. USP16 is an ISG15 cross-reactive deubiquitinase that targets pro-ISG15 and ISGylated proteins involved in metabolism - PubMed. Accessed February 18, 2025. https: / / pubmed.ncbi.nlm.nih.gov / 38055744 /
[0539] 94. Bonacci T, Bolhuis DL, Brown NG, Emanuele MJ. Mechanisms of USP18 delSGylation revealed by comparative analysis with its human paralog USP41. bioRxiv. Published online May 28, 2024:2024.05.28.596309. doi:10.1101 / 2024.05.28.596309
[0540] 95. Malakhova O, Malakhov M, Hetherington C, Zhang DE. Lipopolysaccharide activates the expression of ISG15-specific protease UBP43 via interferon regulatory factor 3. J Biol Chem.
[0541] 2002;277(17):14703-14711. doi:10.1074 / jbc.M111527200
[0542] 96. Ritchie KJ, Malakhov MP, Hetherington CJ, et al. Dysregulation of protein modification by ISG15 results in brain cell injury. Genes Dev. 2002;16(17):2207-2212. doi:10.1101 / gad.1010202 97. Zhang QA, Wang ZL, Li PB, Xie JP. USP18-mediated protein delSGylation and its role in tuberculosis and other infectious diseases. Yi Chuan. 2023;45(11):998-1006. doi: 10.16288 / j.yczz.23-185
[0543] 98. Baechler EC, Batliwalla FM, Karypis G, et al. Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proceedings of the National Academy of Sciences. 2003;100(5):2610-2615. doi:10.1073 / pnas.0337679100
[0544] 99. CrowYJ, Rehwinkel J. Aicardi-Goutieres syndrome and related phenotypes: linking nucleic acid metabolism with autoimmunity. Hum Mol Genet. 2009;18(R2):R130-136. doi:10.1093 / hmg / ddp293
[0545] 100. Rice Gl, Forte GMA, Szynkiewicz M, et al. Assessment of interferon-related biomarkers in Aicardi-Goutieres syndrome associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, and ADAR: a case-control study. The Lancet Neurology.
[0546] 2013;12(12): 1159-1169. doi: 10.1016 / S1474-4422(13)70258-8
[0547] 101. Bogunovic D, Byun M, Durfee LA, et al. Mycobacterial Disease and Impaired IFN-y Immunity in Humans with Inherited ISG15 Deficiency. Science. 2012;337(6102):1684-1688. doi:10.1126 / science.1224026
[0548] 102. Alvarez E, Falqui M, Sin L, et al. Unveiling the Multifaceted Roles of ISG15: From Immunomodulation to Therapeutic Frontiers. Vaccines. 2024;12(2):2. doi:10.3390 / vaccines12020153
[0549] 103. Haas C, Ryffel B, Le Hir M. IFN-gamma is essential for the development of autoimmune glomerulonephritis in MRL / lpr mice. J Immunol. 1997;158(11):5484-5491.
[0550] 104. Balomenos D, Rumold R, Theofilopoulos AN. Interferon-gamma is required for lupus-like disease and lymphoaccumulation in MRL-lpr mice. J Clin Invest. 1998;101 (2):364-371.Frlmp / ISG15_Nbs / 873
[0551] 105. Kevil CG, Hicks MJ, He X, et al. Loss of LFA-1, but not Mac-1, protects MRL / MpJ-Fas(lpr) mice from autoimmune disease. Am J Pathol. 2004;165(2):609-616. doi:10.1016 / S0002- 9440(10)63325-1
[0552] 106. Care MA, Stephenson SJ, Barnes NA, et al. Network Analysis Identifies Proinflammatory Plasma Cell Polarization for Secretion of ISG15 in Human Autoimmunity. J Immunol.
[0553] 2016;197(4): 1447-1459. doi: 10.4049 / jimmunol.1600624
[0554] 107. Ostvik AE, Svendsen TD, Granlund A van B, et al. Intestinal Epithelial Cells Express Immunomodulatory ISG15 During Active Ulcerative Colitis and Crohn’s Disease. J Crohns Colitis. 2020;14(7):920-934. doi:10.1093 / ecco-jcc / jjaa022
[0555] 108. Miller LG, Chiok K, Mariasoosai C, etal. Extracellular ISG15 triggers ISGylation via a type-l interferon independent non-canonical mechanism to regulate host response during virus infection. bioRxiv. Published online August 14, 2024:2024.07.05.602290. doi:10.1101 / 2024.07.05.602290
[0556] 109. Chapman AP. PEGylated antibodies and antibody fragments for improved therapy: a review. Adv Drug Deliv Rev. 2002;54(4):531-545. doi:10.1016 / s0169-409x(02)00026-1
[0557] 110. Veronese FM, Harris JM. Introduction and overview of peptide and protein pegylation. Adv Drug Deliv Rev. 2002;54(4):453-456. doi: 10.1016 / s0169-409x(02)00020-0
[0558] 111. Harris JM, Chess RB. Effect of pegylation on pharmaceuticals. Nat Rev Drug Discov.
[0559] 2003;2(3):214-221. doi:10.1038 / nrd1033
[0560] 112. YangK, Basu A, Wang M, etal. Tailoring structure-function and pharmacokinetic properties of single-chain Fv proteins by site-specific PEGylation. Protein Engineering, Design and Selection. 2003;16(10):761-770. doi:10.1093 / protein / gzg093
[0561] 113. Cao Y, Suresh M. Bispecific MAb Aided Liposomal Drug Delivery. Journal of Drug Targeting.
[0562] 2000;8(4):257-266. doi: 10.3109 / 10611860008997904
[0563] 114. Dosztanyi Z, Csizmok V, Tompa P, Simon I. lUPred: web server for the prediction of intrinsically unstructured regions of proteins based on estimated energy content. Bioinformatics. 2005;21 (16):3433-3434. doi:10.1093 / bioinformatics / bti541
[0564] 115. Rabuka D. Chemoenzymatic methods for site-specific protein modification. Curr Opin Chem Biol. 2010;14(6):790-796. doi:10.1016 / j.cbpa.2010.09.020
[0565] 116. Kulkarni JA, Witzigman n D, Chen S, Cullis PR, van der Meel R. Lipid Na noparticle Technology for Clinical Translation of siRNA Therapeutics. Acc Chem Res. 2019;52(9):2435-2444. doi:10.1021 / acs. accounts.9b00368
[0566] 117. Swaim CD, Canadeo LA, Huibregtse JM. Approaches for investigating the extracellular signaling function of ISG15. Methods Enzymol. 2019;618:211-227. doi:10.1016 / bs.mie.2018.12.027
[0567] 118. Vonrhein C, Flensburg C, Keller P, et al. Data processing and analysis with the autoPROC toolbox. Acta Crystallogr D Biol Crystallogr. 2011;67(Pt 4):293-302. doi:10.1107 / S0907444911007773Frlmp / ISG15_Nbs / 873
[0568] 119. Krissinel E, Lebedev AA, Uski V, et al. CCP4 Cloud for structure determination and project management in macromolecular crystallogra hy. Acta Crystallogr D Struct Biol. 2022;78(Pt 9):1079-1089. doi:10.1107 / S2059798322007987
[0569] 120. Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr. 2004;60(Pt 12 Pt 1 ):2126-2132. doi : 10.1107 / S0907444904019158
[0570] 121. Afonine PV, Grosse-Kunstleve RW, Echols N, et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D Biol Crystallogr. 2012;68(Pt 4):352- 367. doi: 10.1107 / S0907444912001308
[0571] 122. Adams PD, Afonine PV, Bunkoczi G, et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr. 2010;66(Pt 2):213- 221. doi:10.1107 / S0907444909052925
[0572] 123. Basters A, Geurink PP, Rocker A, et al. Structural basis of the specificity of USP18 toward ISG15. Nat Struct Mol Biol. 2017;24(3):270-278. doi:10.1038 / nsmb.3371
[0573] 124. Pilat N, Sayegh MH, WekerleT. Costimulatory pathways in transplantation. Semin Immunol.
[0574] 2011;23(4):293-303. doi:10.1016 / j.smim.2011.04.002
[0575] 125. Nagashima K, Mousa JJ. Epitope Binning of Monoclonal and Polyclonal Antibodies by Biolayer Interferometry. Methods Mol Biol. 2023;2673:17-32. doi:10.1007 / 978-1 -0716-3239-0_2 126. Vuillier F, Li Z, Commere PH, Dynesen LT, Pellegrini S. USP18 and ISG15 coordinately impact on SKP2 and cell cycle progression. Sci Rep. 2019;9(1):4066. doi:10.1038 / S41598-019- 39343-7
[0576] 127. Sharif MN, Tassiulas I, Hu Y, Mecklenbrauker I, Tarakhovsky A, Ivashkiv LB. IFN-alpha priming results in a gain of proinflammatory function by IL-10: implications for systemic lupus erythematosus pathogenesis. J Immunol. 2004;172(10):6476-6481. doi:10.4049 / jimmunol.172.10.6476
[0577] 128. Facciotti F, Larghi P, Bosotti R, et al. Evidence for a pathogenic role of extrafollicular, IL-10- producing CCR6+B helper T cells in systemic lupus erythematosus. Proc Natl Acad Sci USA.
[0578] 2020;117(13):7305-7316. doi:10.1073 / pnas.1917834117
[0579] 129. Biswas S, Bieber K, Manz RA. IL-10 revisited in systemic lupus erythematosus. Front Immunol. 2022;13:970906. doi:10.3389 / fimmu.2022.970906
[0580] 130. Ishida H, Muchamuel T, Sakaguchi S, Andrade S, Menon S, Howard M. Continuous administration of anti-interleukin 10 antibodies delays onsetof autoimmunity in NZB / WF1 mice. J Exp Med. 1994;179(1):305-310. doi:10.1084 / jem.179.1.305
[0581] 131. Godsell J, Rudloff I, Kandane-Rathnayake R, et al. Clinical associations of IL-10 and IL-37 in systemic lupus erythematosus. Sci Rep. 2016;6(1):34604. doi:10.1038 / srep34604
[0582] 132. Smith CJ, Allard DE, Wang Y, Howard JF, Montgomery SA, Su MA. IL-10 Paradoxically Promotes Autoimmune Neuropathy through S1 PR1 -Dependent CD4+ T Cell Migration. J Immunol. 2018;200(5):1580-1592. doi:10.4049 / jimmunol.1701280Frlmp / ISG15_Nbs / 873
[0583] 133. Takeoka K, Watanabe M, Matsuzuka F, Miyauchi A, Iwatani Y. Increase of serum interleukin- 10 in intractable Graves’ disease. Thyroid. 2004;14(3):201-205. doi: 10.1089 / 105072504773297876
[0584] 134. MELGAR S, YEUNG MMW, BAS A, etal. Over-expression of interleukin 10 in mucosal T cells of patients with active ulcerative colitis. Clin Exp Immunol. 2003;134(1 ):127-137. doi: 10.1046 / j.1365-2249.2003.02268.x
[0585] 135. Vonrhein C, Flensburg C, Keller P, et al. Data processing and analysis with the autoPROC toolbox. Acta Crystallographica Section D. 2011 ;67(4):293-302.
[0586] 136. Vonrhein C, Tickle IJ, Flensburg C, et al. Advances in automated data analysis and processing within autoPROC, combined with improved characterisation, mitigation and visualisation of the anisotropy of diffraction limits using STARANISO. Acta Crystallogr A.
[0587] 2018;74:A360-A360.
[0588] 137. Terwilliger TC, Grosse-Kunstleve RW, Afonine PV, etal. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallogr D Biol Crystallogr. 2008;64(Pt 1):61-69. doi:10.1107 / S090744490705024X
Claims
Frlmp / ISG15_Nbs / 873CLAIMS1. A modulator polypeptide that specifically binds to human ISG15 and, upon binding, modulates the immune activity or function of ISG15 protein.
2. The ISG15-specific modulator polypeptide of claim 1 , comprising an antibody, active antibody fragment, immunoglobulin single variable domain (ISVD), single domain antibody, ora VHH that specifically binds to human ISG15.
3. The ISG15-specific modulator polypeptide of claim 1 or 2, which, upon binding, modulates the interaction between USP18 and ISG15 inside a cell.
4. The ISG15-specific modulator polypeptide of claim 3, wherein said modulation of the binding of ISG15 to USP18 inside a cell is downregulation of the binding compared to the absence of said modulator, optionally as measured by a nanoBRET assay.
5. The ISG15-specific modulator polypeptide of any one of claims 1-4, wherein said modulator comprises an ISVD specifically binding human ISG15 and comprising the complementarity- determining-regions (CDRs) as present in SEQ ID NOs: 01 , 05, 09, 13, 17, 21, 25, 29, 33, 37, 41 , wherein the CDRs are annotated according to the Kabat, MacCallum, IMGT, AbM, or Chothia numbering system, or comprising an ISVD comprising a sequence wherein:i) CDR1 comprises SEQ ID NO: 02, CDR2 comprises SEQ ID NO: 03, and CDR3 comprises SEQ ID NO: 04; orii) CDR1 comprises SEQ ID NO: 06, CDR2 comprises SEQ ID NO: 07, and CDR3 comprises SEQ ID NO: 08; oriii) CDR1 comprises SEQ ID NO: 10, CDR2 comprises SEQ ID NO: 11 , and CDR3 comprises SEQ ID NO: 12; oriv) CDR1 comprises SEQ ID NO: 14, CDR2 comprises SEQ ID NO: 15, and CDR3 comprises SEQ ID NO: 16; orv) CDR1 comprises SEQ ID NO: 18, CDR2 comprises SEQ ID NO: 19, and CDR3 comprises SEQ ID NO: 20; orvi) CDR1 comprises SEQ ID NO: 22, CDR2 comprises SEQ ID NO: 23, and CDR3 comprises SEQ ID NO: 24; or93Frlmp / ISG15_Nbs / 873vii) CDR1 comprises SEQ ID NO: 26, CDR2 comprises SEQ ID NO: 27, and CDR3 comprises SEQ ID NO: 28; orviii) CDR1 comprises SEQ ID NO: 30, CDR2 comprises SEQ ID NO: 31 , and CDR3 comprises SEQ ID NO: 32; orix) CDR1 comprises SEQ ID NO: 34, CDR2 comprises SEQ ID NO: 35, and CDR3 comprises SEQ ID NO: 36; orx) CDR1 comprises SEQ ID NO: 38, CDR2 comprises SEQ ID NO: 39, and CDR3 comprises SEQ ID NO: 40; orxi) CDR1 comprises SEQ ID NO: 42, CDR2 comprises SEQ ID NO: 43, and CDR3 comprises SEQ ID NO: 44.
6. The ISG15-specific modulator polypeptide of any one of the preceding claims, which, upon bindin to ISG15, reduces delSGylation compared to the absence of said modulator.
7. The ISG15-specific modulator polypeptide of anyone of the preceding claims, comprising an ISVD with a sequence selected from the group of SEQ ID NOs: 01 , 05, 13, 17, 21 , 25, 29, 33, 37, 41 , or a humanized variant thereof.
8. The ISG15-specific modulator polypeptide of any one of the above claims, wherein said modulator specifically binds ISG15 at a binding site comprising the amino acid residues R92, S93, S94, T95, Y96, E97, Q102, H106, Q109, Q110, S112, G113, L114, E115, G116, V117, Q118, D119, and D120 of SEQ ID NO: 45, or at a binding site comprising the corresponding amino acids thereof in an ISG15 homologue or mutant.
9. The ISG15-specific modulator polypeptide of any one of claims 1-7, wherein said modulator specifically binds ISG15 at a binding site comprising the amino acid Asp4, Lys8, Met9, Leu10, Ala11, Gly12, Asn13, Glu14, Phe15, Gln16, Val17, Ser18, Thr33, Gln34, Lys35, Ile36, Gly37, Val38, Val75, and Lys77 of SEQ ID NO: 45, or at a binding site comprising the corresponding amino acids thereof in an ISG15 homologue or mutant.
10. The ISG15-specific modulator polypeptide of any one of claims 1 to 9, which comprises a further functional moiety, preferably a therapeutic moiety or a half-life-extending moiety.94Frlmp / ISG15_Nbs / 87311. The ISG15-specific modulator polypeptide of any one of claims 1 to 10, which comprises a further targeting moiety, preferably a nucleus-targeting moiety.
12. The ISG15-specific modulator polypeptide of any one of claims 1 to 11 , which is a multivalent or multispecific modulator, preferably comprising at least two moieties specifically binding ISG15, or comprising at least two ISG15-specific ISVDs.
13. A nucleic acid molecule encoding a human ISG15-specific modulator polypeptide according to any of the preceding claims.
14. A pharmaceutical composition comprising the ISG15-specific modulator polypeptide of any one of claims 1 to 12, or the nucleic acid molecule of claim 13.
15. The ISG15-specific modulator polypeptide of any one of claims 1 to 12, the nucleic acid molecule of claim 13, or the pharmaceutical composition of claim 14, for use as a medicament.
16. The ISG15-specific modulator polypeptide of any one of claims 1 to 12, the nucleic acid molecule of claim 13, or the pharmaceutical composition of claim 14, for use in a therapeutic or preventive treatment of an infectious disease.
17. The ISG15-specific modulator polypeptide of any one of claims 1 to 12, the nucleic acid molecule of claim 13, orthe pharmaceutical composition of claim 14, for use in a therapeutic or preventive treatment of an autoimmune disease.
18. The ISG15-specific modulator of anyone of claims 1 -12, wherein the modulator is fused or conjugated to a detection moiety, preferably wherein said detection moiety is a label or a tag.
19. A method for detecting ISG15 protein, wherein the method comprises contacting a sample with the ISG15-specific modulator of claim 18.
20. The ISG15-specific modulator of any one of claims 1-12 or of claim 18, the nucleic acid molecule of claim 13, orthe pharmaceutical composition of claim 14, for use as a diagnostic.95