Small molecule retinoic acid-inducible gene-i (RIG-i) agonists, methods of identifying same, and methods of use thereof

Abstract

The disclosure relates, in part, to retinoic acid-inducible gene-I (RIG-I) agonists, methods of identifying the same, and methods of use thereof. In certain embodiments, the compounds of the disclosure are useful for treating, preventing, and / or ameliorating cancer and / or viral infections in a subject. In certain embodiments, the compounds of the disclosure are useful for promoting or inducing an immune response in a subject.

Description

[0001] Attorney Docket No. 047162-7563WOl(02825)

[0002] TITLE OF THE INVENTION

[0003] Small Molecule Retinoic Acid-Inducible Gene-I (RIG-I) Agonists, Methods of Identifying Same, and Methods of Use Thereof

[0004] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U. S. C. § 119(e) to U. S. Provisional Patent Application No. 63 / 761,561, filed February 21, 2025, which is incorporated herein by reference in its entirety.

[0005] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0006] The XML file named "047162-7563WO1_Sequence_Listing.xml" created on February 16, 2026, comprising 13,476 bytes, is incorporated herein by reference in its entirety.

[0007] BACKGROUND

[0008] Retinoic acid-inducible gene-I (RIG-I) serves as the first line of defense against invasive RNA viruses, such as influenza viruses, coronaviruses, flaviviruses and others. As a cytoplasmic protein expressed in nearly all nucleated cells, RIG-I detects viral RNAs with distinct features, such as blunt double-stranded structures and 5’-end triphosphates.

[0009] Structurally, RIG-I comprises two RecA-like domains (Hell and Hel2), a conserved insertion domain (Hel2i), a C-terminal domain (CTD), and two N-terminal caspase-recruiting domains (CARDs). In its inactive state, RIG-I adopts an auto-repressed conformation, with CARDs bound to Hel2i. Upon binding viral RNA, RIG-I undergoes conformational changes that expose the CARDs, enabling polyubiquitination and interaction with mitochondrial antiviral signaling (MAVS) protein. This triggers type I and III interferons and cytokines to amplify immune responses. Beyond antiviral roles, RIG-I has emerged as a therapeutic target in cancer immunotherapy due to its ability to activate interferons and induce immunogenic cell death.

[0010] Given the potential of targeting RIG-I for antiviral, vaccine adjuvant, and antitumor therapies, significant researches have been devoted to developing synthetic RIG-I agonists. Efforts to target RIG-I have focused on RNA ligands, natural activators of RIG-I.

[0011] Specifically, a family of short, triphosphorylated stem-loop RNAs (SLRs) was designed to function as specific and potent ligands. SLRs have been shown to exhibit nanomolar binding affinity to RIG-I in vitro and activate RIG-I in a specific manner in various cellular models.Attorney Docket No. 047162-7563WOl(02825)

[0012] In mice, SLRs induce type I interferons, subsets of interferon-stimulated genes (ISGs), and cellular remodeling factors. For example, SLR14, a 14-base-pair RIG-I agonist, significantly delays tumor growth and protects against lethal SARS-CoV-2 infection.

[0013] Efforts have also been directed toward developing small molecules to modulate this pathway. Compared to macromolecular RNAs, small molecule modulators, organic compounds with low molecular weight, are the cornerstone of marketed drugs due to their superior pharmacokinetic (PK) properties, cost-effectiveness, improved patient compliance, and ease of production, storage, and transportation. However, knowledge of RIG-I small molecule agonists remains limited, with only a few identified through virus-related functional assay or cell-based assays targeting IRF3 activation, a downstream event of RIG-I-like receptors (RLRs) such as RIG-I. MDA5, and LGP2, Despite their efficacy as influenza vaccine adjuvants, their mechanisms of action remain unclear.

[0014] There is thus a need in the art for RIG-I agonists and methods of use same for treating, preventing, and / or ameliorating disease, disorders, or infections (e g., viral infection(s) and / or cancer) and / or inducing or promoting an immune response. The present disclosure addresses this need.

[0015] BRIEF SUMMARY OF THE INVENTION

[0016] In one aspect, the disclosure provides a method for treating, preventing, and / or ameliorating a viral infection in a subject, the method comprising administering to a subject in need thereof at least one compound of formula (I), or a salt or isotopologue thereof, wherein R1, R2a, R2b, R3, and R4are defined elsewhere herein:

[0017] R2aR2bO

[0018] R1^N^R4

[0019]

[0020] R3(I).

[0021] In another aspect, the disclosure provides a method for treating, preventing, and / or ameliorating cancer in a subject, the method comprising administering to a subject in need thereof at least one compound of formula (I), or a salt or isotopologue thereof, wherein R1, R2a, R2b, R3, and R4are defined elsewhere herein:

[0022] R2a R2bO

[0023] R1W4

[0024] 3(I).

[0025] In one aspect, the disclosure provides a method for promoting or inducing an immune response in a subject, the method comprising administering to a subject in need thereof atAttorney Docket No. 047162-7563WOl(02825)

[0026] least one compound of formula (I), or a salt or isotopologue thereof, wherein R1, R2a. R2b, R3, and R4are defined elsewhere herein:

[0027] □2a p2b Q

[0028] V A

[0029] R1\^N^R4

[0030]

[0031] R3(I).

[0032] In another aspect, the disclosure provides a method for identifying a Retinoic Acid-Inducible Gene-I (RIG-I) agonist, the method comprising:

[0033] (a) contacting a test compound with a dual -labeled RIG-I, wherein the duallabeled RIG-I comprises a RIG-I protein covalently conjugated to:

[0034] (i) a fluorescent molecule at an Hel2i domain thereof; and (ii) a fluorescence quencher at an N-terminus of a caspase activation and recruitment domain (CARD) thereof;

[0035] (b) measuring fluorescence intensity; and

[0036] (c) comparing the fluorescence intensity to positive and negative controls.

[0037] BRIEF DESCRIPTION OF THE FIGURES

[0038] The drawings illustrate generally, by way of example, but not by way of limitation, various embodiments of the present application.

[0039] FIGs. 1A-1D: Dual-labeled FIG. I design and workflow. FIG. 1A: the CARD2 domain is ejected when RIG-I transitions from its autoinhibited conformation to the open conformation upon agonist activation. The autoinhibited structure is represented by duck RIG-I (PDB: 4A2W) aligned with the human Hel2i domain (PDB: 3ZD6, orange). In the open conformation (PDB: 5F9H, with CARD2 domain added from PDB: 2LWD). BHQ10 (left side, top star) is placed at the N-terminus of CARD2, while AZDye488 (left side, bottom star) is positioned at residue D527 within Hel2i. FIG. IB: a schematic overview of the duallabeling process for RIG-I, illustrating key steps in the methods. FIG. 1C (top): gel filtration elution chromatography of AZDye488-labeled RIG-I monitored at absorbance wavelengths of 280 nm, 494 nm, and 550 nm. The 550 nm signal, used to detect BHQ10 labeling, remains at baseline in the AZDye 488-labeled RIG-I sample, confirming the absence of BHQ10. The y-axis represents absorbance units, and the x-axis represents the elution volume (mL). FIG.

[0040] 1C (bottom): AzF-incorporated RIG-I and control RIG-I (without AzF) were incubated with AzDye 488. In-gel fluorescence image acquired using a 525BP20 filter (excitation at 488 nm, emission centered at 525 nm with a 20 nm bandwidth), confirming specific labeling of RIG-I with AZDye 488. Non-specific labeling was minimized by adding 5 mM DTT. CoomassieAttorney Docket No. 047162-7563WOl(02825)

[0041] staining visualized total protein after fluorescence imaging. FIG. ID: The dual-labeled RIG-I elution profile was monitored at 280 nm, 494 nm, and 550 nm absorbance wavelengths.

[0042] FIGs. 2A-2D: High-throughput screening (HTS) assay optimization and testing. FIG.

[0043] 2A: The RIG-I agonist p3SLR14 significantly increased fluorescence due to CARD2 ejection, whereas p3NS had no effect. Benzonase treatment restored fluorescence to no-RNA baseline. Data were analyzed by one-way ANOVA and normalized to no-RNA controls and p3SLR14-treated samples (Eq. 1). Error bars indicate s.e.m. with n > 8 biological replicates FIG. 2B: the Z'-factor, a measure of assay quality, was evaluated over time at RIG-I concentrations of 10 nM, 5 nM, and 1 nM. Z' was calculated using at least five biological replicates to assess assay performance. FIG. 2C: the Z'-factor was measured at 4 °C, 25 °C (room temperature), and 37 °C for RIG-I concentrations of 10 nM and 5 nM to evaluate the impact of temperature on assay qualify. FIG. 2D: relative fluorescence levels were measured across increasing ligand concentrations to evaluate dose dependence. Data represent three replicates per concentration, with error bars indicating the standard error of the mean (s.e.m.) with n=3.

[0044] FIGs. 3A-3D: Identification, validation, and structure-activify-relationship (SAR) summary of RIG-I agonists. FIG. 3 A: hit compound 6 was identified in the primary screen, displaying 29% activation. Responses were normalized as described in Eq. 1, with the hit threshold set at 15% activation, equivalent to three standard deviations above the average response. The Z'-factor for the plate was 0.67. indicating robust assay performance. FIG. 3B: compound 6 demonstrated dose-dependent activation in the fluorescence quenching assay, with an EC50of 0.25 ± 0.06 μM. Data represent four biological replicates, and error bars indicate the standard error of the mean (s.e.m.). EC50values were determined using a 4-parameter logistic function fitted with GraphPad Prism. FIG. 3C: summary of SAR studies on compound 6, with the molecule color-coded to highlight functional regions A, B, and C. Panels corresponds to specific regions of modification: region A (z.e., compounds 75, 83, 30, 95, and 96), region B (z.e., compounds 28 and 63), and region C (z.e., compound 29). FIG.

[0045] 3D: binding affinity characterization of compounds to CARD deleted RIG-I by SPR. The SPR binding sensorgram of compound 95 to RIG-I is rendered.

[0046] FIGs. 4A-4I: compound 95 activates the RIG-I pathway with high specificity and low cytotoxicity. FIG. 4A: the cytotoxicity of compound 95 was evaluated using the MTS assay in A549-Dual cells. Cells were treated with various concentrations of compound 95 for 24 hours, and viability was assessed. IC50values were calculated using a four-parameter logistic model, yielding an IC50of 291.6 μM. Data represent the mean ± s.e.m. from three biologicalAttorney Docket No. 047162-7563WOl(02825)

[0047] replicates. FIG. 4B: A549-Dual cells were treated with 200 pM compound 95 for 3, 6, 12, and 24 hours, followed by medium replacement. Peak RIG-I pathway activation was observed at 12 hours. Data represent the mean ± s.e.m. from six biological replicates. FIG. 4C: a robust dose-dependent response was observed in A549-Dual cells, while RIG-I knockout (KO) cells exhibited minimal activation, confirming specificity. Fold changes in luciferase activity were measured after 12 hours of compound 95 treatment and normalized to DMSO-treated controls. Data represent the mean ± s.e.m. from three biological replicates. FIGs. 4D-4I: the activation of RIG-I-dependent interferons and interferon-stimulated genes (ISGs) was assessed following treatment with 200 pM compound 95 in A549-Dual and RIG-I KO cells. mRNA levels of IFN-0 (FIG. 4D), IFN-y (FIG. 4E), Viperin (FIG. 4F). RIG-I (FIG.

[0048] 4G), OAS1 (FIG. 4H). and ISG54 (FIG. 41) were measured by RT-qPCR. Expression levels were normalized to the housekeeping gene ACTB and are presented as fold changes relative to the vehicle control (0.2% DMSO). Data represent two biological replicates and three technical replicates (n = 6), and error bars indicate the standard error of the mean (s.e.m.).

[0049] FIGs. 5A-5E: dual-labeled RIG-I construct design. FIG. 5A: spectral compatibility of AzD488 and BHQ10 enables fluorescence quenching. The fluorescence excitation-emission spectrum of AzD488 and the absorption spectrum of BHQ10 demonstrate overlap and were normalized to their maximum values for clarity. FIG. 5B: evolutionary divergence informs BHQ10 conjugation sites on RIG-I. Residues Glu494 and Asp527 were selected for labeling due to their evolutionary divergence across species, visualized using sequence alignment with Jalview and conservation indicated by color. FIG. 5C: distance estimation between labeling sites on RIG-I. The calculated distances between residues Glu494 and Asp527 were based on the alpha carbons in the apo RIG-I structure (PDB: 4A2W), accounting for the length of the LPETGG peptide (PDB: 1T2W) added to the N terminal of CARD2 domain. FIG. 5D: absorption spectra of AzD488 and BHQ10 demonstrate their complementary spectral properties. Absorption spectra were normalized to their maximum values for comparison. FIG. 5E: Emission spectra of AZDye 488-labeled and dual-labeled RIG-I upon excitation at 480 nm. Fluorescence signals were background-corrected against buffer controls. Each data point represents the mean ± s.e.m of two replicates.

[0050] FIGs. 6A-6C: assay optimization and pilot screening. FIG. 6 A: signal-to-background (S / B) ratios were measured over time for RIG-I concentrations of 10 nM, 5 nM, and 1 nM. Higher concentrations yielded improved S / B ratios, stabilizing after 12 hours (n > 5 biological replicates). FIG. 6B: S / B ratios were evaluated for RIG-I concentrations of 10 nM and 5 nM at different temperatures. A significant drop in S / B ratios was observed at 37 °C,Attorney Docket No. 047162-7563WOl(02825)

[0051] highlighting the importance of temperature optimization. FIG. 6C: a IK pilot test was conducted across three plates, yielding an average Z' factor of 0.76 and an S / B ratio of 1.8. Responses were normalized to activation percentages using Eq. 1. Positive controls used p3SLR14, while negative controls had no RNA. Hits were defined as responses exceeding three standard deviations above the average response of all samples.

[0052] FIGs. 7A-7J: fluorescence quenching assay evaluation of SAR compounds. FIG. 7A: compound 6 does not exhibit significant fluorescence relative to DMSO. Relative fluorescence was calculated as the sample fluorescence divided by the DMSO fluorescence. Data represent the mean ± s.e.m. from four biological replicates. FIGs. 7B-7C: compounds 29 and 63 fail to eject RIG-I, even at high concentrations (n > 8 biological replicates). FIG. 7D: SAR compounds do not exhibit fluorescence across varying concentrations. Signals were normalized to DMSO emission, and data represent the mean ± s.e.m. from four biological replicates. FIGs. 7E-7J: dose-response curves for small molecule analogs 28, 83, 96, 30, 95, and 75 demonstrate their ability to eject RIG-I. Data represent the mean ± s.e.m. from four biological replicates. ECso values were calculated using a 4-parameter logistic function fitted in GraphPad Prism.

[0053] FIGs. 8A-8D: cellular evaluation of RIG-I agonist potency. FIGs. 8A-8B: treatment with 100 pM and 50 pM compound 95 significantly activated the RIG-I pathway compared to DMSO (p < 0.0001). A549-Dual cells were treated with 0.2% DMSO or the compounds for 24 hours, followed by luciferase activity measurement. Compound 30 was tested at 20 pM and 10 pM due to its low solubility. FIG. 8C: cytotoxicity was assessed using the MTS assay in A549-Dual cells. TEFD, a cytotoxic control, yielded an IC50 of 15.6 pM, while compound 95 showed significantly lower cytotoxicity with an IC50 of 291.6 pM. IC50values were calculated using a four-parameter logistic model (n = 3 biological replicates, error bars represent s.e.m.). FIG. 8D: ACTB gene expression remained unaffected by compound 95 treatment in both A549-Dual and A549-Dual RIG-I KO cells. Cells were treated w ith 200 pM compound 95 for 12 hours, and gene expression was analyzed by qPCR.

[0054] FIGs. 9A-9E: RIG-I agonist evaluation in the THP1 cell line. Dual cells were treated with increasing concentrations of small-molecule agonists (FIG. 9A) compound 95, (FIG. 9B) KIN1148, and (FIG. 9C) SB9200 or RNA agonists (FIG. 9D) p3SLR14and (FIG. 9E) LMW poly(EC) for 24 hours. Luciferase activity, driven by an interferon-stimulated response element (ISRE), was measured and reported as fold change relative to DMSO (0.5% DMSO for small molecules) or transfection reagent control (for RNA treatments). Data represent mean ± s.e.m. from three biological replicates.Attorney Docket No. 047162-7563WOl(02825)

[0055] FIGs. 10A-10D: RT-qPCR of IFNs and ISGs in THPl-Dual cells after 24 hours against treatment. FIG. 10A: Gene expression levels of antiviral cytokines IFN-Z. IFN-p. and Viperin in wild-type THP1 Dual (WT), RIG-I knockout (KO) and IRF3 KO cells measured immediately after 24 hours of treatment with 123 pM compound 95. FIGs. 10B-10D:

[0056] Comparison of the efficacy of 95, KIN1148, SLR14, and LMW poly(I: C) based on the expression levels of (FIG. 10B) IFN-Z, (FIG. 10C) IFN-P, and (FIG. 10D) Viperin in WT and RIG-I KO THP1 Dual cells at the 24-hour timepoint. Cells were treated with 123 pM 95, 10 pM KIN1148, 2000 ng / mL SLR14, or LMW poly(I: C) at the 24-hour timepoint. Expression levels were normalized to the housekeeping gene ACTB and are presented as fold changes relative to the vehicle control. Data represent at three replicates, and error bars indicate s.e.m.

[0057] FIGs. 11A-1 ID: Compound 95 induces sustained and RIG-I-dependent interferon responses in THP1 cells at 48 hours. FIG. 11 A: Gene expression levels of IFN-Z, IFN-P, and Viperin in wild-type (WT), RIG-I and IRF3 knockout (KO) THP1 Dual cells, measured 24 hours after treatment with 123 pM compound 95 for 24 hours. FIGs. 11B-11D: Comparative expression of (FIG. 11 B) IFN-Z. (FIG. 11 C) IFN-P, and (FIG. 11 D) Viperin in WT and RIG-I KO THP1 Dual cells following treatments with 123 pM 95, 10 pM KIN1148, 2000 ng / mL p3SLR14, or LMW poly(LC). Gene expression was assessed at the 48-hour timepoint.

[0058] Expression levels were normalized to the housekeeping gene ACTB and are presented as fold changes relative to the vehicle control. Data represent at three replicates, and error bars indicate s.e.m.

[0059] FIG. 12: SPR measurement of compound 95 binding to full-length RIG-I. Top: SPR sensorgram showing the binding of Compound 95 to full-length RIG-I. Bottom: Binding affinity (Kd) was determined by fitting the data to a 1: 1 kinetic binding model and is reported as the average ± SEM.

[0060] FIGs. 13A-13D: Luciferase assay evaluation of established RIG-I agonists in the A549 Dual system; luciferase responses to RIG-I RNA agonists — (FIG. 13 A) p3SLR14, (FIG. 13B) LMW poly(EC), (FIG. 13C) SB9200, and (FIG. 13D) KIN1148— were assessed in A549 Dual (WT) cells, RIG-I knockout (KO), and MAVS KO derivatives. Fold changes in luciferase activity were measured 24 hours after treatment and normalized to DMSO-treated or transfected reagent-treated controls. Data represent the mean ± s.e.m. from three biological replicates.

[0061] FIGs. 14A-14B: Compound 95 Cytotoxicity evaluation in THP1 and HEK293T cells. Cytotoxicity was assessed using (FIG. 14A) THP1 cells and (FIG. 14B) HEK293T cells using MTS assay. In THP1 Dual cells, TEFD, a cytotoxic control, yielded an ICso of 4.6 pM,Attorney Docket No. 047162-7563WOl(02825)

[0062] while 95 showed significantly lower cytotoxicity with an ICso of 190.7 pM. For HEK293T cells, TEFD yielded an IC50 of 12.1 pM, while 95 showed an ICso of 251.4 pM. IC50 values were calculated using a four-parameter logistic model, n = 4 biological replicates, error bars represent s.e.m.

[0063] FIG. 15: BIOMOL Green ATPase assay evaluation on RIG-I–mediated ATP hydrolysis. Reactions containing 50 nM purified full-length RIG-I and ATP were treated with increasing concentrations (0-80 pM) of Compound 95, with or without 150 nM p3SLR14. Data represent the mean free phosphate concentration from a minimum of four independent replicates, with error bars indicating standard deviation.

[0064] FIG. 16: ATP analogs have minimal effect on 95-induced CARD ejection. RIG-I was incubated with 40 pM compound 95, followed by the addition of the indicated ATP analogs. Statistical significance was assessed using one-way ANOVA. Error bars represent standard deviation (SD) from 16 replicate samples.

[0065] DETAILED DESCRIPTION OF THE INVENTION

[0066] Reference will now be made in detail to certain embodiments of the disclosed subject matter, examples of which are illustrated in part in the accompanying drawings. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject matter is not intended to limit the claims to the disclosed subject matter.

[0067] Throughout this document, values expressed in a range format should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a range of "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include notjust about 0.1% to about 5%, but also the individual values (e.g, 1%, 2%, 3%, and 4%) and the sub-ranges (e.g, 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. The statement "about X to Y" has the same meaning as "about X to about Y," unless indicated otherwise. Likewise, the statement "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z," unless indicated otherwise.

[0068] In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as " A, B, or A and B." In addition, it is to beAttorney Docket No. 047162-7563WOl(02825)

[0069] understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference.

[0070] In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.

[0071] Description

[0072] As indicated elsewhere herein, although efforts have been directed toward the development of small molecule RIG-I agonists, there remains a dearth of such compounds. Thus, in one aspect, the disclosure relates to the development of methods suitable to identify RIG-I agonists. In another aspect, the disclosure relates to exemplary' RIG-I inhibitors and methods of use thereof for various indications (e.g., viral infections, cancer, and immunomodulatory diseases, inter alia).

[0073] The present disclosure describes the identification of the first class of direct-acting RIG-I agonists that specifically initiate the essential activation step of RIG-I signaling: the release of signaling domains (CARDs) from the autoinhibited inactive form of RIG-I, termed " CARD flip-out." To achieve this, a fluorescence quenching assay was developed and optimized to monitor CARD ejection as a critical activation event. Fine-tuning key biochemical parameters enabled the assay to be adapted for high-throughput screening (HTS), providing a robust tool for identifying small molecules with precise CARD-flipping activity. The developed RIG-I agonists featuring aN-benzhydryl-2.5-dioxo-l,2,5,6,7,8-hexahydroquinoline-3-carboxamide skeleton structure with phenyl substitutions that enhance their activity. These compounds demonstrated nanomolar in vitro ECso values for CARD ejection and RIG-I activation. Furthermore, in cellular assays, the optimized compound selectively activated interferons (IFNs) and ISGs in A549-Dual cells, confirming a targeted mechanism of action.

[0074] To highlight the significance of these findings, it is essential to review previouslyAttorney Docket No. 047162-7563WOl(02825)

[0075] identified RIG-I agonists, such as Inarigivir soproxil (SB9200) from Spring Bank Pharmaceuticals. Inc. and KIN 1148 and its analogs from Kineta Inc., which have shaped the current understanding of RIG-I-based small molecule therapies. These compounds were identified through downstream phenotypic screening for antiviral activities but lack clarity on their precise mechanisms of RIG-I activation. SB9200, an orally bioavailable dinucleotide prodrug, was initially optimized for anti-hepatitis B virus (HBV) activity and demonstrated broad-spectrum antiviral efficacy against RNA viruses like HCV and HBV. It progressed to Phase I clinical trials for HBV and HCV but was halted in Phase II due to safety concerns. SB9200 is believed to engage RIG-I and nucleotide-binding oligomerization domaincontaining protein 2 (NOD2), inducing the interferon (IFN) signaling cascade for antiviral defense, as supported by binding assays. However, the precise mechanism and direct evidence of RIG-I activation remain unclear, highlighting the critical need for a stronger understanding of how it activates the RIG-I pathway to ensure safe and effective therapeutic applications.

[0076] Similarly, KIN1148 and its analogs, identified through cell-based assays, exhibit robust antiviral activity and enhance influenza vaccine efficacy. These isoflavone-containing molecules, which target HCV and influenza, function as IRF3 agonists by inducing dosedependent nuclear translocation of IRF3 and upregulating IRF3-dependent genes such as ISG54 and OASL. Although KIN1148 binds to RIG-I, the precise details of how it activates RIG-I, including the specific domains and mechanism involved, remain unclear.

[0077] Additionally, it also pulls down MDA5 alongside RIG-I, raising questions about its primary pathway of action. Despite these uncertainties, the IRF3 activation and IFN production induced by small molecules demonstrate their potential for therapeutic applications targeting the RLR pathway. The disclosure addresses these gaps by providing direct evidence that the identified compounds activate RIG-I through CARD ejection, a mechanism mimicking natural RNA agonists. The optimized compound 95 also induce IFNs (e.g., IFN-a, IFN-y) and ISGs in cellular assays. This work lays a strong foundation for developing precise and effective RIG-I-targeted antiviral therapeutics, with potential applications in immunotherapy and vaccine development.

[0078] A notable core in the identified pharmacophore is an oxidized derivative of the tetrahydroquinoline (THQ) moiety, designated as region C herein. THQ is recognized as a pharmacologically active scaffold with various biological activities. Specifically, a significant number of THQ-based bioactive compounds have exhibited potent antiviral properties against human immunodeficiency virus (HIV). Some of these compounds have been found toAttorney Docket No. 047162-7563WOl(02825)

[0079] decrease HIV transcription in several cell lines through the NF-KB pathway. Without wishing to be bound by any theory, and given that RIG-I is part of the effector mechanism in this pathway, this correlation suggests a potential mechanism of action for these THQ-containing compounds in HIV studies, where modulation of the NF-KB pathway through RIG-I might play a crucial role.

[0080] As described herein, compound 95 demonstrated potential as an antiviral small molecule by specifically activating RIG-I and upregulating downstream immune responses, including interferons (IFN-a, IFN-y) and interferon-stimulated genes (ISGs). Notably, compound 95 increased viperin expression by 35-fold, compared to an 8-fold increase in non-RIG-I pathways. Viperin is a well-characterized antiviral protein that inhibits the replication of various viruses, including West Nile virus, dengue virus, and HIV-1, all of which are known to be targeted by RIG-I pathways. This suggests that our identified agonists have the potential to be evaluated in functional antiviral tests, especially considering that RIG-I activation induces broad-spectrum antiviral effects. Despite the promising nanomolar-level activation observed in vitro, compound 95 exhibited an ECso approximately 600- to 900-fold higher in cellular assays. This discrepancy could be attributed to inefficient cellular delivery of the compound, possibly due to poor solubility or sequestration by other receptors, common challenges in the development of novel small-molecule drugs. Indeed, compound 95 contains multiple phenyl groups that may reduce its solubility in aqueous conditions. Nonetheless, the identified RIG-I agonists are promising compounds, which provide a robust pharmacophore and a set of candidates for further hit optimization.

[0081] An important aspect of this study is the use of CARD ejection as a direct readout for RIG-I activation in high-throughput screening (HTS). CARD ejection is a well-established essential step in RIG-I activation, with previous studies showing that overexpression of CARD domains alone can activate IRF3 and induce type I interferon production. In the assay design, the first CARD domain was truncated to minimize the distance between the fluorophore and quencher, thereby enhancing quenching efficiency. Using the assay, the ejection ability of SLR14 was compared to with two different blunt ends: 5'-triphosphorylated SLR14 (p3SLR14), which mimics viral PAMPs. and 5'-hydroxyl SLR14 (OHSLR14), representing abundant host dsRNA in the cytoplasm. These results showed that the CARD2 domain was ejected by dsRNAs regardless of their terminal modifications, consistent with previous structural studies on RIG-I complexes with these RNAs and FRET studies on CARDs domain dynamics. More importantly, this assay provided quantitative ECso values to evaluate the ejection potency of RIG-I ligands. p3SLR14 exhibited a lowerAttorney Docket No. 047162-7563WOl(02825)

[0082] EC so than OH-SLR14, indicating higher potency in inducing CARD ejection. These EC50 values closely align with previously measured binding affinities (Kd) of similar ligands to full-length RIG-I, providing quantitative evidence supporting the RIG-I activation model, wherein RNA binding alone can release the CARD domains into solution. Overall, the assay of the disclosure has demonstrated its utility as a direct method for evaluating RNA potency as RIG-I ligands. This assay also enables further exploration of RIG-I activation by incorporating ATP analogs.

[0083] Notably, the assay targets the challenging, relatively flat Hel2i-CARD interface and applies fluorescence quenching as an alternative to conventional FRET assays. In the past, fluorophore-quencher schemes have been widely employed in RNA and RNA-protein interaction studies, including splicing assays, molecular beacon assays, and FRET-based studies, to identify small molecules modulating ribozyme activities, microRNA biogenesis, and other RNA-related processes. The quenchers were usually conjugated to the ends of RNAs via chemical synthesis to prevent degradation through aqueous contact. However, the use of quenchers in protein-based assays has been limited by complex conjugation chemistry and the scarcity of water-soluble, high-quality quenchers. In the present disclosure, these challenges were overcome by combining established labeling methods, such as sortase-mediated terminus labeling and SPAAC click chemistry, with high-quality, water-soluble fluorophores and quenchers like BHQ-10. This approach allowed labeled proteins to undergo multiple cycles of gel filtration in aqueous environments, achieving the purity required for HTS. The labeling schemes and assay design described herein, leveraging protein conformational dynamics, provides a model for developing screening assays for other large, multidomain proteins like RIG-I (>100 kDa).

[0084] Thus, in one aspect, the disclosure relates to the development of a novel fluorescence quenching assay optimized for high-throughput screening of RIG-I agonists. This assay provides a framework for applying diverse labeling chemistries to study large, dynamic, multi-domain proteins. In another aspect, using this platform, anew class of small-molecule RIG-I agonists were identified, with a well-defined mechanism of action via CARD ejection. The optimized agonist demonstrated potent interferon responses in cellular models, offering valuable tools for the development of RIG-I-targeted small-molecule therapeutics for antiviral and antitumor applications.

[0085] Definitions

[0086] The term "about" as used herein can allow for a degree of variability in a value orAttorney Docket No. 047162-7563WOl(02825)

[0087] range, for example, within 10%, within 5%, or within 1% of a stated value or of a stated limit of a range, and includes the exact stated value or range.

[0088] The term "alkenyl" as used herein refers to straight and branched chain and cyclic alkyl groups as defined herein, except that at least one double bond exists between two carbon atoms. Thus, alkenyl groups have from 2 to 40 carbon atoms, or 2 to about 20 carbon atoms, or 2 to 12 carbon atoms or, in some embodiments, from 2 to 8 carbon atoms.

[0089] Examples include, but are not limited to vinyl, -CH=C=CCH2, -CH=CH(CH3), -CH=C(CH3)2, -C(CH3)=CH2, -C(CH3)=CH(CH3), -C(CH2CH3)=CH2, cyclohexenyl, cyclopentenyl, cyclohexadienyl, butadienyl, pentadienyl, and hexadienyl among others.

[0090] The term "alkoxy" as used herein refers to an oxygen atom connected to an alky l group, including a cycloalkyl group, as are defined herein. Examples of linear alkoxy’ groups include but are not limited to methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy, and the like. Examples of branched alkoxy include but are not limited to isopropoxy, sec-butoxy, tert-butoxy, isopenty loxy, isohexyloxy, and the like. Examples of cyclic alkoxy include but are not limited to cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, and the like. An alkoxy group can include about 1 to about 12, about 1 to about 20, or about 1 to about 40 carbon atoms bonded to the oxygen atom, and can further include double or triple bonds, and can also include heteroatoms. For example, an allyloxy group or a methoxyethoxy group is also an alkoxy group within the meaning herein, as is a methylenedioxy group in a context where two adjacent atoms of a structure are substituted therewith.

[0091] The term "alkyl" as used herein refers to straight chain and branched alkyl groups and cycloalkyl groups having from 1 to 40 carbon atoms, 1 to about 20 carbon atoms, 1 to 12 carbons or, in some embodiments, from 1 to 8 carbon atoms. Examples of straight chain alky l groups include those with from 1 to 8 carbon atoms such as methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups. Examples of branched alkyl groups include, but are not limited to, isopropyl, iso-butyl, sec-butyl, t-butyl, neopentyl, isopentyl, and 2,2-dimethylpropyl groups. As used herein, the term "alkyl" encompasses n-alkyl, isoalkyl, and anteisoalkyl groups as well as other branched chain forms of alkyl. Representative substituted alkyl groups can be substituted one or more times with any of the groups listed herein, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups.

[0092] The term "alkylene" or "alkylenyl" as used herein refers to a bivalent saturated aliphatic radical (e.g., -CH2-, -CH2CH2-, and -CH2CH2CH2-. inter alia). In certain embodiments, the term may be regarded as a moiety derived from an alkene by opening of the double bond or from an alkane by removal of two hydrogen atoms from the same (e.g, -Attorney Docket No. 047162-7563WOl(02825)

[0093] CH2-) different (c.g.. -CH2CH2-) carbon atoms.

[0094] The term "alkynyl" as used herein refers to straight and branched chain alkyl groups, except that at least one triple bond exists between two carbon atoms. Thus, alkynyl groups have from 2 to 40 carbon atoms, 2 to about 20 carbon atoms, or from 2 to 12 carbons or, in some embodiments, from 2 to 8 carbon atoms. Examples include, but are not limited to -CACH. -OC(CH3), -CAC(CH2CH3). -CH2C=CH. -CH2OC(CH3), and -CH2C=C(CH2CH3) among others.

[0095] The term "aryl" as used herein refers to cyclic aromatic hydrocarbon groups that do not contain heteroatoms in the ring. Thus ar l groups include, but are not limited to, phenyl, azulenyl, heptalenyL biphenyl, indacenyl, fluorenyl, phenanthrenyl, triphenylenyl, pyrenyl, naphthacenyl, chrysenyl, biphenylenyl, anthracenyl, and naphthyl groups. In some embodiments, aryl groups contain about 6 to about 14 carbons in the ring portions of the groups. And groups can be unsubstituted or substituted, as defined herein. Representative substituted aryl groups can be mono-substituted or substituted more than once, such as, but not limited to, a phenyl group substituted at any one or more of 2-, 3-, 4-. 5-, or 6-positions of the phenyl ring, or a naphthyl group substituted at any one or more of 2- to 8-positions thereof.

[0096] The term "cycloalkyl" as used herein refers to cyclic alkyl groups such as, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl groups. In some embodiments, the cycloalkyl group can have 3 to about 8-12 ring members, whereas in other embodiments the number of ring carbon atoms range from 3 to 4, 5, 6, or 7. Cycloalkyl groups further include polycyclic cycloalkyl groups such as, but not limited to, norbomyl, adamantyl, bomyl, camphenyl. isocamphenyl, and carenyl groups, and fused rings such as, but not limited to, decalinyl, and the like. Cycloalkyl groups also include rings that are substituted with straight or branched chain alkyl groups as defined herein. Representative substituted cycloalkyl groups can be mono-substituted or substituted more than once, such as, but not limited to, 2,2-, 2,3-, 2,4- 2,5- or 2,6-disubstituted cyclohexyl groups or mono-, di- or tri-substituted norbomyl or cycloheptyl groups, which can be substituted with, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups. The term "cycloalkenyl" alone or in combination denotes a cyclic alkenyl group.

[0097] The term "cycloalkylene" or "cycloalkylenyl" as used herein refers to a bivalent saturated cycloalkyl radical (e.g.,, " V,

[0098]

[0099] O, and "' ’", inter alia). In certain embodiments, the term may be regarded as a product of removal of two hydrogen atoms fromAttorney Docket No. 047162-7563WOl(02825)

[0100] the corresponding cycloalkane (e.g, cyclobutyl) by removal of two hydrogen atoms from the same (e.g., different (e.g, tZf and ’

[0101]

[0102] ■'O'") carbon atoms.

[0103] A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.

[0104] In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.

[0105] A disease or disorder is "ameliorated" if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, is reduced.

[0106] As used herein, the terms "effective amount," "pharmaceutically effective amount" and "therapeutically effective amount" refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result may be reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An appropriate therapeutic amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.

[0107] The terms "halo," "halogen," or "halide" group, as used herein, by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.

[0108] The term "haloalkyl" group, as used herein, includes mono-halo alkyl groups, polyhalo alkyl groups wherein all halo atoms can be the same or different, and per-halo alkyl groups, wherein all hydrogen atoms are replaced by halogen atoms, such as fluoro. Examples of haloalkyl include trifluoromethyl, 1,1 -di chloroethyl, 1,2-dichloroethyl, l,3-dibromo-3,3-difluoropropyl, peril uorobutyl. and the like.

[0109] The term "heteroaryl" as used herein refers to aromatic ring compounds containing 5 or more ring members, of which, one or more is a heteroatom such as, but not limited to. N, O, and S; for instance, heteroaryl rings can have 5 to about 8-12 ring members. A heteroaryl group is a variety of a heterocyclyl group that possesses an aromatic electronic structure. A heteroaryl group designated as a C2-heteroaryl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth.

[0110] Likewise a C4-heteroaryl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms,Attorney Docket No. 047162-7563WOl(02825)

[0111] and so forth. The number of carbon atoms plus the number of heteroatoms sums up to equal the total number of ring atoms. Heteroaryl groups include, but are not limited to, groups such as pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Heteroaryl groups can be unsubstituted, or can be substituted with groups as is discussed herein. Representative substituted heteroary l groups can be substituted one or more times with groups such as those listed herein.

[0112] Additional examples of aryl and heteroaryl groups include but are not limited to phenyl, biphenyl, indenyl, naphthyl (1 -naphthyl, 2-naphthyl), N-hydroxytetrazolyl, N-hydroxytriazolyl, N-hydroxyimidazolyl, anthracenyl (1-anthracenyl, 2-anthracenyl, 3-anthracenyl), thiophenyl (2 -thieny l, 3-thienyl), furyl (2 -fur l, 3- fury l ), indolyl, oxadiazolyl, isoxazolyl, quinazolinyl. fluorenyl, xanthenyl. isoindanyl. benzhydryl, acridinyl, thiazolyl, pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl), triazolyl (1,2,3-triazol-l-yl, l,2,3-triazol-2-yl l,2,3-triazol-4-yl, l,2,4-triazol-3-yl), oxazolyl (2-oxazolyl, 4-oxazolyl, 5 -oxazolyl), thiazolyl (2 -thiazolyl, 4-thiazolyl. 5-thiazolyl), pyridyl (2-pyridyl, 3-pyridyl, 4-pyridyl), pyrimidinyl (2-pyrimidinyl, 4-pyrimidinyl, 5 -pyrimidinyl, 6-pyrimidinyl), pyrazinyl, pyridazinyl (3- pyridazinyl. 4-pyridazinyl, 5-pyridazinyl), quinolyl (2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 6-quinolyl, 7-quinolyl, 8-quinolyl), isoquinolyl (1 -isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 6-isoquinolyl, 7-isoquinolyl, 8-isoquinolyl), benzo[b]furanyl (2-benzo[b]furanyl, 3-benzo[b]furanyl. 4-benzo[b] furanyl. 5-benzo[b]furanyl. 6-benzo[b] furanyl. 7-benzofb] furanyl), 2,3-dihydro-benzo[b]furanyl (2-(2,3-dihydro-benzo[b]furanyl), 3-(2,3-dihydro-benzo[b] furanyl), 4-(2,3-dihydro-benzo[b]furanyl), 5-(2,3-dihydro-benzo[b]furanyl), 6-(2,3-dihydro-benzo[b]furanyl), 7-(2,3-dihydro-benzo[b]furanyl), benzo[b]thiophenyl (2-benzo[b]thiophenyl, 3-benzo[b]thiophenyl, 4-benzo[b]thiophenyl, 5-benzo[b]thiophenyl, 6-benzo[b]thiophenyl, 7-benzo[b]thiophenyl), 2,3-dihydro-benzo[b]thiophenyl, (2-(2,3-dihydro-benzo[b]thiophenyl), 3-(2,3-dihydro-benzo[b]thiophenyl), 4-(2,3-dihydro-benzo[b]thiophenyl), 5-(2,3-dihydro-benzo[b]thiophenyl), 6-(2,3-dihydro-benzo[b]thiophenyl), 7-(2,3-dihydro-benzo[b]thiophenyl), indolyl (1-indolyl, 2-indolyl, 3-indolyl, 4-indolyl, 5-indolyl. 6-indolyl, 7-indolyl), indazole (1 -indazolyl. 3-indazolyl, 4-indazolyl, 5-indazolyl, 6-indazolyl, 7-indazolyl), benzimidazolyl (1-benzimidazolyl,Attorney Docket No. 047162-7563WOl(02825)

[0113] 2-benzimidazolyl, 4-benzimidazolyl, 5 -benzimidazolyl, 6-benzimidazolyl, 7-benzimidazolyl, 8-benzimidazolyl). benzoxazolyl (1-benzoxazolyl, 2-benzoxazolyl), benzothiazolyl (1-benzothiazolyL 2-benzothiazolyl, 4-benzothiazolyl, 5-benzothiazolyL 6-benzothiazolyl, 7-benzothiazolyl), carbazolyl (1-carbazolyl, 2-carbazolyl, 3-carbazolyl, 4-carbazolyl), 5H-dibenz[b,f] azepine (5H-dibenz[b,f] azepin- 1 -y 1, 5H-dibenz[b,f] azepine-2-y 1,

[0114] 5H-dibenz[b.f]azepine-3-yl, 5H-dibenz[b,f]azepine-4-yl, 5H-dibenz[b,f]azepine-5-yl), 10,1 l-dihydro-5H-dibenz[b,f] azepine (10,ll-dihydro-5H-dibenz[b,f] azepine- 1-yl,

[0115] 10,1 l-dihydro-5H-dibenz[b,f]azepine-2-yl, 10,1 l-dihydro-5H-dibenz[b,f]azepine-3-yl, 10,1 l-dihydro-5H-dibenz[b,f]azepine-4-yl, 10,1 l-dihydro-5H-dibenz[b,f]azepine-5-yl), and the like.

[0116] The term "heteroarylalkyl" as used herein refers to alkyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to a heteroaryl group as defined herein.

[0117] The term "heteroarylene" or "heteroarylenyl" as used herein refers to a bivalent heteroaryl radical (e.g., 2,4-pyridylene). In certain embodiments, the term may be regarded as a divalent radical formed by the removal of two hydrogen atoms from one or more rings of a heteroaryl moiety, wherein the hydrogen atoms may be removed from the same or different rings, preferably the same ring.

[0118] The term "heterocycloalkyl" as used herein refers to an aliphatic, partially unsaturated or fully saturated, 3- to 14-membered ring system, including single rings of 3 to 8 atoms and bi- and tricyclic ring systems where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. A heterocycloalkyl can include one to four heteroatoms independently selected from oxygen, nitrogen, and sulfur, wherein a nitrogen and sulfur heteroatom optionally can be oxidized and a nitrogen heteroatom can be optionally substituted. Representative heterocycloalkyl groups include, but are not limited, to the following exemplary groups: pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl. isothiazolidinyl, and tetrahydrofuryl. The term heterocycloalkyl group can also be a C2 heterocycloalkyl, C2-C3 heterocycloalkyl, C2-C4 heterocycloalkyl, C2-C5 heterocycloalkyl. C2-C6 heterocycloalkyl, C2-C7 heterocycloalkyl, C2-C8 heterocycloalkyl, C2-C9 heterocycloalkyl, C2-C10 heterocycloalkyl, C2-C11 heterocycloalkyl, and the like, up to and including a C2-14s heterocycloalky l. For example, a C2 heterocycloalkyl comprises a group which has two carbon atoms and at least one heteroatom, including, but not limited to, aziridinyl, diazetidinyl, oxiranyl, thiiranyl, and theAttorney Docket No. 047162-7563WOl(02825)

[0119] like. Alternatively, for example, a Cs heterocycloalkyl comprises a group which has five carbon atoms and at least one heteroatom, including, but not limited to. piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, diazepanyl, and the like. It is understood that a heterocycloalkyl group may be bound either through a heteroatom in the ring, where chemically possible, or one of carbons comprising the heterocycloalkyl ring. The heterocycloalkyl group can be substituted or unsubstituted.

[0120] The term "heterocycloalkylene" or "heterocycloalkylenyl" as used herein refers to a

[0121] bivalent saturated cycloalkyl radical (e.g.,

[0122]

[0123] ,. and \ — / , inter alia). In certain embodiments, the term may be regarded as a product of removal of two hydrogen atoms from the corresponding heterocycloalkane (e.g., piperidine) by removal of two hydrogen atoms from the same (e.g.,

[0124]

[0125] different (e.g,

[0126]

[0127] and / N) carbon atom(s) and / or heteroatom(s).

[0128] The term "heterocyclyl" as used herein refers to aromatic and non-aromatic ring compounds containing three or more ring members, of which one or more is a heteroatom such as, but not limited to, N, O, and S. Thus, a heterocyclyl can be a cycloheteroalkyl, or a heteroaryl, or if polycyclic, any combination thereof. In some embodiments, heterocyclyl groups include 3 to about 20 ring members, whereas other such groups have 3 to about 15 ring members. A heterocyclyl group designated as a C2-heterocyclyl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth. Likewise a C4-heterocyclyl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms equals the total number of ring atoms. A heterocyclyl ring can also include one or more double bonds. A heteroaryl ring is an embodiment of a heterocyclyl group. The phrase "heterocyclyl group" includes fused ring species including those that include fused aromatic and non-aromatic groups. For example, a dioxolanyl ring and a benzdioxolanyl ring system (methylenedioxyphenyl ring system) are both heterocyclyl groups within the meaning herein. The phrase also includes polycyclic ring systems containing a heteroatom such as, but not limited to, quinuclidyl. Heterocyclyl groups can be unsubstituted, or can be substituted as discussed herein. Heterocyclyl groups include, but are not limited to, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, pyrrolyl, pyrazolyl. triazolyl. tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, dihydrobenzofuranyl, indolyl, dihydroindolyl, azaindolyl, indazolyl, benzimidazolyl,Attorney Docket No. 047162-7563WOl(02825)

[0129] azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Representative substituted heterocyclyl groups can be mono-substituted or substituted more than once, such as, but not limited to, piperidinyl or quinolinyl groups, which are 2-, 3-, 4-, 5-, or 6-substituted, or disubstituted with groups such as those listed herein.

[0130] The term "hydrocarbon" or "hydrocarbyl" as used herein refers to a molecule or functional group that includes carbon and hydrogen atoms. The term can also refer to a molecule or functional group that normally includes both carbon and hydrogen atoms but wherein all the hydrogen atoms are substituted with other functional groups.

[0131] As used herein, the term "hydrocarbyl" refers to a functional group derived from a straight chain, branched, or cyclic hydrocarbon, and can be alkyl, alkenyl, alkynyl, aryl, cycloalkyl, acyl, or any combination thereof. Hydrocarbyl groups can be shown as (Ca-Cb)hydrocarbyl, wherein a and b are integers and mean having any of a to b number of carbon atoms. For example, (Ci-C4)hydrocarbyl means the hydrocarbyl group can be methyl (Ci), ethyl (C2), propyl (C3), or butyl (C4), and (Co-Cb)hydrocarbyl means in certain embodiments there is no hydrocarbyl group.

[0132] The term "independently selected from" as used herein refers to referenced groups being the same, different, or a mixture thereof, unless the context clearly indicates otherwise. Thus, under this definition, the phrase " X1, X2, and X3are independently selected from noble gases" would include the scenario where, for example, X1, X2, and X3are all the same, where X1, X2, and X3are all different, where X1and X2are the same but X3is different, and other analogous permutations.

[0133] The terms "patient." "subject," or "individual" are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In a non-limiting embodiment, the patient, subject or individual is a human.

[0134] As used herein, the term "pharmaceutically acceptable" refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, z.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

[0135] As used herein, the language "pharmaceutically acceptable salt" refers to a salt of the administered compounds prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic acids or bases, organic acids or bases, solvates, hydrates, orAttorney Docket No. 047162-7563WOl(02825)

[0136] clathrates thereof.

[0137] Suitable pharmaceutically acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid. Examples of inorganic acids include hydrochloric, hydrobromic, hydriodic, nitric, carbonic, sulfuric (including sulfate and hydrogen sulfate), and phosphoric acids (including hydrogen phosphate and dihydrogen phosphate). Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, malonic, saccharin, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, trifluoromethanesulfonic, 2-hydroxyethanesulfonic, p-toluenesulfonic, sulfanilic, cyclohexylaminosulfonic, stearic, alginic, f>-hydroxy butyric. salicylic, galactaric and galacturonic acid.

[0138] Suitable pharmaceutically acceptable base addition salts of compounds described herein include, for example, ammonium salts, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N, N'-dibenzylethylene-diamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. All of these salts may be prepared from the corresponding compound by reacting, for example, the appropriate acid or base with the compound.

[0139] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid fdler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound described herein within or to the patient such that it may perform its intended function. Typically, such compounds are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, including the compound(s) described herein, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppositoryAttorney Docket No. 047162-7563WOl(02825)

[0140] waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. As used herein, "pharmaceutically acceptable carrier" also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound(s) described herein, and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions. The "pharmaceutically acceptable carrier" may further include a pharmaceutically acceptable salt of the compound(s) described herein. Other additional ingredients that may be included in the pharmaceutical compositions used with the methods or compounds described herein are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed.. Mack Publishing Co., 1985, Easton. PA), which is incorporated herein by reference.

[0141] The term "ring-member" as used herein refers to an atom that forms part of the closed loop in a cyclic structure, contributing to the connectivity of the ring. In the context of a monocyclic heterocycloalkyl substituent (e.g., 1-trifluoromethyl-piperidine), each of the five carbon atoms and the nitrogen atom of the piperidine ring comprise a "ring-member" atom, whereas all atoms of the trifluoromethyl substituent, and all hydrogen atoms, are not "ringmember" atoms, as these atoms do not form part of the ring structure.

[0142] The term "specifically binds", or "specifically binds", or the like, means that a compound of the disclosure forms a complex with a biological target that is relatively stable under physiological conditions. The specific bond can be characterized by an equilibrium dissociation constant KD, where a smaller KD denotes a firmer bond. Methods for determining whether two molecules specifically bind to each other are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like.

[0143] The term "substantially" as used herein refers to a majority of, or mostly, as in at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more, or 100%. The term "substantially free of' as used herein can mean having none or having a trivial amount of, such that the amount of material present does not affect the material properties of the composition including the material, such that the composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%,Attorney Docket No. 047162-7563WOl(02825)

[0144] or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8. 0.7, 0.6, 0.5, 0.4. 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less. The term "substantially free of can mean having a trivial amount of, such that a composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less, or about 0 wt%.

[0145] The term "substituted" as used herein in conjunction with a molecule or an organic group as defined herein refers to the state in which one or more hydrogen atoms contained therein are replaced by one or more non-hydrogen atoms. The term "functional group" or "substituent" as used herein refers to a group that can be or is substituted onto a molecule or onto an organic group. Examples of substituents or functional groups include, but are not limited to, a halogen (e.g., F, Cl, Br, and I); an oxygen atom in groups such as hydroxy groups, alkoxy groups, ary I oxy groups, aralkyloxy groups, oxo(carbonyl) groups, carboxyl groups including carboxylic acids, carboxylates, and carboxylate esters; a sulfur atom in groups such as thiol groups, alkyl and aryl sulfide groups, sulfoxide groups, sulfone groups, sulfonyl groups, and sulfonamide groups; a nitrogen atom in groups such as amines, hydroxyamines, nitriles, nitro groups, N-oxides, hydrazides, azides, and enamines; and other heteroatoms in various other groups. Non-limiting examples of substituents that can be bonded to a substituted carbon (or other) atom include F, Cl, Br, I, OR, OC(O)N(R)2, CN, NO, NO2, ONO2, azido, CF3, OCF3. R, O (oxo), S (thiono). C(O), S(O), methylenedioxy, ethylenedioxy, N(R)2, SR, SOR, SO2R, SO2N(R)2, SO3R, C(O)R, C(O)C(O)R, C(O)CH2C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R)2, OC(O)N(R)2, C(S)N(R)2, (CH2)O-2N(R)C(O)R, (CH2)O-2N(R)N(R)2, N(R)N(R)C(O)R, N(R)N(R)C(O)OR, N(R)N(R)CON(R)2, N(R)SO2R. N(R)SO2N(R)2, N(R)C(O)OR, N(R)C(O)R, N(R)C(S)R, N(R)C(O)N(R)2, N(R)C(S)N(R)2, N(COR)COR, N(OR)R, C(=NH)N(R)2, C(O)N(OR)R, and C(=NOR)R, wherein R can be hydrogen or a carbon-based moiety; for example, R can be hydrogen, (Ci-C100) hydrocarbyl, alkyl, acyl, cycloalkyl, aryl, aralkyl, heterocyclyl, heteroaryl, or heteroarylalkyl; or wherein two R groups bonded to a nitrogen atom or to adjacent nitrogen atoms can together with the nitrogen atom or atoms form a heterocyclyl.

[0146] A "therapeutic" treatment is a treatment administered to a subject who exhibits signs of pathology, for the purpose of diminishing or eliminating those signs.

[0147] The terms "treat," "treating" and "treatment," as used herein, means reducing the frequency or severity with which symptoms of a disease or condition are experienced by a subject by virtue of administering an agent or compound to the subject.Attorney Docket No. 047162-7563WOl(02825)

[0148] Compounds

[0149] In one aspect, the disclosure provides a compound of formula (I), or a salt or isotopologue thereof:

[0150] o2a p2b O

[0151] y X

[0152] R1\^N^R4

[0153]

[0154] R3(I).

[0155] wherein:

[0156] R1is selected from the group consisting of optionally substituted Ce-Cio aryl and C2-C10 heteroaryl;

[0157] R2aand R2bare each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl, halogen, ORA, N(RA)(RB), CN, NO2, C(=O)RA, C(=O)ORA, C(=O)N(RA)(RB), S(=O)RA, S(=O)2RA, S(=O)N(RA)(RB). S(=O)2N(RA)(RB), OC(=O)RA, N(RA)C(=O)RB, N(RA)S(=O)RB, and N(RA)S(=O)2RB, or

[0158] R2aand R2bcan combine with the carbon atom to which they are bound to form an optionally substituted C3-C8 cycloalkyl or optionally substituted C2-C8 heterocycloalkyl;

[0159] R3is selected from the group consisting of H, optionally substituted Ci-Cs alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl;

[0160]

[0161] R5a, R5b, R5C, R5d, R5e, R5f, R5g, and R511are each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroary 1, halogen, ORA, N(RA)(RB), CN, NO2, C(=O)RA, C(=O)ORA, C(=O)N(RA)(RB), S(=O)RA, S(=O)2RA, S(=O)N(RA)(RB), S(=O)2N(RA)(RB), O

[0162]

[0163] C(=O)RA, N(RA)C(=O)RB, N(RA)S(=O)RB, and N(RA)S(=O)2RB, orAttorney Docket No. 047162-7563WOl(02825)

[0164] two geminal substituents selected from the group consisting of R5a, R5b, R3c. R5d, R5e, R5f. R5g, and R5bcan combine with the carbon atom to which they are bound to form a moiety selected from the group consisting of C(=O), C(=NRA), C(=S), optionally substituted Cs-Cs cycloalkyl, and optionally substituted C2-C8 heterocycloalkyl, or

[0165] two vicinal substituents selected from the group consisting of R5a, R5b, R5c, R’d, R5e, R5f, R5g, and R5hcan combine with the carbon atoms to which they are bound to form a moiety selected from the group consisting of optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl. optionally substituted C6-C10aryl, and optionally substituted C2-C10 heteroaryl; R6is selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted Cs-Cs cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl;

[0166] R7is selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl;

[0167] each occurrence of RAand RBis independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl. optionally substituted C2-C10 heteroaryl. C(=O)Rc, C(=O)ORc, C(=O)N(RC)(RD), S(=O)RC, S(=O)2RC, S(=O)N(RC)(RD), and S(=O)2N(RC)(RD): and each occurrence of Rcand RDis independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl.

[0168] In certain embodiments, where two vicinal substituents selected from R5a, R5b, R5c, R5d, R5e, R5f, R5g, and R511combine to form an aryl or heteroaryl moiety, any geminal substituents of any the two combined substituents are absent. For example, in certain embodiments, R5cand R5ecombine to form a phenyl moiety, and R5dand R5fare absent:Attorney Docket No. 047162-7563WOl(02825)

[0169]

[0170] R7R5h. In certain embodiments, two vicinal substituents selected from R5a, R5b, R5C, R5d, R5e. R5f, R5g, and R5hcombine to form a double bond. For example, in certain

[0171] embodiments, R5cand R5ecombine to form a double bond:

[0172]

[0173] In certain embodiments, the compound of formula (I) is a compound of formula (la):

[0174]

[0175] (la). In certain embodiments, the compound of formula (I) is a compound of R2aR2bO

[0176] R1N R4

[0177] formula (lb):r3(lb). In certain embodiments, the compound of formula (I) is a R2aO

[0178]

[0179] R1N R4

[0180] compound of formula (la-1):R(la- 1). In certain embodiments, the compound of R2bO

[0181]

[0182] R1N R4

[0183] formula (I) is a compound of formula (la-2): R3(la-2). In certain embodiments,

[0184] R2bO

[0185] R1^N^R4

[0186] the compound of formula (I) is a compound of formula (Ib-1): R (Ib-I ). In certain R2aO R1^N^R4embodiments, the compound of formula (I) is a compound of formula (Ib-1): R3(Ib-2).

[0187] In certain embodiments, R1is optionally substituted furanyl. In certain embodiments, R1is optionally substituted benzofuranyl. In certain embodiments, R1is optionally substituted phenyl. In certain embodiments, each optional substituent of R1is independently selected from the group consisting of a halogen and C1-C3 haloalkyl. In certain embodiments, each optional substituent of R1is independently selected from the group consisting of C1-C3Attorney Docket No. 047162-7563WOl(02825)

[0188] haloalkyl is CF3.

[0189] In certain embodiments, R1is

[0190]

[0191] . In certain embodiments, R1is

[0192]

[0193] In certain embodiments, R1is

[0194]

[0195] . In certain embodiments, R1is

[0196]

[0197] Cl. In Cl certain embodiments, R1is

[0198]

[0199] Cl. In certain embodiments, R1is

[0200]

[0201] Cl In certain embodiments, R2ais H and R2bis optionally substituted phenyl. In certain embodiments, R2ais optionally substituted phenyl and R2bis H. In certain embodiments, R2ais H and R2bis optionally substituted C1-C6 alkyl. In certain embodiments, R2ais optionally substituted Ci-Ce alkyl and R2his H. In certain embodiments. R2aand R2bcombine with the carbon atom to which they are bound to form an optionally substituted Ch-C's cycloalkyl.

[0202] In certain embodiments, R2ais H and R2bis phenyl. In certain embodiments, R2ais phenyl and R2bis H. In certain embodiments, R2ais H and R2bis methyl. In certain embodiments, R2ais methyl and R2bis H. In certain embodiments, R2aand R2bcombine with v

[0203] the carbon atom to which they are bound to form '

[0204] In certain embodiments, at least one of R5a, R5b, R5c, R5d, R5e, R5f, R5g, R5h, and R6comprises a hydrogen bond acceptor. In certain embodiments, R5acomprises a hydrogen bond acceptor. In certain embodiments, R5bcomprises a hydrogen bond acceptor. In certain embodiments, R5ccomprises a hydrogen bond acceptor. In certain embodiments, R5dcomprises a hydrogen bond acceptor. In certain embodiments, R5ecomprises a hydrogen bond acceptor. In certain embodiments, R5fcomprises a hydrogen bond acceptor. In certain embodiments, R5gcomprises a hydrogen bond acceptor. In certain embodiments, R511comprises a hydrogen bond acceptor. In certain embodiments, R6comprises a hydrogen bond acceptor. In certain embodiments, the hydrogen bond acceptor comprise a sterically unencumbered lone pair. In certain embodiments, the lone pair is in an sp2hybridized orbital. In certain embodiments, the lone pair is in an sp3hy bridized orbital. In certain embodiments, the hydrogen bond acceptor is a carbonyl oxygen.

[0205] In certain embodiments, R6is H.

[0206] In certain embodiments, R7is H.

[0207] In certain embodiments, R5aand R5bcombine with the carbon atom to which they are bound to form C(=O).Attorney Docket No. 047162-7563WOl(02825)

[0208] In certain embodiments, at least one of R5c, R5d, R5e, R3f, R3g, and R5his H. In certain embodiments, at least two of R5c, R5d, R5e. R5f, R3g, and R5hare H. In certain embodiments, at least three of R5c, R3d, R3e, R3f, R3g, and R3hare H. In certain embodiments, at least four of R3C, R3d, R3e, R3f, R3g, and R3hare H. In certain embodiments, at least five of R3C, R3d, R3e, R3f, R3g, and R3hare H. In certain embodiments, each of R3c, R3d, R3e, R3f, R3g, and R3hare H.

[0209] O

[0210] In certain embodiments, R

[0211]

[0212] 1is H

[0213] In certain embodiments, R3is H.

[0214] In certain embodiments, each occurrence of optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted phenyl, optionally substituted benzofuranyl, optionally substituted furanyl, and optionally substituted heteroaryl is independently optionally substituted with at least one substituent selected from the group consisting of Ci-Ce alkyl, C3-C8 cycloalkyl, C2-C12 heterocycloalkyl, Ci-Ce hydroxyalkyl, halogen, CN, NO2 OR1, NCR’XR11), Ci-Ce haloalkoxy, C3-C8 halocycloalkoxy, aryl, heteroaryl, (Ci-C6alkj lenyl)C(=O)N(RI)(Rn), (Ci-C6alkylenyl)C(=O)ORI, O(Ci-C3alkylenyl)C(=O)ORn, O(Ci-C3alkylenyl ^O R’XR11), C( O)R'. C(=O)ORI, OC(-O)R'. OC(=O)ORI, SR1, S(-O)R'. S(=0)2RT, S(=O)2N(RI)(R11), S(=0)2NRIC(=0)NHR11, N(RI)S(=0)2R11, N(RI)C(=0)Rn. and C(=0)NRIRn, wherein R1and R11are each independently selected from the group consisting of H, -C(=0)(Ci-C6 alkyl), Ci-Ce alkyl, Ci-Ce haloalkyl, Ci-Ce heteroalkyl, C3-C8 cycloalkyl, C2-C12 heterocycloalkyl, C7-C12 aralkyl, aryl, and heteroaryl.

[0215] In certain embodiments, the compound is selected from the group consisting of: N-(benzofuran-2-yl(phenyl)methyl)-2,5-dioxo-l,2,5,6,7,8-hexahydroquinoline-3-carboxamide;

[0216] N-(l-(benzofuran-2-yl)ethyl)-2,5-dioxo-l,2,5,6,7,8-hexahydroquinoline-3-carboxamide; N-((4-chlorophenyl)(phenyl)methyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;

[0217] N-benzhydryl-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;

[0218] N-(furan-2-yl(phenyl)methyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide; N-((3,4-dichlorophenyl)(phenyl)methyl)-2,5-di oxo-1, 2, 5,6,7, 8-hexahydroquinoline-3-carboxamide; andAttorney Docket No. 047162-7563WOl(02825)

[0219] N-((4-chloro-3-(trifluoromethyl)phenyl)(phenyl)methyl)-2,5-dioxo-l,2,5,6,7,8-hexahydroquinoline-3-carboxamide.

[0220] In another aspect, the present disclosure provides a pharmaceutical composition comprising at least one compound of the present disclosure and a pharmaceutically acceptable carrier.

[0221] In certain embodiments, the pharmaceutical composition further comprises at least one additional therapeutically effective agent.

[0222] The compounds described herein can possess one or more stereocenters, and each stereocenter can exist independently in either the (R) or (S) configuration. In certain embodiments, compounds described herein are present in optically active or racemic forms. It is to be understood that the compounds described herein encompass racemic, optically-active, regioisomeric and stereoisomeric forms, or combinations thereof that possess the therapeutically useful properties described herein. Preparation of optically active forms is achieved in any suitable manner, including by way of non-limiting example, by resolution of the racemic form with recrystallization techniques, synthesis from optically-active starting materials, chiral synthesis, or chromatographic separation using a chiral stationary phase. In certain embodiments, a mixture of one or more isomer is utilized as the therapeutic compound described herein. In other embodiments, compounds described herein contain one or more chiral centers. These compounds are prepared by any means, including stereoselective synthesis, enantioselective synthesis and / or separation of a mixture of enantiomers and / or diastereomers. Resolution of compounds and isomers thereof is achieved by any means including, by way of non-limiting example, chemical processes, enzymatic processes, fractional crystallization, distillation, and chromatography.

[0223] The methods and formulations described herein include the use of N-oxides (if appropriate), crystalline forms (also known as polymorphs), solvates, amorphous phases, and / or pharmaceutically acceptable salts of compounds having the structure of any compound(s) described herein, as well as metabolites and active metabolites of these compounds having the same type of activity. Solvates include water, ether (e.g., tetrahydrofuran, methyl tert-butyl ether) or alcohol (e.g, ethanol) solvates, acetates and the like. In certain embodiments, the compounds described herein exist in solvated forms with pharmaceutically acceptable solvents such as water, and ethanol. In other embodiments, the compounds described herein exist in unsolvated form.

[0224] In certain embodiments, the compound(s) described herein can exist as tautomers. All tautomers are included within the scope of the compounds presented herein.Attorney Docket No. 047162-7563WOl(02825)

[0225] In certain embodiments, compounds described herein are prepared as prodrugs. A "prodrug" refers to an agent that is converted into the parent drug in vivo. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically active form of the compound. In other embodiments, a prodrug is enzymatically metabolized by one or more steps or processes to the biologically, pharmaceutically or therapeutically active form of the compound.

[0226] In certain embodiments, sites on, for example, the aromatic ring portion of compound(s) described herein are susceptible to various metabolic reactions. Incorporation of appropriate substituents on the aromatic ring structures may reduce, minimize or eliminate this metabolic pathway. In certain embodiments, the appropriate substituent to decrease or eliminate the susceptibility of the aromatic ring to metabolic reactions is. by way of example only, a deuterium, a halogen, or an alkyl group.

[0227] Compounds described herein also include isotopically-labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes suitable for inclusion in the compounds described herein include and are not limited to2H,3H,11C,13C,14C,36Cl,18F,123I,125I,13N,15N,15O,17O,180,32P, and35S. In certain embodiments, isotopically-labeled compounds are useful in drug and / or substrate tissue distribution studies. In other embodiments, substitution with heavier isotopes such as deuterium affords greater metabolic stabi 1 i ty (for example, increased in vivo half-life or reduced dosage requirements). In yet other embodiments, substitution with positron emitting isotopes, such as11C,18F,15O, and13N, is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically-labeled reagent in place of the non-labeled reagent otherwise employed.

[0228] In certain embodiments, the compounds described herein are labeled by other means, including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.

[0229] The compounds described herein, and other related compounds having different substituents are synthesized using techniques and materials described herein and as described, for example, in Fieser & Fieser's Reagents for Organic Synthesis, Volumes 1-17 (John Wiley and Sons, 1991); Rodd's Chemistry' of Carbon Compounds, Volumes 1-5 and Supplementals (Elsevier Science Publishers, 1989); Organic Reactions, Volumes 1-40 (John Wiley and Sons, 1991), Larock's Comprehensive Organic Transformations (VCH Publishers Inc., 1989),Attorney Docket No. 047162-7563WOl(02825)

[0230] March, Advanced Organic Chemistry 4thEd., (Wiley 1992); Carey & Sundberg, Advanced Organic Chemistry 4th Ed., Vols. A and B (Plenum 2000.2001), and Green & Wuts, Protective Groups in Organic Synthesis 3rd Ed., (Wiley 1999) (all of which are incorporated by reference for such disclosure). General methods for the preparation of compound as described herein are modified by the use of appropriate reagents and conditions, for the introduction of the various moieties found in the formula as provided herein.

[0231] Compounds described herein are synthesized using any suitable procedures starting from compounds that are available from commercial sources, or are prepared using procedures described herein.

[0232] In certain embodiments, reactive functional groups, such as hydroxyl, amino, imino, thio or carboxy groups, are protected in order to avoid their unwanted participation in reactions. Protecting groups are used to block some or all of the reactive moieties and prevent such groups from participating in chemical reactions until the protective group is removed. In other embodiments, each protective group is removable by a different means. Protective groups that are cleaved under totally disparate reaction conditions fulfill the requirement of differential removal.

[0233] In certain embodiments, protective groups are removed by acid, base, reducing conditions (such as, for example, hydrogenolysis), and / or oxidative conditions. Groups such as trityl, dimethoxytrityl, acetal and t-butyldimethylsilyl are acid labile and are used to protect carboxy and hydroxy reactive moieties in the presence of amino groups protected with Cbz groups, which are removable by hydrogenolysis, and Fmoc groups, which are base labile. Carboxylic acid and hydroxy reactive moieties are blocked with base labile groups such as, but not limited to, methyl, ethyl, and acety l, in the presence of amines that are blocked with acid labile groups, such as t-butyl carbamate, or with carbamates that are both acid and base stable but hydrolytically removable.

[0234] In certain embodiments, carboxylic acid and hydroxy reactive moieties are blocked with hydrolytically removable protective groups such as the benzy l group, while amine groups capable of hydrogen bonding with acids are blocked with base labile groups such as Fmoc. Carboxylic acid reactive moieties are protected by conversion to simple ester compounds as exemplified herein, which include conversion to alkyl esters, or are blocked with oxidatively-removable protective groups such as 2,4-dimethoxybenzyl, while coexisting amino groups are blocked with fluoride labile silyl carbamates.

[0235] Allyl blocking groups are useful in the presence of acid- and base- protecting groups since the former are stable and are subsequently removed by metal or pi-acid catalysts. ForAttorney Docket No. 047162-7563WOl(02825)

[0236] example, an allyl-blocked carboxylic acid is deprotected with a palladium-catalyzed reaction in the presence of acid labile t-butyl carbamate or base-labile acetate amine protecting groups. Yet another form of protecting group is a resin to which a compound or intermediate is attached. As long as the residue is attached to the resin, that functional group is blocked and does not react. Once released from the resin, the functional group is available to react.

[0237] Typically blocking / protecting groups may be selected from allyl, benzyl (Bn), benzyloxy carbonyl (Cbz), allyloxycarbonyl (Alloc), methyl, ethyl, r-butyl, t-butyldimethylsilyl (TBDMS), 2-(trimethylsilyl)ethoxycarbonyl (Teoc), / -butyloxy carbonyl (Boc), para-methoxybenzyl (PMB), triphenylmethyl (trity l), acetyl, and fluorenylmethoxy carbonyl (FMOC).

[0238] Other protecting groups, plus a detailed description of techniques applicable to the creation of protecting groups and their removal are described in Greene & Wuts, Protective Groups in Organic Synthesis, 3rd Ed., John Wiley & Sons, New York, NY, 1999, and Kocienski, Protective Groups, Thieme Verlag, New York, NY, 1994, which are incorporated herein by reference for such disclosure.

[0239] Table 1. Exemplary compounds of the disclosure

[0240] Cmpd Structure Nomenclature

[0241] N-(benzofuran-2-yl(phenyl)methyl)-2,5- o dioxo- 1,2,5,6, 7, 8-hexahy droquinoline-3- O O carboxamide

[0242] 6

[0243] hX JU

[0244] X= / H

[0245] I o o N-(l-(benzofuran-2-yl)ethyl)-2,5-dioxo- l,2,5,6,7,8-hexahydroquinoline-3- 28, _ / IT N if

[0246] / TA J H 1 II 1 carboxamide

[0247] \ \=z / CTH

[0248] N-(benzofuran-2-yl(phenyl)methyl)-2- o oxo-l,2,5,6,7,8-hexahydroquinoline-3- Y ° carboxamide

[0249] 29

[0250] HA JU

[0251] x= / H

[0252] N-((4-chlorophenyl)(phenyl)methyl)-2.5- o dioxo-l,2,5,6,7,8-hexahydroquinoline-3- Y O 0 carboxamide

[0253] 30

[0254] ri^rNT^ir i

[0255] II J H I JI \

[0256]

[0257] HAttorney Docket No. 047162-7563WOl(02825)

[0258] N-(l-(benzofuran-2-yl)cyclopropyl)-2,5- dioxo- 1,2, 5,6,7, 8-hexahydroquinoline-3- 63 carboxamide

[0259] N-benzhydryl-2,5-dioxo-l,2,5,6,7,8- A o hexahydroquinoline-3-carboxamide Y 0 0

[0260] 75

[0261] 11 J H

[0262] IZ I II \

[0263] \ oo= H

[0264] N-(furan-2-yl(phenyl)methyl)-2,5-dioxo- o A IZ 1,2, 5,6,7, 8-hexahydroquinoline-3- o o carboxamide

[0265] 83 ° / \

[0266] H

[0267] N-((3,4-dichlorophenyl)(phenyl)methyl)- o Y0 02,5-dioxo-1.2.5.6.7,8- hexahydroquinoline-3-carboxamide 95

[0268] II JH1 1 J

[0269] H

[0270] o N-((4-chloro-3- (trifluoromethyl)phenyl)(phenyl)methyl)- Y °02,5-dioxo-1.2.5.6,7,8- 96 hexahydroquinoline-3-carboxamide II J H J 11 \

[0271]

[0272] H

[0273] Methods

[0274] Therapeutic Methods

[0275] In one aspect, the disclosure provides a method for treating, preventing, and / or ameliorating a viral infection in a subject. In certain embodiments, the method comprises administering to the subject at least one compound of formula (I), or a salt or isotopologue thereof, wherein R1, R2a, R2b, R3, and R4are defined elsewhere herein:

[0276] R2aR2bO

[0277] R1Y^R4

[0278]

[0279] R3(I).

[0280] In certain embodiments, the viral infection is caused by a virus selected from the group consisting of chikungunya virus, cytomegalovirus, Dengue virus, Ebola virus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis E virus, herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2), human immunodeficiency virusAttorney Docket No. 047162-7563WOl(02825)

[0281] (HIV), human metapneumovirus, human papillomavirus (HPV), influenza A virus, influenza B virus, influenza C virus, Lassa virus, Marburg virus, measles virus. Middle East respiratory syndrome coronavirus (MERS-CoV), Nipah virus, norovirus, parainfluenza virus, poliovirus, rabies virus, respiratory syncytial virus (RSV), Rift Valley fever virus, rotavirus, SARS-CoV-1, SARS-CoV-2, varicella-zoster virus (VZV), West Nile virus, yellow fever virus, or Zika virus.

[0282] In certain embodiments, the viral infection is at least one selected from the group consisting of AIDS, bronchiolitis, chikungunya fever, COVID-19, cytomegalovirus infection, dengue fever, Ebola virus disease, Epstein-Barr virus infection, genital herpes, hepatitis, herpes simplex virus infection, human papillomavirus infection, influenza, Lassa fever, Marburg virus disease, measles, meningitis. Middle East respiratory syndrome (MERS), mononucleosis, Nipah virus infection, norovirus infection, polio, rabies, respiratory syncytial virus (RSV) infection, Rift Valley fever, rotavirus gastroenteritis, rubella, SARS, shingles, smallpox, varicella, viral encephalitis, viral meningitis, West Nile virus infection, yellow fever, and Zika virus disease.

[0283] In certain embodiments, the subject is administered at least one additional agent suitable for the treatment, prevention, and / or amelioration of a viral infection. In certain embodiments, the compound and the at least one additional agent are co-administered, optionally wherein the compound and the at least one additional agent are co-formulated. In certain embodiments, the compound is administered as an adjuvant in a vaccination.

[0284] In another aspect, the disclosure provides a method for treating, preventing, and / or ameliorating cancer in a subject. In certain embodiments, the method comprises administering to the subject at least one compound of formula (I), or a salt or isotopologue thereof, wherein R1, R2a. R2b, R3, and R4are defined elsewhere herein:

[0285] R2aR2bO

[0286] y A

[0287] RAN^R4

[0288]

[0289] R3(I).

[0290] In certain embodiments, the cancer is at least one selected from the group consisting of bladder cancer, bone cancer, brain cancer, breast cancer, cervical cancer, central nervous system (CNS) cancer, colorectal cancer, colon cancer, esophageal cancer, gastric cancer, glioblastoma, head and neck cancer, head and neck squamous cell carcinoma, hepatocellular carcinoma, hepatocellular cancer, leukemia, lung cancer, lymphoma, melanoma, multiple myeloma, neuroendocrine cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, small cell lung cancer, and soft tissue sarcoma.Attorney Docket No. 047162-7563WOl(02825)

[0291] In certain embodiments, the subject is administered at least one additional agent suitable for the treatment, prevention, and / or amelioration of cancer. In certain embodiments, the compound and the at least one additional agent are co-administered, optionally wherein the compound and the at least one additional agent are co-formulated.

[0292] In another aspect, the disclosure provides a method for promoting or inducing an immune response in a subject. In certain embodiments, the method comprises administering to the subject at least one compound of formula (I), or a salt or isotopologue thereof, wherein R1, R2a, R2b, R3, and R4are defined elsewhere herein:

[0293] R2a<R2bQ

[0294] R1\^R4

[0295]

[0296] R3(I).

[0297] In certain embodiments, the immune response is promoted or induced through activation of type I or type III interferon signaling.

[0298] In certain embodiments, administration of the compound increases production of at least one interferon selected from the group consisting of IFN-a and IFN-y.

[0299] RIG-I Agonist Identifying Method

[0300] In one aspect, the disclosure provides a method for identifying a Retinoic Acid-Inducible Gene-I (RIG-I) agonist. In certain embodiments, the method comprises contacting a test compound with a dual-labeled RIG-I. In certain embodiments, the dual-labeled RIG-I comprises a RIG-I protein covalently conjugated to a fluorescent molecule at an Hel2i domain thereof. In certain embodiments, the dual-labeled RIG-I comprises a RIG-I protein covalently conjugated to a fluorescence quencher at an N-terminus of a caspase activation and recruitment domain (CARD) thereof. In certain embodiments, the method comprises measuring fluorescence intensity. In certain embodiments, the method comprises comparing the fluorescence intensity to positive and negative controls.

[0301] In certain embodiments, the fluorescent molecule comprises AZDye 488. In certain embodiments, the AZDye 488 is covalently conjugated to Asp527 of the Hel2i domain. In certain embodiments, the AZDye 488 is covalently conjugated to Asp527 of the Hel2i domain via a strain-promoted azide-alkyne cycloaddition (SPAAC) reaction between the Hel2i domain and a dibenzocyclooctyne (DBCO) substituted AZDye 488.

[0302] In certain embodiments, the fluorescence quencher comprises BHQ-10. In certain embodiments, the BHQ-10 is covalently conjugated to the N-terminus of the CARD by reaction between a terminal amine of the CARD and a succinimidyl ester of BHQ-10.Attorney Docket No. 047162-7563WOl(02825)

[0303] In certain embodiments, the measuring comprises an excitation wavelength of about 485 nm. In certain embodiments, the measuring comprises an emission wavelength of about 528 nm. In certain embodiments, the measuring comprises an emission filter bandwidth of about 20 nm.

[0304] In certain embodiments, the negative control comprises a fluorescence measurement of a sample comprising solvent (e.g., DMSO) and the dual-labeled RIG-I.

[0305] In certain embodiments, the positive control comprises a fluorescence measurement of a sample comprising triphosphorylated SLR14 (p3SLR14) and the dual-labeled RIG-I.

[0306] In certain embodiments, the comparing is performed according to Equation 1 (Eq. 1):

[0307] Fluorescence^^ - Fluorescence^™^ ( %) = - - - - -

[0308]

[0309] F Ltioi esc ciict f.,;,,:,., Caniks (Eq.

[0310] 1).

[0311] Administration / Dosage / Formulations

[0312] The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations may be administered to the subject either prior to or after the onset of the disease or disorder. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.

[0313] Administration of the compositions described herein to a patient, preferably a mammal, more preferably a human, may be carried out using known procedures, at dosages and for periods of time effective to treat the disease or disorder in the patient. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound to treat the disease or disorder in the patient. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A nonlimiting example of an effective dose range for a therapeutic compound described herein is from about 1 and 5,000 mg / kg of body weight / per day. One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effectiveAttorney Docket No. 047162-7563WOl(02825)

[0314] amount of the therapeutic compound without undue experimentation.

[0315] Actual dosage levels of the active ingredients in the pharmaceutical compositions described herein may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[0316] In particular, the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well, known in the medical arts.

[0317] A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds described herein employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

[0318] In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms of the compound(s) described herein are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic compound.

[0319] In certain embodiments, the compositions described herein are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions described herein comprise a therapeutically effective amount of a compound described herein and a pharmaceutically acceptable carrier.

[0320] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of theAttorney Docket No. 047162-7563WOl(02825)

[0321] required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, sodium chloride, or poly alcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.

[0322] In certain embodiments, the compositions described herein are administered to the patient in dosages that range from one to five times per day or more. In other embodiments, the compositions described herein are administered to the patient in range of dosages that include, but are not limited to, once every day, every two. days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions described herein varies from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, administration of the compounds and compositions described herein should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physician taking all other factors about the patient into account.

[0323] The compound(s) described herein for administration may be in the range of from about 1 pg to about 10,000 mg, about 20 pg to about 9,500 mg, about 40 pg to about 9,000 mg, about 75 pg to about 8,500 mg, about 150 pg to about 7,500 mg, about 200 pg to about 7,000 mg, about 350 pg to about 6,000 mg, about 500 pg to about 5,000 mg, about 750 pg to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 30 mg to about 1,000 mg, about 40 mg to about 900 mg, about 50 mg to about 800 mg, about 60 mg to about 750 mg, about 70 mg to about 600 mg, about 80 mg to about 500 mg, and any and all whole or partial increments therebetween.

[0324] In some embodiments, the dose of a compound described herein is from about 1 mg and about 2,500 mg. In some embodiments, a dose of a compound described herein used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2.000 mg, or less than about 1,000 mg. or less than about 500 mg. or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a secondAttorney Docket No. 047162-7563WOl(02825)

[0325] compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg. or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.

[0326] In certain embodiments, a composition as described herein is a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound described herein, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, or reduce one or more symptoms of a disease or disorder in a patient.

[0327] Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and / or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents.

[0328] Routes of administration of any of the compositions described herein include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. The compounds for use in the compositions described herein can be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal. transmucosal (e.g. sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g, trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapul monary. intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.

[0329] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry' powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositionsAttorney Docket No. 047162-7563WOl(02825)

[0330] described herein are not limited to the particular formulations and compositions that are described herein.

[0331] Oral Administration

[0332] For oral application, particularly suitable are tablets, dragees, liquids, drops, suppositories, or capsules, caplets and gelcaps. The compositions intended for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.

[0333] For oral administration, the compound(s) described herein can be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropyl methylcellulose); fillers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g, sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OPADRY™ film coating systems available from Colorcon, West Point, Pa. (e.g, OPADRY™ OY Type, OYC Type, Organic Enteric OY-P Type, Aqueous Enteric OY-A Type, OY-PM Type and OPADRY™ White, 32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters or ethyl alcohol); and preservatives (e.g., methyl or propyl p-hydroxy benzoates or sorbic acid).

[0334] Parenteral Administration

[0335] For parenteral administration, the compounds as described herein may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and / or continuous infusion. Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and / or dispersing agents may be used.Attorney Docket No. 047162-7563WOl(02825)

[0336] Sterile injectable forms of the compositions described herein may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1, 3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils, such as olive oil or castor oil. especially in their polyoxy ethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, such as Ph. Helv or similar alcohol.

[0337] Additional Administration Forms

[0338] Additional dosage forms suitable for use with the compound(s) and compositions described herein include dosage forms as described in U. S. Patents Nos. 6,340,475;

[0339] 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms suitable for use with the compound(s) and compositions described herein also include dosage forms as described in U. S. Patent Applications Nos. 20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms suitable for use with the compound(s) and compositions described herein also include dosage forms as described in PCT Applications Nos. WO 03 / 35041; WO 03 / 35040; WO 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757.

[0340] Controlled Release Formulations and Drug Delivery Systems

[0341] In certain embodiments, the formulations described herein can be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations.

[0342] The term sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form.Attorney Docket No. 047162-7563WOl(02825)

[0343] For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use with the method(s) described herein may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation.

[0344] In some cases, the dosage forms to be used can be provided as slow or controlled-release of one or more active ingredients therein using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, or microspheres or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled-release formulations known to those of ordinary skill in the art, including those described herein, can be readily selected for use with the pharmaceutical compositions described herein. Thus, single unit dosage forms suitable for oral administration, such as tablets, capsules, gelcaps, and caplets that are adapted for controlled-release are encompassed by the compositions and dosage forms described herein.

[0345] Most controlled-release pharmaceutical products have a common goal of improving drug therapy over that achieved by their non-controlled counterparts. Ideally, the use of an optimally designed controlled-release preparation in medical treatment is characterized by a minimum of drug substance being employed to cure or control the condition in a minimum amount of time. Advantages of controlled-release formulations include extended activity of the drug, reduced dosage frequency, and increased patient compliance. In addition, controlled-release formulations can be used to affect the time of onset of action or other characteristics, such as blood level of the drug, and thus can affect the occurrence of side effects.

[0346] Most controlled-release formulations are designed to initially release an amount of drug that promptly produces the desired therapeutic effect, and gradually and continually release of other amounts of drug to maintain this level of therapeutic effect over an extended period of time. In order to maintain this constant level of drug in the body, the drug must be released from the dosage form at a rate that will replace the amount of drug being metabolized and excreted from the body.

[0347] Controlled-release of an active ingredient can be stimulated by various inducers, for example pH, temperature, enzymes, water, or other physiological conditions or compounds. The term "controlled-release component" is defined herein as a compound or compounds, including, but not limited to. polymers, polymer matrices, gels, permeable membranes, liposomes, or microspheres or a combination thereof that facilitates the controlled-release ofAttorney Docket No. 047162-7563WOl(02825)

[0348] the active ingredient. In some embodiments, the compound(s) described herein are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation. In some embodiments, the compound(s) described herein are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.

[0349] The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.

[0350] The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration.

[0351] The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration.

[0352] As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.

[0353] As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration.

[0354] Dosing

[0355] The therapeutically effective amount or dose of a compound described herein depends on the age, sex and weight of the patient, the current medical condition of the patient and the progression of the disease or disorder in the patient being treated. The skilled artisan is able to determine appropriate dosages depending on these and other factors.

[0356] A suitable dose of a compound described herein can be in the range of from about 0.01 mg to about 5,000 mg per day, such as from about 0.1 mg to about 1,000 mg, for example, from about 1 mg to about 500 mg, such as about 5 mg to about 250 mg per day. The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5Attorney Docket No. 047162-7563WOl(02825)

[0357] mg doses, with about a 12-hour interval between doses.

[0358] It is understood that the amount of compound dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on.

[0359] In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the compound(s) described herein is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%. 45%. 50%. 55%. 60%. 65%. 70%. 75%. 80%. 85%. 90%. 95%. or 100%.

[0360] Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced to a level at which the improved disease is retained. In certain embodiments, patients require intermittent treatment on a long-term basis upon any recurrence of symptoms and / or infection.

[0361] The compounds described herein can be formulated in unit dosage form. The term "unit dosage form" refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.

[0362] Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. The data obtained from cell culture assays and animal studies are optionally used inAttorney Docket No. 047162-7563WOl(02825)

[0363] formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the EDso with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized.

[0364] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents are considered to be within the scope of this disclosure and covered by the claims appended hereto. For example, it should be understood, that modifications in reaction conditions, including but not limited to reaction times, reaction size / volume, and experimental reagents, such as solvents, catalysts, pressures, atmospheric conditions, e.g., nitrogen atmosphere, and reducing / oxidizing agents, with art-recognized alternatives and using no more than routine experimentation, are within the scope of the present application.

[0365] It is to be understood that wherever values and ranges are provided herein, all values and ranges encompassed by these values and ranges, are meant to be encompassed within the scope of the present disclosure. Moreover, all values that fall within these ranges, as well as the upper or lower limits of a range of values, are also contemplated by the present application.

[0366] The following examples further illustrate aspects of the present disclosure. However, they are in no way a limitation of the teachings or disclosure of the present disclosure as set forth herein.

[0367] EXAMPLES

[0368] Various embodiments of the present application can be better understood by reference to the following Examples which are offered by way of illustration. The scope of the present application is not limited to the Examples given herein.

[0369] Materials and Methods

[0370] Plasmids and RNA preparation

[0371] The RIG-I constructs used in this study were 3G-DC-RIG-I and 3G-DC-527TAG-RIG-I, all of which were mutated from wild-type human RIG-I in a pET SUMO expression vector using the Q5® Site-Directed Mutagenesis Kit (NEB). The 3G-DC-RIG-I construct was generated by deleting the N-terminal CARD domain (residues 1-89) of full-length RIG-I, followed by the addition of three glycine residues at the N-terminus. The 3G-DC-527TAG-Attorney Docket No. 047162-7563WOl(02825)

[0372] RIG-I construct was generated by mutating Asp527 to an amber stop codon (UAG) of the 3G-DC-RIG-I construct. Pet30b-7M SrtAused in this study (Addgene plasmid # 51141) was provided as a gift.

[0373] 5 ’-Triphosphorylated SLR14 (p3SLR14), 5'-hydroxyl SLR14 (OHSLR14) and p3NS used in this study were synthesized on MerMade 12 DNA-RNA synthesizer (BioAutomation) and deprotected as previously described.

[0374] Protein expression and purification

[0375] 3G-DC-RIG-I was expressed and purified as described previously. The construct was transformed into Rosetta II (DE3) Singles™ (Novagen) cells. Cultures were grown at 37 °C until the OD600 reached 0.6, at which point expression was induced with 0.5 mM IPTG (MedChemExpress) and grown at 16 °C overnight. The cells were harvested and lysed in buffer containing 25 mM HEPES (pH 8.0), 300 mM NaCl, 10% glycerol, and 5 mM BME. Lysates were purified using nickel affinity chromatography with Ni-NTA Superflow beads (Qiagen). To remove the SUMO tag, RIG-I was treated with ULP1 for one hour. Following this, the sample was further purified using HiTrap Heparin HP columns to eliminate nucleic acid contamination, and size exclusion chromatography was performed using Superdex 200 Increase 10 / 300 GL columns (Cytiva). The monomeric peak was collected in the storage buffer (25 mM HEPES, pH 7.4, 200 mM NaCl, 5% Glycerol, 5 mM BME). flash-frozen, and stored at -80 °C

[0376] For the incorporation of the unnatural amino acid, 3G-DC-527TAG-RIG-I and pEVOL-pAzF (Addgene plasmid #31186, was a gift from Peter Schultz) were co-transformed into BL21(DE3) Competent Cells. Cultures were grown to an OD600 of 0.4, at which point 4-azido-L-phenylalanine (0.25 g / L) and L-arabinose (0.04%) were added, and the temperature was lowered to 16 °C. When the OD600 reached 0.6, 0.5 mM IPTG was added, and induction continued for 9 hours, w ith minimal light exposure to protect the azide group. 3G-DC-527AZF-RIG-I was purified using a similar protocol as for 3G-DC-RIG-I, with the following modifications: the purification process was conducted with limited light exposure, and reducing agents were omitted.

[0377] 7M Sortase A was expressed and purified as previously described. In brief, the Pet30b-7M SrtA construct was transformed into E. coli BL21(DE3) cells and expression was induced with 1 mM IPTG overnight at 30 °C when the OD600 reached 0.6. Cell pellets were resuspended and lysed in wash buffer (50 mM Tris, 150 mM NaCl, 10 mM imidazole, 2 mM DTT, 10% glycerol, pH 7.6) supplemented with complete EDTA-free Protease InhibitorAttorney Docket No. 047162-7563WOl(02825)

[0378] Cocktail (Roche). The resulting supernatant was further purified by nickel affinity chromatography, followed by size exclusion chromatography. The monomeric peak was collected from the HiLoad® 16 / 600 Superdex® 75 pg column (Cytiva) in Sortase storage buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 2 mM DTT, and 10% glycerol).

[0379] Small molecule preparation

[0380] Compounds used in this study were purchased from Enamine. SB9200 (inarigivir soproxil, Ca. No. HY-109035) and KIN1148 (Cat. No. HY-101950) were obtained from MedChemExpress. All compounds were freshly prepared and dissolved in DMSO prior to use.

[0381] Dual-labeled protein preparation

[0382] 3G-DC-527AZF -RIG-I was first labeled with AZDye 488 DBCO (Vector Laboratories). Briefly, 3G-DC-527AZF-RIG-I was incubated with AZDye 488 DBCO (1:9 molar ratio, final DMSO < 1% (v / v)) in RIG-I storage buffer, with 10 mM DTT added to the reaction to minimize non-specific interactions. The reaction was carried out for 2 hours. The mixture was then purified by size exclusion chromatography using a Superdex 200 Increase 10 / 300 GL column (Cytiva) in RIG-I storage buffer, without reducing agents. The monomeric peak was collected and used for the subsequent BHQ conjugation step.

[0383] BHQ conjugation was facilitated by a sortase-mediated reaction. To prepare for conjugation, BHQ-10 Succinimidyl Ester (Biosearchtech), dissolved in DMSO, was added to the LPETGG peptide (synthesized by GeneScript) in a 2: 1 molar ratio in a buffer containing 0.1 M sodium bicarbonate (pH 8.5). The reaction was carried out at room temperature for one hour. The resulting BHQ-peptide conjugate was purified using a Superdex 30 Increase column (Cytiva), with absorbance monitored at 214 nm and 516 nm. Pure fractions were dialyzed against water for 4-6 hours and lyophilized into powder using a SpeedVac Concentrator.

[0384] BHQ-LPETGG was dissolved in RIG-I storage buffer and added to 7M Sortase A and fluorophore-labeled RIG-I in a 10:3:1 molar ratio. The reaction was performed at 4 °C for 30 minutes in the dark. Free fluorophore and sortase were removed by size exclusion chromatography using a Superdex 200 Increase 10 / 300 GL column (Cytiva), equilibrated with RIG-I storage buffer without reducing agents. The dual-labeled RIG-I was quantified using a Nanodrop, measuring absorbance at 280 nm, 494 nm. and 550 nm. The protein was then aliquoted, snap-frozen with liquid nitrogen, and stored at -80 °C.Attorney Docket No. 047162-7563WO1(02825)

[0385] The quenching efficiency of BHQ10 toward AZDye 488 in Dual-Labeled RIG-I was calculated using Equation 3 (Eq. 3):

[0386] Fluorescencedual-labeled RIG-I at max emission wavelength Quenching Efficiency (%) = 1 —

[0387]

[0388] FluorescenceAzDye488 labeled RIG-I at max emission wavelength (Eq. 3)

[0389] High-throughput screening using fluorescence quenching assay and data normalization Small molecule screening in our studies was conducted using the Enamine RNA Library (14800 compounds). 40 nL / well of DMSO or test compounds (final concentration of 20 μM in a 20 μL / well reaction system) were dispensed into black non-binding 384-well plates (Coming 3575) using the Labcyte Echo. Next, 10 pL / well of assay buffer (25 mM HEPES, pH 7.4, 200 mM NaCl, 5% glycerol, 10% PEG, 5 mM DTT) or 400 nM p3SLR14 (positive control, diluted in assay buffer) was added to the plates using a Multidrop Combi (ThermoFisher Scientific), and the fluorescence intensity was measured on a BioTek Synergy Neo2 plate reader (λex 485 nm, λem 528 nm, 20 nm bandwidth) to record the raw fluorescence of the compounds.

[0390] Then, 10 pL dual -labeled RIG-1 in 10 nM was added to the wells. The reaction mixtures were incubated at 4 °C for 2 hours, followed by fluorescence intensity measurement using the same setup (485 / 528 / 20 nm).

[0391] Screening data were normalized to a percentage of activation relative to negative (DMSO +dual-labeled RIG-I) and positive controls (DMSO+p3SLR14+ dual-labeled RIG-I) according to Eq. 1:

[0392] Activation (%) =

[0393]

[0394] FluorescencePositive Control - FluorescenceNegative Control (Eq. 1)

[0395] The percentage of activation was calculated on a per-plate basis. For hit selection, compounds exhibiting raw fluorescence were excluded as fluorescent artifacts. Hits were defined as responses exceeding three standard deviations above the average of all samples on the plate. The Z' factor was calculated as previously described: Z′ = 1 − 3 × (σp + σn) / |μp − μn|, where σP and μP represent the standard deviation and mean of the positive control, respectively, and σn and μn represent the standard deviation and mean of the negative control, respectively.

[0396] Hits selected from the primary screen were further validated at the same dose (20 uM)Attorney Docket No. 047162-7563WOl(02825)

[0397] as the primary screening, with more than 12 replicates. The validated compounds were subsequently assayed for dose-response, and EC50 values were fitted using GraphPad Prism to a 4-parameter logistic function (Eq. 2):

[0398] X^HillSlope * (Top − Bottom)

[0399] Y = Bottom + X^HillSlope / (X^HillSlope + EC50^HillSlope)

[0400]

[0401] (Eq. 2)

[0402] where X represents the concentration of the compound, y is the fluorescent response, Top and Bottom are plateaus of the maximum and minimal response. Data are reported as the average ± s.e.m.

[0403] Surface plasmon resonance binding assay

[0404] Binding experiments between the compounds and 3G-DC-RIG-I-6xHis were performed using the Biacore™ 8K (Cytiva) at room temperature. 3G-DC-RIG-I-6xHis was diluted in lx HBS-P+ buffer (0.01 M HEPES, 0.15 M NaCl, 0.005% v / v Surfactant P20, pH 7.4) to a final concentration of 20 pg / mL. Protein was immobilized on a High Affinity poly-Ni-NTA sensor NiD200M chip (Xantec), targeting a protein immobilization level of at least 2000 resonance units (RU). All experiments were run in lx HBS-P+ buffer containing 5% DMSO. Compounds dissolved in DMSO were serially diluted in lx HBS-P+ buffer to maintain a final DMSO concentration of 5%. Binding was assessed with a flow rate of 10 pL / min, an association time of 80 seconds, and a dissociation time of 180 seconds.

[0405] The reported data represent the average of at least two independent experiments, with Kd values expressed as average. Data analysis was performed using Biacore Insight Evaluation Software (Cytiva), and Kd values were fitted using a 1: 1 kinetics binding model.

[0406] Cell culture and luciferase reporter assays

[0407] Compound induced RIG-I activations were evaluated based on Lucia luciferase activity in A549-Dual™ and A549-Dual-RIG-I KO™ Cells, A549-Dual-MAVS KO™. THPl-Dual™. THP1 -RIG-I KO™, THP1-IRF3 KO™ Cells (Invivogen). The luciferase gene in the cell lines is under the control of the ISG54 minimal promoter, which responds to interferon-stimulated response elements (ISREs). Activation of RIG-I triggers IRF3 and NF-κB, leading to luciferase expression. Both cell lines were maintained in growth medium consisting of DMEM supplemented with 2 mM L-glutamine, 4.5 g / L glucose, 10% fetal bovine serum (FBS), 100 U / mL penicillin, 100 μg / mL streptomycin, and 100 pg / mL Normocin at 37 °C with 5% CO2. Atotal of 1.0 x 105cells per well were seeded into 24-wellAttorney Docket No. 047162-7563WOl(02825)

[0408] plates with 500 pL of assay medium (DMEM supplemented with 2 mM L-glutamine, 4.5 g / L glucose, 10% FBS. 100 U / mL penicillin, and 100 pg / mL streptomycin) and incubated for 24 hours.

[0409] Compounds of interest, dissolved in DMSO, were serially diluted and mixed in tubes with 100 pL of assay medium before being added to each well (final DMSO concentration of 0.2%, total volume per well after compound addition: 600 pL). Both RNAs were complexed with RNAiMAX (Invitrogen) at concentrations of 20 pL / mL and the complex was added to the cells at one-tenth the total media volume. After the designated compound / RNA treatment time (e.g., 12 hours), the medium was replaced with 500 pL fresh assay medium, and after 6 hours of incubation, 20 pL of supernatant was collected after 6 hours for luminescence analysis.

[0410] THP-1 Dual cells and their knockout derivatives were cultured in RPMI 1640 supplemented with 2 mM L-glutamine, 25 mM HEPES, 10% heat-inactivated fetal bovine serum, 100 pg / mL Normocin, and Penicillin-Streptomycin (lOOU / mL-100 pg / mL) at 37 °C in a 5% CO2 atmosphere. The treatment of compounds or RNAs in THPl-Dual cells follows a similar protocol as for A549-Dual cells, with the following differences: THPl-Dual cells w ere seeded at IxlO5cells per w ell in 96-well plates in THP1 test medium (RPMI 1640, 2 mM L-glutamine, 25 mM HEPES, 10% heat-inactivated fetal bovine serum, Pen-Strep (100 U / ml-100 pg / ml)) and differentiated into macrophage-like cells by treatment with 40 nM phorbol 12-myristate 13-acetate (PMA; Sigma- Aldrich) for 24 hours prior to compound or RNA exposure. After differentiation, cells were washed with PBS. Compounds of interest were dissolved in DMSO, serially diluted in assay medium, and added to the cells at a final DMSO concentration of 0.5% (v / v). Low molecular w eight poly(LC) (LMW PIC) and p3SLR14 were diluted in Opti-MEM (Thermo Fisher Scientific) to the indicated concentrations and complexed with 0.2 pL of Lipofectamine 2000 (Invitrogen) per well in 96 wells. After 24 hours, the medium was replaced with 100 pL fresh assay medium, and 20 pL of supernatant was collected after 6 hours for luminescence analysis.

[0411] A total of 50 pL of lx Quanti-Luc 4 substrate (Invivogen) was injected into each well containing 20 pL of supernatant. Luminescence was measured using the BioTek Synergy Neo2 plate reader, and data were normalized to wells containing 0.2% DMSO as vehicle controls. The experiments w ere performed with at least three biological replicates.

[0412] Quantification of Interferon-stimulated genes (ISGs) in Cells by RT-qPCR

[0413] Cells were maintained and treated in the same way as in the luciferase reporter assays,Attorney Docket No. 047162-7563WOl(02825)

[0414] with the following modifications: For the 12- or 24-hour time point, cells were treated with the compound for 12 or 24 hr before collection. For the 48-hour time point in THPl-Dual cells, compounds were applied for 24 hr, washed three times with 1 x PBS, then incubated in 100 pL fresh assay medium in 96 well-plates for an additional 24 h before collection. Total cellular RNA was extracted using TRIzol reagent, treated with Turbo DNase (ThermoFisher), and purified with the RNA Clean & Concentrator Kit (Zymo). To prepare cDNA. 150 ng of RNA was combined with SuperScript III Reverse Transcriptase (ThermoFisher) and random hexamers, following the manufacturer’s protocols.

[0415] RT-qPCR was performed using LightCycler 480 Mastermix (Roche) on a CFX Connect instrument (Bio-Rad). The primers used in this study were as follows:

[0416] IFNB [Fwd: GCGACACTGTTCGTGTTGTC (SEQ ID NO:1), Rev:

[0417] GCCTCCCATTCAATTGCCAC] (SEQ ID NO:2),

[0418] IFNy [Fwd: GGACGCCTTGGAAGAGTCACT (SEQ ID NO: 3), Rev:

[0419] AGAAGCCTCAGGTCCCAATTC] (SEQ ID NO: 4),

[0420] RIG-I [Fwd: CTGATTGCCACCTCAGTTGC (SEQ ID NO:5) Rev:

[0421] GTCCCATGTCTGAAGGCGTAJ (SEQ ID NO:6).

[0422] ISG54 [Fwd: CTGGTCACCTGGGGAAACTA (SEQ ID NO:7) Rev:

[0423] GAGCCTTCTCAAAGCACACC] (SEQ ID NO: 8),

[0424] Viperin [Fwd: TCGCTATCTCCTGTGACAGC (SEQ ID NO:9) Rev:

[0425] CACCACCTCCTCAGCTTTTG] (SEQ ID NO:10) and

[0426] OSA1 [Fwd: GATCTC AGAAATACCCCAGCC A (SEQ ID NO: 11 ) Rev:

[0427] AGCTACCTCGGAAGCACCTT] (SEQ ID NO: 12).

[0428] Gene expression levels w ere normalized to ACTB | Fw d:

[0429] TTCCAGCAGATGTGGATCAG (SEQ ID NO: 13) Rev: GGTGTAACGCAACTAAGTCA] (SEQ ID NO: 14), and further normalized to DMSO-treated vehicle control to determine the fold induction of gene expression. Each data point represents two biological replicates and three technical replicates.

[0430] MTS Cell Viability Assay

[0431] A549-Dual™ Cells were seeded in 96-well plates at a density of 60,000 cells per well in 180 pL of cell culture medium (DMEM supplemented w ith 2 mM L-glutamine, 4.5 g / L glucose, 10% fetal bovine serum). THPl-Dual cells were seeded at IxlO5cells per well in 96-well plates in THP1 test medium (RPMI 1640, 2 mM L-glutamine, 25 mM HEPES, 10% heat-inactivated fetal bovine serum, Pen-Strep (100 U / ml-100 pg / ml)) and differentiated intoAttorney Docket No. 047162-7563WOl(02825)

[0432] macrophage-like cells by treatment with 40 nM phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich) for 24 hours prior to compound or RNA exposure. After differentiation, cells were washed with PBS before compound or RNA treatment. HEK293T cells were seeded at 50,000 cells per well in 180 pL of cell culture medium (DMEM supplemented with 2 mM L-glutamine, 4.5 g / L glucose, 10% fetal bovine serum). After 24 hours, the medium was replaced with 100 pL fresh culture medium and 1 pL of compounds at various concentrations was mixed with 19 pL of culture medium and added to the cells. The cells were then incubated with the compounds for 24 hours.

[0433] Cell viability was assessed using the CellTiter 96® AQueous One Solution Cell Proliferation Assay Kit (Promega). After the designated incubation periods, 20 pL of CellTiter 96® AQueous One Solution Reagent was added to each well and incubated at 37 °C with 5% CO2 for 2 hours. Absorbance at 490 nm was measured using the BioTek Synergy Neo2 plate reader.

[0434] Data was analyzed using GraphPad Prism. Each data point represents at least three replicates, and error bars represent the S. E. M.

[0435] Example 1: Design and labeling of RIG-I constructs

[0436] To develop a direct agonist screening assay, a fluorescence-quencher reporter was first designed system that tracks the well-characterized RIG-I conformational change that occurs upon receptor activation (FIG. 1A). During the first stage of RIG-I activation, the CARD domains are released from their protein-protein interface with Hel2i, remaining connected with the RIG-I protein via a long tethering domain. Once solvent-exposed, the CARDs interact with cofactor proteins to initiate interferon responses. Previous FRET-based methods monitored this process by labeling the Hel2i and CARD domains with paired fluorophores but suffered from increased noise and reduced sensitivity due to dual fluorophores. To improve sensitivity and enable high-throughput screening, a fluorophore-quencher system was implemented. Specifically, BHQ-10 (Biosearch Technologies) was selected as the quencher due to its strong water solubility and broad absorption spectrum without native emission. Its pairing fluorophore, AZDye 488, was chosen for its optimal spectral overlap with BHQ-10, ensuring efficient quenching (FIG. 5 A).

[0437] During the initial search for optimal protein labeling sites, focus was placed on labeling the CARDs and Hel2i domains, as they undergo a contact-break process during activation, causing them to become far apart in space. Due to the limited availability of BHQ-10 in the form of carboxylic acid succinimidyl ester and given that RIG-I has more than 10Attorney Docket No. 047162-7563WOl(02825)

[0438] lysine residues, sortase-mediated reactions were used to attach BHQ-10 at the N-terminus of CARD domains, ensuring specificity. To ensure the fluorophore and quencher labeling did not interfere with ejection of the CARDS and to provide maximal quenching efficiency, several labeling positions were evaluated. For BHQ10, the N-terminus of CARD1 (amino acids 1-89) and the CARD2 domain (amino acids 90-188, after truncation of amino acids 1-89) were compared. For AZDye 488, AZDye 488 DBCO was selected, which enables strain-promoted azide-alkyne cycloaddition (SPAAC) at an internal site within the Hel2i domain. The sites Glu494 and Asp527 within Hel2i were selected based on evolutionary divergence to minimize the risk of disrupting protein stability or activity (FIG. 5B). Ultimately, the N-terminus of the CARD2 for BHQ10 and Asp527 on the Hel2i domain was selected for the fluorophore. This pair was chosen because the 41 A distance between these sites was the shortest among the evaluated options, providing optimal quenching efficiency (FIG. 5A and FIG. 5C).

[0439] To prepare for conjugation, the construct that deleted the first CARD domain (amino acids 1-89) was designed and purified and next was added three glycine residues to the N-terminus of CARD2 to facilitate sortase-mediated reactions. For the Hel2i domain, an amber stop codon at Asp527 was introduced to incorporate 4-azido-phenylalanine (AZF) for fluorophore labeling via copper-free strain-promoted alkyne-azide cycloaddition (SPAAC) (FIG. IB). Copper-free SPAAC conjugated AZDye 488 DBCO to Hel2i, with 10 mM DTT added to prevent non-specific thio-yne reactions. Successful labeling was confirmed by gel filtration chromatography and SDS-PAGE, showing absorbance at 494 nm and a distinct protein band imaged using a 525BP20 filter (excitation at 488 nm, emission collected at 525 ± 10 nm) (FIG. 1C).

[0440] Next, the CARD2 domain was labeled with BHQ-10 using sortase-mediated reactions. This step followed fluorophore labeling, as BHQ-10 is incompatible with the reducing agent DTT used in the click reaction. The labeled RIG-I protein was purified using gel filtration, with BHQ-10 labeling monitored at 550 nm, as AZDye 488 does not absorb at this wavelength (FIG. ID and FIG. 5D). To evaluate BHQ-10 quenching efficiency on AZDye 488 in dual-label RIG-1, emission spectra of singly labeled AZDye 488-RIG-l and dual-labeled RIG-I were compared (FIG. 5E). The fluorescence intensity of the singly labeled protein was about 3.4-fold higher than the dual-labeled form at max emission of 520 nm, indicating effective quenching. Based on this, quenching efficiency was estimated at 70% (Eq. 3)Attorney Docket No. 047162-7563WOl(02825)

[0441] Example 2: Fluorescence quenching-based assay optimization

[0442] The ability of dual-labeled RIG-I to accurately report on the process of CARD release was then tested. This was particularly important given the optical necessity of employing a CARD1 truncation to reduce the overall size of our construct, which contains only the proximal CARD2 that forms the Hel2i interface. To test this, the well-characterized RIG-I agonist triphosphorylated SLR14 (p3SLR14) was used, which is known to activate RIG-I and promote CARD ejection. These studies were carried out in parallel with a control RNA known as pppNS (p3NS), which is single-stranded 5' triphosphorylated RNA with weak micromolar affinity for RIG-I that does not activate the protein in cellulo or in vivo. Under all conditions tested, 200 nM p3SLR14 was added as a positive control, since 200 nM is over 100-fold higher than the binding constant between p3SLR14 and RIG-I measured in other studies, ensuring that RIG-I CARD is fully ejected. At 200 nM, p3SLR14 significantly increased fluorescence, indicative of CARD ejection (p < 0.0001), while p3NS produced no fluorescence change, comparable to the no-RNA control (FIG. 2A). RNase treatment of p3SLR14-treated samples reversed fluorescence to control levels, consistent with full-length RIG-I observations. These results confirm that CARD1 deletion does not impair CARD2 ejection and they validate the utility of the construct for reporting on the activity of RIG-I agonists.

[0443] To adapt the assay for high-throughput screening (HTS) applications, focus was placed on optimizing three key parameters: protein concentration, incubation time, and temperature. The assay quality was assessed using the Z'-factor, a statistical measure where values above 0.5 indicate a robust and reliable assay. The high Z'-factor, calculated by comparing signals and standard deviations from positive controls (RIG-I plus 200 nM p3SLR14) to negative controls (autoinhibited RIG-I), reflects a high signal-to-background ratio with low variability.

[0444] First, various concentrations of dual-labeled RIG-I were tested over 30 minutes to 24 hours at 4 °C to determine the lowest effective concentration of protein that can be used. Concentrations of 5 nM and 10 nM labeled-RIG-I consistently yielded Z'-factors above 0.5, while 1 nM resulted in Z’ lower than 0.5 and insufficient S / B ratios (FIG. 2B and FIG. 6B), suggesting that protein concentrations below 5 nM produce signals insufficient for reliable differentiation between samples. Further analysis of incubation times: 30 minutes, 1, 2, 4, 8, 12, and 24 hours, showed increasing Z'-factors and S / B ratios up to 12 hours, with a slight decrease thereafter, indicating a stabilization process (FIG. 2B and FIG. 6A). A slight decrease was observed after 12 hours, demonstrating the assay's robustness over an extendedAttorney Docket No. 047162-7563WOl(02825)

[0445] experimental timeframe. Moreover, higher temperatures reduced Z'-factors, with 37 °C causing protein instability (FIG. 2C and FIG. 6B). Building on these results, for HTS the following conditions were selected: 5 nM dual-labeled RIG-I with a 2-hour incubation time at 4 °C.

[0446] With these optimized conditions, the assay's capability beyond agonist screening was further explored. The assay’s ability to differentiate between high-affinity and moderate RIG-I ligands was therefore evaluated. Specifically, p3SLR14 (high-affinity) and 5'-hydroxyl SLR14 (OHSLR14, moderate-affinity) were compared. By conducting dose-dependent experiment using the assay, CARD ejection was monitored via fluorescence level and determined EC₅₀ values of 0.2 nM for p3SLR14 and 3.3 nM for OHSLR14 (FIG. 2D), closely matching previously reported Kd values for similar RNA lengths with identical termini. Thus, our assay is capable of generating accurate EC₅₀ values that help us to determine potency of newly identified agonists.

[0447] Example 3: Discovery of potent RIG-I agonists

[0448] After optimizing and validating the assay for reliably reporting RIG-I activation, the assay’s applicability for high-throughput screening (HTS) of small-molecule agonists was evaluated. In a pilot test using 960 compounds from the Life Chemicals SP3 diversity library, the assay, performed in 384-well plates with HTP automation, yielded an average signal-to-background (S / B) ratio of 1.8 and a Z' factor of 0.76 (FIG. 6C). demonstrating robustness for screening RIG-I agonists.

[0449] Therefore, a HTP screening of 14,800 compounds from the Enamine RNA library was subsequently conducted. Compounds with intrinsic fluorescence at 480 / 528 nm were excluded to eliminate false positives. Hits identified in the primary screen were validated in a single-dose confirmation assay. From this screening, compound 6 consistently emerged as a hit, showing 29% activation (FIG. 3A). Compound 6 demonstrated dose-dependent CARD ejection with an EC₅₀ of 0.25 μM (FIG. 3B). To confirm that the fluorescence increase was due to CARD ejection, compound 6’s fluorescence was compared to the same dose in DMSO, observing no intrinsic fluorescence (FIG. 7A).

[0450] With compound 6 identified as a promising RIG-I agonist, small-scale structureactivity relationship (SAR) studies were conducted to understand its activity and further expand the agonist pool. The C6 was defined into three regions (A, B and C) for SAR studies to evaluate the impact of structural modifications (FIG. 3C). Commercially available analogs of compound 6 were tested using the established metrics: ECso values from the fluorescenceAttorney Docket No. 047162-7563WOl(02825)

[0451] quenching assay, which provided quantitative measures of potency. For region A, the benzofuran was successfully changed to either a phenyl group (compound 75) or a furan ring (compound 83) without significant loss of agonistic activity, suggesting that this region is well-tolerated to modifications. Compound 83 exhibited a 10-fold reduction in potency compared to compound 6, although these values remained within the micromolar range. In contrast, compound 75 retained similar potency to the parent molecule compound 6 (Table 2 and FIGs. 7F-7G), indicating that region A can be minimized to a phenyl group.

[0452] Table 2. SAR data for exemplary compounds of the disclosure

[0453] Compound No. EC50(UM)

[0454] 6 0.25 ± 0.06

[0455] 28 > 50

[0456] 63 Inactive

[0457] 29 Inactive

[0458] 75 0.22 ± 0.07

[0459] 83 2.8 ± 0.7

[0460] 30 0.29 ± 0.07

[0461] 95 0.16 ± 0.06

[0462]

[0463] 96 0.13 ± 0.06

[0464] For region B, replacing the phenyl group with a methyl group (compound 28) resulted in a significant loss of activity, while substitution with a cyclopropyl group (compound 63) led to a complete loss of activity (Table 2, FIG. 7B, and FIG. 7E). These results suggest that the phenyl group’s aromatic system may serve to stabilize RIG-I binding to the compounds. Without wishing to be bound by any theory, it may be the case that, although the methyl and cyclopropyl groups are hydrophobic, they lack the electronic properties needed to mimic the phenyl group’s interactions. Alternatively, without wishing to be bound by any theory, the methyl group may lack ideal sterics properties to provide significant contact in the binding pocket.

[0465] For region C, the reduction of the ketone of the tetrahydroquinoline-2,5-dione core (compound 29) resulted in the complete loss of agonistic activity, as indicated by the absence of measurable CARD ejection (Table 2 and FIG. 7C). This result suggests that region C is highly sensitive to structural changes and the ketone, or the electron donative properties thereof, are essential for activity, likely facilitating key interactions with RIG-I via hydrogen bonding or electronic effects and making it a necessary part of the pharmacophore.

[0466] Based on these findings, the Topliss method was applied to further optimize substitutions on the Ring A aromatic system. Commercially available 4-C1 (compound 30),Attorney Docket No. 047162-7563WOl(02825)

[0467] 3,4-Cl₂ (compound 95), and the 4-chloro-3-(trifluoromethyl)phenyl (compound 96) derivative were tested. None exhibited intrinsic fluorescence (FIG. 7D). All compounds exhibited agonistic activity, with compound 95 and compound 96 displayed a two-fold improvement in potency compared to compound 6 in vitro (Table 2 and FIGs. 7G-7I). The direct interactions between the SAR compounds and CARD-deleted and full-length RIG-I were further validated through surface plasmon resonance (SPR) experiments (FIG. 3D and FIG. 12). Differences in Kᵈ among the compounds correlated well with trends observed in EC₅₀, further supporting their agonistic effects. That said, Kᵈ values were higher than corresponding EC₅₀ values, which may be due to differences in assay conditions. Specifically, the fluorescence quenching assay was conducted at 4 °C with 10% PEG as a crowding agent to mimic the cellular environment and enhance sensitivity. In contrast, the SPR assay was performed at room temperature and without PEG, accounting for the weaker Kᵈ observed. Overall, the SAR analysis used with the assay described herein permitted refinement of compound 6 and expansion of the repertoire of RIG-I agonists.

[0468] Example 4: Activation of RIG-I in cells

[0469] Given that establishment of a compound series capable of ejecting the CARD domain of RIG-I in vitro, it was next sought to investigate whether these compounds could activate the RIG-I pathway in cellular systems. A well-established luciferase assay system with A549-Dual™ cell lines (InvivoGen) was used as the model system. In this system, endogenous RIG-I activation is assessed by Lucia luciferase production, driven by IRF3 translocation to ISREs, a hallmark of RIG-I pathway activation. Compounds were tested at 50 pM and 100 pM, with DMSO as a control. Among the six in v / tro-activated compounds (i.e., compounds 6, 75, 83, 30, 95, and 96), compound 95 showed significant activation at both concentrations (p < 0.0001) compared to controls (FIGs. 8A-8B). Based on these results, compound 95 was selected for further characterization. The cytotoxicity of compound 95 was first assessed. Compound 95 demonstrated low cytotoxicity in A549-Dual™ cells, with an ICso of 291.6 pM after 24 hours incubations in an MTS assay (FIG. 4A). In comparison, the cytotoxic control terfenadine (TEFD) exhibited an ICso of 15.6 pM (FIG. 8C), indicating compound 95’s significantly lower toxicity.

[0470] Next, to evaluate activation kinetics, cells were treated with 200 pM 95 for different durations. RIG-I pathway activation was detected within 6 hours, reached its peak at 12 hours with an 8.3-fold increase, and then declined over time (FIG. 4C). Thus, a 12-hour treatment duration was chosen for subsequent experiments.Attorney Docket No. 047162-7563WOl(02825)

[0471] To confirm specificity, A549-Dual-RIG-I KO™ cells were utilized. In wild-type A549-Dual cells, compound 95 induced a dose-dependent response with an EC₅₀ of 146.6 μM, while no significant activation was observed in A549-Dual RIG-I and MAVS KO cells (FIG. 5C). At 200 pM, RIG-I KO cells showed three-fold low er activation than wild-ty pe cells, indicating moderate specificity' for RIG-I-mediated signaling (FIG. 4B). To benchmark the activation potential of compound 95, it was compared w ith known RIG-I agonists, including the p3SLR14, low molecular weight poly(I: C) (LMW PIC), and the small molecules SB9200 and KIN1148, using the same luciferase assay in A549 Dual cells (FIGs.

[0472] 13A-13D). P3SLR14 exhibited strong and highly specific RIG-I activation, inducing up to a 10-fold increase in luciferase activity', comparable to compound 95. LMW PIC also induced an about 10-fold increase, but similar activation was observed in RIG-I knockout (KO) cells, indicating that its effect likely occurs through an alternative pathway, such as MDA5. Among the small molecules tested, only KIN 1148 elicited a 6-fold increase at 20 pM in both RIG-I KO and MAVS KO cells, suggesting activity dow nstream of MAVS, consistent w ith reports of KIN 1148 as a IRF3 agonist. Together, these comparison support that compound 95 activates the RIG-I pathway robustly.

[0473] The RIG-I signaling pathw ay is well established to induce the expression of type I interferon genes, which play a critical role in clearing viral infections. However, different RIG-I or IRF3 agonists targeting the RIG-I-like receptor pathway have been shown to elicit distinct patterns of downstream gene expression. Therefore, it was sought to explore whether compound 95 activates downstream interferon-stimulated genes (ISGs) and different interferons in a RIG-I-dependent manner using RT-qPCR.

[0474] Interferon-beta (IFN-β) and interferon-gamma (IFN-γ) were selected as representative type I and type III interferons, respectively, as they are well-established markers of RIG-I activation in studies involving validated RIG-I agonists. Additionally, interferon-stimulated genes (ISGs) such as ISG54, OAS1, Viperin, and RIG-I itself, were examined, which have been consistently show n to be upregulated in studies on RIG-I agonists. Using the optimized conditions, A549-Dual and RIG-I KO cells were treated after treatment w ith 200 pM compound 95 for 12 hours. Gene expression was normalized to cell metabolism marker ACTB, which was unaffected by compound 95 treatment (FIG. 8D).

[0475] In A549-Dual cells, IFN-β and IFN-γ levels increased 7-fold and 20-fold, respectively, compared to only 2-fold and 4-fold increases in RIG-I KO cells (FIGs. 4D-4I). ISGs such as RIG-I, OAS1, and ISG54 were robustly induced (10- to 15-fold) in wild-type cells, while expression remained minimal in KO cells (2- to 4-fold) (FIGs. 4G-4I). Viperin showed theAttorney Docket No. 047162-7563WOl(02825)

[0476] highest induction, with a 35-fold increase in wild-type cells, approximately 4.3 times higher than in KO cells (FIG. 4F). These results demonstrate that compound 95 activates diverse interferons and ISGs in a largely RIG-I-dependent manner.

[0477] To further investigate the agonist activity of compound 95, the characterization was extended to THP-1 Dual reporter cells, a widely used human monocy tic leukemia cell line for studying innate immune signaling. Using a luciferase-based readout, it was assessed whether compound 95 could activate immune pathways (FIG. 9 A). For benchmarking, its efficacy was compared to other known RIG-I agonists tested previously in the A549 Dual system. Compound 95 induced clear dose-dependent activation, reaching 10-fold luciferase induction at 123 pM. KIN 1148 peaked at 5-10 pM with approximately 5 -fold induction, indicating lower efficacy than compound 95 (FIG. 9B). SB9200 produced no consistent dose response (FIG. 9C). RNA agonists LMW poly(I: C) and SLR14 elicited strong responses at 2000 ng / mL (FIGs. 9D-9E). These data guided the selection of optimal agonist concentrations for subsequent RT-qPCR analysis of endogenous IFN and ISG expression to confirm RIG-I pathway activation.

[0478] Agonists were tested in both THP1 Dual (WT) and THP1 RIG-I KO cell lines at two timepoints: after 24 hours and 48 hours of treatment, and IFN response kinetics were assessed. IFN-k, IFN-0, and the ISG viperin were measured as RIG-I activation markers. Compound 95 was also evaluated in IRF3 KO cells to assess downstream specificity. At 24 hours (FIGs. 10A-10D), Compound 95 elicited robust immune activation, with a 40-fold increase in IFN-Z in WT cells, which was substantially reduced in RIG-I KO (14-fold) and IRF3 KO (2-fold) cells. Compound 95 also increased IFN-0 and viperin by 9-fold and 7-fold, respectively, with smaller differences from RIG-I KO. Compared to KIN1148, which strongly induced IFN-X (35-fold) but showed limited IFN-0 and viperin responses, compound 95 displayed greater breadth. RNA agonists p3SLR14 and LMW PIC produced even stronger responses, with p3SLR14 showing high RIG-I specificity.

[0479] By 48 hours (FIGs. 11A-11D), compound 95 maintained strong signaling, increasing IFN-X, IFN-0, and viperin expression to 36-fold, 47-fold, and 37-fold respectively, compared to only 5-fold, 7-fold, and 4-fold in the RIG-I KO cells and basal levels in the IRF3 KO cells line, which underscores the moderate specificity of compound 95 for RIG-I-mediated signaling at longer timepoints.

[0480] In contrast, IFN responses to the RNA agonists declined significantly, consistent with reports that SLR14-induced RIG-I activation peaks early. At this extended timepoint, compound 95 produced at least 4-fold higher IFN-X and IFN-0 expression than the RNAAttorney Docket No. 047162-7563WOl(02825)

[0481] agonists (SLR14, LMW poly(I: C)) and over 18-fold higher than KIN1148. These results highlight the uniquely sustained. RIG-I-dependent activation profile of compound 95, supporting its potential as a long-acting immunostimulatory agent.

[0482] To further evaluate its safety profile, cytotoxicity assessments were expanded to additional cell lines. In HEK293T cells, compound 95 exhibited low toxicity, with an IC50 of 251.4 pM (FIG. 14B). In THP-1 Dual cells, the IC50 was 190 pM, which is substantially higher than the EC50 value of 96.6 pM determined using the luciferase-based assay (FIG. 9A and FIG. 14 A).

[0483] To better understand the physicochemical characteristics of compound 95 in cells, computational predictions were performed using SwissADME and ADMETLab3.0 platforms. These analyses indicated high lipophilicity, with a consensus LogP of 4.36 across models, suggesting lower aqueous solubility and potentially limited membrane permeability (Table 3). Together, these factors likely explain the >900-fold difference between the in vitro EC50 (0.16 pM) and the cellular ECso across cell lines, indicating that the gap stems from physicochemical constraints rather than lack of intrinsic potency. Thus, while Compound 95 represents a good starting point for RIG-I agonist design, it will benefit from further structural optimization. Fortunately, this particular scaffold is amenable to expanded synthetic campaign.

[0484] Table 3. Predicted lipophilicity and aqueous solubility characteristics of compound 95aLipophilicity Water Solubility Permeability Consensus Log S Solubility Log S Solubility MDCK PAMPA Log Po / w (ESOL) class (All) class Permeability

[0485] 4.36 -5.54 Moderately -5.12 Moderately -4.907b0.904b

[0486]

[0487] soluble soluble

[0488] "“Predictions were generated by inputting the SMILES representation of compound 95 into the SwissADME and ADMETlab 3.0 web-based platforms.blow permeability.

[0489] Sequence Listing

[0490] SEQ ID NO: 1

[0491] GCGACACTGTTCGTGTTGTC

[0492] SEQ ID NO: 2

[0493] GCCTCCCATTCAATTGCCAC

[0494] SEQ ID NO: 3Attorney Docket No. 047162-7563WOl(02825) GGACGCCTTGGAAGAGTCACT SEQ ID NO: 4 AGAAGCCTCAGGTCCCAATTC SEQ ID NO: 5 CTGATTGCCACCTCAGTTGC SEQ ID NO: 6 GTCCCATGTCTGAAGGCGTA

[0495] SEQ ID NO: 7 CTGGTCACCTGGGGAAACTA SEQ ID NO: 8 GAGCCTTCTCAAAGCACACC SEQ ID NO: 9 TCGCTATCTCCTGTGACAGC SEQ ID NO: 10 CACCACCTCCTCAGCTTTTG SEQ ID NO: 11 GATCTCAGAAATACCCCAGCCA SEQ ID NO: 12 AGCTACCTCGGAAGCACCTT SEQ ID NO: 13 TTCCAGCAGATGTGGATCAG SEQ ID NO: 14

[0496] GGTGTAACGCAACTAAGTCAAttorney Docket No. 047162-7563WOl(02825)

[0497] Enumerated Embodiments

[0498] The following exemplary embodiments are provided, the numbering of which is not to be construed as designating levels of importance:

[0499] Embodiment 1 provides a method for treating, preventing, and / or ameliorating a viral infection or cancer, or promoting or inducing an immune response in a subject, the method comprising administering to a subject in need thereof at least one compound of formula (I), or a salt or isotopologue thereof:

[0500] R2aR2t>0

[0501] R1\^R4

[0502]

[0503] R3(I).

[0504] wherein:

[0505] R1is selected from the group consisting of optionally substituted Ce-Cio aryl and C2-C10 heteroaryl;

[0506] R2aand R2bare each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C6-C10 aryl, optionally substituted C2-C10 heteroaryl, halogen, ORA, N(RA)(RB), CN, NO2, C(=O)RA, C(=O)ORA, C(=O)N(RA)(RB), S(=O)RA, S(=O)2RA, S(=O)N(RA)(RB), S(=O)2N(RA)(RB), OC(=O)RA, N

[0507]

[0508] (RA)C(=O)RB, N(RA)S(=O)RB, and N(RA)S(=O)2RB, or R2aand R2bcan combine with the carbon atom to which they are bound to form an optionally substituted Cs-Cs cycloalkyl or optionally substituted C2-C8 heterocycloalkyl;

[0509] R3is selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted Cs-Cs cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl;

[0510]

[0511] R5a, R5b, R5c, R5d, R5e, R5f, R5g, and R5hare each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8Attorney Docket No. 047162-7563WOl(02825)

[0512] cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl, halogen, ORA, N(RA)(RB), CN, NO2, C(=O)RA, C(=O)ORA, C(=O)N(RA)(RB), S(=O)RA, S(=O)2RA, S(=O)N(RA)(RB), S(=O)2N(RA)(RB), O

[0513]

[0514] C(=O)RA, N(RA)C(=O)RB, N(RA)S(=O)RB, and N(RA)S(=O)2RB, or

[0515] two geminal substituents selected from the group consisting of R5a, R5b, R5c, R5d, R5e, R5f, R5g, and R5hcan combine with the carbon atom to which they are bound to form a moiety selected from the group consisting of C(=O), C(=NRA), C(=S), optionally substituted Cs-Cs cycloalkyl, and optionally substituted C2-C8 heterocycloalkyl, or

[0516] two vicinal substituents selected from the group consisting of R5a, R5b, R5c, R5d, R5e, R5f, R5g, and R5hcan combine with the carbon atoms to which they are bound to form a moiety selected from the group consisting of optionally substituted CACs cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-C10aryl, and optionally substituted C2-C10 heteroaryl; R6is selected from the group consisting of H, optionally substituted Ci-Cs alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl:

[0517] R7is selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted Cs-Cs cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl:

[0518] each occurrence of RAand RBis independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl, C(=O)Rc, C(=O)ORc, C(=O)N(RC)(RD), S(=O)RC, S(=O)2RC, S(=O)N(RC)(RD), and S(=O)2N(RC)(RD); and each occurrence of Rcand RDis independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl.

[0519] Embodiment 2 provides the method of Embodiment 1, wherein the compound of formula (I) is selected from the group consisting of:Attorney Docket No. 047162-7563WOl(02825)

[0520] R2aR2bO

[0521] R1\^N^R4

[0522]

[0523] (la) and R3(lb).

[0524] Embodiment 3 provides the method of Embodiment 1, wherein the compound of formula (I) is selected from the group consisting of:

[0525] R2aO R2bO R2bO R2aO

[0526]

[0527] R3(la-1), R3(la-2), R3(Ib-1), R3(Ib-2). Embodiment 4 provides the method of any one of Embodiments 1-3, wherein R1is selected from the group consisting of optionally substituted furanyl, optionally substituted benzofuranyl, and optionally substituted phenyl.

[0528] Embodiment 5 provides the method of Embodiment 4, wherein each optional substituent of R1is independently selected from the group consisting of a halogen and C1-C3 haloalkyl, optionally wherein the halogen is Cl, and optionally wherein the C1-C3 haloalkyl is CF3.

[0529] Embodiment 6 provides the method of any one of Embodiments 1-5, wherein R1is

[0530]

[0531] Embodiment 7 provides the method of any one of Embodiments 1-6, wherein one of the following applies:

[0532] (a) R2ais H and R2bis optionally substituted phenyl;

[0533] (b) R2ais optionally substituted phenyl and R2bis H;

[0534] (c) R2ais H and R2bis optionally substituted Ci-Ce alkyl;

[0535] (d) R2ais optionally substituted Ci-Ce alkyl and R2bis H; and

[0536] (e) R2aand R2bcombine with the carbon atom to which they are bound to form an optionally substituted C3-C8 cycloalkyl.

[0537] Embodiment 8 provides the method of any one of Embodiments 1-7, wherein one of the following applies:

[0538] (a) R2ais H and R2bis phenyl;

[0539] (b) R2ais phenyl and R2bis H;

[0540] (c) R2ais H and R2bis methyl;Attorney Docket No. 047162-7563WOl(02825)

[0541] (d) R2ais methyl and R2bis H; and

[0542] (e) R2aand R2bcombine with the carbon atom to which they are bound to form x

[0543] Embodiment 9 provides the method of any one of Embodiments 1-8, wherein at least one of R5a, R5b, R5c, R5d, R5e, R5f, R5g, R5h, and R6comprises a hydrogen bond acceptor.

[0544] Embodiment 10 provides the method of Embodiment 9, wherein the hydrogen bond acceptor is a lone pair of a carbonyl oxygen.

[0545] Embodiment 11 provides the method of any one of Embodiments 1-10, wherein R6is H.

[0546] Embodiment 12 provides the method of any one of Embodiments 1-11, wherein R7is H.

[0547] Embodiment 13 provides the method of any one of Embodiments 1-12, wherein R5aand R5bcombine with the carbon atom to which they are bound to form C(=O).

[0548] Embodiment 14 provides the method of any one of Embodiments 1-13, wherein at least one of the following applies:

[0549] (a) at least one of R5c, R5d, R5e, R5f, R5g, and R5his H;

[0550] (b) at least two of R5c, R5d, R5e, R5f, R5g, and R5hare H;

[0551] (c) at least three of R5c, R5d, R5e, R5f, R5g, and R5hare H;

[0552] (d) at least four of R5c, R5d, R5e, R5f, R5g, and R5hare H;

[0553] (e) at least five of R5c, R5d, R5e, R5f, R5g, and R5hare H; and

[0554] (f) each of R5c, R5d, R5e, R5f, R5g, and R5hare H.

[0555] Embodiment 15 provides the method of any one of Embodiments 1-14, wherein R1is

[0556]

[0557] Embodiment 16 provides the method of any one of Embodiments 1-15, wherein R3is H.

[0558] Embodiment 17 provides the method of any one of Embodiments 1-16, wherein each occurrence of optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted phenyl, optionally substituted benzofuranyl, optionally substituted furanyl, and optionally substituted heteroaryl is independently optionally substituted with at least one substituent selected from the group consisting of Ci-Ce alkyl, C3-C8 cycloalkyl, C2-Attorney Docket No. 047162-7563WOl(02825)

[0559] C 12 heterocycloalkyl, Ci-Ce hydroxyalkyl, halogen, CN, NO2, ORI, N(RI)(RII), C1-C6 haloalkoxy, C3-C8 halocycloalkoxy, aryl, heteroaryl, (C1-C6 alkylenyl)C(=O)N(RI)(RII), (C1-C6 alkylenyl)C(=O)ORI, O(C1-C3 alkylenyl)C(=O)ORII, O(C1-C3 alkylenyl)C(=O)N(RI)(RII), C(=O)RI, C(=O)ORI, OC(=O)RI, OC(=O)ORI, SRI, S(=O)RI, S(=O)2RI, S(=O)2N(RI)(Rn),

[0560]

[0561] S(=0)2NRIC(=0)NHR11, N(RI)S(=O)2R11, N(RI)C(=0)Rn, and C(=0)NRIRn, wherein R1and Rnare each independently selected from the group consisting of H, -C(=O)(Ci-Ce alkyl), Ci-Ce alkyl, Ci-Ce haloalkyl, Ci-Ce heteroalkyl, C3-Cs cycloalkyl, C2-C12 heterocycloalkyl, C7-C12 aralkyl, aryl, and heteroaryl.

[0562] Embodiment 18 provides the method of any one of Embodiments 1-17, wherein the compound is selected from the group consisting of:

[0563] N-(benzofuran-2-yl(phenyl)methyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;

[0564] N-(1-(benzofuran-2-yl)ethyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;

[0565] N-((4-chlorophenyl)(phenyl)methyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;

[0566] N-benzhydryl-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;

[0567] N-(furan-2-yl(phenyl)methyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;

[0568] N-((3,4-dichlorophenyl)(phenyl)methyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide; and

[0569] N-((4-chloro-3-(trifluoromethyl)phenyl)(phenyl)methyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide.

[0570] Embodiment 19 provides the method of any one of Embodiments 1-18, wherein the viral infection is caused by a virus selected from the group consisting of chikungunya virus, cytomegalovirus, Dengue virus, Ebola virus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis E virus, herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2), human immunodeficiency virus (HIV), human metapneumovirus, human papillomavirus (HPV), influenza A virus, influenza B virus, influenza C virus, Lassa virus, Marburg virus, measles virus, Middle East respiratory syndrome coronavirus (MERS-CoV), Nipah virus, norovirus, parainfluenza virus, poliovirus, rabies virus, respiratory syncytial virus (RSV), Rift Valley fever virus, rotavirus, SARS-CoV-1, SARS-CoV-2, varicella-zoster virus (VZV), West Nile virus, yellow fever virus, or Zika virus.

[0571] Embodiment 20 provides the method of any one of Embodiments 1-19, wherein theAttorney Docket No. 047162-7563WOl(02825)

[0572] viral infection is at least one selected from the group consisting of AIDS, bronchiolitis, chikungunya fever, COVID-19, cytomegalovirus infection, dengue fever, Ebolavirus disease, Epstein-Barr virus infection, genital herpes, hepatitis, herpes simplex virus infection, human papillomavirus infection, influenza, Lassa fever, Marburg virus disease, measles, meningitis, Middle East respiratory syndrome (MERS), mononucleosis, Nipah virus infection, norovirus infection, polio, rabies, respiratory syncytial virus (RSV) infection, Rift Valley fever, rotavirus gastroenteritis, rubella, SARS, shingles, smallpox, varicella, viral encephalitis, viral meningitis, West Nile virus infection, yellow fever, and Zika virus disease.

[0573] Embodiment 21 provides the method of any one of Embodiments 1-20, wherein the subject is administered at least one additional agent suitable for the treatment, prevention, and / or amelioration of a viral infection.

[0574] Embodiment 22 provides the method of Embodiment 21, wherein the compound and the at least one additional agent are co-administered, optionally wherein the compound and the at least one additional agent are co-formulated.

[0575] Embodiment 23 provides the method of any one of Embodiments 1-22, wherein the compound is administered as an adjuvant in a vaccination.

[0576] Embodiment 24 provides the method of any one of Embodiments 1-18, wherein the cancer is at least one selected from the group consisting of bladder cancer, bone cancer, brain cancer, breast cancer, cervical cancer, central nervous system (CNS) cancer, colorectal cancer, colon cancer, esophageal cancer, gastric cancer, glioblastoma, head and neck cancer, head and neck squamous cell carcinoma, hepatocellular carcinoma, hepatocellular cancer, leukemia, lung cancer, lymphoma, melanoma, multiple myeloma, neuroendocrine cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, small cell lung cancer, and soft tissue sarcoma.

[0577] Embodiment 25 provides the method of Embodiment 24, wherein the subject is administered at least one additional agent suitable for the treatment, prevention, and / or amelioration of cancer.

[0578] Embodiment 26 provides the method of Embodiment 21, wherein the compound and the at least one additional agent are co-administered, optionally wherein the compound and the at least one additional agent are co-formulated.

[0579] Embodiment 27 provides the method of any one of Embodiments 1-18, wherein the immune response is promoted or induced through activation of type I or type III interferon signaling.

[0580] Embodiment 28 provides the method of any one of Embodiments 1-18 and 27,Attorney Docket No. 047162-7563WOl(02825)

[0581] wherein administration of the compound increases production of at least one interferon selected from the group consisting of IFN-a and IFN-y.

[0582] Embodiment 29 provides a method for identifying a Retinoic Acid-Inducible Gene-I (RIG-I) agonist, the method comprising:

[0583] (a) contacting a test compound with a dual -labeled RIG-I, wherein the duallabeled RIG-I comprises a RIG-I protein covalently conjugated to:

[0584] (i) a fluorescent molecule at an Hel2i domain thereof; and (ii) a fluorescence quencher at an N-terminus of a caspase activation and recruitment domain (CARD) thereof;

[0585] (b) measuring fluorescence intensity; and

[0586] (c) comparing the fluorescence intensity to positive and negative controls.

[0587] Embodiment 30 provides the method of Embodiment 29, wherein the fluorescent molecule comprises AZDye 488.

[0588] Embodiment 31 provides the method of Embodiment 30, wherein the AZDye 488 is covalently conjugated to Asp527 of the Hel2i domain.

[0589] Embodiment 32 provides the method of Embodiment 31, wherein the AZDye 488 is covalently conjugated to Asp527 of the Hel2i domain via a strain-promoted azide-alkyne cycloaddition (SPAAC) reaction between the Hel2i domain and a dibenzocyclooctyne (DBCO) substituted AZDye 488.

[0590] Embodiment 33 provides the method of any one of Embodiments 29-32, wherein the fluorescence quencher comprises BHQ-10.

[0591] Embodiment 34 provides the method of Embodiment 33, wherein the BHQ-10 is covalently conjugated to the N-terminus of the CARD by reaction between a terminal amine of the CARD and a succinimidyl ester of BHQ-10.

[0592] Embodiment 35 provides the method of any one of Embodiments 29-34, wherein the measuring comprises at least one of the following:

[0593] (a) an excitation wavelength of about 485 nm;

[0594] (b) an emission wavelength of about 528 nm; and

[0595] (c) an emission filter bandwidth of about 20 nm.

[0596] Embodiment 36 provides the method of any one of Embodiments 29-35, wherein the negative control comprises a fluorescence measurement of a sample comprising solvent (e.g, DMSO) and the dual-labeled RIG-I.

[0597] Embodiment 37 provides the method of any one of Embodiments 29-36, wherein the positive control comprises a fluorescence measurement of a sample comprisingAttomey Docket No. 047162-7563WOl(02825)

[0598] triphosphorylated SLR14 (p3SLR14) and the dual-labeled RIG-I.

[0599] Embodiment 38 provides the method of any one of Embodiments 29-37, wherein the comparing is performed according to Equation 1 (Eq. 1):

[0600] Fluorescence

[0601]

[0602] - Fluorescence^CoiifcroJActuation (%) - — - - - - - - -

[0603]

[0604] Fluorescence^^raairo5- Fluorescence^^ (Eq.

[0605] 1).

[0606] The terms and expressions employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the embodiments of the present application. Thus, it should be understood that although the present application describes specific embodiments and optional features, modification and variation of the compositions, methods, and concepts herein disclosed may be resorted to by those of ordinary skill in the art, and that such modifications and variations are considered to be within the scope of embodiments of the present application.

Claims

Attomey Docket No. 047162-7563WOl(02825)CLAIMSWhat is claimed is:

1. A method for treating, preventing, and / or ameliorating a viral infection or cancer, or promoting or inducing an immune response in a subject, the method comprising administering to a subject in need thereof at least one compound of formula (I), or a salt or isotopologue thereof:R2aR2bOR1\N^R4R3(I),wherein:R1is selected from the group consisting of optionally substituted C6-C10 aryl and C2-C10 heteroaryl;R2aand R2bare each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl, halogen, ORA, N(RA)(RB), CN, NO2, C(=O)RA, C(=O)ORA, C(=O)N(RA)(RB), S(=O)RA, S(=O)2RA, S(=O)N(RA)(RB), S(=O)2N(RA)(RB), OC(=O)RA, N(RA)C(=O)RB, N(RA)S(=O)RB, and N(RA)S(=O)2RB, orR2aand R2bcan combine with the carbon atom to which they are bound to form an optionally substituted C3-C8 cycloalkyl or optionally substituted C2-C8 heterocycloalkyl;R3is selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted Cs-Cs cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl;R5a, R5b, R5c, R5d, R5e, R5f, R5g, and R5hare each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl,Attomey Docket No. 047162-7563WOl(02825)optionally substituted C2-C10 heteroaryl, halogen, ORA, N(RA)(RB), CN, NO2, C(=O)RA, C(=O)ORA, C(=O)N(RA)(RB), S(=O)RA, S(=O)2RA, S(=O)N(RA)(RB), S(=O)2N(RA)(RB), OC(=O)RA, N(RA)C(=O)RB, N(RA)S(=O)RB, and N(RA)S(=O)2RB, or two geminal substituents selected from the group consisting of R5a, R5b, R5c, R5d, R5e, R5f, R5g, and R5hcan combine with the carbon atom to which they are bound to form a moiety selected from the group consisting of C(=O), C(=NRA), C(=S), optionally substituted C3-C8 cycloalkyl, and optionally substituted C2-C8 heterocycloalkyl, ortwo vicinal substituents selected from the group consisting of R5a, R5b, R5c, R5d. R5e, R5f, R5g, and R5hcan combine with the carbon atoms to which they are bound to form a moiety’ selected from the group consisting of optionally substituted Cs-Cs cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-C10aryl, and optionally substituted C2-C10 heteroaryl: R6is selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted Cs-Cs cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl;R7is selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted Cs-Cs cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl;each occurrence of RAand RBis independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl, C(=O)Rc, C(=O)ORc, C(=O)N(RC)(RD), S(=O)RC, S(=O)2RC, S(=O)N(RC)(RD), and S(=O)2N(RC)(RD); and each occurrence of Rcand RDis independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, optionally substituted Ci-Ce heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted Ce-Cio aryl, optionally substituted C2-C10 heteroaryl.

2. The method of claim 1, wherein the compound of formula (I) is selected from the group consisting of:Attorney Docket No. 047162-7563WOl(02825)R2a* R2b0R1^N^R4R33. The method of claim 1, wherein the compound of formula (I) is selected from the group consisting of:R2aO R2bO R2bO R2aOR3(la-1), R3(la-2), R3(Ib-1), R3(Ib-2).

4. The method of any one of claims 1-3, wherein R1is selected from the group consisting of optionally substituted furanyl, optionally substituted benzofuranyl, and optionally substituted phenyl.

5. The method of claim 4, wherein each optional substituent of R1is independently selected from the group consisting of a halogen and C1-C3 haloalkyl, optionally wherein the halogen is Cl, and optionally wherein the C1-C3 haloalkyl is CF3.

6. The method of any one of claims 1-5, wherein R1is selected from the group consisting of7. The method of any one of claims 1-6, wherein one of the following applies:(a) R2ais H and R2bis optionally substituted phenyl;(b) R2ais optionally substituted phenyl and R2bis H;(c) R2ais H and R2bis optionally substituted Ci-Ce alkyl;(d) R2ais optionally substituted Ci-Ce alkyl and R2bis H; and(e) R2aand R2bcombine with the carbon atom to which they are bound to form an optionally substituted C'3-Cs cycloalkyl.

8. The method of any one of claims 1-7, wherein one of the following applies:(a) R2ais H and R2bis phenyl;Attorney Docket No. 047162-7563WOl(02825)(b) R2ais phenyl and R2bis H;(c) R2ais H and R2bis methyl;(d) R2ais methyl and R2bis H; and(e) R2aand R2bcombine with the carbon atom to which they are bound to form V9. The method of any one of claims 1-8, wherein at least one of R5a, R5b, R5c, R5d, R5e, R'1. R5g, R5h, and R6comprises a hydrogen bond acceptor.

10. The method of claim 9, wherein the hy drogen bond acceptor is a lone pair of a carbonyl oxygen.

11. The method of any one of claims 1-10, wherein R6is H.

12. The method of any one of claims 1-11, wherein R7is H.

13. The method of any one of claims 1-12, wherein R5aand R5bcombine with the carbon atom to which they are bound to form C(=O).

14. The method of any one of claims 1-13, wherein at least one of the following applies:(a) at least one of R5c, R5d, R5e, R5f, R5g, and R5his H;(b) at least two of R5c, R5d, R5e, R5f, R5g, and R5hare H;(c) at least three of R5c, R5d, R5e, R5f, R5g, and R5hare H;(d) at least four of R5c, R5d, R5e, R5f, R5g. and R5hare H;(e) at least five of R5c, R5d, R5e, R5f, R5g, and R5hare H; and(f) each of R5c, R5d, R5e, R5f, R5g, and R5hare H.The method of any one of claims 1-14, whereinR1isThe method of any one of claims 1-15, wherein R3is H.Attorney Docket No. 047162-7563WOl(02825)17. The method of any one of claims 1-16, wherein each occurrence of optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted phenyl, optionally substituted benzofuranyl, optionally substituted furanyl, and optionally substituted heteroaryl is independently optionally substituted with at least one substituent selected from the group consisting of C1-C6alkyl, C3-C8cycloalkyl, C2-C12 heterocycloalkyl, C1-C6 hydroxyalkyl, halogen, CN, NO2 OR1, NIR’XR11), Ci-Ce haloalkoxy, C3-C8 halocycloalkoxy, aryl, heteroaryl, (Ci-Ce alkylenyl)C(=O)N(R1)(R11), (Ci-Cealkylenyl)C(=O)ORI, O(Ci-Cs alkylenyl)C(=O)ORn, O(Ci-C3alkylenyl)C(=O)N(RI)(Rn), C(=O)RT. C(=O)ORT, OC(=O)RT, OC(=O)ORT, SR1, S(=O)RT, S(=O)2RT, S(=O)2N(RT)(Rn),S(=O)2NRIC(=O)NHR11. N(RI)S(=O)2R11, N(RI)C(=O)Rn. and C(=O)NRIRn, wherein R1and Rnare each independently selected from the group consisting of H, -C(=O)(Ci-C6 alkyl), Ci-Ce alkyl, Ci-Ce haloalkyl, Ci-Ce heteroalkyl, Cs-Cs cycloalkyl, C2-C12 heterocycloalkyl, C7-C12aralkyl, aryl, and heteroaryl.

18. The method of any one of claims 1-17, wherein the compound is selected from the group consisting of:N-(benzofuran-2-yl(phenyl)methyl)-2,5-dioxo-l,2,5,6,7,8-hexahydroquinoline-3-carboxamide;N-(1-(benzofuran-2-yl)ethyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;N-((4-chlorophenyl)(phenyl)methyl)-2,5-dioxo-l,2,5,6,7,8-hexahydroquinoline-3-carboxamide;N-benzhydryl-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;N-(furan-2-yl(phenyl)methyl)-2,5-dioxo-1,2,5,6,7,8-hexahydroquinoline-3-carboxamide;N-((3,4-dichlorophenyl)(phenyl)methyl)-2,5-dioxo-l,2,5,6,7,8-hexahydroquinoline-3-carboxamide; andN-((4-chloro-3-(trifluoromethyl)phenyl)(phenyl)methyl)-2,5-dioxo-l,2,5,6,7,8-hexahydroquinoline-3-carboxamide.

19. The method of any one of claims 1-18, wherein the viral infection is caused by a virus selected from the group consisting of chikungunya virus, cytomegalovirus. Dengue virus, Ebola virus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitisAttomey Docket No. 047162-7563WOl(02825)E virus, herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2), human immunodeficiency virus (HIV), human metapneumovirus, human papillomavirus (HPV), influenza A virus, influenza B virus, influenza C virus, Lassa virus, Marburg virus, measles virus, Middle East respiratory syndrome coronavirus (MERS-CoV), Nipah virus, norovirus, parainfluenza virus, poliovirus, rabies virus, respiratory syncytial virus (RSV), Rift Valley fever virus. rotavirus, SARS-CoV-1, SARS-CoV-2, varicella-zoster virus (VZV), West Nile virus, yellow fever virus, and Zika virus.

20. The method of any one of claims 1-19, wherein the viral infection is at least one selected from the group consisting of AIDS, bronchiolitis, chikungunya fever, COVID-19, cytomegalovirus infection, dengue fever, Ebola virus disease. Epstein-Barr virus infection, genital herpes, hepatitis, herpes simplex virus infection, human papillomavirus infection, influenza, Lassa fever, Marburg virus disease, measles, meningitis, Middle East respiratory syndrome (MERS), mononucleosis, Nipah virus infection, norovirus infection, polio, rabies, respiratory syncytial virus (RSV) infection, Rift Valley fever, rotavirus gastroenteritis, rubella, S ARS, shingles, smallpox, varicella, viral encephalitis, viral meningitis, West Nile virus infection, yellow fever, and Zika virus disease.

21. The method of any one of claims 1-20, wherein the subject is administered at least one additional agent suitable for the treatment, prevention, and / or amelioration of a viral infection.

22. The method of claim 21, wherein the compound and the at least one additional agent are co-administered, optionally wherein the compound and the at least one additional agent are co-formulated.

23. The method of any one of claims 1-22, w herein the compound is administered as an adjuvant in a vaccination.

24. The method of any one of claims 1-18, wherein the cancer is at least one selected from the group consisting of bladder cancer, bone cancer, brain cancer, breast cancer, cervical cancer, central nervous system (CNS) cancer, colorectal cancer, colon cancer, esophageal cancer, gastric cancer, glioblastoma, head and neck cancer, head and neck squamous cell carcinoma, hepatocellular carcinoma, hepatocellular cancer, leukemia, lungAttorney Docket No. 047162-7563WOl(02825)cancer, lymphoma, melanoma, multiple myeloma, neuroendocrine cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, small cell lung cancer, and soft tissue sarcoma.

25. The method of claim 24, wherein the subject is administered at least one additional agent suitable for the treatment, prevention, and / or amelioration of cancer.

26. The method of claim 21, wherein the compound and the at least one additional agent are co-administered, optionally wherein the compound and the at least one additional agent are co-formulated.

27. The method of any one of claims 1-18, wherein the immune response is promoted or induced through activation of type I or type III interferon signaling.

28. The method of any one of claims 1-18 and 27. wherein administration of the compound increases production of at least one interferon selected from the group consisting of IFN-a and IFN-y.

29. A method for identifying a Retinoic Acid-Inducible Gene-I (RIG-I) agonist, the method comprising:(a) contacting a test compound with a dual-labeled RIG-I, wherein the duallabeled RIG-I comprises a RIG-I protein covalently conjugated to:(i) a fluorescent molecule at an Hel2i domain thereof; and (ii) a fluorescence quencher at an N-terminus of a caspase activation and recruitment domain (CARD) thereof;(b) measuring fluorescence intensity; and(c) comparing the fluorescence intensity to positive and negative controls.

30. The method of claim 29, wherein the fluorescent molecule comprises AZDye 488.

31. The method of claim 30, wherein the AZDye 488 is covalently conjugated to Asp527 of the Hel2i domain.

32. The method of claim 31, wherein the AZDye 488 is covalently conjugated to Asp527Attomey Docket No. 047162-7563WOl(02825)of the Hel2i domain via a strain-promoted azide-alkyne cycloaddition (SPAAC) reaction between the Hel2i domain and a dibenzocyclooctyne (DBCO) substituted AZDye 488.

33. The method of any one of claims 29-32, wherein the fluorescence quencher comprises BHQ-10.

34. The method of claim 33, wherein the BHQ-10 is covalently conjugated to the N-terminus of the CARD by reaction between a terminal amine of the CARD and a succinimidyl ester of BHQ-10.

35. The method of any one of claims 29-34, wherein the measuring comprises at least one of the following:(a) an excitation wavelength of about 485 nm;(b) an emission wavelength of about 528 nm; and(c) an emission filter bandwidth of about 20 nm.

36. The method of any one of claims 29-35, wherein the negative control comprises a fluorescence measurement of a sample comprising solvent (e.g., DMSO) and the dual-labeled RIG-I.

37. The method of any one of claims 29-36, wherein the positive control comprises a fluorescence measurement of a sample comprising triphosphorylated SLR14 (p3SLR14) and the dual-labeled RIG-I.

38. The method of any one of claims 29-37, wherein the comparing is performed according to Equation 1 (Eq. 1):Activation (%) = (Fluorescencesample− FluorescenceNegative Control) / (FluorescencePositive Control− FluorescenceNegative Control)Fluorescence^^ - Fluorescence}^^ (Eq. 1).

Images