Ssdna aptamers for malaria detection and their use in diagnostic compositions, kits and biosensors

WO2026177608A1PCT designated stage Publication Date: 2026-08-27LATVIJAS UNIVE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/LV2026/050003
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-02-21
Filing Date
2026-02-17
Publication Date
2026-08-27

Smart Images

  • Figure IMGF000007_0001_TABLE
    Figure IMGF000007_0001_TABLE
  • Figure IMGF000007_0002_TABLE
    Figure IMGF000007_0002_TABLE
  • Figure IMGF000008_0001_TABLE
    Figure IMGF000008_0001_TABLE
Patent Text Reader

Abstract

The present invention relates to single-stranded DNA (ssDNA) aptamers that speciically bind to Plasmodium falciparum lactate dehydrogenase (Pf-LDH) for malaria detection. The invention provides full-length aptamers (SEQ ID NOs: 1–4) and their truncated variants (SEQ ID NOs: 5–7), which retain high afinity for Pf-LDH. A diagnostic composition comprising these aptamers is disclosed, along with a kit for in vitro malaria detection. The invention further provides a biosensor incorporating immobilized aptamers on a transducer surface to generate a detectable signal upon LDH binding. Additionally, the invention covers the use of the aptamers for Pf-LDH detection in biological samples, enabling their integration into various diagnostic platforms.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] ssDNA Aptamers for Malaria Detection and Their Use in Diagnostic Compositions, Kits, and Biosensors

[0002] Technical field

[0003]

[0001] The present invention relates to nucleic acid-based diagnostics, specifically to ssDNA aptamers that bind to Plasmodium lactate dehydrogenase (LDH). The invention further concerns the use of these aptamers in diagnostic compositions, kits, biosensors, and in vitro malaria detection assays.

[0004] Background art

[0005]

[0002] Malaria is caused by the Plasmodium parasite, which has several species. Plasmodium falciparum is the most virulent and widespread species, responsible for the majority of malaria-related deaths. Plasmodium vivax and Plasmodium ovale cause a milder form of malaria, but these species are known for causing relapses due to their characteristic dormant stages in the liver. Plasmodium malariae causes a chronic infection associated with long-term complications.

[0006]

[0003] According to the World Health Organization (WHO), in 2022, there were an estimated 249 million malaria cases and 608,000 deaths across 85 countries worldwide. The WHO African Region bears an overwhelmingly large portion of the global malaria burden. Children under five years of age accounted for about 80% of all malaria deaths in the region. Malaria is primarily transmitted to humans through the bites of infected female Anopheles mosquitoes. However, blood transfusion and contaminated needles may also transmit malaria. The first symptoms may be mild, resembling many febrile illnesses, making malaria difficult to recognize. If left untreated, P. falciparum malaria can progress to severe illness and death within 24 hours. Thus, rapid diagnostic tests (RDTs) are of high importance for providing fast and accurate diagnosis, particularly in settings where microscopy is unavailable or unreliable. For effective diagnosis of all malaria cases, the chosen diagnostic method must be both sensitive and accessible at the point of care. Current RDTs rely on antibodies and enable qualitative detection of P. falciparum histidine-rich protein 2 (PfHRP2) and Plasmodium spp. lactate dehydrogenase (pLDH) [1],

[0004] It has been reported that false -negative HRP2-based rapid diagnostic test (HRP- RDT) results can arise due to HRP2 / 3 deletions, high parasitemia, or low parasite density. Thus, lactate dehydrogenase (LDH) is considered a more suitable antigen for RDTs. However, antibody-based RDTs are not ideal in cases of low parasitemia due to their limited sensitivity and specificity [2], [3], Aptamers are short, single -stranded DNA or RNA molecules that can selectively bind to specific targets. In comparison to antibodies, aptamers offer several advantages. Aptamers are synthetically produced, more cost- effective, and demonstrate lower batch-to-batch variability. Importantly, aptamers are highly stable even at elevated temperatures and have an extended shelflife. Moreover, they can be easily modified to meet specific application needs [4],

[0007]

[0005] Few ssDNA aptamer candidates for Plasmodium spp. LDH have been reported in the literature. Aptamer 2008 targets P. falciparum with a dissociation constant (Kd) of 42 nM, as determined by isothermal titration calorimetry (ITC). Aptamer pL-1 targets P. falciparum and R vivax, with Kd values of 38.7 nM and 16.8 nM, respectively, as determined by a fluorescence-based method and Kd values of 6.2 nM and KD = 2.9 nM, as determined by enzyme-linked oligonucleotide assay (ELONA) [5], Aptamer LDHpll recognizes P. falciparum and P. vivax, with Kd values of 321.2 nM and 41.4 nM, respectively, as determined by ELONA [6], [7], [8], The reported aptamer candidates exhibit relatively low affinity for their targets, which may limit their application in aptamer-based sensors due to reduced sensitivity. Moreover, aptamers capable of recognizing P. ovale and P. malariae have not been reported in the literature to date. To address this, the inventors performed protein systematic evolution of ligands by exponential enrichment (protein SELEX) to identify pan-malaria aptamers capable of recognizing the three most common and infectious malaria-causing species: P. falciparum, P. vivax, and P. ovale. Since P. malariae infections often result in low parasitemia levels and frequently occur as mixed infections with P. falciparum or P. vivax, selection specifically targeting P. malariae LDH was not performed. However, the cross-reactivity of aptamers with P. malariae was evaluated [9],

[0006] In summary, despite the availability of some aptamer candidates in literature, there remains a need for aptamers with higher affinity and broader species recognition. The aptamers disclosed in this invention could provide enhanced sensitivity and widerdetection coverage of Plasmodium species, enabling the development of an aptamer-based malaria biosensor or rapid diagnostic test (aptasensor) for use in endemic regions or as needed in non-endemic areas.

[0008] Summary of invention

[0009]

[0007] The present invention relates to single-stranded DNA (ssDNA) aptamers that selectively bind to P. falciparum lactate dehydrogenase (Pf-LDH), a key biomarker for malaria detection. The invention provides four full-length aptamers (SEQ ID NOs: 1-4) and their truncated variants (SEQ ID NOs: 5-7), which retain specific binding to Pf-LDH. The disclosed aptamers are incorporated into a composition for malaria diagnosis, which can be used in in vitro detection assays. A diagnostic kit is also provided, comprising of at least one Pf-LDH-specific aptamer. Additionally, the invention provides a biosensor for malaria detection, in which the aptamers are immobilized on a transducer surface to detect Pf-LDH binding and generate a detectable signal. The invention further encompasses the use of the disclosed aptamers for detecting Pf-LDH in biological samples, ensuring their application in various diagnostic platforms.

[0010] Brief Description of Drawings

[0011]

[0008] Fig. 1 is a diagram depicting the relationship between the aptamer concentration and optical density measurement, representing the binding interaction of the disclosed full-length aptamers with P. falciparum LDH (Pf-LDH) by ELONA.

[0012] Fig. 2 is a diagram depicting the relationship between the aptamer concentration and optical density measurement, representing the binding interaction of the disclosed truncated aptamers Pf-LDHlt, Pf-LDH2t, Pf-LDH4t with P. falciparum LDH (Pf-LDH) by ELONA. For comparison the binding curve of the published aptamer 2008 has been included. GreenBl aptamer specific to Integrin- l

[0010] included as a negative control. Fig. 3 is a representative diagram showing the enthalpy change, providing thermodynamic characterization of the Pf-LDH4t-Pf-LDH interaction based on isothermal titration calorimetry (ITC) measurements.Fig. 4 is a representative diagram showing the molar ratio, providing thermodynamic characterization of the Pf-LDH4t-Pf-LDH interaction based on isothermal titration calorimetry (ITC) measurements.

[0013] Fig. 5 is a representative image of the Pf-LDH4t binding site on the Pf-LDH.

[0014] Detailed Description of the Invention

[0015]

[0009] The aptamers are initially selected from a randomized single -stranded DNA (ssDNA) library (sequence = 5-FAM-ATCCAGAGTGACGCAGCA- NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN- TGGACACGGTGGCTTAGT) with a molecular weight [MW] of 23.5 kDa. His-tagged magnetic beads are used to capture His-tagged Pf-LDH.

[0016]

[0010] The randomized aptamer library is folded by heating and cooling at room temperature. The folded aptamers are added to the His-tagged bead-protein complex and incubated to allow aptamers to bind to the LDH protein. After incubation, the solution containing bead-protein-aptamer complexes is split into three tubes to perform a variable number of washing steps, initially 1-3 washes. The number of washing steps is adjusted in each selection cycle. Washing is performed using magnetic separation. Bound aptamers are eluted from the bead-protein complex.

[0017] [Oil] Preparative PCR is performed using the eluate and the number of cycles identified as optimal during PCR optimization. Eluates from each washing step are amplified by PCR to determine the optimal number of washing steps per cycle and to optimize the number of PCR amplification cycles. For PCR optimization in each SELEX cycle, 6, 8, 10, 12, and 14 cycles are tested. A 3% agarose gel electrophoresis is used to evaluate the integrity of aptamer bands and to select the optimal number of washing steps and PCR cycles for preparative PCR.

[0018]

[0012] After preparative PCR, DNA is purified using DNA clean-and-concentrate columns. Double-stranded DNA (dsDNA) is obtained, and its concentration is measured. Streptavidin-coated magnetic beads are then used to capture dsDNA. Single-stranded DNA (ssDNA) is eluted using NaOH, and the pH is neutralized with an equivalent amount of HC1. The ssDNA is purified using an oligo purification kit, and its concentration is measured. Afinal concentration of 100 nM ssDNA is used for the next SELEX cycle. In total, eight SELEX cycles are performed.

[0019]

[0013] To determine the sequences of the selected aptamers, next-generation sequencing (NGS) is performed using Illumina MiSeq. Sample preparation is carried out according to Illumina’s recommendations. After sequencing, the data are processed using Cutadapt to remove constant primer binding sites originating from the initial library. Fastaptamer software is then used to evaluate sequence enrichment over eight selection cycles. The most enriched aptamers are selected for in vitro validation.

[0020]

[0014] Four sequences were identified as a result of SELEX selection against Plasmodium falciparum LDH (Pf-LDH), designated as Pf-LDHl (SEQ ID NO: 1), Pf-LDH2 (SEQ ID NO: 2), Pf-LDH4 (SEQ ID NO: 3), and Pf-LDH5 (SEQ ID NO: 4). All sequences are 76 nucleotides long:

[0021] SEQ ID NO. 1

[0022] 5’- AT C C AG AG T G AC G C AG C AG G G G C T C GAG C G G C C C TAG AG AG AC T C TAG GAG TAG CACCTGGACA CGGTGGCTTAGT - 3’

[0023] SEQ ID NO. 2

[0024] 5’ - ATCCAGAGTGACGCAGCAACTTATGCCGACAAATCATCAACCAGGACCGGTAAGTAGCTGGACA CGGTGGCTTAGT - 3’

[0025] SEQ ID NO. 3

[0026] 5’- AT C C AG AGT GAG G GAG CAT G ATAG AAGT C G GT GAAC GAT CT GT T C G GT TAAAT TGC CAT G GAGA CGGTGGCTTAGT - 3'

[0027] SEQ ID NO. 4

[0028] 5’- ATCCAGAGTGACGCAGCACAGGGTCGTTAGAGAGACTCACTCTGTTACCTCATTCAAGTGGACA CGGTGGCTTAGT -3’

[0029]

[0015] Truncated variants of these sequences were generated by removing primer binding sites from the initial randomized library, resulting in Pf-LDHlt (SEQ ID NO: 5), Pf-LDH2t(SEQ ID NO: 6), and Pf-LDH4t (SEQ ID NO: 7). These truncated sequences are 40 nucleotides long:

[0030] SEQ ID NO. 5

[0031] 5’- GGGGCTCGAGCGGCCCTACAGAGACTCTAGGAGTAGCACC — 3'

[0032] SEQ ID NO. 6

[0033] 5’ - ACTTATGCCGACAAATCATCAACCAGGACCGGTAAGTAGC - 3’

[0034] SEQ ID NO. 7

[0035] 5’- TGATAGAAGTCGGTGAACGATCTGTTCGGTTAAATTCCCA - 3’

[0036]

[0016] An enzyme-linked oligonucleotide assay (ELONA) was used to determine the sequence specificity and affinity of the aptamers for P. falciparum, P. vivax, P. ovale, and P. malariae LDH from different sources - SPAN Diagnostics commercial protein and inhouse recombinant Plasmodium spp. LDH’s. Cross-reactivity with human LDH isoforms A and B was also assessed. The respective His-tagged Plasmodium spp. LDH proteins were immobilized on Ni-NTA HisSorb plates, which were then washed to remove unbound protein. Each selected aptamer stock was folded by heating and subsequently cooled for 5 minutes. The folded aptamers were added to the plates in serial dilutions (1 pM - 0.064 nM), incubated, and washed to remove unbound aptamers. Each well was then incubated with poly-HRP-Streptavidin reagent, followed by washing. Tetramethylbenzidine (TMB) substrate was added and incubated. The reaction was stopped using sulfuric acid, and optical density (OD) was measured at 450 nm. The dissociation constant (Kd) was determined using GraphPad Prism software.

[0037]

[0017] Kd values towards P. falciparum, P. ovale, P. vivax and P. malariae LDH from SPAN Diagnostics are shown in in Table 1 and Kd values towards in-house recombinant P. falciparum, P. ovale and P. vivax LDH are shown in Table 2.Table 1

[0038] Dissociation Constants (Kd) of Aptamers for Plasmodium spp. LDH (SPAN Diagnostics) and Human LDH Isoforms

[0039]

[0040] Table 2

[0041] Dissociation Constants (Kd) of Aptamers for Plasmodium spp. LDH (in-house recombinant)

[0042]

[0043]

[0044]

[0018] Sequences Pf-LDH1-Pf-LDH5 (SEQ ID NO.: 1-5) and Pf-LDHlt-Pf-LDH4t (SEQ ID NO.: 6-7) exhibit 5- to 79-fold higher affinity for P. falciparum LDH from SPAN Diagnostics compared to a previously published aptamer, Aptamer 2008 (Kd = 16.5 nM, as determined by ELONA tested along with Pf-LDH aptamers selected (Fig. 1-2)). When aptamer affinity was compared to an in-house recombinant Plasmodium spp. LDH, divergence in Kd values were observed indicating that aptamer binding is affected by the source and production system of the target protein. In general, Kd values for the in-house P. falciparum and P. ovale LDH were lower than those obtained by commercial protein Notably, aptamers Pf-LDHl and Pf-LDHlt exhibited a complete loss of binding when tested against in-house recombinant LDH.

[0045]

[0019] Pf-LDH4t (SEQ ID NO. 7) was selected as a representative aptamer for a more detailed characterization using ITC and the in-house recombinant Plasmodium falciparum LDH. The dissociation constant (Kd) determined by ITC averaged 55 ± 9 nM, aligning with the Kd value of aptamer 2008 obtained by ITC. This consistency further validates the ELONA results. Thus, Pf-LDH4t represents the binding properties of all sequences disclosed in this application.

[0046]

[0020] Figures 1 and 2 provide a graphical representation of aptamer-Pf-LDH binding, confirming strong and specific interactions as determined by ELONA. Table 3 summarizes the binding affinity (Kd), stoichiometry, and thermodynamic parameters, indicating that binding is enthalpically driven and spontaneous as indicated by aptamer Pf-LDH4t (SEQ ID NO. 7) ITC analysis.Table 3 Thermodynamic and Binding Parameters of Aptamer-Pf-LDH Interaction Determined by Isothermal Titration Calorimetry (ITC)

[0047]

[0048]

[0021] The results, summarized in Table 3, indicate that the aptamer binds Pf-LDH with a Kd of 46.7 nM, reflecting a strong interaction. The stoichiometry (N = 0.252) suggests that one aptamer molecule binds to a fraction of available Pf-LDH sites, which may indicate cooperative or partial occupancy binding. The negative AH (-13.3 kcal / mol) signifies an exothermic reaction, meaning binding is driven by favorable enthalpic interactions. The entropy term (-TAS = 3.3 kcal / mol) contributes positively, but the overall binding is primarily enthalpy-driven, as shown by the negative Gibbs free energy (AG = -10.0 kcal / mol), confirming a spontaneous interaction. Since affinity values obtained by ELONA are similar, it is expected that the binding mechanism would be similar to all Pf-LDH aptamer sequences (SEQ ID No.: 1-7) and thus ITC is not repeated for all sequences. The binding site of Pf-LDH4t on the Pf-LDH was assessed by crystallography. The Pf-LDH4t aptamer was observed to be bound to the Pf-LDH tetramer in a groove between two monomers. ITC measurements confirmed that indeed only one DNA aptamer binds to one Pf-LDH tetramer even in solution, thereby excluding any crystallization-related artifacts such as displacement of one aptamer by crystal contacts. Current explanation is that binding of one aptamer causes a number of small structural changes in the other part of Pf-LDH molecule and favours alternative conformation of aptamer-binding loop which collectively prevent binding of second aptamer. Crystallography confirms thatthe aptamer indeed binds to the protein and it is considered representative for all disclosed sequences.

[0022] Materials. His-tagged protein - 20 pg P. falciparum LDH or P. vivax LDH; ssDNA aptamer library - 10 uM of randomised library for the first cycle, 100 nM ssDNA aptamers for next SELEX cycles. Dilute in binding buffer. Buffers: PBS.; Folding buffer: PBS, 5 mM MgC12. Binding buffer: PBS, 5 mM MgC12, 0.1% BSA, 0.1 mg / mL salmon sperm DNA or tRNA (5mg for 50ml buffer). Washing buffer (PBS-W): PBS, 5 M MgC12, 0.1% BSA, 5 mM imidazole. Elution buffer: PBS, 0.1% BSA, 400 mM imidazole. 2X binding buffer: PBS, 10 mM MgC12, 0.2% BSA, tRNA (lOmg on 50ml buffer). Ni-NTA magnetic beads - Dynabeads Dynabeads™ His-Tag Isolation and Pulldown - use lOul beads per reaction (for each planned eluate).

[0049]

[0023] Protocol. Take 30 pL of Ni-NTA magnetic beads and wash twice with 1 m of PBS (do not use PBS containing BSA, as BSA may coat the beads and reduce His-tagged protein binding). Resuspend the beads in 500 pL of folding buffer containing 20 pg of His-tagged Pf-LDH protein. Incubate for 1 hour at room temperature (RT) with end-over-end mixing. Meanwhile, prepare the aptamer library: for the first SELEX cycle, dilute 10 pM of the randomized library to 500 pL with binding buffer; for subsequent cycles, dilute ssDNA aptamers from the previous cycle to 100 nM with 2X binding buffer. Fold the aptamers by heating at 95°C for 5 minutes, then cool for 15 minutes at RT. Wash the protein-bound beads three times with 900 pL of PBS-W (change tubes and tips between washes). Washing protocol: After magnetic pull-down, remove the supernatant, add 1 mL of PBS-W, vortex on medium setting, transfer to a new tube, and place in a magnetic separator for 3 minutes. Add the folded aptamers to the beads and incubate (1 hour for the first four cycles, 30 minutes for cycles 4-8) at RT with end-over-end mixing. Resuspend the beads in 900 pL of PBS-W and split into three separate 1.5 mL tubes. Place in a magnetic separator for 3 minutes and remove the supernatant. Additional washing protocol: Perform x-y washing steps, increasing the number of washes in later SELEX cycles as enrichment progresses (typically 1-3 washes in early cycles). Add 1 mL of PBS-W, vortex on medium setting, transfer to a new tube, place in a magnetic separator for 3 minutes, and remove the supernatant. Proceed to the elution step or repeat the washing procedure (adjusting wash cycles based on optimization results). Optimize PCR cycles for each sample, ensuring clear band formation around the 10th cycle. Elution step: Add 60 pL ofelution buffer to the beads, vortex, and place in a magnetic separator for 3 minutes. Collect the eluate and proceed with PCR amplification optimization and preparative PCR.

[0050]

[0024] Optimization. PCR amplification is performed using 10 pM ofthe forward primer (5'-ATCCAGAGTGACGCAGCA) and the reverse primer (5’-Biot-ACTAAGCCACCGTGTCCA) for 6, 8, 10, 12, and 14 cycles. PCR conditions: Initial denaturation at 95°C for 12 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 56.3°C for 30 seconds, and elongation at 72°C for 30 seconds. A 3% agarose gel electrophoresis is performed to evaluate which eluate and PCR cycle number produce a uniform aptamer band.

[0051]

[0025] Preparative PCR. Select the eluate from the optimization step and amplify it for the chosen number of PCR cycles (determined during optimization) using 100 pM of the forward primer (5'-ATCCAGAGTGACGCAGCA) and the reverse primer (5'-Biot-ACTAAGCCACCGTGTCCA). Purify the double-stranded DNA (dsDNA) obtained after PCR using a DNA clean-and-concentrate kit and dilute it in 50 pL of molecular-grade water.

[0052]

[0026] ssDNA preparation from dsDNA. Prepare a 20 mM NaOH solution. Take 10 pL of Dynabeads™ MyOne™ Streptavidin Cl beads and wash them with 1 mb of folding buffer. Add 45 pL of dsDNA from the previous step to the beads and incubate for 30 minutes at room temperature with end-over-end mixing. Wash the beads 2-3 times with 1 mb of folding buffer. Elute the ssDNA by incubating the beads in 50 pL of 20 mM NaOH for 10 minutes using an end-over-end shaker. Neutralize the solution with 50 pL of 20 mM HC1. Purify the resulting ssDNA using an oligo purification kit (Zymo) according to the manufacturer's protocol and elute in 15 pL of water. Measure the ssDNA concentration using a spectrophotometer. Repeat for 8 cycles.

[0053]

[0027] ELONA Buffers. Blocking buffer - PBS, 4.5 mM MgC12, 100 ug / ml tRNS, 1% BSA; Washing buffer - PBS, 4.5 mM MgC12, 0,005% Tween-20; Binding buffer - PBS, 4.5 mM MgC12. lOOug / ml tRNS, 0,005% Tween-20.

[0054]

[0028] ELONA Protocol. Coat Ni-NTA HisSorb plates with 2.5 pg / mL His-tagged Plasmodium spp. LDH in PBS. Add 100 pL of protein solution to each well and incubate for 1 hour at room temperature (RT). Remove the solution from the wells and perform blockingby adding 200 pL of blocking buffer per well. Incubate for 1 hour at RT. Wash the plate three times with 230 pL / well of washing buffer. Prepare 1 pM aptamer solutions inbinding buffer and fold them by heating at 95°C for 5 minutes, followed by cooling at RT for 5 minutes. Apply aptamer solutions in serial dilutions to the plate. Adjust concentrations as necessary, with an initial gradient of 1 pM to 0.064 nM. Incubate for 1 hour at RT. Remove the solution from the wells and wash the plate three times with 230 pL / well of washing buffer. Add 100 pL / well of poly-HRP-streptavidin solution diluted 1:2000 in blocking buffer and incubate for 5 minutes at RT. Wash the plate three times with 230 pL / well of washing buffer. Add 100 pL / well ofTMB substrate and incubate for 5 minutes at RT in the dark. Add IM sulfuric acid as a stop solution and immediately measure optical density (OD) at 450 nm.

[0055]

[0029] Isothermal titration calorimetry. ITC experiments were performed on a PEAQ ITC instrument (Malvern Panalytical) in PBS as the reaction buffer. Pf-LDH and Pf-LDH4t (SEQ ID N0.:7) aptamer concentrations were determined using absorption at 280 nm and 260 nm, respectively. ITC experiments were performed with 10 pM Pf-LDH in the cell and 50 or 100 pM aptamer Pf-LDH4t (SEQ ID N0.:7) in the syringe at25°C, with 750 RPM stirring, DP = 4.0 pcal / sec. Injection volumes of 1.3 or 2 pl were used. Thermogram integration and isotherm fitting were performed using the PEAQ ITC analysis software (Malvern Panalytical). Isotherms were fitted to a 1:1 binding model with variable stoichiometry and fixed concentrations. Offset subtraction was implemented to account for injection heats.

[0056]

[0030] Crystallography. Lactate dehydrogenase amino acid sequence from Plasmodium falciparum (pfLDH, GenBank accession number ABY76169.1) was complemented with a cleavable N-terminal His-tag. The corresponding E. coli codon-optimized nucleotide sequence was ordered in company BioCat, cloned in between restriction sites Ncol and PstI of expression vector pETDuet-1. The pETDuet-l-6xH-pfLDH plasmid was transformed into chemically competent E. coli BL21(DE3) cells for the production of the protein. Pf-LDH was purified. Since the His-tag did not seem to interfere with any downstream process, cleavage by TEV protease was not performed. Aptamer was dissolved in 20 mM tris-HCl, 10 mM MgCh.and mixed with purified pfLDH in molar ratio 1:1 to LDH monomer. The protein concentration in mixture was 5 mg / ml. The mixture was incubated overnight at +4°C and further purified by Superdex200 (16 / 600) column (Cytiva) equilibrated to 20 mM tris-HCl, 10 mM MgCh. Fractions of 1 mL volume were collected and UV absorbancemonitored at both 260 and 280 nm. The purified Pf-LDH-aptamer complex was concentrated to 10 mg / ml using Amicon Ultra-15 10K filtration unit and subjected to crystallization using sitting drop evaporation technique and several crystallization kits from Molecular Dimensions. The crystals were briefly soaked in mother liquor supplemented with 30% glycerol, flash-frozen in liquid nitrogen and sent for data collection to beamline iO 4 of Diamond Light source, UK. The data were collected and auto processed in a fully automated mode. The best data set had resolution of 1.9A. The structure was solved by molecular replacement, using protein part of PDB entry 3ZH2 as a search model in CCP4 suite

[0011] program Molrep

[0012] , The initial electron density map clearly showed features ofbound DNA aptamer at an interface oftwo monomers in roughly the same place as in 3ZH2, except that no similar density could be observed in the symmetrically located monomer interface in the other end of LDH tetramer. The DNA chain was manually built in COOT

[0013] and refined in REFMAC

[0014] ,

[0057]

[0031] The disclosed Plasmodium spp. LDH specific aptamers could be combined in the biosensor to ensure P. falciparum recognition. P. falciparum is responsible for the majority of malaria-related deaths worldwide due to its ability to rapidly multiply in the bloodstream, leading to severe complications such as cerebral malaria, severe anemia, and multi-organ failure. If left untreated, P. falciparum malaria can progress to a fatal outcome within 24 hours, thus a rapid detection and identification of the species of infection agent is very important. Aptamers Pf-LDH2 / t, Pf-LDH4 / t, Pf-LDH5 could serve as detection aptamers to distinguish P. ovale. P. ovale causes a milder form of malaria but is associated with dormant liver-stage parasites (hypnozoites), which can reactivate and trigger a relapse of infection. Therefore, accurate identification of P. ovale is essential to ensure complete parasite eradication and prevent disease recurrence, of the parasite that can reactivate weeks, months, or even years after the initial infection. Thus, its identification is important to ensure a complete parasite eradication and to avoid relapse of the disease. Differentiating malaria-causing species is crucial for assisting healthcare professionals in selecting the most appropriate treatment.

[0058]

[0032] Therefore, disclosed aptamers are useful for detecting Plasmodium spp. LDH in biological samples, enabling the identification of Plasmodium infections. The aptamersmay be employed in various diagnostic formats, including but not limited to: ELONA assays, where aptamers are coated onto plates for enzyme-linked detection; lateral flow assays, in which aptamers are immobilized on test strips for rapid malaria testing; biosensors, integrating aptamers with electrochemical or optical readout systems for realtime malaria diagnosis. The use of aptamers in malaria diagnostics offers advantages over antibody-based methods, including higher stability, reduced batch-to-batch variability, and enhanced specificity. These aptamers can be applied to point-of-care testing, laboratory diagnostics, and field-based surveillance of malaria infections.

[0059]

[0033] The aptamers (SEQ ID NOs: 1-7), which specifically bind to Plasmodium falciparum LDH (Pf-LDH), can be incorporated into diagnostic compositions for detecting malaria in biological samples. These compositions may include a single aptamer or a combination of aptamers, depending on the target pathogen. For Pf-LDH detection, aptamers (SEQ ID NOs: 1-7) may be used. In some embodiments, a combination of several Pf-LDH- specific aptamers may be utilized for broader malaria species detection. The diagnostic composition may be formulated as a liquid solution, lyophilized powder, or immobilized on a solid-phase support, depending on the intended assay format. The aptamers may be used individually or as part of a multiplex detection system, optionally in combination with other malaria biomarkers. The composition may further comprise stabilizing agents, buffers, and auxiliary reagents to maintain aptamer functionality.

[0060]

[0034] The invention further provides a diagnostic kit for malaria detection, comprising at least one aptamer capable of binding Pf-LDH, facilitating the identification of Plasmodium spp. in a biological sample. The kit may include: aptamers in solution or immobilized on a solid support (e.g., microtiter plates, biosensor surfaces, lateral flow membranes); binding and washing buffers to optimize aptamer-target interactions; detection reagents, including enzyme -linked, fluorescent, or electrochemical labels for readout; positive and negative control samples for assay validation. The kit may be configured for enzyme-linked oligonucleotide assays (ELONA), lateral flow tests, biosensors, or other malaria diagnostic platforms. Additionally, in some embodiments, the kit contains Pf-LDH- specific aptamers (SEQ ID NOs: 1-7) to enable the detection of multiple malaria species, enhancing diagnostic accuracy.

[0035] In another embodiment, the aptamers are integrated into a biosensor for detecting Plasmodium spp. LDH in a biological sample. The biosensor comprises: an immobilized DNA aptamer functionalized on a transducer surface, such as a gold electrode, silicon chip, or optical sensor; a transduction mechanism that generates a measurable signal upon aptamer-target binding, including electrochemical, optical, or piezoelectric detection; a signal processing unit to analyze the response and determine the presence or absence of Pf-LDH. The biosensor may be implemented in portable malaria diagnostic devices or laboratory-based detection systems. It provides rapid, label-free detection with high specificity, making it suitable for point-of-care applications in endemic regions (Table 3). Table 3. The characterization of aptamer species recognition and their potential role in a malaria detection biosensor

[0061]

[0062] References

[0063] [1] X. Martianez-Vendrell et al., "Quantification of malaria antigens PfHRP2 and pLDH by quantitative suspension array technology in whole blood, dried blood spot and plasma,” Malar J, vol. 19, no. 1, p. 12, Dec. 2020, doi: 10.1186 / sl2936-019-3083-5.

[0064] [2] D. Nolder et al., "Failure of rapid diagnostic tests in Plasmodium falciparum malaria cases among travelers to the UK and Ireland: Identification and characterisation of the parasites,” International Journal of Infectious Diseases, vol. 108, pp. 137-144, Jul. 2021, doi: 10.1016 / j.ijid.2021.05.008.

[0065] [3] S. M. Feleke etal., "Field performance of Plasmodium falciparum lactate dehydrogenase rapid diagnostic tests during a large histidine-rich protein 2 deletion survey in Ethiopia,” Malar J, vol. 21, no. 1, p. 236, Aug. 2022, doi: 10.1186 / sl2936-022-04257-9.

[0066] [4] J. Zhou and J. Rossi, "Aptamers as targeted therapeutics: current potential and challenges,” Nat Rev Drug Discov, vol. 16, no. 3, pp. 181-202, Mar. 2017, doi: 10.1038 / nrd.2016.199.

[0067] [5] Y.-W. Cheung, R. M. Dirkzwager, W.-C. Wong, J. Cardoso, J. D rc Neves Costa, and J. A.

[0068] Tanner, "Aptamer-mediated Plasmodium-specific diagnosis of malaria,” Biochimie, vol.

[0069] 145, pp. 131-136, Feb. 2018, doi: 10.1016 / j.biochi.2017.10.017.

[0070] [6] Y.-W. Cheung, J. Kwok, A. W. L. Law, R. M. Watt, M. Kotaka, and J. A. Tanner, "Structural basis for discriminatory recognition of Plasmodium lactate dehydrogenase by a DNA aptamer,” Proc. Natl. Acad. Sci. U.S.A., vol. 110, no. 40, pp. 15967-15972, Oct. 2013, doi: 10.1073 / pnas.1309538110.

[0071] [7] S. Lee, K.-M. Song, W. Jeon, H. Jo, Y.-B. Shim, and C. Ban, "A highly sensitive aptasensor towards Plasmodium lactate dehydrogenase for the diagnosis of malaria,” Biosensors and Bioelectronics, vol. 35, no. 1, pp. 291-296, May 2012, doi: 10.1016 / j.bios.2012.03.003.

[0072] [8] K.-A. Frith et al., "Towards development of aptamers that specifically bind to lactate dehydrogenase of Plasmodium falciparum through epitopic targeting,” Malar J, vol. 17, no. 1, p. 191, Dec. 2018, doi: 10.1186 / sl2936-018-2336-z.

[0073] [9] S. S. Nundu et al., "Malaria parasite species composition of Plasmodium infections among asymptomatic and symptomatic school-age children in rural and urban areasof Kinshasa, Democratic Republic of Congo,” Malar J, vol. 20, no. 1, p. 389, Dec. 2021, doi: 10.1186 / S12936-021-03919-4.

[0074]

[0010] K. Pleiko et al., "Targeting triple-negative breast cancer cells with a pi-integrin binding aptamer,” Molecular Therapy - Nucleic Acids, vol. 33, pp. 871-884, Sep. 2023, doi: 10.1016 / j.omtn.2023.08.015.

[0075]

[0011] M. D. Winn et al., "Overview of the CCP 4 suite and current developments,” Acta Crystallogr D Biol Crystallogr, vol. 67, no. 4, pp. 235-242, Apr. 2011, doi: 10.1107 / S0907444910045749.

[0076]

[0012] A. Vagin and A. Teplyakov, “MOLREP : an Automated Program for Molecular Replacement,” J Appl Crystallogr, vol. 30, no. 6, pp. 1022-1025, Dec. 1997, doi: 10.1107 / S0021889897006766.

[0077]

[0013] P. Emsley and K. Cowtan, "Coot : model-building tools for molecular graphics,” Acta Crystallogr D Biol Crystallogr, vol. 60, no. 12, pp. 2126-2132, Dec. 2004, doi: 10.1107 / S0907444904019158.

[0078]

[0014] G. N. Murshudov, A. A. Vagin, and E. ]. Dodson, "Refinement of Macromolecular Structures by the Maximum-Likelihood Method,” Acta Crystallogr D Biol Crystallogr, vol. 53, no. 3, pp. 240-255, May 1997, doi: 10.1107 / S0907444996012255.

Claims

Claims1. A ssDNA aptamer specifically binding to Plasmodium falciparum LDH (Pf-LDH), wherein the ssDNA aptamer has a base sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

2. A ssDNA aptamer specifically binding to Plasmodium falciparum LDH (Pf-LDH), wherein the ssDNA aptamer has a truncated base sequence of SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.

3. A composition for diagnosis of malaria, comprisingthe ssDNA aptamer of claim 1 and / or claim 2.

4. A kit for in vitro detecting malaria in a biological sample, the kit comprising at least one ssDNA aptamer according to claim 1 and claim 2.

5. A biosensor for in vitro detecting malaria in a biological sample, the biosensor comprising: (i) at least one immobilized ssDNA aptamer according to claim 1 and claim 2; (ii) a transducer element configured to generate a detectable signal upon aptamer-LDH binding; and (hi) a signal processing unit configured to determine the presence or absence of Plasmodium falciparum in the biological sample.

6. Use of a ssDNA aptamer according to claim 1 or claim 2 for detecting Plasmodium falciparum LDH (Pf-LDH) in a biological sample.