Modified guide RNAs

Modified guide RNAs with specific nucleotide modifications address the degradation issue, enhancing stability and efficiency of CRISPR/Cas systems for effective gene editing.

AU2024201264B2Pending Publication Date: 2026-07-16INTELLIA THERAPEUTICS INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
AU2024201264
Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-02-26
Publication Date
2026-07-16

AI Technical Summary

Technical Problem

Oligonucleotides, particularly RNA, are prone to degradation by endonucleases and exonucleases, which affects the stability and efficiency of guide RNAs in CRISPR/Cas systems, especially in therapeutic applications.

Method used

Modified guide RNAs with specific nucleotide modifications, such as 2’-O-methyl, 2’-fluoro, and phosphorothioate bonds, are introduced to enhance stability and improve the activity of the guide RNA/Cas9 complex for targeted DNA cleavage.

Benefits of technology

The modified guide RNAs demonstrate improved stability and enhanced gene editing efficiency both in vitro and in vivo, as evidenced by increased editing percentages in cellular and animal models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000120_0000
    Figure 00000120_0000
  • Figure 00000121_0000
    Figure 00000121_0000
  • Figure 00000122_0000
    Figure 00000122_0000
Patent Text Reader

Abstract

This disclosure relates to modified single and dual guide RNAs having improved in vitro and in vivo activity in gene editing methods. 20 24 20 12 64 26 F eb 2 02 4 A B S T R A C T 2 0 2 4 2 0 1 2 6 4 2 6 F e b 2 0 2 4
Need to check novelty before this filing date? Find Prior Art

Description

[000001] This is a divisional of Australian patent application No. 2017374044, which entire contents of which is incorporated herein by reference. SEQUENCE LISTING

[00001] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on December 7, 2017, is named 01155-0004-00PCT SeqList.txt and is 118,877 bytes in size.

[0001] This application claims the benefit of priority to United States Provisional Application No. 62 / 431,756, which was filed on December 8, 2016, and which is incorporated by reference in its entirety.

[0002] This disclosure relates to the field of gene editing using CRISPR / Cas systems, a part of the prokaryotic immune system that recognizes and cuts exogenous genetic elements. The CRISPR / Cas system relies on a single nuclease, termed CRISPR-associated protein 9 (Cas9), which induces site-specific breaks in DNA. Cas9 is guided to specific DNA sequences by small RNA molecules termed guide RNA (gRNA). Guide RNA comprises trRNA (also known as tracrRNA) and crisprRNA (crRNA). The trRNA and crRNA may be contained within a single guide RNA (sgRNA) or in two separate RNA molecules of a dual guide RNA (dgRNA). Cas9 in combination with trRNA and crRNA or an sgRNA is termed the Cas9 ribonucleoprotein complex (RNP).

[0003] Oligonucleotides, and in particular RNA, are sometimes degraded in cells and in serum by endonuclease or exonuclease cleavage. Improved methods and compositions for preventing such degradation, improving stability of gRNAs and enhancing gene editing efficiency is desired, especially for therapeutic applications. SUMMARY

[0004] In some embodiments, therapeutic genome editing tools are provided comprising modified guide RNAs. The modified guide RNAs described herein may improve the stability of the guide RNA and the guide RNA / Cas9 complex and improve the activity of Cas9 (e.g., SpyCas9 and equivalents) to cleave target DNA. In some embodiments, the guide RNA is an sgRNA. In some embodiments, the guide RNA is a dgRNA. In some embodiments, the guide RNA is a tracrRNA. In some embodiments, the guide RNA is a crRNA.

[0005] The guide RNAs described herein comprise at least one modified nucleotide. Modifications may include 2’-O-methyl (2’-O-Me), 2’-O-(2-methoxyethyl) (2’-O-moe), 2’-fluoro (2’-F), phosphorothioate (PS) bond between nucleotides, G-C substitutions, and 2024201264   26 Feb 2024 inverted abasic linkages between nucleotides and equivalents thereof. Embodiments of the invention include:

[0006] In some embodiments, a single guide RNA (sgRNA) is encompassed comprising a 5’ end modification and one or more modification in one or more of: the upper stem region; the hairpin 1 region; and the hairpin 2 region, wherein the 5’ end modification comprises at least two phosphorothioate linkages within the first seven nucleotides at the 5’ end of the 5’ terminus. In some instances, the modification is a 2’-O-methyl (2’-O-Me) modified nucleotide. In some embodiments, the modification is a 2’-fluoro (2’-F) modified nucleotide.

[0007] In some embodiments, the sgRNA comprises modifications at US1 to US 12 and / or a modification at Hl-1 and / or a modification in H2-1. In some embodiments, the sgRNA comprises modifications at Hl-1 to Hl-12 and / or H2-1 to H2-15. In some embodiments, the sgRNA comprises one or more modifications in each of the upper stem region, the hairpin 1 region, and the hairpin 2 region. In some embodiments, the sgRNA comprises a modified nucleotide between hairpin 1 and hairpin 2 regions. In some embodiments, the sgRNA comprises a modification in the lower stem region.

[0008] In some embodiments, the sgRNA comprises a modification at the 5’ terminus and / or the 3’ terminus. In some embodiments, the sgRNA comprises a 3’ end modification in the 3’ terminus. In some embodiments, the sgRNA comprises modifications on at least two of the last four nucleotides at the 3’ end of the 3’ terminus. In some embodiments, the sgRNA comprises a 5’ end modification in the 5’ terminus. In some embodiments, the sgRNA comprises modifications on at least two of the first four nucleotides at the 5’ end of the 5’ terminus. In some embodiments, the sgRNA comprises a 3’ end modification in the 3’ terminus and a 5’ end modification in the 5’ terminus. In some embodiments, the sgRNA comprises modifications on at least two of the last four nucleotides at the 3’ end of the 3’ terminus and on at least two of the first four nucleotides at the 5’ end of the 5’ terminus. In some instances, these modifications are 2’-O-Me, 2’-F, 2’-O-moe, or phosphorothioate (PS) bonds linking the nucleotides. In some embodiments, the sgRNA comprises PS bonds between at least two of the last four nucleotides at the 3’ end of the 3’ terminus and / or at least two of the first four nucleotides at the 5’ end of the 5’ terminus. In some instances, the sgRNA comprises 5’ terminus and 3’ terminus with more than one modification as described herein, such as, with PS bonds and 2’-O-Me modifications. 2024201264   26 Feb 2024

[0009] In some embodiments, the sgRNA comprises a modification in the bulge region. In some embodiments, 50% of the nucleotides in the bulge region are modified, wherein the modification is 2’-O-Me or 2’-F.

[0010] In some embodiments, the sgRNA comprises a modification in the nexus region. In some embodiments, the sgRNA comprises modifications atN15, N16, N17, and / or N18 in the nexus region, wherein the modification is 2’-O-Me or 2’-F. In some instances, N16, N17, andN18 are linked with PS bonds.

[0011] In some embodiments, the sgRNA comprises at least the first three nucleotides at the 5’ end of the 5’ terminus, and the last three nucleotides at the 3’ end of the 3’ terminus are modified.

[0012] In some embodiments, the sgRNA comprises modifications at the 3’ terminus and / or 5’ terminus. In some instances, the first four nucleotides at the 5’ end of the 5’ terminus, and the last four nucleotides at the 3’ end of the 3’ terminus are linked with phosphorothioate (PS) bonds. In some embodiments, the 5’ and 3’ modification comprises 2’-O-Me or 2’-O-moe. In some embodiments, the 5’ and 3’ modification comprises 2’-F. In some embodiments, the 5’ and / or 3’ modification comprises PS bonds linking nucleotides. In some embodiments, the 5’ and / or 3’ modification comprises one or more of 2’-O-Me, 2’-O-moe, 2’-F, and PS bonds linking nucleotides.

[0013] In some embodiments, the sgRNA comprises modifications at the first four nucleotides at the 5’ end of the 5’ terminus and the last four nucleotides at the 3’ end of the 3’terminus. In some instances, these modifications are linking PS bond (i.e., PS bonds that link the first four and last four nucleotides). In some embodiments, the sgRNA further comprises 2’-O-Me modifications at the first three nucleotides at the 5’ end of the 5’ terminus and the last three nucleotides at the 3’ end of the 3’ terminus.

[0014] In some embodiments, the sgRNA comprises modifications at the first four nucleotides at the 5’ end of the 5’ terminus and the last four nucleotides at the 3’ end of the 3’ terminus, wherein the modifications are at least PS bonds linking the four nucleotides, and further wherein the first three nucleotides at the 5’ end of the 5’ terminus and the last three nucleotides at the 3’ end of the 3’ terminus comprise 2’-O-Me, 2’-O-moe, or 2’-F modifications.

[0015] In some embodiments, the sgRNA comprises modifications LSI, LS6, LS7, LS8, LS11, and LS12, wherein the modification is 2’-O-Me or 2’-F.

[0016] In some embodiments, the sgRNA comprises modifications at each of the nucleotides in the bulge region, wherein the modification is 2’-O-Me or 2’-F. 2024201264   26 Feb 2024

[0017] In some embodiments, the sgRNA comprises modifications at each of the nucleotides in the upper stem region, wherein the modification is 2’-O-Me or 2’-F.

[0018] In some embodiments, the sgRNA comprises modifications at each of the nucleotides in the hairpin 1 region, wherein the modification is 2’-O-Me or 2’-F.

[0019] In some embodiments, the sgRNA comprises modifications at each of the nucleotides in the hairpin 2 region, wherein the modification is 2’-O-Me or 2’-F.

[0020] In some embodiments, an sgRNA is encompassed comprising 2’-O-Me modified nucleotides at the following positions: a. the first three nucleotides at the 5’ end of the 5’ terminus; b. LSI, LS6, LS7, LS8, LS11, and / or LS12 in the lower stem region; c. Bl and / or B2 in the bulge region; d. each nucleotide in the upper stem region; e. N16, N17, and / or N18 in the nexus region; f each nucleotide in the hairpin 1 region; g. each nucleotide in the hairpin 2 region; and h. the last four nucleotides at the 3’ end of the 3’ terminus. In some embodiments, B3-B6 are modified with 2’-O-Me. In some instances, the sgRNA further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus. In some embodiments, the sgRNA comprises 2’-F modifications at LS9 and LS10. In some embodiments, the sgRNA comprises 2’F modifications atN15, N16, N17, and N18. In some embodiments, the sgRNA comprises 2’F modifications at H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H2-15. In some embodiments, the sgRNA comprises 2’F modifications at the second to last, third to last, and fourth to last nucleotides at the 3’ end of the 3’ terminus.

[0021] In some embodiments, an sgRNA is encompassed comprising 2’-F modified nucleotides at the following positions: a. LS9 and LS10 in the lower stem region; b. N15, N16, N17, and N18 in the nexus region; and c. H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H2-15 in the hairpin 2 region. In some embodiments, the sgRNA comprises 2’-F modified nucleotides at the second to last, third to last, and fourth to last nucleotides at the 3’ terminus. In some embodiments, the sgRNA comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of 2024201264   26 Feb 2024 the 3’ terminus. In some embodiments, the sgRNA comprises 2’-O-Me or 2’-F modified nucleotides at the first three nucleotides at the 5’ end of the 5’ terminus, and 2’-O-Me or 2’-F modified nucleotides at three of the last four nucleotides at the 3’ end of the 3’ terminus.

[0022] In some embodiments, an sgRNA is encompassed comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end of the 5’ terminus; b. Optional 2’-O-Me modified nucleotides at LSI and / or LS6; c. 2’-O-Me modified nucleotides at US 1-US 12; d. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; e. Optional 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; f 2’-O-Me modified nucleotides at H2-1 - H2-15; and g. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ end of the 3’ terminus; and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0023] In some embodiments, an sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end of the 5’ terminus; b. 2’-F modified nucleotides at LS1-LS6; c. 2’-O-Me modified nucleotides at US 1-US 12; d. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; e. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; f 2’-O-Me modified nucleotides at H2-1 - H2-15; and g. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ end of the 3’ terminus; and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0024] In some embodiments, an sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-F modified nucleotides at LS2-LS5; c. 2’-O-Me modified nucleotides at LSI and LS6; d. 2’-O-Me modified nucleotides at US 1-US 12; 2024201264   26 Feb 2024 e. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; f a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; g. 2’-O-Me modified nucleotides at H2-1 - H2-15; and h. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0025] In some embodiments, a sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at US 1-US 12; c. 2’-O-Me modified nucleotides at LS7, LS8, LSI 1, and LS12; d. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; e. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; f 2’-O-Me modified nucleotides at H2-1 - H2-15; and g. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus, and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0026] In some embodiments, a sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at US 1-US 12; c. 2’-O-Me modified nucleotides at LS7, LS8, LSI 1, and LS12; d. 2’-F modified nucleotides at LS9 and LS10; e. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; f a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; g. 2’-O-Me modified nucleotides at H2-1 - H2-15; and h. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus, and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0027] In some embodiments, an sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at US 1-US 12; 2024201264   26 Feb 2024 c. 2’-O-Me modified nucleotides at LS8, LS10, and LS12; d. 2’-O-F modified nucleotides at LS7, LS9, and LS11; e. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; f a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; g. 2’-O-Me modified nucleotides at H2-1 - H2-15; and h. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus, and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0028] In some embodiments, a sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at LSI, LS6, LS7, LS8, LS11, and LS12 c. 2’-O-Me modified nucleotides at US 1-US 12; d. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; e. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; f 2’-O-Me modified nucleotides at H2-1 - H2-15; and g. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus, and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus

[0029] In some embodiments, a sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at LSI, LS6, LS7, LS8, LS11, and LS12; c. 2’-F modified nucleotides at LS9 and LS10; d. 2’-O-Me modified nucleotides at US 1-US 12; e. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; f a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; g. 2’-O-Me modified nucleotides at H2-1 - H2-15; and h. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus, and optionally 2024201264   26 Feb 2024 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0030] In some embodiments, a sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end of the 5’ terminus; b. 2’-O-Me modified nucleotides at US 1-US 12; c. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; d. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; e. 2’-O-Me modified nucleotides at H2-1 - H2-8; f 2’-F modified nucleotides at H2-9 - H2-15; g. 2’-F modified nucleotides at the second from last, third from last, and fourth from last nucleotide at the 3’ terminus; and h. a 2’-O-Me modified nucleotide at the last nucleotide at the 3’ terminus, and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0031] In some embodiments, a sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end of the 5’ terminus; b. 2’-O-Me modified nucleotides at US 1-US 12; c. 2’-O-Me modified nucleotides at Hl-2, Hl-4, Hl-6, Hl-8, Hl-10, and Hl-12; d. 2’-F modified nucleotides at Hl-1, Hl-3, Hl-5, Hl-7, Hl-9, and Hl-11; e. a 2’-F modified nucleotide between Hairpin 1 and Hairpin 2; f 2’-F modified nucleotides at H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2-14; g. 2’-O-Me modified nucleotides at H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and H2-15; h. 2’-F modified nucleotides at the second from last, and fourth from last nucleotide at the 3’ terminus; and i. 2’-O-Me modified nucleotide at the third from last and last nucleotide at the 3’ end of the 3’ terminus, 2024201264   26 Feb 2024 and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus.

[0032] In some embodiments, a sgRNA is encompassed comprising: a. 2’-O-Me modified nucleotides LS8, LS10, LS12, Hl-2, Hl-4, Hl-6, Hl-8, Hl-10, Hl-12, H2-1, H2-3, H2-5, H2-7, H2-9, H2-11, H2-13, and H2-15; and b. 2’-F modified nucleotides at LS7, LS9, LSI 1; Hl-1, Hl-3, Hl-5, Hl-7, Hl-9, Hl-11, Hl-13, H2-2, H2-4, H2-6, H2-8, H2-10, H2-12, and H2-14, and optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus; and optionally further comprising: c. 2’-O-Me modified nucleotides at the last and third to last nucleotide at the 3’ end of the 3’ terminus; and / or d. 2’-F modified nucleotides at the second to last, fourth to last, and / or last nucleotide at the 3’ end of the 3’ terminus.

[0033] In some embodiments, a sgRNA is encompassed comprising the nucleic acids of any of SEQ ID Nos: 228-353, including the modifications of Table 4. In some embodiments, a sgRNA is encompassed comprising any of SEQ ID Nos: 228-332, including the modifications of Table 4. In some embodiments, an sgRNA is encompassed comprising any of SEQ ID Nos: 235-240, 265-285, and 309-329, including the modifications of Table 4. In some embodiments, an sgRNA is encompassed comprising SEQ ID No: 240. In some embodiments, a sgRNA is encompassed comprising SEQ ID No. 240, including the modifications of Table 4. In some embodiments, a sgRNA is encompassed comprising SEQ ID No: 242. In some embodiments, a sgRNA is encompassed comprising SEQ ID No: 358. In additional embodiments, a sgRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleic acids of any one of SEQ ID Nos: 235-240, 265-285, and 309-329, wherein the modification at each nucleotide of the sgRNA that corresponds to a nucleotide of the reference sequence identifier in Table 4, is identical to or equivalent to the modification shown in the reference sequence identifier in Table 4, optionally further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ end of the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ end of the 3’ terminus. In some embodiments, the sgRNA further comprises at least three PS bonds linking the nucleotides in the hairpin 1 region. In some embodiments, the sgRNA further comprises at least three PS bonds linking the nucleotides in 2024201264   26 Feb 2024 the hairpin 2 region. In some embodiments, the sgRNA further comprises at least three PS bonds linking the nucleotides in the upper stem region. In some embodiments, the sgRNA forms a ribonucleoprotein complex with S. pyogenes Cas9. FIGURE LEGENDS

[0034] FIG 1 shows percent editing as measured by next-generation sequence (NGS) of mouse transthyretin (TTR) gene following transfection of Neuro2A cells with modified crRNAs together with Cas9 mRNA and unmodified trRNA (TR000002).

[0035] FIG 2 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with modified trRNAs together with unmodified crRNA (CR000686) and Cas9 mRNA.

[0036] FIG 3 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with Cas9 mRNA and crRNAs and trRNAs having G-C pairings not found in parental sequences.

[0037] FIG 4 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with modified crRNAs and trRNAs together with Cas9 mRNA. Standard deviations follow the value.

[0038] FIG 5 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with modified sgRNAs together with Cas9 mRNA.

[0039] FIG 6 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with modified crRNAs and unmodified trRNA (TR000002) together with Cas9 mRNA. The asterisk denotes a dual guide that for technical reasons did not show activity in this experiment. This dual guide was tested again in the experiment represented in Figure 9, in which it showed editing activity.

[0040] FIG 7 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with unmodified crRNA (CR000686) and modified trRNAs together with Cas9 mRNA.

[0041] FIG 8 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with Cas9 mRNA and crRNA and trRNA pairings with G-C pairings or G-U mismatches not found in the parental sequences.

[0042] FIG 9 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with modified crRNAs and modified trRNAs together with Cas9 mRNA. Standard deviations follow the value. 2024201264   26 Feb 2024

[0043] FIG 10 shows percent editing as measured by NGS of mouse TTR gene following transfection of Neuro2A cells with modified sgRNAs together with Cas9 mRNA.

[0044] FIG 11 shows percent editing as measured by NGS of mouse Factor VII (FVII) gene following transfection of Neuro2A cells with modified sgRNAs together with Cas9 mRNA.

[0045] FIGs 12A and 12B show percent editing as measured by NGS of mouse TTR (FIG 12A) or FVII (FIG 12B) following transfection of Neuro2A cells with modified crRNAs and unmodified trRNA together with Cas9 mRNA.

[0046] FIGs 13 A and 13B shows percent editing as measured by NGS of mouse TTR (FIG 13A) or FVII (FIG 13B) following transfection of Neuro2A cells with modified trRNAs and unmodified crRNA together with Cas9 mRNA.

[0047] FIGs 14A, 14B, 14C, and 14D show interferon alpha (IFN-alpha, 14A), interleukin 6 (IL-6, 14B), monocyte chemotactic protein 1 (MCP-1, 14C), and tumor necrosis factor alpha (TNF-alpha, 14D) levels in serum after in vivo administration of LNPs comprising Cas9 mRNA and sgRNAs.

[0048] FIGs 15A, 15B, and 15C show in vivo results following administration of LNPs comprising Cas9 mRNA and sgRNAs. FIG 15 A shows percentage of total editing in liver. FIG 15B shows serum TTR levels. FIG 15C shows the mean and standard deviation for the results of FIG 15 A. FIG 15D summarizes modifications to the G000209 sgRNA (SEQ ID NO: 228). FIG 15E summarizes modifications to the G000267 sgRNA (SEQ ID NO: 234). In FIG 15D and 15E, the nucleotides in bold are 2’-O-Me modified.

[0049] FIGs 16A, 16B, 16C, and 16D show interferon alpha (IFN-alpha, 16A), tumor necrosis factor alpha (TNF-alpha, 16B), interleukin 6 (IL-6, 16C), and monocyte chemotactic protein 1 (MCP-1, 16D) levels in serum after in vivo administration of LNPs comprising Cas9 mRNA and sgRNAs.

[0050] FIGs 17A, 17B, 17C, and 17D show in vivo results following administration of LNPs comprising Cas9 mRNA and sgRNAs. FIG 17A shows percentage of total editing in liver. FIG 17B shows the mean and standard deviation for the results of FIG 17 A. FIG 17C shows serum TTR levels. FIG 17D shows the mean and standard deviation for the results of FIG 17B.

[0051] FIGs 18A, 18B, and 18C show in vivo results following administration of LNPs comprising Cas9 mRNA and sgRNAs. FIG 18A shows percentage of total editing in liver. FIG 18B summarizes liver editing data. FIG 18C shows serum TTR levels. MPK = milligrams per kilogram; BLOD = below level of detection. 2024201264   26 Feb 2024

[0052] FIGs 19A, 19B, 19C, and 19D show interferon alpha (IFN-alpha, 19A), monocyte chemotactic protein 1 (MCP-1, 19B), interleukin 6 (IL-6, 19C), and tumor necrosis factor alpha (TNF-alpha, 19D) levels in serum after in vivo administration of LNPs comprising Cas9 mRNA and sgRNAs.

[0053] FIGs 20A and 20B show editing in liver of FVII locus (FIG 20A) and TTR locus (FIG 20B) following in vivo administration of LNPs comprising Cas9 mRNA and sgRNAs.

[0054] FIGs 21A, 21B, and 21C show schematics of an annotated sgRNA (SEQ ID NO: 341) (FIG 21 A), non-annotated dgRNA CR000686 (SEQ ID NO: 1) and TR000002 (SEQ ID NO: 188) (FIG 21B), and annotated dgRNA CR000686 (SEQ ID NO: 1) and TR000002 (SEQ ID NO: 188) (FIG 21C).

[0055] FIG 22A, 22B, and 22C show in vivo results following administration of LNPs comprising Cas9 mRNA and sgRNAs. FIG 22A shows percentage of total editing of TTR locus in liver. FIG 22B summarizes liver editing data. FIG 22C shows serum TTR levels.

[0056] FIG 23A, 23B, and 23C show in vivo results following administration of LNPs comprising Cas9 mRNA and sgRNAs. FIG 23A shows percentage of total editing of TTR locus in liver. FIG 23B summarizes liver editing data. FIG 23C shows serum TTR levels.

[0057] FIGs 24A, 24B, and 24C show editing in primary mouse hepatocytes following administration of LNPs comprising Cas9 mRNA and sgRNAs. FIG24A shows editing percentage of total editing of TTR locus. FIG24B shows normalized transforms of editing percentage as a function of mRNA dose used to calculate EC50. FIG 24C shows EC50 values for the LNPs tested. DETAILED DESCRIPTION

[0058] Provided herein are modified guide RNAs, including dual and single guide RNAs for use in gene editing methods. The modified guides are more stable and show improved in vitro and in vivo efficacy as compared to their non-modified counterparts. Sequences of engineered and tested guide RNAs are shown in Table 4. Table 4: SEQ ID NO Name Alias Description Sequence crRNA 1 CR000686 unmodified CCAGUCCAGCGAGGCAAAGGGUUUUAGAGCUAUGCUGUUUUG 2 CR003393 CR686-1 upper CCAGUCCAGCGAGGCAAAGGGUUUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 3 CR003394 CR686-2 partial upper CCAGUCCAGCGAGGCAAAGGGUUUUAGAGCUAmUmGmCmUmGmUmU mUmUmG 4 CR003395 CR686-3 partial upper CCAGUCCAGCGAGGCAAAGGGUUUUAGAGCUAUGCmUmGmUmUmUm UmG 5 CR003396 CR686-4 partial upper CCAGUCCAGCGAGGCAAAGGGUUUUAGAGCUAUGCUGUmUmUmUmG 6 CR003397 CR686-5 lower CCAGUCCAGCGAGGCAAAGGmGmUmUmUmUmAGAGCUAUGCUGUUU UG 7 CR003398 CR686-6 lower walk CCAGUCCAGCGAGGCAAAGGmGUUUUAGAGCUAUGCUGUUUUG 8 CR003399 CR686-7 lower walk CCAGUCCAGCGAGGCAAAGGGmUUUUAGAGCUAUGCUGUUUUG 9 CR003400 CR686-8 lower walk CCAGUCCAGCGAGGCAAAGGGUmUUUAGAGCUAUGCUGUUUUG 10 CR003401 CR686-9 lower walk CCAGUCCAGCGAGGCAAAGGGUUmUUAGAGCUAUGCUGUUUUG 11 CR003402 CR686-10 lower walk CCAGUCCAGCGAGGCAAAGGGUUUmUAGAGCUAUGCUGUUUUG 12 CR003403 CR686-11 lower walk CCAGUCCAGCGAGGCAAAGGGUUUUmAGAGCUAUGCUGUUUUG 13 CR003404 CR686-12 partial lower CCAGUCCAGCGAGGCAAAGGGmUmUmUmUAGAGCUAUGCUGUUUUG 14 CR003405 CR686-13 partial lower CCAGUCCAGCGAGGCAAAGGGUmUmUUAGAGCUAUGCUGUUUUG 15 CR003406 CR686-GC1 Lower GC CCAGUCCAGCGAGGCAAAGGGGCGCAGAGCUAUGCUGUUUUG 16 CR003407 CR686-GC3 Upper GC CCAGUCCAGCGAGGCAAAGGGUUUUAGAGCUAUGCUGGCGCG 17 CR003408 CR686-GC5 Lower Upper GC CCAGUCCAGCGAGGCAAAGGGGCGCAGAGCUAUGCUGGCGCG 18 CR003409 CR686 all OMe mCmCmAmGmUmCmCmAmGmCmGmAmGmGmCmAmAmAmGmGm GmUmUmUmUmAmGmAmGmCmUmAmUmGmCmUmGmUmUmUmU mG 19 CR003393 - mod only upper GUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 20 CR003394 - mod only partial upper GUUUUAGAGCUAmUmGmCmUmGmUmUmUmUmG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 21 CR003395 - mod only partial upper GUUUUAGAGCUAUGCmUmGmUmUmUmUmG 22 CR003396 - mod only partial upper GUUUUAGAGCUAUGCUGUmUmUmUmG 23 CR003397 - mod only lower mGmUmUmUmUmAGAGCUAUGCUGUUUUG 24 CR003398 - mod only lower walk mGUUUUAGAGCUAUGCUGUUUUG 25 CR003399 - mod only lower walk GmUUUUAGAGCUAUGCUGUUUUG 26 CR003400 - mod only lower walk GUmUUUAGAGCUAUGCUGUUUUG 27 CR003401 - mod only lower walk GUUmUUAGAGCUAUGCUGUUUUG 28 CR003402 - mod only lower walk GUUUmUAGAGCUAUGCUGUUUUG 29 CR003403 - mod only lower walk G U U U Um AGAGCU AUGCUG U U U UG 30 CR003404 - mod only partial lower GmUmUmUmUAGAGCUAUGCUGUUUUG 31 CR003405 - mod only partial lower GUmUmUUAGAGCUAUGCUGUUUUG 32 CR003721 CR686-14 upper and lower CCAGUCCAGCGAGGCAAAGGmGUUUmUmAGAmGmCmUmAmUmGmC mUmGmUmUmUmUmG 33 CR003722 CR686-15 lower combo CCAGUCCAGCGAGGCAAAGGmGUUUmUmAGAGCUAUGCUGUUUUG 34 CR003723 CR686-16 upper, lower combo CCAGUCCAGCGAGGCAAAGGmGUUUUmAGAmGmCmUmAmUmGmCm UmGmUmUmUmUmG 35 CR003724 CR686-17 lower combo CCAGUCCAGCGAGGCAAAGGmGUUUUmAGAGCUAUGCUGUUUUG 36 CR003725 CR686-18 upper, lower combo CCAGUCCAGCGAGGCAAAGGmGUUUUAGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 37 CR003726 CR686-19 nexus walk CCAGUCCAGCGAGGCAAAGGGUUUUAmGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 38 CR003727 CR686-20 nexus walk CCAGUCCAGCGAGGCAAAGGGUUUUAGmAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 39 CR003728 CR686-21 nexus walk CCAGUCCAGCGAGGCAAAGGGUUUUAfGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 40 CR003729 CR686-22 nexus walk CCAGUCCAGCGAGGCAAAGGGUUUUAGfAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 41 CR003730 CR686-23 2'F lower walk CCAGUCCAGCGAGGCAAAGGGfUUUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 42 CR003731 CR686-24 2'F lower walk CCAGUCCAGCGAGGCAAAGGGUfUUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 43 CR003732 CR686-25 2'F lower walk CCAGUCCAGCGAGGCAAAGGGUUfUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 44 CR003733 CR686-26 2'F lower walk CCAGUCCAGCGAGGCAAAGGGUUUfUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 45 CR003734 CR686-27 2'F lower combo CCAGUCCAGCGAGGCAAAGGfGfUfUfUfUfAGAmGmCmUmAmUmGmCm UmGmUmUmUmUmG 46 CR003735 CR686-28 lower alt CCAGUCCAGCGAGGCAAAGGfGmUfUmUfUmAGAmGmCmUmAmUmG mCmUmGmUmUmUmUmG 47 CR003736 CR686-29 lower alt CCAGUCCAGCGAGGCAAAGGmGfUmUfUmUfAGAmGmCmUmAmUmG mCmUmGmUmUmUmUmG 48 CR003737 CR686-GC6 Lower GC CCAGUCCAGCGAGGCAAAGGGUCUCAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 49 CR003738 CR686-GC7 Lower C walk CCAGUCCAGCGAGGCAAAGGGCUUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 50 CR003739 CR686-GC8 Lower C walk CCAGUCCAGCGAGGCAAAGGGUCUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 51 CR003740 CR686-GC9 Lower C walk CCAGUCCAGCGAGGCAAAGGGUUCUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 52 CR003741 CR686-GC10 Lower C walk CCAGUCCAGCGAGGCAAAGGGUUUCAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 53 CR003721-mod only CR686-14-mod only upper and lower mGUUUmUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 54 CR003722-mod only CR686-15-mod only lower combo mGUUUmUmAGAGCUAUGCUGUUUUG 55 CR003723-mod only CR686-16-mod only upper, lower combo mGUUUUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 56 CR003724-mod only CR686-17-mod only lower combo mGUUUUmAGAGCUAUGCUGUUUUG 57 CR003725-mod only CR686-18-mod only upper, lower combo mGUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 58 CR003726-mod only CR686-19-mod only nexus walk GUUUUAmGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 59 CR003727-mod only CR686-20-mod only nexus walk GUUUUAGmAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 60 CR003728-mod only CR686-21-mod only nexus walk GUUUUAfGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 61 CR003729-mod only CR686-22-mod only nexus walk GUUUUAGfAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 62 CR003730-mod only CR686-23-mod only 2'F lower walk GfUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 63 CR003731-mod only CR686-24-mod only 2'F lower walk GUfUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 64 CR003732-mod only CR686-25-mod only 2'F lower walk GUUfUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 65 CR003733-mod only CR686-26-mod only 2'F lower walk GUUUfUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 66 CR003734-mod only CR686-27-mod only 2'F lower combo IGfUfUfUfUfAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 67 CR003735-mod only CR686-28-mod only lower alt IGmUfUmUfUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 68 CR003736-mod only CR686-29-mod only lower alt mGfUmUfUmUfAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 69 CR003737-mod only CR686-GC6-mod only Lower GC GUCUCAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 70 CR003738-mod only CR686-GC7-mod only Lower C walk GCUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 71 CR003739-mod only CR686-GC8-mod only Lower C walk GUCUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 72 CR003740-mod only CR686-GC9-mod only Lower C walk GUUCUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 73 CR003741-mod only CR686-GC10-mod only Lower C walk GUUUCAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 74 CR000705 unmodified UUACAGCCACGUCUACAGCAGUUUUAGAGCUAUGCUGUUUUG 75 CR004188 CR705-1 upper UUACAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 76 CR004189 CR705-2 partial upper UUACAGCCACGUCUACAGCAGUUUUAGAGCUAmUmGmCmUmGmUmU mUmUmG 77 CR004190 CR705-3 partial upper UUACAGCCACGUCUACAGCAGUUUUAGAGCUAUGCmUmGmUmUmUm UmG 78 CR004191 CR705-4 partial upper UUACAGCCACGUCUACAGCAGUUUUAGAGCUAUGCUGUmUmUmUmG 79 CR004192 CR705-5 lower UUACAGCCACGUCUACAGCAmGmUmUmUmUmAGAGCUAUGCUGUUU UG 80 CR004193 CR705-6 lower walk U UACAGCCACG UCU ACAGCAmG UUUUAGAGCUAUGCUGUUUUG 81 CR004194 CR705-7 lower walk U UACAGCCACG UCU ACAGCAGm U UUUAGAGCUAUGCUGUUUUG 82 CR004195 CR705-8 lower walk UUACAGCCACGUCUACAGCAGUmUUUAGAGCUAUGCUGUUUUG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 83 CR004196 CR705-9 lower walk UUACAGCCACGUCUACAGCAGUUmUUAGAGCUAUGCUGUUUUG 84 CR004197 CR705-10 lower walk UUACAGCCACGUCUACAGCAGUUUmUAGAGCUAUGCUGUUUUG 85 CR004198 CR705-11 lower walk UUACAGCCACGUCUACAGCAGUUUUmAGAGCUAUGCUGUUUUG 86 CR004199 CR705-14 upper and lower UUACAGCCACGUCUACAGCAmGUUUmUmAGAmGmCmUmAmUmGmC mUmGmUmUmUmUmG 87 CR004200 CR705-15 lower combo UUACAGCCACGUCUACAGCAmGUUUmUmAGAGCUAUGCUGUUUUG 88 CR004201 CR705-16 upper, lower combo UUACAGCCACGUCUACAGCAmGUUUUmAGAmGmCmUmAmUmGmCm UmGmUmUmUmUmG 89 CR004202 CR705-17 lower combo UUACAGCCACGUCUACAGCAmGUUUUmAGAGCUAUGCUGUUUUG 90 CR004203 CR705-18 upper, lower combo UUACAGCCACGUCUACAGCAmGUUUUAGAmGmCmUmAmUmGmCmU mGmUmUmUmllmG 91 CR004204 CR705-19 nexus walk UUACAGCCACGUCUACAGCAGUUUUAmGAmGmCmUmAmUmGmCmU mGmUmUmUmllmG 92 CR004205 CR705-20 nexus walk UUACAGCCACGUCUACAGCAGUUUUAGmAmGmCmUmAmUmGmCmU mGmUmUmUmllmG 93 CR004206 CR705-21 nexus walk UUACAGCCACGUCUACAGCAGUUUUAfGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 94 CR004207 CR705-22 nexus walk UUACAGCCACGUCUACAGCAGUUUUAGfAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 95 CR004208 CR705-23 2'F lower walk UUACAGCCACGUCUACAGCAGfUUUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 96 CR004209 CR705-24 2'F lower walk UUACAGCCACGUCUACAGCAGUfUUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 97 CR004210 CR705-25 2'F lower walk UUACAGCCACGUCUACAGCAGUUfUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 98 CR004211 CR705-26 2'F lower walk UUACAGCCACGUCUACAGCAGUUUfUAGAmGmCmUmAmUmGmCmUm GmUmUmUmUmG 99 CR004212 CR705-27 2'F lower combo UUACAGCCACGUCUACAGCAfGfUfUfUfUfAGAmGmCmUmAmUmGmCm UmGmUmUmUmUmG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 100 CR004213 CR705-28 lower alt UUACAGCCACGUCUACAGCAfGmUfUmUfUmAGAmGmCmUmAmUmG mCmUmGmUmUmUmUmG 101 CR004214 CR705-29 lower alt UUACAGCCACGUCUACAGCAmGfUmUfUmUfAGAmGmCmUmAmUmG mCmUmGmUmUmUmUmG 102 CR004215 CR705-GC1 Lower GC UUACAGCCACGUCUACAGCAGGCGCAGAGCUAUGCUGUUUUG 103 CR004216 CR705-GC3 Upper GC UUACAGCCACGUCUACAGCAGUUUUAGAGCUAUGCUGGCGCG 104 CR004188-mod only CR705-l-mod only upper GUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 105 CR004189-mod only CR705-2-mod only partial upper GUUUUAGAGCUAmUmGmCmUmGmUmUmUmUmG 106 CR004190-mod only CR705-3-mod only partial upper GUUUUAGAGCUAUGCmUmGmUmUmUmUmG 107 CR004191-mod only CR705-4-mod only partial upper GUUUUAGAGCUAUGCUGUmUmUmUmG 108 CR004192-mod only CR705-5-mod only lower mGmUmUmUmUmAGAGCUAUGCUGUUUUG 109 CR004193-mod only CR705-6-mod only lower walk mGUUUUAGAGCUAUGCUGUUUUG 110 CR004194-mod only CR705-7-mod only lower walk GmUUUUAGAGCUAUGCUGUUUUG 111 CR004195-mod only-mod only CR705-8-mod only lower walk GUmUUUAGAGCUAUGCUGUUUUG 112 CR004196-mod only CR705-9-mod only lower walk GUUmUUAGAGCUAUGCUGUUUUG 113 CR004197-mod only CR705-10-mod only lower walk GUUUmUAGAGCUAUGCUGUUUUG 114 CR004198-mod only CR705-ll-mod only lower walk GUUUUmAGAGCUAUGCUGUUUUG 115 CR004199-mod only CR705-14-mod only upper and lower mGUUUmUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 116 CR004200-mod only CR705-15-mod only lower combo mGUUUmUmAGAGCUAUGCUGUUUUG 117 CR004201-mod only CR705-16-mod only upper, lower combo mGUUUUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 118 CR004202-mod only CR705-17-mod only lower combo mGUUUUmAGAGCUAUGCUGUUUUG 119 CR004203-mod only CR705-18-mod only upper, lower combo mGUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 120 CR004204-mod only CR705-19-mod only nexus walk GUUUUAmGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 121 CR004205-mod only CR705-20-mod only nexus walk GUUUUAGmAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 122 CR004206-mod only CR705-21-mod only nexus walk GAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 123 CR004207-mod only CR705-22-mod only nexus walk GfAmGmCmUmAmUmGmCmUmGmUmUmUmUmG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 124 CR004208-mod only CR705-23-mod only 2'F lower walk GfUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 125 CR004209-mod only CR705-24-mod only 2'F lower walk GUfUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 126 CR004210-mod only CR705-25-mod only 2'F lower walk GUUfUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 127 CR004211-mod only CR705-26-mod only 2'F lower walk GUUUfUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 128 CR004212-mod only CR705-27-mod only 2'F lower combo IGfUfUfUfUfAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 129 CR004213-mod only CR705-28-mod only lower alt IGmUfUmUfUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 130 CR004214-mod only CR705-29-mod only lower alt mGfUmUfUmUfAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 131 CR000657 unmodified CAGGGCUCUUGAAGAUCUCCGUUUUAGAGCUAUGCUGUUUUG 132 CR004218 CR657-1 upper CAGGGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmUmGmCmUm GmUmUmUmllmG 133 CR004219 CR657-2 partial upper CAGGGCUCUUGAAGAUCUCCGUUUUAGAGCUAmUmGmCmUmGmUm UmUmUmG 134 CR004220 CR657-3 partial upper CAGGGCUCUUGAAGAUCUCCGUUUUAGAGCUAUGCmUmGmUmUmUm UmG 135 CR004221 CR657-4 partial upper CAGGGCUCUUGAAGAUCUCCGUUUUAGAGCUAUGCUGUmUmUmUmG 136 CR004222 CR657-5 lower CAGGGCUCUUGAAGAUCUCCmGmUmUmUmUmAGAGCUAUGCUGUUU UG 137 CR004223 CR657-6 lower walk CAGGGCUCUUGAAGAUCUCCmGUUUUAGAGCUAUGCUGUUUUG 138 CR004224 CR657-7 lower walk CAGGGCUCUUGAAGAUCUCCGmUUUUAGAGCUAUGCUGUUUUG 139 CR004225 CR657-8 lower walk CAGGGCUCUUGAAGAUCUCCGUmUUUAGAGCUAUGCUGUUUUG 140 CR004226 CR657-9 lower walk CAGGGCUCUUGAAGAUCUCCGUUmUUAGAGCUAUGCUGUUUUG 141 CR004227 CR657-10 lower walk CAGGGCUCUUGAAGAUCUCCGUUUmUAGAGCUAUGCUGUUUUG 142 CR004228 CR657-11 lower walk CAGGGCUCUUGAAGAUCUCCGUUUUmAGAGCUAUGCUGUUUUG 143 CR004229 CR657-14 upper and lower CAGGGCUCUUGAAGAUCUCCmGUUUmUmAGAmGmCmUmAmUmGmC mUmGmUmUmUmUmG 144 CR004230 CR657-15 lower combo CAGGGCUCUUGAAGAUCUCCmGUUUmUmAGAGCUAUGCUGUUUUG 145 CR004231 CR657-16 upper, lower combo CAGGGCUCUUGAAGAUCUCCmGUUUUmAGAmGmCmUmAmUmGmCm UmGmUmUmUmUmG 146 CR004232 CR657-17 lower combo CAGGGCUCUUGAAGAUCUCCmGUUUUmAGAGCUAUGCUGUUUUG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 147 CR004233 CR657-18 upper, lower combo CAGGGCUCUUGAAGAUCUCCmGUUUUAGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 148 CR004234 CR657-19 nexus walk CAGGGCUCUUGAAGAUCUCCGUUUUAmGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 149 CR004235 CR657-20 nexus walk CAGGGCUCUUGAAGAUCUCCGUUUUAGmAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 150 CR004236 CR657-21 nexus walk CAGGGCUCUUGAAGAUCUCCGUUUUAfGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 151 CR004237 CR657-22 nexus walk CAGGGCUCUUGAAGAUCUCCGUUUUAGfAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 152 CR004238 CR657-23 2'F lower walk CAGGGCUCUUGAAGAUCUCCGfUUUUAGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 153 CR004239 CR657-24 2'F lower walk CAGGGCUCUUGAAGAUCUCCGUfUUUAGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 154 CR004240 CR657-25 2'F lower walk CAGGGCUCUUGAAGAUCUCCGUUfUUAGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 155 CR004241 CR657-26 2'F lower walk CAGGGCUCUUGAAGAUCUCCGUUUfUAGAmGmCmUmAmUmGmCmU mGmUmUmUmUmG 156 CR004242 CR657-27 2'F lower combo CAGGGCUCUUGAAGAUCUCCfGfUfUfUfUfAGAmGmCmUmAmUmGmC mUmGmUmUmUmUmG 157 CR004243 CR657-28 lower alt CAGGGCUCUUGAAGAUCUCCfGmUfUmUfUmAGAmGmCmUmAmUmG mCmUmGmUmUmUmUmG 158 CR004244 CR657-29 lower alt CAGGGCUCUUGAAGAUCUCCmGfUmUfUmUfAGAmGmCmUmAmUmG mCmUmGmUmUmUmUmG 159 CR004245 CR657-GC1 Lower GC CAGGGCUCUUGAAGAUCUCCGGCGCAGAGCUAUGCUGUUUUG 160 CR004246 CR657-GC3 Upper GC CAGGGCUCUUGAAGAUCUCCGUUUUAGAGCUAUGCUGGCGCG 161 CR004218-mod only CR657-l-mod only upper GUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 162 CR004219-mod only CR657-2-mod only partial upper GUUUUAGAGCUAmUmGmCmUmGmUmUmUmUmG 163 CR004220-mod only CR657-3-mod only partial upper GUUUUAGAGCUAUGCmUmGmUmUmUmUmG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 164 CR004221-mod only CR657-4-mod only partial upper G U U U U AGAGCU AUGCUG U m U m U m U mG 165 CR004222-mod only CR657-5-mod only lower mGmUmUmUmUmAGAGCUAUGCUGUUUUG 166 CR004223-mod only CR657-6-mod only lower walk mGUUUUAGAGCUAUGCUGUUUUG 167 CR004224-mod only CR657-7-mod only lower walk GmUUUUAGAGCUAUGCUGUUUUG 168 CR004225-mod only CR657-8-mod only lower walk GUmUUUAGAGCUAUGCUGUUUUG 169 CR004226-mod only CR657-9-mod only lower walk GUUmUUAGAGCUAUGCUGUUUUG 170 CR004227-mod only CR657-10-mod only lower walk GUUUmUAGAGCUAUGCUGUUUUG 171 CR004228-mod only CR657-ll-mod only lower walk G U U U U mAGAGCU AUGCUG U U U UG 172 CR004229-mod only CR657-14-mod only upper and lower mGUUUmUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 173 CR004230-mod only CR657-15-mod only lower combo mGUUUmUmAGAGCUAUGCUGUUUUG 174 CR004231-mod only CR657-16-mod only upper, lower combo mGUUUUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 175 CR004232-mod only CR657-17-mod only lower combo mGUUUUmAGAGCUAUGCUGUUUUG 176 CR004233-mod only CR657-18-mod only upper, lower combo mGUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 177 CR004234-mod only CR657-19-mod only nexus walk GUUUUAmGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 178 CR004235-mod only CR657-20-mod only nexus walk GUUUUAGmAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 179 CR004236-mod only CR657-21-mod only nexus walk GUUUUAfGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 180 CR004237-mod only CR657-22-mod only nexus walk G U U U U AGfAmG mCm U m Am U m G m Cm U mG m U m U m U m U m G 181 CR004238-mod only CR657-23-mod only 2'F lower walk GfUUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 182 CR004239-mod only CR657-24-mod only 2'F lower walk GUfUUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 183 CR004240-mod only CR657-25-mod only 2'F lower walk GUUfUUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 184 CR004241-mod only CR657-26-mod only 2'F lower walk GUUUfUAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 185 CR004242-mod only CR657-27-mod only 2'F lower combo fGf Uf Uf Uf UfAG AmGmCm Um Am U mG mCm U mG m U m U m Um U mG 186 CR004243-mod only CR657-28-mod only lower alt fGmUfUmUfUmAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG 187 CR004244-mod only CR657-29-mod only lower alt mGfUmUfUmUfAGAmGmCmUmAmUmGmCmUmGmUmUmUmUmG trRNA 188 TR000002 unmodified AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAG UGGCACCGAGUCGGUGCUUUUUUU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 189 TR000110 TR2-V2-1 shortened tail AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAG UGGCACCGAGUCGGUGCUUUU 190 TR000111 TR2-V2-2 Upper, hairpins mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU AUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGm AmGmUmCmGmGmUmGmCmUmUmUmU 191 TR000112 TR2-V2-3 upper only mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU 192 TR000113 TR2-V2-4 hairpin 1 AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUm GmAmAmAmAmAmGmUmGGCACCGAGUCGGUGCUUUU 193 TR000114 TR2-V2-5 hairpin 2 AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAG UGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU 194 TR000115 TR2-V2-6 upper, hairpin 2 mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGmGmCmAmCmCmGmAmGmUmCmGmGmUmG mCmUmUmUmU 195 TR000116 TR2-V2-7 both hairpins AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUm GmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGm UmGmCmUmUmUmU 196 TR000117 TR2-V2-8 lower walk AACAGCAUAGCAAGUmUmAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCGGUGCUUUU 197 TR000118 TR2-V2-9 lower walk AACAGCAUAGCAAGUUAmAmAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCGGUGCUUUU 198 TR000119 TR2-V2-10 lower walk AACAGCAUAGCAAGUUAAAmAmUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCGGUGCUUUU 199 TR000120 TR2-V2-11 partial nexus AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGmUmUmAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU 200 TR000121 TR2-V2-12 partial nexus AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAmUmCmAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU 201 TR000122 TR2-GC1 Lower GC AACAGCAUAGCAAGUUGCGCUAAGGCUAGUCCGUUAUCAACUUGAAAAAG UGGCACCGAGUCGGUGCUUUU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 202 TR000123 TR2-GC3 upper GC GCCAGCAUAGCAAG U UAAAAUAAGGCUAG UCCG U UAUCAACU UGAAAAAG UGGCACCGAGUCGGUGCUUUU 203 TR000124 TR2-GC5 Lower Upper GC GCCAGCAUAGCAAGUUGCGCUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGCUUUU 204 TR000125 TR2 all OMe mAmAmCmAmGmCmAmUmAmGmCmAmAmGmUmUmAmAmAmAmU mAmAmGmGmCmUmAmGmUmCmCmGmUmUmAmUmCmAmAmCmU mUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmG mGmUmGmCmUmUmUmUmUmUmU 205 TR000126 TR2-V2-13 lower mAmAmCmAmGmCm Am UmAmGmCAAGUmUmAmAmAm Am U AAGGCU AGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmA mCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU 206 TR000127 TR2-V2-14 lower mAmAmCmAmGmCmAmUmAmGmCAAGUmUmAAAmAmUAAGGCUAG UCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmC mCmGmAmGmUmCmGmGmUmGmCmUmUmUmU 207 TR000128 TR2-V2-15 lower mAmAmCmAmGmCmAmUmAmGmCAAGUmUmAfAfAmAmUAAGGCUA GUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAm CmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU 208 TR000129 TR2-V2-16 lower alt mAmAmCmAmGmCmAmUmAmGmCAAGUmUfAmAfAmAfUAAGGCUAG UCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmC mCmGmAmGmUmCmGmGmUmGmCmUmUmUmU 209 TR000130 TR2-V2-17 lower alt m AmAmCmAmGmCm Am UmAmGmCAAGUfUmAfAmAfAmU AAGGCU AG UCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmC mCmGmAmGmUmCmGmGmUmGmCmUmUmUmU 210 TR000131 TR2-V2-18 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU AUCmAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG mAmGmUmCmGmGmUmGmCmUmUmUmU 211 TR000132 TR2-V2-19 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU AUmCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG mAmGmUmCmGmGmUmGmCmUmUmUmU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 212 TR000133 TR2-V2-20 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU AmUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG mAmGmUmCmGmGmUmGmCmUmUmUmU 213 TR000134 TR2-V2-21 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU mAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG mAmGmUmCmGmGmUmGmCmUmUmUmU 214 TR000135 TR2-V2-22 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU mUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCm GmAmGmUmCmGmGmUmGmCmUmUmUmU 215 TR000136 TR2-V2-23 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGm UUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCm GmAmGmUmCmGmGmUmGmCmUmUmUmU 216 TR000137 TR2-V2-24 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU AUfCfAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG mAmGmUmCmGmGmUmGmCmUmUmUmU 217 TR000138 TR2-V2-25 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUU fAfUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG mAmGmUmCmGmGmUmGmCmUmUmUmU 218 TR000139 TR2-V2-26 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGfUf UAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG mAmGmUmCmGmGmUmGmCmUmUmUmU 219 TR000140 TR2-V2-27 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAmGmGmCUAGUC CGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCm CmGmAmGmUmCmGmGmUmGmCmUmUmUmU 220 TR000141 TR2-V2-28 nexus walk mAmAmCmAmGmCmAmUmAmGmCAAGUUAAAAUAAGGCUAGUmCmC mGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCm CmGmAmGmUmCmGmGmUmGmCmUmUmUmU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 221 TR000142 TR2-V2-29 bulge walk mAmAmCmAmGmCmAmUmAmGmCmAmAGUUAAAAUAAGGCUAGUCC GUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmC mGmAmGmUmCmGmGmUmGmCmUmUmUmU 222 TR000143 TR2-V2-30 bulge walk mAmAmCmAmGmCmAmUmAmGmCAAmGmUUAAAAUAAGGCUAGUCC GUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmC mGmAmGmUmCmGmGmUmGmCmUmUmUmU 223 TR000144 TR2-GC6 Lower GC AACAGCAUAGCAAGUUGAGAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGCUUUU 224 TR000145 TR2-GC7 Lower GC walk AACAGCAUAGCAAGUUAAAGUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGCUUUU 225 TR000146 TR2-GC8 Lower GC walk AACAGCAUAGCAAGUUAAGAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGCUUUU 226 TR000147 TR2-GC9 Lower GC walk AACAGCAUAGCAAGUUAGAAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGCUUUU in TR000148 TR2-GC10 Lower GC walk AACAGCAUAGCAAGUUGAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAA GUGGCACCGAGUCGGUGCUUUU sgRNA 228 G000209 mC*mC*mA*GUCCAGCGAGGCAAAGGGUUUUAGAGCUAGAAAUAGCAAG UUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCmU*mU*mU*U 229 G000262 G209-1 hairpin 2 mC*mC*mA*GUCCAGCGAGGCAAAGGGUUUUAGAGCUAGAAAUAGCAAG UUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUmGmGmCmAmC mCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 230 G000263 G209-2 hairpins mC*mC*mA*GUCCAGCGAGGCAAAGGGUUUUAGAGCUAGAAAUAGCAAG UUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU *mU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 231 G000264 G209-3 tetraloop mC*mC*mA*GUCCAGCGAGGCAAAGGGUUUUAGAGCUAmGmAmAmAU AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCmU*mU*mU*U 232 G000265 G209-4 upper mC*mC*mA*GUCCAGCGAGGCAAAGGGUUUUAGAmGmCmUmAGAAAm UmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG GCACCGAGUCGGUGCmU*mU*mU*U 233 G000266 G209-5 upper and loop mC*mC*mA*GUCCAGCGAGGCAAAGGGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCmU*mU*mU*U 234 G000267 G209-6 upper, loop, hairpins mC*mC*mA*GUCCAGCGAGGCAAAGGGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmU mUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmG mGmUmGmCmU*mU*mU*mU 235 G000262-mod only G209-l-mod only hairpin 2 G UUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG UUAUCAA CUUGAAAAAGUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCm U*mU*mU*mU 236 G000263-mod only G209-2-mod only hairpins G UUUUAGAGCUAGAAAUAGCAAGU UAAAAUAAGGCUAG UCCG U UAUCAm AmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGm UmCmGmGmUmGmCmU*mU*mU*mU 237 G000264-mod only G209-3-mod only tetraloop GUUUUAGAGCUAmGmAmAmAUAGCAAGUUAAAAUAAGGCUAGUCCGU UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmU*mU*mU*U 238 G000265-mod only G209-4-mod only upper GUUUUAGAmGmCmUmAGAAAmUmAmGmCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmU*mU*mU*U 239 G000266-mod only G209-5-mod only upper and loop GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmU*mU* mU*U 240 G000267-mod only G209-6-mod only upper, loop, hairpins GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG GCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGm CmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 241 G000211 end mod mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAGCUAGAAAUAGCAAG UUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCmU*mU*mU*U 242 G000282 mod6 mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUm UmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGm GmUmGmCmU*mU*mU*mU 243 G000201 unmod UUACAGCCACGUCUACAGCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAA UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU UU 244 G000331 G211-7 lower cr mU*mU*mA*CAGCCACGUCUACAGCAmGUUUUmAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmU*mU*mU*mU 245 G000332 G211-8 lower cr mU*mU*mA*CAGCCACGUCUACAGCAfGfUfUfUfUfAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmU*mU*mU*mU 246 G000333 G211-9 lower cr mU*mU*mA*CAGCCACGUCUACAGCAmGfUfUfUfUmAGAmGmCmUmAm GmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAm CmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUm CmGmGmUmGmCmU*mU*mU*mU 247 G000334 G211-10 lower tr mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUmUmAAAmAmUAAGGCUAGUCCGUUAUCAmAm CmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUm CmGmGmUmGmCmU*mU*mU*mU 248 G000335 G211-11 lower tr mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUmUmAfAfAmAmUAAGGCUAGUCCGUUAUCAmA WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence mCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmU mCmGmGmUmGmCmU*mU*mU*mU 249 G000336 G211-12 lower tr mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUfUmAfAmAfAmUAAGGCUAGUCCGUUAUCAmA mCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmU mCmGmGmUmGmCmU*mU*mU*mU 250 G000337 G211-13 lower all mU*mU*mA*CAGCCACGUCUACAGCAmGUUUUmAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUmUmAAAmAmUAAGGCUAGUCCGUUAUCA mAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmG mUmCmGmGmUmGmCmU*mU*mU*mU 251 G000338 G211-14 lower all mU*mU*mA*CAGCCACGUCUACAGCAmGUUUUmAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUmUmAfAfAmAmUAAGGCUAGUCCGUUAUC AmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmU*mU*mU*mU 252 G000339 G211-15 lower all mU*mU*mA*CAGCCACGUCUACAGCAmGUUUUmAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUfUmAfAmAfAmUAAGGCUAGUCCGUUAUC AmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmU*mU*mU*mU 253 G000340 G211-16 lower all mU*mU*mA*CAGCCACGUCUACAGCAfGfUfUfUfUfAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUmUmAAAmAmUAAGGCUAGUCCGUUAUCA mAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmG mUmCmGmGmUmGmCmU*mU*mU*mU 254 G000341 G211-17 lower all mU*mU*mA*CAGCCACGUCUACAGCAfGfUfUfUfUfAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUmUmAfAfAmAmUAAGGCUAGUCCGUUAUC AmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmU*mU*mU*mU 255 G000342 G211-18 lower all mU*mU*mA*CAGCCACGUCUACAGCAfGfUfUfUfUfAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUfUmAfAmAfAmUAAGGCUAGUCCGUUAUC WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence AmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmU*mU*mU*mU 256 G000343 G211-19 Bulge cr mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAmGmAmGmCmUmAmG mAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmU*mU*mU*mU 257 G000344 G211-20 Bulge tr mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCmAmAmGmUUAAAAUAAGGCUAGUCCGUUAUCAmAm CmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUm CmGmGmUmGmCmU*mU*mU*mU 258 G000345 G211-21 nexus mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUfAfUfCfAmAmCmU mUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmG mGmUmGmCmU*mU*mU*mU 259 G000346 G211-22 nexus mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAmUmCmAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmU*mU*mU*mU 260 G000347 G211-23 lower all mU*mU*mA*CAGCCACGUCUACAGCAfGfUfUfUfUfAmGmAmGmCmUmA m G m A m A m A m U m A m G m C m A m A m G m U m U m AfAfA m A m U A A G G C U A G U CCGUUAmUmCmAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCm AmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 261 G000348 G211-24 no PS mUmUmACAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAmAm AmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUm GmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGm U m G m C m U m U m U m U 262 G000349 G211-25 2 OMe PS mU*mU*ACAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAmA mAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence mGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmG mUmGmCmUmU*mU*mU 263 G000350 G211-26 2'F hairpin mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUm UmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGfUfCfGfGfUf GfCfU*fU*fU*mU 264 G000351 G211-27 Alt hairpin mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAfAmCfUmUf GmAfAmAfAmAfGmUfGmGfCmAfCmCfGmAfGmUfCmGfGmUfGmCfU*m U*fU*mU 265 G000331-mod only G211-7-mod only lower cr mGUUUUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAU AAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmG mGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 266 G000332-mod only G211-8-mod only lower cr IGfUfUfUfUfAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGULJAAAAU AAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmG mGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 267 G000333-mod only G211-9-mod only lower cr mGfUfUfUfUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAA AUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUm GmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 268 G000334-mod only G211-10-mod only lower tr GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAAAmA mUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmU mGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 269 G000335-mod only G211-ll-mod only lower tr GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAfAfAm AmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmU mGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 270 G000336-mod only G211-12-mod only lower tr GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUfUmAfAmAfA mUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmU mGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 271 G000337-mod only G211-13-mod only lower all mGUUUUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAAA mAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGm UmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*m U Til G000338-mod only G211-14-mod only lower all mGUUUUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAfAf AmAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmG mUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU* mil ITS G000339-mod only G211-15-mod only lower all mGUUUUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUfUmAfAm AfAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmG mUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU* mil 274 G000340-mod only G211-16-mod only lower all IGfUfUfUfUfAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAA AmAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmG mUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU* mil 275 G000341-mod only G211-17-mod only lower all IGfUfUfUfUfAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAfA fAmAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU *mU 276 G000342-mod only G211-18-mod only lower all IGfUfUfUfUfAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUfUmAfA mAfAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU *mU 277 G000343-mod only G211-19-mod only Bulge cr GUUUUAmGmAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAU AAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmG mGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 278 G000344-mod only G211-20-mod only Bulge tr GUUUUAGArnGrnCrnUrnAmGrnArnArnArnUrnArnGrnCrnArnArnGrnUUAAA AUAAGGCUAGUCCGUUAUCArnAmCrnUrnUrnGrnArnArnArnArnArnGrnUrn GmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 279 G000345-mod only G211-21-mod only nexus GUUUUAGArnGmCrnUrnArnGrnArnArnArnUrnArnGrnCAAGUUAAAAUAAG GCUAGUCCGUUfAfUfCfArnArnCrnUmUrnGrnArnArnArnArnArnGrnUrnGrn GmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 280 G000346-mod only G211-22-mod only nexus GUUUUAGArnGmCrnUrnArnGrnArnArnArnUrnArnGrnCAAGUUAAAAUAAG GCUAGUCCGUUArnUrnCrnArnArnCmUrnUrnGrnArnArnArnArnArnGrnUrnG mGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 281 G000347-mod only G211-23-mod only lower all fGfUfUfUfUfArnGrnArnGrnCrnUrnAmGrnArnArnArnUrnArnGrnCrnArnArnG m U m U mAfAfAm Arn U AAGGCU AG UCCG U U Arn U rnCmAmArnCrn U m U mG mAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmU mGmCmU*mU*mU*mU 282 G000348-mod only G211-24-mod only no PS GUUUUAGArnGmCrnUrnArnGrnArnArnArnUrnArnGrnCAAGUUAAAAUAAG GCUAGUCCGUUAUCArnArnCrnUrnUrnGrnArnArnArnArnArnGrnUrnGrnGrn CmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU 283 G000349-mod only G211-25-mod only 2 OMe PS GUUUUAGArnGmCrnUrnArnGrnArnArnArnUrnArnGrnCAAGUUAAAAUAAG GCUAGUCCGUUAUCArnArnCrnUrnUrnGrnArnArnArnArnArnGrnUrnGrnGrn CmAmCmCmGmAmGmUmCmGmGmUmGmCmUmU*mU*mU 284 G000350-mod only G211-26-mod only 2'F hairpin GUUUUAGArnGmCrnUrnArnGrnArnArnArnUrnArnGrnCAAGUUAAAAUAAG GCUAGUCCGUUAUCArnArnCrnUrnUrnGrnArnArnArnArnArnGrnUrnGrnGrn CmAmCmCmGmAmGfUfCfGfGfUfGfCfU*fU*fU*mU 285 G000351-mod only G211-27-mod only Alt hairpin GUUUUAGArnGmCrnUrnArnGrnArnArnArnUrnArnGrnCAAGUUAAAAUAAG GCUAGUCCGUUAUCAfAmCfUrnUfGrnAfArnAfArnAfGrnUfGmGfCrnAfCrnC fGmAfGmUfCmGfGmUfGmCfU*mU*fU*mU 286 G000208 end mod mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAGCUAGAAAUAGCAAG UUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCmU*mU*mU*U WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 287 G000373 mod6 mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmU mUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmG mGmUmGmCmU*mU*mU*mU 288 G000352 G208-7 lower cr mC*mA*mG*GGCUCUUGAAGAUCUCCmGUUUUmAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmU*mU*mU*mU 289 G000353 G208-8 lower cr mC*mA*mG*GGCUCUUGAAGAUCUCCfGfUfUfUfUfAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmU*mU*mU*mU 290 G000354 G208-9 lower cr mC*mA*mG*GGCUCUUGAAGAUCUCCmGfUfUfUfUmAGAmGmCmUmA mGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmA mCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmU mCmGmGmUmGmCmU*mU*mU*mU 291 G000355 G208-10 lower tr mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUmUmAAAmAmUAAGGCUAGUCCGUUAUCAmA mCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmU mCmGmGmUmGmCmU*mU*mU*mU 292 G000356 G208-11 lower tr mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUmUmAfAfAmAmUAAGGCUAGUCCGUUAUCAm AmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGm UmCmGmGmUmGmCmU*mU*mU*mU 293 G000357 G208-12 lower tr mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUfUmAfAmAfAmUAAGGCUAGUCCGUUAUCAm AmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGm UmCmGmGmUmGmCmU*mU*mU*mU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 294 G000358 G208-13 lower all mC*mA*mG*GGCUCUUGAAGAUCUCCmGUUUUmAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUmUmAAAmAmUAAGGCUAGUCCGUUAUCA mAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmG mUmCmGmGmUmGmCmU*mU*mU*mU 295 G000359 G208-14 lower all mC*mA*mG*GGCUCUUGAAGAUCUCCmGUUUUmAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUmUmAfAfAmAmUAAGGCUAGUCCGUUAUC AmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmU*mU*mU*mU 296 G000360 G208-15 lower all mC*mA*mG*GGCUCUUGAAGAUCUCCmGUUUUmAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUfUmAfAmAfAmUAAGGCUAGUCCGUUAUC AmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmU*mU*mU*mU 297 G000361 G208-16 lower all mC*mA*mG*GGCUCUUGAAGAUCUCCfGfUfUfUfUfAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUmUmAAAmAmUAAGGCUAGUCCGUUAUCA mAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmG mUmCmGmGmUmGmCmU*mU*mU*mU 298 G000362 G208-17 lower all mC*mA*mG*GGCUCUUGAAGAUCUCCfGfUfUfUfUfAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUmUmAfAfAmAmUAAGGCUAGUCCGUUAUC AmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmU*mU*mU*mU 299 G000363 G208-18 lower all mC*mA*mG*GGCUCUUGAAGAUCUCCfGfUfUfUfUfAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUfUmAfAmAfAmUAAGGCUAGUCCGUUAUC AmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmU*mU*mU*mU 300 G000364 G208-19 Bulge cr mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAmGmAmGmCmUmAmG mAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmU*mU*mU*mU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 301 G000365 G208-20 Bulge tr mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCmAmAmGmUUAAAAUAAGGCUAGUCCGUUAUCAmA mCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmU mCmGmGmUmGmCmU*mU*mU*mU 302 G000366 G208-21 nexus mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUfAfUfCfAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmU*mU*mU*mU 303 G000367 G208-22 nexus mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAmUmCmAmAm CmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUm CmGmGmUmGmCmU*mU*mU*mU 304 G000368 G208-23 lower all mC*mA*mG*GGCUCUUGAAGAUCUCCfGfUfUfUfUfAmGmAmGmCmUm AmGmAmAmAmUmAmGmCmAmAmGmUmUmAfAfAmAmUAAGGCUAG UCCGUUAmUmCmAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmC mAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 305 G000369 G208-24 no PS mCmAmGGGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmAmA mAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmU mGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmG mUmGmCmUmUmUmU 306 G000370 G208-25 2 OMe PS mC*mAG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmAmA mAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmU mGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmG mUmGmCmUmU*mU*mU 307 G000371 G208-26 2'F hairpin mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmU mUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGfUfCfGfGfU fGfCfU*fU*fU*mU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 308 G000372 G208-27 Alt hairpin mC*mA*mG*GGCUCUUGAAGAUCUCCGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAfAmCfUmU fGmAfAmAfAmAfGmUfGmGfCmAfCmCfGmAfGmUfCmGfGmUfGmCfU* mU*fU*mU 309 G000352-mod only G208-7-mod only lower cr mGUUUUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAU AAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmG mGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 310 G000353-mod only G208-8-mod only lower cr IGfUfUfUfUfAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGULJAAAAU AAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmG mGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 311 G000354-mod only G208-9-mod only lower cr mGfUfUfUfUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAA AUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUm GmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 312 G000355-mod only G208-10-mod only lower tr GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAAAmA mUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmU mGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 313 G000356-mod only G208-ll-mod only lower tr GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAfAfAm AmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmU mGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 314 G000357-mod only G208-12-mod only lower tr GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUfUmAfAmAfA mUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmU mGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 315 G000358-mod only G208-13-mod only lower all mGUUUUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAAA mAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGm UmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*m U 316 G000359-mod only G208-14-mod only lower all mGUUUUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAfAf AmAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmG WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence mUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU* mil 317 G000360-mod only G208-15-mod only lower all mGUUUUmAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUfUmAfAm AfAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmG mUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU* mil 318 G000361-mod only G208-16-mod only lower all IGfUfUfUfUfAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAA AmAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmG mUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU* mil 319 G000362-mod only G208-17-mod only lower all IGfUfUfUfUfAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUmUmAfA fAmAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU *mU 320 G000363-mod only G208-18-mod only lower all IGfUfUfUfUfAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUfUmAfA mAfAmUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU *mU 321 G000364-mod only G208-19-mod only Bulge cr GUUUUAmGmAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAU AAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmG mGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 322 G000365-mod only G208-20-mod only Bulge tr GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCmAmAmGmUUAAA AUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUm GmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 323 G000366-mod only G208-21-mod only nexus GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG GCUAGUCCGUUfAfUfCfAmAmCmUmUmGmAmAmAmAmAmGmUmGm GmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 324 G000367-mod only G208-22-mod only nexus GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG GCUAGUCCGUUAmUmCmAmAmCmUmUmGmAmAmAmAmAmGmUmG mGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU 325 G000368-mod only G208-23-mod only lower all IGfUfUfUfUfAmGmAmGmCmUmAmGmAmAmAmUmAmGmCmAmAmG mUmUmAfAfAmAmUAAGGCUAGUCCGUUAmUmCmAmAmCmUmUmG mAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmU mGmCmU*mU*mU*mU 326 G000369-mod only G208-24-mod only no PS GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG GCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGm CmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU 327 G000370-mod only G208-25-mod only 2 OMe PS GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG GCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGm CmAmCmCmGmAmGmUmCmGmGmUmGmCmUmU*mU*mU 328 G000371-mod only G208-26-mod only 2'F hairpin GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG GCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGm CmAmCmCmGmAmGfUfCfGfGfUfGfCfU*fU*fU*mU 329 G000372-mod only G208-27-mod only Alt hairpin GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG GCUAGUCCGUUAUCAfAmCfUmUfGmAfAmAfAmAfGmUfGmGfCmAfCmC fGmAfGmUfCmGfGmUfGmCfU*mU*fU*mU 330 G000269 end mod mC*mC*mC*AUACUCCUACAGCACCAGUUUUAGAGCUAGAAAUAGCAAG UUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCmU*mU*mU*U 331 G000283 mod6 mC*mC*mC*AUACUCCUACAGCACCAGUUUUAGAmGmCmUmAmGmAm AmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUm UmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGm GmUmGmCmU*mU*mU*mU 332 G000285 unmod CCCAUACUCCUACAGCACCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCG UUAUCAACU UGAAAAAGUGGCACCGAGUCGGUGCUUU U WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 342 G000537 G211-33 5'end 3xOMePS mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmU mUmGmAmAmAmAmAmGmUmGmGmCmAmCinCmGmAmGmUinCin GmGmUmGmCmUmUmUmU 343 G000538 G211-34 3'end 3xOMePS mUmUmACAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAmA mAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUm UmGmAmAmAmAmAmGmUmGmGmCmAmCinCmGmAmGmUinCmG mGmUmGmCmU*mU*mU*mU 344 G000539 G211-35 5xOMePS mU*mU*mA*mC*mA*GCCACGUCUACAGCAGUUUUAGAmGmCmUmA mGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAm AmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGm UmCmGmGmUmG*mC*mU*mU*mU*mU 345 G000541 G211-37 3xOMePS+2PS mU*mU*mA*C*A*GCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGm AmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCm UmUmGmAmAmAmAmAmGmUmGmGmCmAmCinCmGmAmGmUinCin GmGmUmGW*mU*mU*mU*mU 346 G000542 G211-38 3xOMePS+7PS mU*mU*mA*C*A*G*C*C*A*C*GUCUACAGCAGUUUUAGAmGmCmUm AmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCA mAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmG mU*mC*mG*mG*mU*mG*mC*mU*mU*mU*mU 347 G000543 G211-39 invd abasic (invd)UUACAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmAmA mAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUm UmGmAmAmAmAmAmGmUmGmGmCmAmCinCmGmAmGmUinCmG mGmUmGmCmUmUmUmU(invd) 348 G000544 G211-40 invd abasic + 3x0 Me PS (invd)mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAm GmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmA mCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGm UmCmGmGmUmGmCmU*mU*mU*mU(invd) WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description Sequence 349 G000564 G211-42 3xMOE-PS moeU*moeU*moeA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmA mGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAm AmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGm UmCmGmGmUmGmCmoeU*moeU*moeU*mU 350 G000545 G211-43 US loop PS mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmA*mG* mA*mA*mA*mUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAm AmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGm UmCmGmGmUmGmCmU*mU*mU*mU 351 G000546 G211-44 Hl loop PS mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmU mU*mG*mA*mA*mA*mAmAmGmUmGmGmCmAmCmCmGmAmGmU mCmGmGmUmGmCmU*mU*mU*mU 352 G000547 G211-45 H2 loop PS mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmAmGmA mAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmU mUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG*mA*mG*mU* mCmGmGmUmGmCmU*mU*mU*mU 353 G000548 G211-46 all loops PS mU*mU*mA*CAGCCACGUCUACAGCAGUUUUAGAmGmCmUmA*mG* mA*mA*mA*mUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAm AmCmUmU*mG*mA*mA*mA*mAmAmGmUmGmGmCmAmCmCmG* mAWmU*mCmGmGmUmGmCmU*mU*mU*mU 354 Mod6 (with modifications not shown in sequence listing) mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUm CmGmGmUmGmCmU*mU*mU*mU N = any nucleotide 355 Invariable region only GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU WO 2018 / 107028                                                 PCT / US2017 / 065306 SEQ ID NO Name Alias Description 356 Mod6 pattern; invariable region only 357 Variable and invariable region 358 Mod6 with modifications shown in sequence listing Sequence G U U U U AG A m G m C m U m A m G m A m A m A m U m A m G m C A AG U U A A A A U A A GGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmG mCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC UUUU____________________________________________ mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmG mAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmC mUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUm CmGmGmUmGmCmU*mU*mU*mU N = any nucleotide WO 2018 / 107028                                                 PCT / US2017 / 065306 2024201264   26 Feb 2024

[0059] “Guide RNA” and “gRNA” are used herein interchangeably to refer collectively to either an sgRNA, a trRNA (also known as tracrRNA), or a crRNA (also known as a CRISPR RNA). The crRNA and trRNA may be associated on one RNA molecule (single guide RNA [sgRNA]) or in two separate RNA molecules (dual guide RNA [dgRNA]). “Guide RNA” or “gRNA” refers to each type.

[0060] The trRNA sequences may be naturally-occurring, or the trRNA sequence may include modifications or variations compared to naturally-occurring sequences.

[0061] “Editing efficiency” or “editing percentage” or “percent editing” as used herein is the total number of sequence reads with insertions or deletions of nucleotides into the target region of interest over the total number of sequence reads following cleavage by a Cas RNP.

[0062] “Hairpin” as used herein describes a loop of nucleic acids that is created when a nucleic acid strand folds and forms base pairs with another section of the same strand. A hairpin may form a structure that comprises a loop or a U-shape. In some embodiments, a hairpin may be comprised of a RNA loop. Hairpins can be formed with two complementary sequences in a single nucleic acid molecule bind together, with a folding or wrinkling of the molecule. In some embodiments, hairpins comprise stem or stem loop structures.

[0063] “Regions” as used herein describes conserved groups of nucleic acids. Regions may also be referred to as “modules” or “domains.” Regions of a gRNA may perform particular functions, e.g., in directing endonuclease activity of the RNP, for example as described in Briner AE et al., Molecular Cell 56:333-339 (2014). Regions of a gRNA are described in Tables 1-3.

[0064] “Ribonucleoprotein” (RNP) or “RNP complex” as used herein describes a gRNA, for example, together with a nuclease, such as a Cas protein. In some embodiments, the RNP comprises Cas9 and gRNA.

[0065] “Stem loop” as used herein describes a secondary structure of nucleotides that form a base-paired “stem” that ends in a loop of unpaired nucleic acids. A stem may be formed when two regions of the same nucleic acid strand are at least partially complementary in sequence when read in opposite directions. “Loop” as used herein describes a region of nucleotides that do not base pair (i.e., are not complementary) that may cap a stem. A “tetraloop” describes a loop of 4 nucleotides. As used herein, the upper stem of a sgRNA may comprise a tetraloop.

[0066] In certain embodiments involving dgRNA, a “stem” region as used herein describes a secondary structure of nucleotides that forms a base-paired region between certain 2024201264   26 Feb 2024 regions of a crRNA and trRNA (e.g., the lower and upper stem regions of each RNA). The “stem” region of a dgRNA may also be referred to in the art as a “flagpole” region.

[0067] “Treatment” as used herein covers any administration or application of a therapeutic for disease in a subject, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing reoccurrence of one or more symptoms of the disease. 1. Types of Modifications A. 2’-O-methyl modifications

[0068] Modified sugars are believed to control the puckering of nucleotide sugar rings, a physical property that influences oligonucleotide binding affinity for complementary strands, duplex formation, and interaction with nucleases. Substitutions on sugar rings can therefore alter the confirmation and puckering of these sugars. For example, 2’-O-methyl (2’-O-Me) modifications can increase binding affinity and nuclease stability of oligonucleotides, though as shown in the Examples, the effect of any modification at a given position in an oligonucleotide needs to be empirically determined.

[0069] The terms “mA,” “mC,” “mU,” or “mG” may be used to denote a nucleotide that has been modified with 2’-O-Me.

[0070] Modification of a ribonucleotide as 2’-O-methyl ribonucleotide can be depicted as follows: B. 2’-O-(2-methoxyethyl) modifications

[0071] In some embodiments, the modification may be 2’-O-(2-methoxyethyl) (2’-O-moe). Modification of a ribonucleotide as a 2’-O-moe ribonucleotide can be depicted as follows: 2024201264   26 Feb 2024

[0072] The terms “moeA,” “moeC,” “moeU,” or “moeG” may be used to denote a nucleotide that has been modified with 2’-O-moe. C. 2’-fluoro modifications

[0073] Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution. For example, 2’-fluoro (2’-F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability.

[0074] In this application, the terms “fA,” “fC,” “fU,” or “fG” may be used to denote a nucleotide that has been substituted with 2’-F.

[0075] Substitution of 2’-F can be depicted as follows: Natural composition of RNA 2'F substitution D. Phosphorothioate modifications

[0076] Phosphorothioate (PS) linkage or bond refers to a bond where a sulfur is substituted for one nonbridging phosphate oxygen in a phosphodiester linkage, for example 2024201264   26 Feb 2024 in the bonds between nucleotides bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.

[0077] A “*” may be used to depict a PS modification. In this application, the terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a PS bond.

[0078] In this application, the terms “mA*,” “mC*,” “mU*,” or “mG*” may be used to denote a nucleotide that has been substituted with 2’-0-Me and that is linked to the next (e.g., 3’) nucleotide with a PS bond. Similarly, the terms “fA*,” “fC*,” “fU*,” or “fG*” may be used to denote a nucleotide that has been substituted with 2’-F and that is linked to the next (e.g., 3’) nucleotide with a PS bond. Equivalents of a PS linkage or bond are encompassed by embodiments described herein.

[0079] The diagram below shows the substitution of S- into a nonbridging phosphate oxygen, generating a PS bond in lieu of a phosphodiester bond: Natural phosphodiester linkage of RNA Modified phosphorothiaate (PS) bond E. G-C substitutions

[0080] In some embodiments, gRNAs are modified with sequence substitutions that do not comprise chemical modifications. In some embodiments, modified gRNAs are engineered with G-C pairings (e.g., in lower and / or upper stem regions) that are not found in the parental gRNA sequence. In some embodiments, modified gRNAs are engineered with G-U mismatches (“GU wobbles” or mismatch pairings) that are not found in the parental gRNA sequence. 2024201264   26 Feb 2024 F. Inverted abasic modifications

[0081] Abasic nucleotides refer to those which lack nitrogenous bases. The figure below depicts an oligonucleotide with an abasic (also known as apurinic) site that lacks a base:

[0082] Inverted bases refer to those with linkages that are inverted from the normal 5’ to 3’ linkage (i.e., either a 5’ to 5’ linkage or a 3’ to 3’ linkage). For example: Normal oilgonuchotide Inverted oligoGudeatide linkage                         linkage

[0083] An abasic nucleotide can be attached with an inverted linkage. For example, an abasic nucleotide may be attached to the terminal 5’ nucleotide via a 5’ to 5’ linkage, or an abasic nucleotide may be attached to the terminal 3’ nucleotide via a 3’ to 3’ linkage. An inverted abasic nucleotide at either the terminal 5’ or 3’ nucleotide may also be called an inverted abasic end cap. In this application, the terms “invd” indicates an inverted abasic nucleotide linkage.

[0084] The above modifications and their equivalents are included within the scope of the embodiments described herein. 2024201264   26 Feb 2024 2. Guide RNA Compositions

[0085] Compositions comprising guide RNA are encompassed. In some embodiments, the guide RNA comprises a trRNA. In some embodiments, the guide RNA comprises a crRNA. In some embodiments, the guide RNA comprises a crRNA and trRNA. In some embodiments, the guide RNA comprises a crRNA and trRNA on one RNA molecule as a sgRNA. In some embodiments, the guide RNA comprises a crRNA and trRNA on two RNA molecules as a dgRNA. In a dgRNA, the two RNA molecules may associate via base pairing.

[0086] In some embodiments, the guide RNA comprises a 5’ terminus region. In some embodiments, the guide RNA does not comprise a 5’ terminus region. In some embodiments, the 5’ terminus region comprises a “spacer” region as described in Briner AE et al., Molecular Cell 56:333-339 (2014) for sgRNA (but applicable herein to all guide RNAs). In some embodiments, the 5’ terminus region comprises a 5’ end modification. A 5’ terminus region with or without a spacer region may be associated with a crRNA, trRNA, sgRNA and / or dgRNA. The spacer region is also sometimes referred to herein, and by others, as a “guide region,” “guide domain” or “targeting domain.” A “target sequence” as used herein refers to a sequence of nucleic acid to which the guide region / domain directs a nuclease for cleavage. In some embodiments, a spyCas9 protein may be directed by a guide region / domain to a target sequence of a target nucleic acid molecule by the nucleotides present in the spacer region. In some embodiments, the guide RNA does not comprise a spacer region.

[0087] In some embodiments, the guide RNAs described herein comprise or consist of any of the sequences shown in Table 4. Note, however, that where a sequence shows a guide / spacer region, it should be recognized that the composition may comprise this region or not. Further, guide RNAs are encompassed that comprise the modifications of any of the sequences shown in Table 4, and identified therein by SEQ ID No. That is, the nucleotides may be the same or different, but the modification pattern shown may be the same or similar to a modification pattern of a guide sequence of Table 4. A modification pattern includes the relative position and identity of modifications of the gRNA or a region of the gRNA (e.g. 5’ terminus region, lower stem region, bulge region, upper stem region, nexus region, hairpin 1 region, hairpin 2 region, 3’ terminus region). In some embodiments, the modification pattern contains at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% of the modifications of any one of the sequences shown in the sequence column of Table 2024201264   26 Feb 2024 4, or over one or more regions of the sequence. In some embodiments, the modification pattern is at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical to the modification pattern of any one of the sequences shown in the sequence column of Table 4. In some embodiments, the modification pattern is at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical over one or more regions of the sequence shown in Table 4, e.g., a 5’ terminus region, lower stem region, bulge region, upper stem region, nexus region, hairpin 1 region, hairpin 2 region, and / or 3’ terminus region. For example, in some embodiments, a guide RNA is encompassed wherein the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical to the modification pattern of a sequence over the 5’ terminus region. In some embodiments, a guide RNA is encompassed wherein the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical over the lower stem. In some embodiments, a guide RNA is encompassed wherein the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical over the bulge. In some embodiments, a guide RNA is encompassed wherein the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical over the upper stem. In some embodiments, a guide RNA is encompassed wherein the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical over the nexus. In some embodiments, a guide RNA is encompassed wherein the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical over the hairpin 1. In some embodiments, a guide RNA is encompassed wherein the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical over the hairpin 2. In some embodiments, a guide RNA is encompassed wherein the modification pattern is least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical over the 3’ terminus. In some embodiments, the modification pattern differs from the modification pattern of a sequence of Table 4, or a region (e.g. 5’ terminus, lower stem, bulge, upper stem, nexus, hairpin 1, hairpin 2, 3’ terminus) of such a sequence, at 0, 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, the gRNA comprises modifications that differ from the modifications of a sequence of Table 4, at 0, 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, the gRNA comprises modifications that differ from modifications of a region (e.g. 5’ terminus, lower stem, bulge, upper stem, nexus, hairpin 1, hairpin 2, 3’ terminus) of a sequence of Table 4, at 0, 1, 2, 3, 4, 5, or 6 nucleotides. 2024201264   26 Feb 2024

[0088] In some embodiments, the gRNA comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the gRNA comprises a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide. In some embodiments, the gRNA comprises a 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the gRNA comprises a phosphorothioate (PS) bond between nucleotides.

[0089] In some embodiments, the gRNA comprises a 5’ end modification, a 3’ end modification, or 5’ and 3’ end modifications. In some embodiments, the 5’ end modification comprises a phosphorothioate (PS) bond between nucleotides. In some embodiments, the 5’ end modification comprises a 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl) (2'-O-moe), and / or 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the 5’ end modification comprises at least one phosphorothioate (PS) bond and one or more of a 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl) (2'-O-moe), and / or 2'-fluoro (2'-F) modified nucleotide. The end modification may comprise a phosphorothioate (PS), 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl) (2'-O-moe), and / or 2'-fluoro (2'-F) modification. Equivalent end modifications are also encompassed by embodiments described herein. In some embodiments, the gRNA comprises an end modification in combination with a modification of one or more regions of the gRNA. A. Compositions of sgRNAs

[0090] In some embodiments, the compositions and methods of the invention comprise gRNA comprising a crRNA and trRNA that direct a nuclease such as Cas9 to a target DNA sequence. In some embodiments, the gRNAs described herein may be associated on one RNA molecule (single guide RNA or sgRNA).

[0091] In some embodiments, the invention comprises a sgRNA comprising or consisting of any one of the sequences described in SEQ ID Nos: 228-332.

[0092] In some embodiments, a sgRNA comprising any one of the modified sequences of SEQ ID Nos: 235-240, 265-285, and 309-329 is provided. In some embodiments, a sgRNA comprising any one of the modified sequences of SEQ ID Nos: 235240, 265-285, and 309-329, wherein the sgRNA further comprises a 5’ “spacer” sequence (“guide sequence”) that is complementary to a target sequence, and directs a Cas9 to its target for cleavage is encompassed. In some instances, the invention comprises sgRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleic acids of any one of SEQ ID Nos: 235-240, 265-285, and 309-329, wherein the 2024201264   26 Feb 2024 modification pattern is identical to the modification pattern shown in the reference sequence identifier. 1. Domains of sgRNAs

[0093] Briner AE el al., Molecular Cell 56:333-339 (2014) describes functional domains of sgRNAs, referred to herein as “domains”, including the “spacer” domain responsible for targeting, the “lower stem”, the “bulge”, “upper stem” (which may include a tetraloop), the “nexus”, and the “hairpin 1” and “hairpin 2” domains. See, Briner et al. at page 334, Figure 1A.

[0094] Table 1 and FIG. 21A provide a description of the domains of a sgRNA as used herein. In Table 1, the “n” between regions represents a variable number of nucleotides, for example, from Oto 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some embodiments, n equals 0. In some embodiments, n equals 1. Table 1: Regions of sgRNA (linear view, 5’ to 3’) LSI-6 Bl-2 5' terminus (n) lower stem n bulge n US1-12 upper stem B3-6 bulge (continued below) LS7-12 lower stem Nl-18 nexus Hl 1 thru Hl-12 H2-lthru H2-15 hairpin 1 hairpin 2 3' terminus WO 2018 / 107028                                                 PCT / US2017 / 065306 2024201264   26 Feb 2024 a) 5’ terminus region

[0095] In some embodiments, the sgRNA comprises nucleotides at the 5’ terminus as shown in Table 1. In some embodiments, the 5’ terminus of the sgRNA comprises a spacer or guide region that functions to direct a Cas protein to a target nucleotide sequence. In some embodiments, the 5’ terminus does not comprise a spacer or guide region. In some embodiments, the 5’ terminus comprises a spacer and additional nucleotides that do not function to direct a Cas protein to a target nucleotide region.

[0096] In some embodiments, the guide region comprises the first 1-10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides at the 5’ end of the sgRNA. In some embodiments, the guide region comprises 20 nucleotides. In some embodiments, the guide region may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more nucleotides. In some embodiments, the guide region may comprise 17 nucleotides. In some embodiments, the guide region may comprise 18 nucleotides. In some embodiments, the guide region may comprise 19 nucleotides.

[0097] In some embodiments, the selection of the guide region is determined based on target sequences within the gene of interest for editing. For example, in some embodiments, the sgRNA comprises a guide region that is complementary to target sequences of a gene of interest.

[0098] In some embodiments, the target sequence in the gene of interest may be complementary to the guide region of the sgRNA. In some embodiments, the degree of complementarity or identity between a guide region of a sgRNA and its corresponding target sequence in the gene of interest may be about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the guide region of a sgRNA and the target region of a gene of interest may be 100% complementary or identical. In other embodiments, the guide region of a sgRNA and the target region of a gene of interest may contain at least one mismatch. For example, the guide region of a sgRNA and the target sequence of a gene of interest may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches, where the total length of the target sequence is at least about 17, 18, 19, 20 or more base pairs. In some embodiments, the guide region of a sgRNA and the target region of a gene of interest may contain 1-6 mismatches where the guide sequence comprises at least about 17, 18, 19, 20 or more nucleotides. In some embodiments, the guide region of a sgRNA and the target region of a gene of interest may contain 1, 2, 3, 4, 5, or 6 mismatches where the guide 2024201264   26 Feb 2024 sequence comprises about 20 nucleotides. The 5’ terminus may comprise nucleotides that are not considered guide regions (i.e., do not function to direct a cas9 protein to a target nucleic acid). b) Lower stem

[0099] In some embodiments, the sgRNA comprises a lower stem (LS) region that when viewed linearly, is separated by a bulge and upper stem regions. See Table 1.

[00100] In some embodiments, the lower stem regions comprise 1-12 nucleotides, e.g. in one embodiment the lower stem regions comprise LS1-LS12. In some embodiments, the lower stem region comprises fewer nucleotides than shown in Table 1 and FIG. 21A. In some embodiments, the lower stem region comprises more nucleotides than shown in Table 1 and FIG. 21 A. When the lower stem region comprises fewer or more nucleotides than shown in the schematic of Table 1 and FIG. 21 A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[00101] In some embodiments, the lower stem region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence of lower stem leads to a secondary structure of a stem in the sgRNA (e.g., the regions may base pair with one another). In some embodiments, the lower stem regions may not be perfectly complimentary to each other when read in opposite directions. c) Bulge

[00102] In some embodiments, the sgRNA comprises a bulge region comprising six nucleotides, B1-B6. When viewed linearly, the bulge region is separated into two regions. See Table 1. In some embodiments, the bulge region comprises six nucleotides, wherein the first two nucleotides are followed by an upper stem region, followed by the last four nucleotides of the bulge. In some embodiments, the bulge region comprises fewer nucleotides than shown in Table 1 and FIG. 21A. In some embodiments, the bulge region comprises more nucleotides than shown in Table 1 and FIG. 21 A. When the bulge region comprises fewer or more nucleotides than shown in the schematic of Table 1 and FIG. 21A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[00103] In some embodiments, the presence of a bulge results in a directional kink between the upper and lower stem modules in a sgRNA. 2024201264   26 Feb 2024 d) Upper stem

[00104] In some embodiments, the sgRNA comprises an upper stem region comprising 12 nucleotides. In some embodiments, the upper stem region comprises a loop sequence. In some instances, the loop is a tetraloop (loop consisting of four nucleotides).

[00105] In some embodiments, the upper stem region comprises fewer nucleotides than shown in Table 1 and FIG. 21 A. In some embodiments, the upper stem region comprises more nucleotides than shown in Table 1 and FIG. 21A. When the upper stem region comprises fewer or more nucleotides than shown in the schematic of Table 1 and FIG. 21A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[00106] In some embodiments, the upper stem region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence of upper stem leads to a secondary structure of a stem in the sgRNA (e.g., the regions may base pair with one another). In some embodiments, the upper stem regions may not be perfectly complimentary to each other when read in opposite directions. e) Nexus

[00107] In some embodiments, the sgRNA comprises a nexus region that is located between the lower stem region and the hairpin 1 region. In some embodiments, the nexus comprises 18 nucleotides. In some embodiments, the nexus region comprises nucleotides N1 through N18 as shown in Table 1 and FIG. 21 A.

[00108] In some embodiments, the nexus region comprises fewer nucleotides than shown in Table 1 and FIG. 21A. In some embodiments, the nexus region comprises more nucleotides than shown in Table 1 and FIG. 21 A. When the nexus region comprises fewer or more nucleotides than shown in the schematic of Table 1 and FIG. 21A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[00109] In some embodiments, the nexus region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence leads to a secondary structure of a stem and / or stem loop in the sgRNA (e.g., certain nucleotides in the nexus region may base pair with one another). In some embodiments, the nexus regions may not be perfectly complimentary to each other when read in opposite directions. 2024201264   26 Feb 2024 f) Hairpin

[00110] In some embodiments, the sgRNA comprises one or more hairpin regions. In some embodiments, the hairpin region is downstream of (e.g., 3’ to) the nexus region. In some embodiments, the region of nucleotides immediately downstream of the nexus region is termed “hairpin 1” or “Hl”. In some embodiments, the region of nucleotides 3’ to hairpin 1 is termed “hairpin 2” or “H2” In some embodiments, the hairpin region comprises hairpin 1 and hairpin 2. In some embodiments, the sgRNA comprises only hairpin 1 or hairpin 2.

[00111] In some embodiments, the hairpin 1 region comprises 12 nucleic acids immediately downstream of the nexus region. In some embodiments, the hairpin 1 region comprises nucleotides Hl-1 through Hl-12 as shown in Table 1 and FIG. 21 A.

[00112] In some embodiments, the hairpin 2 region comprises 15 nucleic acids downstream of the hairpin 1 region. In some embodiments, the hairpin 2 region comprises nucleotides H2-1 through H2-15 as shown in Table 1 and FIG. 21A.

[00113] In some embodiments, one or more nucleotides is present between the hairpin 1 and the hairpin 2 regions. The one or more nucleotides between the hairpin 1 and hairpin 2 region may be modified or unmodified. In some embodiments, hairpin 1 and hairpin 2 are separated by one nucleotide. In some embodiments, the hairpin regions comprise fewer nucleotides than shown in Table 1 and FIG. 21 A. In some embodiments, the hairpin regions comprise more nucleotides than shown in Table 1 and FIG. 21 A. When a hairpin region comprises fewer or more nucleotides than shown in the schematic of Table 1 and FIG. 21A, the modification pattern, as will be apparent to the skilled artisan, should be maintained.

[00114] In some embodiments, a hairpin region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the hairpin regions may not be perfectly complimentary to each other when read in opposite directions (e.g., the top or loop of the hairpin comprises unpaired nucleotides).

[00115] In some embodiments, the sgRNA comprises replacement of hairpin 1 with nucleotides “n”, wherein “n” is an integer between 1 and 50, 40, 30, 20, 15, 10, 5, 4, 3, and 2. In some embodiments, the hairpin 1 region of a sgRNA is replaced by 2 nucleotides. g) 3’ terminus region

[00116] In some embodiments, the sgRNA comprises nucleotides after the hairpin region(s). In some embodiments, the 3’ terminus region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more nucleotides, e.g. that are not associated with the secondary structure of a 2024201264   26 Feb 2024 hairpin. In some embodiments, the 3’ terminus region comprises 1, 2, 3, or 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ terminus region comprises 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ terminus region comprises 1, 2, or 3 nucleotides that are not associated with the secondary structure of a hairpin. 2. Modifications of sgRNAs

[00117] In some embodiments, the invention comprises a sgRNA comprising one or more modifications within one or more of the following regions: the nucleotides at the 5' terminus; the lower stem region; the bulge region; the upper stem region; the nexus region; the hairpin 1 region; the hairpin 2 region; and the nucleotides at the 3' terminus.

[00118] In some embodiments, the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modification comprises a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide. In some embodiments, the modification comprises a 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the modification comprises a phosphorothioate (PS) bond between nucleotides.

[00119] In some embodiments, the sgRNA comprises modifications at 1, 2, 3, or 4 of the first 4 nucleotides at its 5’ end. In some embodiments, the first three or four nucleotides at the 5' terminus, and the last three or four nucleotides at the 3' terminus are modified. In some embodiments, the first four nucleotides at the 5' terminus, and the last four nucleotides at the 3' terminus are linked with phosphorothioate (PS) bonds. In some embodiments, the modification comprises 2'-O-Me. In some embodiments, the modification comprises 2'-F. In some embodiments, the modification comprises 2'-O-moe.

[00120] In some embodiments, the sgRNA comprises modifications at 1, 2, 3, or 4 of the first 4 nucleotides at the 5’ end. In some embodiments, the sgRNA comprises modifications at 1, 2, 3, or 4 of the first 4 nucleotides at the 3’ end. In some embodiments, the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked with a PS bond, and the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise 2'-O-Me or 2’-O-moe modifications.

[00121] In some embodiments, the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked with a PS bond, and the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise 2'-F modifications.

[00122] In some embodiments, a sgRNA is provided wherein LSI, LS6, LS7, LS8, LSI 1, and LS12 are modified with 2'-O-Me. In some embodiments, each of the nucleotides in 2024201264   26 Feb 2024 the bulge region of the sgRNA are modified with 2'-O-Me. In some embodiments, each of the nucleotides in the upper stem region of the sgRNA are modified with 2'-O-Me. In some embodiments, N16, N17, and N18 in the nexus region of the sgRNA are modified with 2'-O-Me. In some embodiments, each of the nucleotides in the hairpin 1 region of the sgRNA are modified with 2'-O-Me. In some embodiments, each of the nucleotides in the hairpin 2 region of the sgRNA are modified with 2'-O-Me.

[00123] In some embodiments, the sgRNA comprises 2’-O-Me modified nucleotides at the following nucleotides: the first three nucleotides at the 5’ terminus; LSI, LS6, LS7, LS8, LSI 1, and LSI 2; Bl and B2 in the bulge region; each of the nucleotides in the upper stem region of the sgRNA; N16, N17, and N18 in the nexus region; each of the nucleotides in the hairpin 1 region; each of the nucleotides in the hairpin 2 region; and last four nucleotides at the 3’ terminus.

[00124] In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus. In some embodiments, the sgRNA further comprises 2'-O-Me or 2'-F modified nucleic acids at the first three nucleotides at the 5' terminus, and 2'-O-Me or 2'-F modified nucleic acids at the last four nucleotides at the 3' terminus. In some embodiments, LS9 and LS10 are modified with 2'-F. In some embodiments, N15, N16, N17, andN18 are modified with 2'-F. In some embodiments, H2-9, H2-10, H2-11, H2-12, H2-13, HS-14, and H2-15 are modified with 2'-F. In some embodiments, the second to last, third to last, and fourth to last nucleotides at the 3’ terminus are modified with 2’-F

[00125] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2'-F modified nucleic acids at the following nucleotides: LS9 and LS10 in the lower stem region; N15, N16, N17, and N18 in the nexus region; and H2-9, H2-10, H2-11, H2-12, H2-13, HS-14, and H2-15 in the hairpin 2 region. In some embodiments, the sgRNA further comprises 2’-F modified nucleotides at the second to last, third to last, and fourth to last nucleotides at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus. In some embodiments, the sgRNA further comprises 2'-O-Me or 2'-F modified nucleic acids at the first three nucleotides at the 5' terminus, and 2'-O-Me or 2'-F modified nucleic acids at three of the last four nucleotides at the 3' terminus.

[00126] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-O-Me 2024201264   26 Feb 2024 modified nucleotides at LSI and LS6; 2’-O-Me modified nucleotides at US1-US12; 2’-O-Me modified nucleotides at Hl-1 - Hl-12; a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; 2’-O-Me modified nucleotides at H2-1 - H2-15; and 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00127] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-F modified nucleotides at LS1-LS6; 2’-O-Me modified nucleotides at US1-US12; 2’-O-Me modified nucleotides at Hl-1 - Hl-12; a 2’-O-Me modified nucleotide at “n” between Hairpin 1 and Hairpin 2; 2’-O-Me modified nucleotides at H2-1 - H2-15; and 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00128] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-F modified nucleotides at LS2-LS5; 2’-O-Me modified nucleotides at LSI and LS6; 2’-O-Me modified nucleotides at US1-US12; 2’-O-Me modified nucleotides at Hl-1 - Hl-12; a 2’-O-Me modified nucleotide at “n” between Hairpin 1 and Hairpin 2; 2’-O-Me modified nucleotides at H2-1 - H2-15; and 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00129] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-O-Me modified nucleotides at US1-US12; 2’-O-Me modified nucleotides at LS7, LS8, LS11, and LS12; 2’-O-Me modified nucleotides at Hl-1 - Hl-12; a 2’-O-Me modified nucleotide at “n” between Hairpin 1 and Hairpin 2; 2’-O-Me modified nucleotides at H2-1 - H2-15; and 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00130] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-O-Me 2024201264   26 Feb 2024 modified nucleotides at US1-US12; 2’-O-Me modified nucleotides at LS8, LS10, and LS12; 2’-O-F modified nucleotides at LS7, LS9, and LS11; 2’-O-Me modified nucleotides at Hl-1 - Hl-12; a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; 2’-O-Me modified nucleotides at H2-1 - H2-15; and 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00131] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-O-Me modified nucleotides at LSI, LS6, LS7, LS8, LS11, and LS12; 2’-O-Me modified nucleotides at US1-US12; 2’-O-Me modified nucleotides at Hl-1 - Hl-12; a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; 2’-O-Me modified nucleotides at H2-1 - H2-15; and 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00132] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-O-Me modified nucleotides at LSI, LS6, LS7, LS8, LS11, and LS12; 2’-F modified nucleotides at LS9 and LS10; 2’-O-Me modified nucleotides at US1-US12; 2’-O-Me modified nucleotides at Hl-1 - Hl-12; a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; 2’-O-Me modified nucleotides at H2-1 - H2-15; and 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00133] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-O-Me modified nucleotides atUSl-US12; 2’-O-Me modified nucleotides at Hl-1 - Hl-12; a2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; 2’-O-Me modified nucleotides at H2-1 - H2-8; 2’-F modified nucleotides at H2-9 - H2-15; 2’-F modified nucleotides at the second from last, third from last, and fourth from last nucleotide at the 3’ terminus; and a 2’-O-Me modified nucleotide at the last nucleotide at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. 2024201264   26 Feb 2024

[00134] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; 2’-O-Me modified nucleotides at US1-US12; 2’-O-Me modified nucleotides at Hl-2, Hl-4, Hl-6, Hl-8, Hl-10, and Hl-12; 2’-F modified nucleotides at Hl-1, Hl-3, Hl-5, Hl-7, Hl-9, and Hill; a 2’-F modified nucleotide between Hairpin 1 and Hairpin 2; 2’-F modified nucleotides at H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2-14; 2’-O-Me modified nucleotides at H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and H2-15; 2’-F modified nucleotides at the second from last, and fourth from last nucleotide at the 3’ terminus; and 2’-O-Me modified nucleotide at the third from last, and last nucleotide at the 3’ terminus. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00135] Disclosed herein, in some embodiments, is a single guide RNA (sgRNA) comprising 2'-O-Me modifications at nucleotides LS8, LS10, LS12, Hl-2, Hl-4, Hl-6, Hl-8, Hl-10, Hl-12, H2-1, H2-3, H2-5, H2-7, H2-9, H2-11, H2-13, and H2-15; and 2'-F modifications at LS7, LS9, LS11; Hl-1, Hl-3, Hl-5, Hl-7, Hl-9, Hl-11, Hl-13, H2-2, H2-4, H2-6, H2-8, H2-10, H2-12, and H2-14. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus. In some embodiments, the sgRNA further comprises 2’-O-Me modified nucleotides at the last and third to last nucleotide at the 3’ terminus; and 2’-F modified nucleotides at the second to last and third to last nucleotide at the 3’ terminus.

[00136] Disclosed herein, in some embodiments, is a sgRNA comprising the nucleic acids of any one of SEQ ID Nos: 228-232. Disclosed herein, in some embodiments, is a sgRNA comprising the nucleic acids of any one of SEQ ID Nos: 235-240, 265-285, and 309329. Disclosed herein, in some embodiments, is a sgRNA comprises nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleic acids of any one of SEQ ID Nos: 235-240, 265-285, and 309-329, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier. In some embodiments, the sgRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus.

[00137] In some embodiments, a sgRNA comprising a 5’ end modification and one or more modifications in one or more of: the upper stem region; the hairpin 1 region; and the 2024201264   26 Feb 2024 hairpin 2 region is provided, wherein the 5’ end modification comprises at least two phosphorothioate linkages within the first seven nucleotides of the 5’ terminus.

[00138] In some embodiments, a sgRNA comprising a 5’ end modification and one or more modifications in one or more of: the upper stem region; the hairpin 1 region; and the hairpin 2 region is provided, wherein the 5’ end modification comprises one or more phosphorothioate linkages at the 5’ end of the RNA. In some embodiments, one or more phorphorothioate bonds link the 5’ terminal nucleotides.

[00139] In some embodiments, a sgRNA comprising a 5’ end modification and one or more modifications in one or more of: the upper stem region; the hairpin 1 region; and the hairpin 2 region is provided, wherein the 5’ end modification comprises one or more phosphorothioate linkages within the first seven nucleotides of the 5’ terminus.

[00140] In some embodiments, a sgRNA comprising any one of the modified sgRNA sequences of SEQ ID Nos: 228-332 is provided.

[00141] In some embodiments, a sgRNA comprising or consisting of any one of the modified sgRNA sequences of SEQ ID Nos: 235-240, 265-285, and 309-329 is provided.

[00142] In some embodiments, the invention comprises a sgRNA comprising any one of the modified sequences of SEQ ID Nos: 235-240, 265-285, and 309-329, wherein the sgRNA further comprises a 5’ spacer sequence that is at least partially complementary to a target sequence, and directs a Cas9 to its target for cleavage.

[00143] In some embodiments, the invention comprises a sgRNA comprising nucleotides having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleotides of any one of SEQ ID Nos: 235-240, 265-285, and 309-329, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier. That is, the nucleotides A, U, C, and G may differ by 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% compared to what is shown in in the sequences, but the modification remains unchanged.

[00144] In some embodiments, the invention comprises a sgRNA comprising one or more modifications within one or more of the following regions: the nucleotides at the 5' terminus; the lower stem region; the bulge region; the upper stem region; the; the nexus region; the hairpin 1 region; the hairpin 2 region; and the nucleotides at the 3' terminus.

[00145] In some embodiments, the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modification comprises a 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the modification comprises a phosphorothioate 2024201264   26 Feb 2024 (PS) bond between nucleotides. In some embodiments, the modification comprises an inverted abasic nucleotide.

[00146] In some embodiments, a sgRNA is provided comprising 2'-O-Me modified nucleotides at: the first three nucleotides in the 5’ terminus; LSI, LS6, LS7, LS8, LSI 1, and LSI 2 in the lower stem; Bl and B2 in the bulge region; each of the nucleotides in the upper stem region; N16, N17, and N18 in the nexus region; each of the nucleotides in the hairpin 1 region; one nucleotide between hairpin 1 and hairpin 2; each of the nucleotides in the hairpin 2 region; and the last four nucleotides at the 3’ terminus. In one embodiment, the sgRNA further comprises three PS bonds between the first four nucleotides at the 5’ terminus and three PS bonds between the last four nucleotides at the 3’ terminus.

[00147] In some embodiments, a sgRNA is provided comprising 2'-O-Me modified nucleotides at: the first three nucleotides in the 5’ terminus; LSI, LS6, LS7, LS8, LSI 1, and LSI 2 in the lower stem; B1-B6 in the bulge region; each of the nucleotides in the upper stem region; N16, N17, and N18 in the nexus region; each of the nucleotides in the hairpin 1 region; one nucleotide between hairpin 1 and hairpin 2; each of the nucleotides in the hairpin 2 region; and the last four nucleotides at the 3’ terminus. In one embodiment, the sgRNA further comprises three PS bonds between the first four nucleotides at the 5’ terminus and three PS bonds between the last four nucleotides at the 3’ terminus.

[00148] In some embodiments, a sgRNA is provided comprising 2'-F modified nucleotides at: LS9 and LS10 in the lower stem; 15-N18 in the nexus region; H2-9-HS-15 in the hairpin 2 region; and the second to last, third to last, and fourth to last nucleotide in the 3’ terminus region.

[00149] In some embodiments, a sgRNA is provided comprising 2'-F modified nucleotides at: each nucleotide in the lower stem; 15-N18 in the nexus region; H2-9-HS-15 in the hairpin 2 region; and the second to last, third to last, and fourth to last nucleotide in the 3’ terminus region.

[00150] In some embodiments, a single guide RNA (sgRNA) is provided comprising 2’-O-Me modified nucleotides at LS8, LS10, LS12, Hl-2, Hl-4, Hl-6, Hl-8, Hl-10, Hl-12, H2-1, H2-3, H2-5, H2-7, H2-9, H2-11, H2-13, H2-15, and the last and third to last nucleotides at the 3’ terminus; and 2'-F modifications at LS7, LS9, LS11; Hl-1, Hl-3, Hl-5, Hl-7, Hl-9, Hl-11, Hl-13, H2-2, H2-4, H2-6, H2-8, H2-10, H2-12, H2-14, and the second to last and fourth to last nucleotide at the 3’ terminus.

[00151] Each of the following embodiments are encompassed: 2024201264   26 Feb 2024 Embodiment 01. A single guide RNA (sgRNA) comprising one or more modifications in one or more of the following regions: a. the 5’ terminus; b. the lower stem region; c. the bulge region; d. the upper stem region; e. the nexus region; f. the hairpin 1 region; g. the hairpin 2 region; and h. the 3’ terminus. Embodiment 02. The sgRNA of embodiment 1, wherein the modification comprises a 2’-O-methyl (2’-O-Me) modified nucleotide. Embodiment 03. The sgRNA of embodiment 1, wherein the modification comprises a 2’-fluoro (2’-F) modified nucleotide. Embodiment 04. The sgRNA of embodiment 1, wherein the modification comprises a phosphorothioate (PS) bond between nucleotides. Embodiment 05. The sgRNA of any one of embodiments 1-3, wherein the first three or four nucleotides at the 5’ terminus, and the last three or four nucleotides at the 3’ terminus are modified. Embodiment 06. The sgRNA of any one of embodiments 1-5, wherein the first four nucleotides at the 5’ terminus, and the last four nucleotides at the 3’ terminus are linked with phosphorothioate (PS) bonds. Embodiment 07. The sgRNA of embodiment 5, wherein the modification comprises 2’- O-Me. Embodiment 08. The sgRNA of embodiment 5, wherein the modification comprises 2’-F. Embodiment 09. The sgRNA of any one of embodiments 1-7, wherein the first four nucleotides at the 5’ terminus and the last four nucleotides at the 3’terminus are linked with a PS bond, and wherein the first three nucleotides at the 5’ terminus and the last three nucleotides at the 3’ terminus comprise 2’-O-Me modifications. Embodiment 10. The sgRNA of any one of embodiments 1-8, wherein the first four nucleotides at the 5’ terminus and the last four nucleotides at the 3’ terminus are linked with a PS bond, and wherein the first three nucleotides at the 5’ terminus and the last three nucleotides at the 3’ terminus comprise 2’-F modifications. 2024201264   26 Feb 2024 Embodiment 11. The sgRNA of any one of embodiments 1-10, wherein LSI, LS6, LS7, LS8, LS11, and LS12 are modified with 2’-O-Me. Embodiment 12. The sgRNA of any one of embodiments 1-11, wherein each of the nucleotides in the bulge region are modified with 2’-O-Me. Embodiment 13. The sgRNA of any one of embodiments 1-12, wherein each of the nucleotides in the upper stem region are modified with 2’-O-Me. Embodiment 14. The sgRNA of any one of embodiments 1-13, wherein N16, N17, and N18 in the nexus region are modified with 2’-O-Me. Embodiment 15. The sgRNA of any one of embodiments 1-14, wherein each of the nucleotides in the hairpin 1 region are modified with 2’-O-Me. Embodiment 16. The sgRNA of any one of embodiments 1-15, wherein each of the nucleotides in the hairpin 2 region are modified with 2’-O-Me. Embodiment 17. A single guide RNA (sgRNA) comprising 2’-O-Me modified nucleic acids at the following nucleotides: a. the first three nucleotides at the 5’ terminus; b. LSI, LS6, LS7, LS8, LS11, and LS12 in the lower stem region; c. Bl and B2 in the bulge region; d. each nucleotide in the upper stem region; e. N16, N17, and N18 in the nexus region; f. each nucleotide in the hairpin 1 region; g. each nucleotide in the hairpin 2 region; and h. the last four nucleotides at the 3’ terminus. Embodiment 18. The sgRNA of embodiment 17, wherein B3-B6 are modified with 2’-O-Me. Embodiment 19. The sgRNA of embodiment 17, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 20. The sgRNA of any one of embodiments 1-10, wherein LS9 and LS10 are modified with 2’-F. Embodiment 21. The sgRNA of any one of embodiments 1-10 and 20, wherein N15, N16, N17, and N18 are modified with 2’-F. Embodiment 22. The sgRNA of any one of embodiments 1-10 and 20-21, wherein H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H2-15 are modified with 2’-F. 2024201264   26 Feb 2024 Embodiment 23. The sgRNA of any one of embodiments 1-10 and 21-22, wherein the second to last, third to last, and fourth to last nucleotides at the 3’ terminus are modified with 2’-F. Embodiment 24. A single guide RNA (sgRNA) comprising 2’-F modified nucleotides at the following positions: a. LS9 and LS10 in the lower stem region; b. N15, N16, N17, andN18 in the nexus region; and c. H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H2-15 in the hairpin 2 region. Embodiment 25. The sgRNA of embodiment 24, further comprising 2’-F modified nucleotides at the second to last, third to last, and fourth to last nucleotides at the 3’ terminus. Embodiment 26. The sgRNA of any one of embodiments 24 or 25, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 27. The sgRNA of any one of embodiments 24 -26, further comprising 2’-O-Me or 2’-F modified nucleotides at the first three nucleotides at the 5’ terminus, and 2’-O-Me or 2’-F modified nucleotides at the three of the last four nucleotides at the 3’ terminus. Embodiment 28. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at LSI and LS6; c. 2’-O-Me modified nucleotides at US1-US12; d. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; e. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; f. 2’-O-Me modified nucleotides at H2-1 - H2-15; and g. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. Embodiment 29. The sgRNA of embodiment 28 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 30. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-F modified nucleotides at LS1-LS6; c. 2’-O-Me modified nucleotides at US1-US12; d. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; 2024201264   26 Feb 2024 e. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; f. 2’-O-Me modified nucleotides at H2-1 - H2-15; and g. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. Embodiment 31. The sgRNA of embodiment 30 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 32. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-F modified nucleotides at LS2-LS5; c. 2’-O-Me modified nucleotides at LSI and LS6; d. 2’-O-Me modified nucleotides at US1-US12; e. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; f. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; g. 2’-O-Me modified nucleotides at H2-1 - H2-15; and h. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. Embodiment 33. The sgRNA of embodiment 32 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 34. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at US1-US12; c. 2’-O-Me modified nucleotides at LS7, LS8, LS11, and LS12; d. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; e. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; f. 2’-O-Me modified nucleotides at H2-1 - H2-15; and g. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. Embodiment 35. The sgRNA of embodiment 34 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 36. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at US1-US12; c. 2’-O-Me modified nucleotides at LS7, LS8, LS11, and LS12; d. 2’-F modified nucleotides at LS9 and LS10; 2024201264   26 Feb 2024 e. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; f. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; g. 2’-O-Me modified nucleotides at H2-1 - H2-15; and h. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. Embodiment 37. The sgRNA of embodiment 36 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 38. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at US1-US12; c. 2’-O-Me modified nucleotides at LS8, LS10, and LS12; d. 2’-O-F modified nucleotides at LS7, LS9, and LSI 1; e. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; f. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; g. 2’-O-Me modified nucleotides at H2-1 - H2-15; and h. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. Embodiment 39. The sgRNA of embodiment 32 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 40. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at LSI, LS6, LS7, LS8, LS11, and LS12 c. 2’-O-Me modified nucleotides at US1-US12; d. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; e. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; f. 2’-O-Me modified nucleotides at H2-1 - H2-15; and g. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. Embodiment 41. The sgRNA of embodiment 40 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus Embodiment 42. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at LSI, LS6, LS7, LS8, LS11, and LS12; c. 2’-F modified nucleotides at LS9 and LS10; 2024201264   26 Feb 2024 d. 2’-O-Me modified nucleotides at US1-US12; e. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; f. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; g. 2’-O-Me modified nucleotides at H2-1 - H2-15; and h. 2’-O-Me modified nucleotides at the last four nucleotides at the 3’ terminus. Embodiment 43. The sgRNA of embodiment 43 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 44. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at US1-US12; c. 2’-O-Me modified nucleotides at Hl-1 - Hl-12; d. a 2’-O-Me modified nucleotide between Hairpin 1 and Hairpin 2; e. 2’-O-Me modified nucleotides at H2-1 - H2-8; f. 2’-F modified nucleotides at H2-9 - H2-15; g. 2’-F modified nucleotides at the second from last, third from last, and fourth from last nucleotide at the 3’ terminus; and h. a 2’-O-Me modified nucleotide at the last nucleotide at the 3’ terminus. Embodiment 45. The sgRNA of embodiment 44 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 46. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ terminus; b. 2’-O-Me modified nucleotides at US1-US12; c. 2’-O-Me modified nucleotides at Hl-2, Hl-4, Hl-6, Hl-8, Hl-10, and Hl-12; d. 2’-F modified nucleotides at Hl-1, Hl-3, Hl-5, Hl-7, Hl-9, and Hl-11; e. a 2’-F modified nucleotide between Hairpin 1 and Hairpin 2; f. 2’-F modified nucleotides at H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2-14; g. 2’-O-Me modified nucleotides at H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and H2-15; h. 2’-F modified nucleotides at the second from last, and fourth from last nucleotide at the 3’ terminus; and 2024201264   26 Feb 2024 i. 2’-O-Me modified nucleotide at the third from last, and last nucleotide at the 3’ terminus. Embodiment 47. The sgRNA of embodiment 46 further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 48. A single guide RNA (sgRNA) comprising a. 2’-O-Me modified nucleotides LS8, LS10, LS12, Hl-2, Hl-4, Hl-6, Hl-8, Hl-10, Hl-12, H2-1, H2-3, H2-5, H2-7, H2-9, H2-11, H2-13, and H2-15; and b. 2’-F modified nucleotides at LS7, LS9, LS11; Hl-1, Hl-3, Hl-5, Hl-7, Hl-9, Hl-11, Hl-13, H2-2, H2-4, H2-6, H2-8, H2-10, H2-12, and H2-14. Embodiment 49. The sgRNA of embodiment 48, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 50. The sgRNA of any one of embodiments 48-49, further comprising a. 2’-O-Me modified nucleotides at the last and third to last nucleotide at the 3’ terminus; and b. 2’-F modified nucleotides at the second to last and third to last nucleotide at the 3’ terminus. Embodiment 51. A sgRNA comprising the nucleic acids of any one of SEQ ID Nos: 228-332. Embodiment 52. A sgRNA comprising the nucleic acids of any one of SEQ ID Nos: 235-240, 265-285, and 309-329. Embodiment 53. A sgRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleic acids of any one of SEQ ID Nos: 235-240, 265-285, and 309-329, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier. Embodiment 54. The sgRNA of any one of embodiments 51-53, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. B. Compositions of dgRNAs

[00152] In some embodiments, the compositions and methods of the invention comprise gRNA comprising a crRNA and trRNA that direct a nuclease such as Cas9 to a 2024201264   26 Feb 2024 target DNA sequence. In some embodiments, the gRNAs are associated, but on two separate RNA molecules (dual guide RNA or dgRNA).

[00153] Table 2 and FIG. 21C provides a description of domains of a crRNA as used herein. The 5’ terminus region may comprise a spacer region at or near the 5’ terminus of the crRNA and functions to direct a Cas9 to a target region in the DNA, e.g., as described herein. In Table 2, the “n” between regions represents a variable number of nucleotides, for example, from 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some embodiments, n equals 0. Any of the dgRNAs described herein may include an “n” between any domain.

[00154] Table 3 and FIG. 21C provide a description of domains of a trRNA as used herein. In Table 3, the “n” between regions represents a variable number of nucleotides, for example, from 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some embodiments, n equals 0. Any of the dgRNAs described herein may include an “n” between any domain. 1. Domains of dgRNAs

[00155] As described in Briner 2014, dgRNAs can be developed based on specific functional domains, referred to herein as “domains”, including the spacer responsible for targeting, the lower stem, the bulge, the upper stem, the nexus, and the hairpin domains. In dgRNAs, the crRNA comprises some components of the gRNA and the trRNA comprises some components of the gRNA.

[00156] Regions of crRNAs are provided in Table 2 and FIG 21C. Regions of trRNAs are provided in Table 3 and FIG 21C. FIG 21C shows a schematic of an exemplary dgRNA. Table 2: Regions of crRNA (linear view, 5’ to 3’) 5' terminus (n) LSI-6 lower stem Table 3: Regions of trRNA (linear view, 5’ to 3’) Bl-2 bulge US1-14 upper stem 3' terminus US1-11 Bl-4 LSl-6 5' terminus (n) upper stem n bulge n lower stem n Nl-18 Hl-lthru Hl-12 H2-lthru H2-15 nexus n hairpin 1 n hairpin 2 3' terminus WO 2018 / 107028                                                 PCT / US2017 / 065306 2024201264   26 Feb 2024 a) 5’ Terminus Region

[00157] In some embodiments, the dgRNA comprises nucleotides at the 5’ terminus of the crRNA and trRNA as shown in Tables 2-3 and FIG 2IC.

[00158] In some embodiments, the 5’ terminus of the crRNA comprises a spacer or guide region that functions to direct a Cas protein to a target nucleotide sequence. In some embodiments, the 5’ terminus does not comprise a spacer or guide region. In some embodiments, the 5’ terminus comprises a spacer and additional nucleotides that do not function to direct a Cas protein to a target nucleotide region.

[00159] In some embodiments, the guide region comprises the first 1-10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides at the 5’ end of the crRNA. In some embodiments, the guide region comprises 20 nucleotides. In some embodiments, the guide region may comprises, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21, 22, 23, 24, or 25 or more nucleotides. In some embodiments, the guide region may comprise 17 nucleotides. In some embodiments, the guide region may comprise 18 nucleotides. In some embodiments, the guide region may comprise 19 nucleotides.

[00160] In some embodiments, the selection of the guide region is determined based on target sequences within the gene of interest for editing. For example, in some embodiments, the crRNA comprises a guide region that is complementary to target sequences of a gene of interest.

[00161] In some embodiments, the target sequence in the gene of interest may be complementary to the guide region of the crRNA. In some embodiments, the degree of complementarity or identity between a guide region of a crRNA and its corresponding target sequence in the gene of interest may be about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the guide region of a crRNA and the target region of a gene of interest may be 100% complementary or identical. In other embodiments, the guide region of a crRNA and the target region of a gene of interest may contain at least one mismatch. For example, the guide region of a crRNA and the target sequence of a gene of interest may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches, where the total length of the target sequence is at least about 17, 18, 19, 20 or more base pairs. In some embodiments, the guide region of a crRNA and the target region of a gene of interest may contain 1-6 mismatches where the guide sequence comprises at least about 17, 18, 19, 20 or more nucleotides. In some embodiments, the guide region of a crRNA and the target 2024201264   26 Feb 2024 region of a gene of interest may contain 1, 2, 3, 4, 5, or 6 mismatches where the guide sequence comprises about 20 nucleotides.

[00162] In some embodiments, the trRNA comprises a 5’ terminus. In some embodiments, the trRNA comprises a 5’ terminus which forms, in part, the upper stem of a dgRNA. The 5’ terminus of the trRNA is not complementary to a region of the target gene. b) Lower stem

[00163] In some embodiments, the dgRNA comprises a lower stem (LS) region. The lower stem region comprises a crRNA lower stem region and a trRNA lower stem region that associate as depicted in FIG 21C. In some embodiments, the lower stem region of the crRNA is at least partially complementary to the lower stem region of the trRNA. In some embodiments, the lower stem region of the crRNA is fully complementary to the lower stem region of the trRNA.

[00164] In some embodiments, the lower stem region of the crRNA and trRNA each comprise 6 nucleotides. In some embodiments, the lower stem region of the crRNA and trRNA each comprise fewer nucleotides than shown in Tables 2 and 3 and FIG. 21C. In some embodiments, the lower stem region comprises more nucleotides than shown in Tables 2 and 3 and FIG. 21C. When the lower stem region comprises fewer or more nucleotides than shown in the schematic of Tables 2 and 3 and FIG. 21C, the modification patterns, as will be apparent to the skilled artisan, are maintained. In some embodiments, the number of nucleotides in the lower stem of the crRNA differs from the number of nucleotides in the lower stem of the trRNA. c) Bulge

[00165] In some embodiments, the dgRNA comprises a bulge (B) region. In some embodiments, the crRNA comprises one bulge region and the trRNA comprises one bulge region. In some embodiments, each bulge region comprises 1-4 nucleotides. In some embodiments, the bulge region of the crRNA comprises two nucleotides, and the bulge region of the trRNA comprises four nucleotides.

[00166] In some embodiments, the crRNA bulge region is located between the lower stem region and the upper stem region of the crRNA. In some embodiments, the bulge region of the crRNA comprises two nucleotides. In some embodiments, the bulge region of the crRNA comprises nucleotides Bl and B2 as shown Table 2 and FIG 21C.

[00167] In some embodiments, the trRNA bulge region is located between the upper stem region and the lower stem region of the trRNA. In some embodiments, the bulge region 2024201264   26 Feb 2024 of the trRNA comprises four nucleotides. In some embodiments, the bulge region of the trRNA comprises nucleotides Bl through B4 as shown Table 3 and FIG 21C.

[00168] In some embodiments, the presence of a bulge results in a directional kink between the upper and lower stems modules in a dgRNA. The crRNA bulge and trRNA bulge may be partially complementary. The crRNA bulge and trRNA bulge may have no complementary.

[00169] In some embodiments, the bulge regions of the crRNA and trRNA comprise more nucleotides than shown in Tables 2 and 3 and FIG. 21C. When the bulge region comprises fewer or more nucleotides than shown in the schematic of Tables 2 and 3 and FIG. 2IC, the modification patterns, as will be apparent to the skilled artisan, are maintained. In some embodiments, the number of nucleotides in the bulge of the crRNA differs from the number of nucleotides in the bulge of the trRNA. d) Upper stem

[00170] In some embodiments, the dgRNA comprises an upper stem (US) region. The upper stem region comprises a crRNA upper stem region and a trRNA upper stem region that associate as depicted in FIG 21C. In some embodiments, the upper stem region of the crRNA is at least partially complementary to the upper stem region of the trRNA. In some embodiments, the upper stem region of the crRNA is fully complementary to the upper stem region of the trRNA.

[00171] In some embodiments, the upper stem region of the crRNA comprises fourteen nucleotides. In some embodiments, the upper stem region of the trRNA comprises eleven nucleotides. In some embodiments, the upper stem regions of the crRNA and trRNA each comprise fewer nucleotides than shown in Tables 2 and 3 and FIG. 21C. In some embodiments, the upper stem regions of the crRNA and trRNA comprise more nucleotides than shown in Tables 2 and 3 and FIG. 21C. When the upper stem region comprises fewer or more nucleotides than shown in the schematic of Tables 2 and 3 and FIG. 21C, the modification patterns, as will be apparent to the skilled artisan, are maintained.

[00172] In some embodiments, the upper stem of the crRNA comprises nucleotides US1 through US14 as shown in Table 2 and FIG. 21C.

[00173] In some embodiments, the upper stem of the trRNA comprises nucleotides US1 through US11 as shown in Table 3 and FIG. 21C. 2024201264   26 Feb 2024 e) Nexus

[00174] In some embodiments, the dgRNA comprises a trRNA comprising a nexus region. In some embodiments, the nexus is between the lower stem region and the hairpin 1 region of the trRNA. In some embodiments, the nexus is located immediately downstream of the lower stem of the trRNA. In some embodiments, the nexus comprises eighteen nucleotides. In some embodiments, the nexus region of the trRNA comprises nucleotides NINIS as shown in Table 3 and FIG 21C. In some embodiments, the nexus comprises fewer nucleotides than shown in Table 3 and FIG 21C. In some embodiments, the nexus region of the trRNA comprises more nucleotides than shown in Table 3 and FIG. 21C. When the nexus region comprises fewer or more nucleotides than shown in Table 3 and FIG. 21C, the modification patterns, as will be apparent to the skilled artisan, are maintained.

[00175] In some embodiments, the nexus region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence leads to a secondary structure of a stem and / or stem loop in the sgRNA (e.g., certain nucleotides in the nexus region may base pair with one another). In some embodiments, the nexus regions may not be perfectly complimentary to each other when read in opposite directions. f) Hairpin

[00176] In some embodiments, the hairpin region of the trRNA is downstream of the nexus region. In some embodiments, the region of nucleotides immediately downstream of the nexus region is termed “hairpin 1.” In some embodiments, the region of nucleotides immediately downstream of the hairpin 1 region is termed “hairpin 2.” In some embodiments, the hairpin region comprises hairpin 1 and hairpin 2. In some instances, hairpin 1 and hairpin 2 are separated by one or more nucleotide “n.” In some embodiments, n=l. In some embodiments, the trRNA comprises only hairpin 1 or hairpin 2.

[00177] Replacement of the hairpin 1 region of a trRNA with 2 nucleotides has been shown to allow editing activity of a Cas RNP (see US20150376586, Fig. 16). In some embodiments, the trRNA comprises replacement of hairpin 1 with nucleotides “n”, wherein “n” is an integer between 1 and 50, 40, 30, 20, 15, 10, 5, 4, 3, and 2. In some embodiments, the hairpin 1 region of a trRNA is replaced by 2 nucleotides.

[00178] In some embodiments, hairpin 1 of the trRNA comprises twelve nucleotides immediately downstream of the nexus region. In some embodiments, the hairpin 1 region of the trRNA comprises nucleotides Hl-1 through Hl-12 as shown in Table 3 and FIG 21C. 2024201264   26 Feb 2024

[00179] In some embodiments, non-hairpin nucleotides are present between the hairpin 1 and the hairpin 2 regions of the trRNA. In some embodiments, one to two non-hairpin nucleotides reside between hairpin 1 and hairpin 2.

[00180] In some embodiments, hairpin 2 of the trRNA comprises fifteen nucleotides after (3’ to) hairpin 1. In some embodiments, the hairpin 2 region of the trRNA comprises nucleotides H2-1 through H2-15 as shown in Table 3 and FIG 21C. In some embodiments, the hairpin 2 region of the trRNA comprises nucleotides H2-1 through H2-15 as shown in Table 3, and the “n” between hairpin 1 and hairpin 2 is 1 or 2.

[00181] In some embodiments, a hairpin region of the trRNA comprises more nucleotides than shown in Table 3 and FIG. 21C. When a hairpin region comprises fewer or more nucleotides than shown in Table 3 and FIG. 21C, the modification patterns, as will be apparent to the skilled artisan, are maintained.

[00182] In some embodiments, a hairpin region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the hairpin regions may not be perfectly complimentary to each other when read in opposite directions (e.g., the top or loop of the hairpin comprises unpaired nucleotides).

[00183] In some embodiments, the trRNA comprises replacement of hairpin 1 with nucleotides “n”, wherein “n” is an integer between 1 and 50, 40, 30, 20, 15, 10, 5, 4, 3, and 2. In some embodiments, the hairpin 1 region of a trRNA is replaced by 2 nucleotides. g) 3’ terminus

[00184] In some embodiments, the dgRNA comprises a trRNA comprising a 3’ terminus region comprising additional nucleotides after (3’ to) the hairpin region(s). In some embodiments, the 3’ terminus region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ terminus region comprises 1, 2, 3, or 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ terminus region comprises 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ terminus region comprises 1, 2, or 3 nucleotides that are not associated with the secondary structure of a hairpin. 2. Modifications of dgRNAs

[00185] In some embodiments, a dgRNA comprises a modified crRNA and an unmodified trRNA. In some embodiments, a dgRNA comprises an unmodified crRNA and a 2024201264   26 Feb 2024 modified trRNA. In some embodiments, both the crRNA and trRNA of a dgRNA comprise modifications.

[00186] In some embodiments, the gRNAs described herein are in two separate RNA molecules (dual guide or dgRNA). See, Tables 2, 3, and FIG. 21C.

[00187] In some embodiments, the invention comprises a dgRNA comprising or consisting of a) any one of the crRNA sequences of SEQ ID Nos: 1-187; and b) any one of the trRNA sequences described in SEQ ID Nos: 188-227.

[00188] In some embodiments, a dgRNA comprising any one of the modified crRNA sequences of 1-187 is provided.

[00189] In some embodiments, a dgRNA comprising any one of the modified trRNA sequences of 188-227 is provided.

[00190] In some embodiments, a dgRNA comprising any one of the modified crRNA sequences of SEQ ID Nos: 19-31, 53-73, and 104-130 is provided. In some embodiments, the invention comprises a dgRNA comprising any one of the modified sequences of SEQ ID Nos: 19-31, 53-73, and 104-130, wherein the crRNA further comprises a 5’ spacer sequence that is at least partially complementary to a target sequence, and directs a Cas9 to its target for cleavage.

[00191] In some embodiments, the invention comprises a crRNA comprising any one of the sequences described in SEQ ID Nos: 1-187. In some embodiments, the invention comprises a crRNA comprising or consisting of any one of the sequences described in SEQ ID Nos: 19-31, 53-73, and 104-130. In some embodiments, the invention comprises a crRNA comprising any one of the sequences described in SEQ ID Nos: 19-31, 53-73, and 104-130 and a spacer region.

[00192] In some embodiments, the invention comprises a trRNA comprising or consisting of any one of the sequences described in SEQ ID Nos: 188-277.

[00193] In some embodiments, the invention comprises a crRNA comprising nucleotides having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleotides of any one of SEQ ID Nos: 1-187, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier. That is, the nucleotides A, U, C, and G may differ by 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% compared to what is shown in in the sequences, but the modification remains unchanged.

[00194] In some embodiments, the invention comprises a trRNA comprising nucleotides having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to 2024201264   26 Feb 2024 the nucleotides of any one of SEQ ID Nos: 188-277, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier. That is, the nucleotides A, U, C, and G may differ by 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% compared to what is shown in the sequences, but the modification on each nucleotide remains unchanged. 3. crRNAs, trRNAs, and dgRNAs with modifications

[00195] In some embodiments, the crRNA comprises one or more modified nucleotides within one or more of the 5’ terminus, lower stem, bulge, upper stem, and 3’ terminus.

[00196] In some embodiments, the modification comprises 2’-O-Me.

[00197] In some embodiments, the modification comprises 2’-F.

[00198] In some embodiments, the modification comprises a phosphorothioate (PS) bond linking one or more nucleotides. In some embodiments, the modification is three PS bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus.

[00199] In some embodiments, the modification comprises an inverted abasic nucleotide.

[00200] In some embodiments, a crRNA is provided comprising 2’-O-Me modified nucleotides at each nucleotide in the upper stem. In some embodiments, US-1 through US-14 of the crRNA are each modified with 2’-O-Me. In some embodiments, LSI and LS6 of the crRNA are modified with 2’-O-Me. In some embodiments, LS5 of the crRNA is modified with 2’-O-Me.

[00201] In some embodiments, a crRNA comprising 2’-O-Me modified nucleotides at each of the nucleotides in the upper stem, and LSI and LS6 in the lower stem is provided. In some embodiments, the crRNA further comprises one or more 2’-O-Me or 2’-O-moe modified nucleotides in the 5’ and / or 3’ terminus region, e.g. in a 5’ and / or 3’ end modification.

[00202] In some embodiments, a crRNA comprising 2’-O-Me modified nucleotides at each of the nucleotides in the upper stem, LSI, LS5, and LS6 in the lower stem is provided. In some embodiments, the crRNA further comprises one or more 2’-O-Me or 2’-O-moe modified nucleotides in the 5’ and / or 3’ terminus region, e.g. in a 5’ and / or 3’ end modification. 2024201264   26 Feb 2024

[00203] In some embodiments, the invention comprises a crRNA comprising 2’-F modified nucleotides at LSI, LS2, and LS6 in the lower stem. In some embodiments, the crRNA further comprises 2’-F modified nucleotides at each of Bl and B2 in the bulge region. In some embodiments, the invention comprises a crRNA comprising 2’-F modified nucleotides at LSI, LS2, and LS6 in the lower stem, and at each of Bl and B2 in the bulge region. In some embodiments, the crRNA further comprises one or more 2’-O-Me or 2’-O-moe modified nucleotides in the 5’ and / or 3’ terminus region, e.g. in a 5’ and / or 3’ end modification.

[00204] In some embodiments, the crRNA comprises 2’-O-Me modified nucleotides at nucleotides LSI and LS6 in the lower stem region; each of the nucleic acids in the bulge region; and each of the nucleic acids in the upper stem region. In some embodiments, the LS5 nucleotide of the crRNA is also modified with 2’-O-Me. In some embodiments, LS2, LS3, and LS4 of the crRNA are not modified. In some embodiments, the crRNA further comprises one or more 2’-O-Me or 2’-O-moe modified nucleotides in the 5’ and / or 3’ terminus region, e.g. in a 5’ and / or 3’ end modification.

[00205] In some embodiments, the crRNA comprises 2’-fluoro (2’-F) modified nucleotides at LSI, LS2, and LS6 in the lower stem region, and each of the nucleotides in the bulge region. In some embodiments, the crRNA comprises 2’-fluoro (2’-F) modified nucleotides at LSI, LS2, and LS6 in the lower stem region, and at B2 and B2 in the bulge region. In some embodiments, the crRNA comprises 2’-fluoro (2’-F) modified nucleotides at LSI - LS6 in the lower stem region, and each of the nucleotides in the bulge region. In some embodiments, the crRNA further comprises one or more 2’-O-Me or 2’-O-moe modified nucleotides in the 5’ and / or 3’ terminus region, e.g. in a 5’ and / or 3’ end modification.

[00206] In some embodiments, the invention comprises a trRNA comprising one or more modified nucleotides within one or more of the following regions: the 5’ terminus, the upper stem region; the bulge region; the lower stem region; the nexus region; the hairpin 1 region; the intervening region between the hairpin 1 and hairpin 2 regions; the hairpin 2 region; and the 3’ terminus region.

[00207] In some embodiments, the modification comprises 2’-O-Me.

[00208] In some embodiments, the modification comprises 2’-F.

[00209] In some embodiments, the modification comprises a phosphorothioate (PS) bond linking one or more nucleotides. In some embodiments, the modification is three PS bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. 2024201264   26 Feb 2024

[00210] In some embodiments, the modification comprises an inverted abasic nucleotide.

[00211] In some embodiments, the trRNA comprises 2’-O-Me modified nucleotides at each nucleic acid in the upper stem; Bl and B2 in the bulge region; LSI and LS2 in the lower stem region; N3, N4, N5, N15, N16, N17, and N18 in the nexus region; each nucleotide in the hairpin 1 region; one nucleotide between the hairpin 1 and hairpin 2 region; and each nucleotide in the hairpin 2 region. In some embodiments, the trRNA further comprises one or more 2’-O-Me or 2’-O-moe modified nucleotides in the 5’ and / or 3’ terminus region, e.g. in a 5’ and / or 3’ end modification.

[00212] In some embodiments, the trRNA comprises 2’-O-Me modified nucleotides at each nucleic acid in the upper stem; each nucleotide in the bulge region; LSI, LS2, LS5, and LS6 in the lower stem region; N3- N5, N10-N18 in the nexus region; each nucleotide in the hairpin 1 region; one nucleotide between the hairpin 1 and hairpin 2 region; and each nucleotide in the hairpin 2 region. In some embodiments, the crRNA further comprises one or more 2’-O-Me or 2’-O-moe modified nucleotides in the 5’ and / or 3’ terminus region,, e.g. in a 5’ and / or 3’ end modification.

[00213] In some embodiments, the trRNA comprises 2’-F modified nucleotides at N15 through N18 in the nexus region. In some embodiments, the trRNA further comprises one or more 2’-F modified nucleotides in the 5’ and / or 3’ terminus region, e.g. in a 5’ and / or 3’ end modification.

[00214] In some embodiments, the trRNA comprises 2’-F modified nucleotides at LS4 and LS5 in the lower stem region, and N13-N18 in the nexus region. In some embodiments, the trRNA further comprises one or more 2’-F modified nucleotides in the 5’ and / or 3’ terminus region, e.g. in a 5’ and / or 3’ end modification.

[00215] In some embodiments, the trRNA comprises 2’-F modified nucleotides at LSI, LS3, and LS5 in the lower stem, and 2’-O-Me modified nucleotides at LS2, LS4, and LS6 in the lower stem.

[00216] Disclosed herein, in some embodiments, is a crispr RNA (crRNA) comprising one or more modifications within one or more of the following regions: the first five nucleotides at the 5' terminus; the lower stem region; the bulge region; the upper stem region; and the last five nucleotides at the 3' terminus. In some embodiments, the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modification comprises a 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the modification comprises a phosphorothioate (PS) bond between nucleotides. In some 2024201264   26 Feb 2024 embodiments, the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus are modified. In some embodiments, the first four nucleotides at the 5' terminus, and the last four nucleotides at the 3' terminus are linked with phosphorothioate (PS) bonds. In some embodiments, the modification comprises 2'-O-Me. In some embodiments, the modification comprises 2'-F. In some embodiments, the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked with a PS bond, and wherein the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise 2'-O-Me modifications. In some embodiments, the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked with a PS bond, and wherein the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise 2'-F modifications. In some embodiments, LSI and LS6 are modified with 2'-O-Me. In some embodiments, each of the nucleotides in the upper stem region are modified with 2'-O-Me.

[00217] In some embodiments, the invention comprises a crispr RNA (crRNA) comprising 2'-O-Me modified nucleic acids at the following nucleotides: LSI and LS6 in the lower stem region; and each nucleotide in the upper stem region. In some embodiments, the crRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus. In some embodiments, the crRNA further comprises 2'-O-Me or 2'-F modified nucleic acids at the first three nucleotides at the 5' terminus, and 2'-O-Me or 2'-F modified nucleic acids at the last three nucleotides at the 3' terminus. In some embodiments, LSI, LS2, and LS6 are modified with 2'-F. In some embodiments, each nucleotide in the bulge region is modified with 2'-F.

[00218] Disclosed herein, in some embodiments, is a crispr RNA (crRNA) comprising 2'-F modified nucleic acids at the following nucleotides: LSI, LS2, and LS6 in the lower stem region; and each nucleotide in the bulge region. In some embodiments, the crRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus. In some embodiments, the crRNA further comprises 2'-O-Me or 2'-F modified nucleic acids at the first three nucleotides at the 5' terminus, and 2'-O-Me or 2'-F modified nucleic acids at the last three nucleotides at the 3' terminus.

[00219] In some embodiments, a crRNA comprising the nucleic acids of any one of SEQ ID Nos: 1 - 187 is provided. In some embodiments, a crRNA comprising the nucleic acids of any one of SEQ ID Nos: 19-31, 53-73, 104-130, and 161-187 is provided. In some 2024201264   26 Feb 2024 embodiments, a crRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleic acids of any one of SEQ ID Nos: 19-31, 53-73, 104-130, and 161-187, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier, is provided. In some embodiments, the crRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus.

[00220] Also encompassed is a tracr RNA (trRNA) comprising one or more modifications within one or more of the following regions: the first five nucleotides at the 5' terminus; the upper stem region; the bulge region; the lower stem region; the nexus region; the hairpin 1 region; the hairpin 2 region; and the last five nucleotides at the 3' terminus. In some embodiments, the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modification comprises a 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the modification comprises a phosphorothioate (PS) bond between nucleotides. In some embodiments, the first four nucleotides at the 5' terminus, and the last four nucleotides at the 3' terminus are linked with phosphorothioate (PS) bonds. In some embodiments, the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus are modified. In some embodiments, the modification comprises 2'-O-Me. In some embodiments, the modification comprises 2'-F. In some embodiments, the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked with a PS bond, and wherein the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise 2'-O-Me modifications. In some embodiments, the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked with a PS bond, and wherein the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise 2'-F modifications. In some embodiments, each nucleotide in the upper stem region is modified with 2’-O-Me. In some embodiments, Bl and B2 within the bulge region are modified with 2’-O-Me. In some embodiments, N3, N4, N5, N15, N16, N17, and N18 in the nexus region are modified with 2’-O-Me. In some embodiments, each nucleotide in the hairpin 1 region is modified with 2’-O-Me. In some embodiments, each nucleotide in the hairpin 2 region is modified with 2’-O-Me.

[00221] In some embodiments, the invention comprises a tracr RNA (trRNA) comprising 2'-O-Me modified nucleic acids at the following nucleotides: each nucleotide in the upper stem; Bl and B2 within the bulge region; N3, N4, N5, N15, N16, N17, and N18 in 2024201264   26 Feb 2024 the nexus region; each nucleotide in the hairpin 1 region; and each nucleotide in the hairpin 2 region. In some embodiments, the trRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus. In some embodiments, the trRNA further comprises 2'-O-Me or 2'-F modified nucleotides at the first three nucleotides at the 5' terminus, and 2'-O-Me or 2'-F modified nucleic acids at the last three nucleotides at the 3' terminus. In some embodiments, N15, N16, N17, and N18 are modified with 2'-F. In some embodiments, LSI, LS3, and LS5 are modified with 2'-F, and LS2, LS4, and LS6 are modified with 2'-O-Me. In some embodiments, the trRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus. In some embodiments, the trRNA further comprises 2'-O-Me or 2'-F modified nucleic acids at the first three nucleotides at the 5' terminus, and 2'-O-Me or 2'-F modified nucleic acids at the last three nucleotides at the 3' terminus.

[00222] In some embodiments, a trRNA comprising the nucleic acids of any one of SEQ ID Nos: 188-227 is provided. In some embodiments, a trRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleic acids of any one of SEQ ID Nos: 188-227, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier, is provided. In some embodiments, the trRNA further comprises three phosphorothioate (PS) bonds linking the first four nucleotides at the 5' terminus and three PS bonds linking the last four nucleotides at the 3' terminus.

[00223] In some instances, a dual guide comprising a crRNA and a trRNA is provided, wherein the crRNA comprises the nucleic acids of any one of SEQ ID Nos: 1-187, and wherein the trRNA comprises the nucleic acids of any one of SEQ ID Nos: 188-227.

[00224] A dual guide comprising a crRNA disclosed herein and a trRNA disclosed herein is encompassed, as is a dual guide comprising a crRNA disclosed herein and an unmodified trRNA. In some embodiments, a dual guide comprising an unmodified crRNA and a modified trRNA disclosed herein is provided.

[00225] In some embodiments, and of the following are encompassed: Embodiment 55. A crispr RNA (crRNA) comprising one or more modifications within one or more of the following regions: a. the first five nucleotides at the 5’ terminus; b. the lower stem region; c. the bulge region; 2024201264   26 Feb 2024 d. the upper stem region; and e. the last five nucleotides at the 3’ terminus. Embodiment 56. The crRNA of embodiment 55, wherein the modification comprises a 2’-O-methyl (2’-O-Me) modified nucleotide. Embodiment 57. The crRNA of embodiment 55, wherein the modification comprises a 2’-fluoro (2’-F) modified nucleotide. Embodiment 58. The crRNA of embodiment 55, wherein the modification comprises a phosphorothioate (PS) bond between nucleotides. Embodiment 59. The crRNA of any one of embodiments 55-58, wherein the first three nucleotides at the 5’ terminus and the last three nucleotides at the 3’ terminus are modified. Embodiment 60. The crRNA of any one of embodiments 55-58, wherein the first four nucleotides at the 5’ terminus, and the last four nucleotides at the 3’ terminus are linked with phosphorothioate (PS) bonds. Embodiment 61. O-Me. Embodiment 62. F. Embodiment 63. The crRNA of embodiment 59, wherein the modification comprises 2’- The crRNA of embodiment 59, wherein the modification comprises 2’- The crRNA of any one of embodiments 55-62, wherein the first four nucleotides at the 5’ terminus and the last four nucleotides at the 3’terminus are linked with a PS bond, and wherein the first three nucleotides at the 5’ terminus and the last three nucleotides at the 3’ terminus comprise 2’-O-Me modifications. Embodiment 64.    The crRNA of any one of embodiments 55-62, wherein the first four nucleotides at the 5’ terminus and the last four nucleotides at the 3’terminus are linked with a PS bond, and wherein the first three nucleotides at the 5’ terminus and the last three nucleotides at the 3’ terminus comprise 2’-F modifications. Embodiment 65.    The crRNA of any one of embodiments 55-60, wherein LSI and LS6 are modified with 2’-O-Me. Embodiment 66.    The crRNA of any one of embodiments 55-60and 65, wherein each of the nucleotides in the upper stem region are modified with 2’-O-Me. Embodiment 67. A crispr RNA (crRNA) comprising 2’-O-Me modified nucleotides at: a. LSI and LS6 in the lower stem region; and b. each nucleotide in the upper stem region. 2024201264   26 Feb 2024 Embodiment 68. The crRNA of embodiment 67, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 69. The crRNA of embodiment 67 or 68, further comprising 2’-O-Me or 2’-F modified nucleotides at the first three nucleotides at the 5’ terminus, and 2’-O-Me or 2’-F modified nucleotides at the last three nucleotides at the 3’ terminus. Embodiment 70. The crRNA of any of embodiments 55-60, wherein LSI, LS2, and LS6 are modified with 2’-F. Embodiment 71. The crRNA of any of embodiments 55-60 and 70, wherein each nucleotide in the bulge region is modified with 2’-F. Embodiment 72. A crispr RNA (crRNA) comprising 2’-F modified nucleotides at: a. LSI, LS2, and LS6 in the lower stem region; and b. each nucleotide in the bulge region. Embodiment 73. The crRNA of any one of embodiments 70-72, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 74. The crRNA of embodiment 72 or 73, further comprising 2’-O-Me or 2’-F modified nucleotides at the first three nucleotides at the 5’ terminus, and 2’-O-Me or 2’-F modified nucleotides at the last three nucleotides at the 3’ terminus. Embodiment 75. A crRNA comprising the nucleic acids of any one of SEQ ID Nos: 1 -187. Embodiment 76. A crRNA comprising the nucleic acids of any one of SEQ ID Nos: 1931, 53-73, 104-130, and 161-187. Embodiment 77. A crRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleic acids of any one of SEQ ID Nos: 19-31, 53-73, 104-130, and 161-187, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier. Embodiment 78. The crRNA of any one of embodiments 75-77, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 79. A tracr RNA (trRNA) comprising one or more modifications within one or more of the following regions: a. the first five nucleotides at the 5’ terminus; b. the upper stem region; 2024201264   26 Feb 2024 c. the bulge region; d. the lower stem region; e. the nexus region; f. the hairpin 1 region; g. the hairpin 2 region; and h. the last five nucleotides at the 3’ terminus. Embodiment 80. The trRNA of embodiment 79, wherein the modification comprises 2’-O-methyl (2’-O-Me) modified nucleotide. Embodiment 81. The trRNA of embodiment 79, wherein the modification comprises 2’-fluoro (2’-F) modified nucleotide. Embodiment 82. The trRNA of embodiment 79, wherein the modification comprises phosphorothioate (PS) bond between nucleotides. Embodiment 83. The trRNA of any one of embodiments 79-82, wherein the first four nucleotides at the 5’ terminus, and the last four nucleotides at the 3’ terminus are linked with phosphorothioate (PS) bonds. Embodiment 84. The trRNA of any one of embodiments 79-82, wherein the first three nucleotides at the 5’ terminus, and the last three nucleotides at the 3’ terminus are modified. Embodiment 85. The trRNA of embodiment 84, wherein the modification comprises 2’- O-Me. Embodiment 86. The trRNA of embodiment 84, wherein the modification comprises 2’- F. Embodiment 87. The trRNA of any one of embodiments 79-86, wherein the first four nucleotides at the 5’ terminus and the last four nucleotides at the 3’terminus are linked with a PS bond, and wherein the first three nucleotides at the 5’ terminus and the last three nucleotides at the 3’ terminus comprise 2’-O-Me modifications. Embodiment 88. The trRNA of any one of embodiments 79-86, wherein the first four nucleotides at the 5’ terminus and the last four nucleotides at the 3’terminus are linked with a PS bond, and wherein the first three nucleotides at the 5’ terminus and the last three nucleotides at the 3’ terminus comprise 2’-F modifications. Embodiment 89. The trRNA of any one of embodiments 79-84, wherein each nucleotide in the upper stem region is modified with 2’-O-Me. Embodiment 90. The trRNA of any one of embodiments 79-84 and 89, wherein Bl and B2 within the bulge region are modified with 2’-O-Me. 2024201264   26 Feb 2024 Embodiment 91. The trRNA of any one of embodiments 79-84 and 89-90, wherein N3, N4, N5, N15, N16, N17, andN18 in the nexus region are modified with 2’-O-Me. Embodiment 92. The trRNA of any one of embodiments 79-84 and 89-91, wherein each nucleotide in the hairpin 1 region is modified with 2’-O-Me. Embodiment 93. The trRNA of any one of embodiments 79-84 and 89-92, wherein each nucleotide in the hairpin 2 region is modified with 2’-O-Me. Embodiment 94. A tracr RNA (trRNA) comprising 2’-O-Me modified nucleotides at: a. each nucleotide in the upper stem; b. Bl and B2 within the bulge region; c. N3, N4, N5, N15, N16, N17, andN18 in the nexus region; d. each nucleotide in the hairpin 1 region; and e. each nucleotide in the hairpin 2 region. Embodiment 95. The trRNA of embodiment 94, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 96.    The crRNA of embodiment 94 or 95, further comprising 2’-O-Me or 2’-F modified nucleotides at the first three nucleotides at the 5’ terminus, and 2’-O-Me or 2’-F modified nucleic acids at the last three nucleotides at the 3’ terminus. Embodiment 97. The trRNA of any of embodiments 79-84, wherein N15, N16, N17, and N18 are modified with 2’-F. Embodiment 98. The trRNA of any of embodiments 79-84 and 97, wherein LSI, LS3, and LS5 are modified with 2’-F, and LS2, LS4, and LS6 are modified with 2’-O-Me. Embodiment 99. The trRNA of any one of embodiments 87-98, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 100. The trRNA of embodiment 98 or 99, further comprising 2’-O-Me or 2’-F modified nucleotides at the first three nucleotides at the 5’ terminus, and 2’-O-Me or 2’-F modified nucleotides at the last three nucleotides at the 3’ terminus. Embodiment 101. A trRNA comprising the nucleic acids of any one of SEQ ID Nos: 188227. Embodiment 102. A trRNA comprising nucleic acids having at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to the nucleic acids of any one of SEQ ID Nos: 188-227, wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier. 2024201264   26 Feb 2024 Embodiment 103. The trRNA of any one of embodiments 101 - 102, further comprising three phosphorothioate (PS) bonds linking the first four nucleotides at the 5’ terminus and three PS bonds linking the last four nucleotides at the 3’ terminus. Embodiment 104. A dual guide comprising a crRNA and a trRNA, wherein the crRNA comprises the nucleotides of any one of SEQ ID Nos: 1-187, and wherein the trRNA comprises the nucleic acids of any one of SEQ ID Nos: 188-227. Embodiment 105. A dual guide comprising a crRNA of any one of embodiments 55-78 and a trRNA of any one of embodiments 79-103. Embodiment 106. A dual guide comprising a crRNA of any one of embodiments 55-78 and an unmodified trRNA. Embodiment 107. A dual guide comprising an unmodified crRNA and a trRNA of any one of embodiments 79-103. C. Modifications to terminal nucleotides

[00226] In some embodiments, the 5’ or 3’ terminal nucleotides of any of the guide RNAs described herein are modified. In some embodiments, the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in 3’ terminus region of guide RNA, including, for example, the sgRNA, the dgRNA, the crRNA, trRNA, or both crRNA and trRNA are modified. In some embodiments, the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in 3’ terminus region of guide RNA comprise more than one modification. In some embodiments, at least one of the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 3’ terminus region are modified. In some embodiments, at least two of the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in 3’ terminus region are modified. In some embodiments, at least three of the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in 3’ terminus region are modified, some embodiments, the modification comprises a PS linkage.

[00227] In some embodiments, the 5’ end of the 5’ terminus region is modified, for example, the first 1, 2, 3, 4, 5, 6, or 7 nucleotides of the sgRNA, the dgRNA, crRNA, trRNA, or both crRNA and trRNA are modified. In some embodiments, the first 1, 2, 3, 4, 5, 6, or 7 nucleotides in 3’ terminus region of guide RNA comprise more than one modification. In some embodiments, at least one of the terminal (i.e., first) 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5’ end are modified. In some embodiments, at least two of the terminal 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5’ end are modified. In some embodiments, at least three of the terminal 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5’ end are modified, some embodiments, the modification comprises a PS linkage. 2024201264   26 Feb 2024

[00228] In some embodiments, both the 5’ and 3’ termini (e.g., ends) of the guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA are modified. In some embodiments, only the 5’ terminus of the guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA is modified. In some embodiments, only the 3’ terminus of the guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA is modified.

[00229] In some embodiments, the gRNA comprises modifications at 1, 2, 3, 4, 5, 6, or 7 of the first 7 nucleotides at a 5’ end of the gRNA. In some embodiments, the gRNA comprises modifications at 1, 2, 3, 4, 5, 6, or 7 of the 7 terminal nucleotides at a 3’ end. In some embodiments, 2, 3, or 4 of the first 4 nucleotides at the 5' end, and / or 2, 3, or 4 of the terminal 4 nucleotides at the 3' end are modified. In some embodiments, 2, 3, or 4 of the first 4 nucleotides at the 5' end are linked with phosphorothioate (PS) bonds.

[00230] In some embodiments, the modification to the 5’ terminus and / or 3’ terminus comprises a 2’-O-methyl (2’-O-Me) or 2’-O-(2-methoxyethyl) (2’-O-moe) modification to a nucleotide. In some embodiments, the modification comprises a2’-fluoro (2’-F) modification to a nucleotide. In some embodiments, the modification comprises a phosphorothioate (PS) linkage between nucleotides. In some embodiments, the modification comprises an inverted abasic nucleotide. In some embodiments, the modification comprises a more than one modification selected from 2’-O-Me, 2’-O-moe, 2’-fluoro (2’-F), a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic nucleotide. In some embodiments, an equivalent modification is encompassed.

[00231] In some embodiments, the guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA comprises one or more phosphorothioate (PS) linkages between the first one, two, three, four, five, six, or seven nucleotides at the 5’ terminus. In some embodiments, the guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA comprises one or more PS linkages between the last one, two, three, four, five, six, or seven nucleotides at the 3’ terminus. In some embodiments, the guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA comprises one or more PS linkages between the last one, two, three, four, five, six, or seven nucleotides at both the 5’ terminus and the 3’ terminus. In some embodiments, in addition to PS linkages, the 5’ and 3’ terminal nucleotides may comprise 2’-O-Me, 2’-O-moe, or 2’-F modified nucleotides.

[00232] In some embodiments, the guide RNA, e.g., sgRNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA comprises modified nucleotides at the 5’ and 3’ terminus, and 2024201264   26 Feb 2024 modified nucleotides in one or more other regions described in Tables 1-3 and FIG 21A or 21C.

[00233] In some embodiments, the crRNA, trRNA, or both crRNA and trRNA comprises modified nucleotides that are not at the 5’ or 3’ ends. Specific patterns of modifications are described below and in Table 4. 3. Delivery of gRNAs and Cas Protein

[00234] In some embodiments, in addition to the at least one gRNA, the compositions provided herein further comprise a nuclease. In some embodiments, the nuclease is a Cas protein. In some embodiments, the gRNA together with a Cas protein is called a Cas RNP. In some embodiments, the Cas protein is from the Type-II CRISPR / Cas system. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas9 protein is a wild type Cas9. In some embodiments, the Cas9 protein is derived from the Streptococcus pyogenes Cas9 protein, e.g., a S. pyogenes Cas9. In some embodiments, the Cas9 protein is not derived from S. pyogenes, but functions in the same way as S. pyogenes Cas9 such that gRNA that is specific to S. pyogenes Cas9 will direct the non-S. pyogenes Cas9 to its target site. In some embodiments, the Cas induces a double strand break in target DNA. Equivalents of S. pyogenes Cas9 protein are encompassed by the embodiments described herein.

[00235] Cas9 encompasses modified and variants thereof. Modified versions of Cas9 having one catalytic domain, either RuvC or HNH, that is inactive are termed “nickases.” Nickases cut only one strand on the target DNA, thus creating a single-strand break. A singlestrand break may also be known as a “nick.” In some embodiments, the compositions and methods comprise nickases. In some embodiments, the compositions and methods comprise a nickase Cas9 that induces a nick rather than a double strand break in the target DNA.

[00236] In some embodiments, the Cas protein may be modified to contain only one functional nuclease domain. For example, the Cas protein may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, a nickase Cas is used having a RuvC domain with reduced activity. In some embodiments, a nickase Cas is used having an inactive RuvC domain. In some embodiments, a nickase Cas is used having an HNH domain with reduced activity. In some embodiments, a nickase Cas is used having an inactive HNH domain.

[00237] In some embodiments, a conserved amino acid within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity. In some embodiments, a Cas protein 2024201264   26 Feb 2024 may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). In some embodiments, the Cas protein may comprise an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein).

[00238] In some embodiments, the RNP complex described herein comprises a nickase and a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to a target sequence and introduce a double stranded break (DSB) by generating a nick on opposite strands of the target sequence (i.e., double nicking). In some embodiments, use of double nicking may improve specificity and reduce off-target effects. In some embodiments, a nickase Cas is used together with two separate guide RNAs targeting opposite strands of DNA to produce a double nick in the target DNA. In some embodiments, a nickase Cas is used together with two separate guide RNAs that are selected to be in close proximity to produce a double nick in the target DNA.

[00239] In some embodiments, chimeric Cas proteins are used, where one domain or region of the protein is replaced by a portion of a different protein. In some embodiments, a Cas nuclease domain may be replaced with a domain from a different nuclease such as Fokl. In some embodiments, a Cas protein may be a modified nuclease.

[00240] In some embodiments, the Cas protein comprises a fusion protein comprising a catalytically inactive Cas9 linked to a heterologous functional domain (see, e.g., WO2014152432). In some embodiments, the catalytically inactive Cas9 is from S. pyogenes. In some embodiments, the catalytically inactive Cas9 comprises mutations that inactivate the Cas9. In some embodiments, the heterologous functional domain is a domain that modifies gene expression, histones, or DNA. In some embodiments, the heterologous functional domain is a transcriptional activation domain or a transcriptional repressor domain. A. PAM

[00241] In some embodiments, the target sequence may be adjacent to the PAM. In some embodiments, the PAM may be adjacent to or within 1, 2, 3, or 4, nucleotides of the 3' end of the target sequence. The length and the sequence of the PAM may depend on the Cas protein used. For example, the PAM may be selected from a consensus or a particular PAM sequence for a specific Cas9 protein or Cas9 ortholog, including those disclosed in Figure 1 2024201264   26 Feb 2024 of Ran et al., Nature 520:186-191 (2015), which is incorporated herein by reference. In some embodiments, the PAM may comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Nonlimiting exemplary PAM sequences include NGG, NAG, NGA, NGAG, NGCG, NNGRRT, TTN, NGGNG, NG, NAAAAN, NNAAAAW, NNNNACA, GNNNCNNA, and NNNNGATT (wherein N is defined as any nucleotide, and W is defined as either A or T, and R is defined as either A or G). In some embodiments, the PAM sequence may be NGG. In some embodiments, the PAM sequence may be NGGNG. In some embodiments, the PAM sequence may be NNAAAAW. B. Delivery of Modified gRNA

[00242] Lipid nanoparticles (LNPs) are a well-known means for delivery of nucleotide and protein cargo, and may be used for delivery of the gRNA, mRNA, Cas9, and RNPs disclosed herein. In some embodiments, the LNPs deliver nucleic acid, protein, or nucleic acid together with protein.

[00243] In some embodiments, the invention comprises a method for delivering any one of the gRNAs disclosed herein to a subject, wherein the gRNA is associated with an LNP. In some embodiments, the gRNA / LNP is also associated with a Cas9 or an mRNA encoding Cas9.

[00244] In some embodiments, the invention comprises a composition comprising any one of the gRNAs disclosed and an LNP. In some embodiments, the composition further comprises a Cas9 or an mRNA encoding Cas9.

[00245] In some embodiments, the LNPs comprise cationic lipids. In some embodiments, the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate). In some embodiments, the LNPs comprise molar ratios of a cationic lipid amine to RNA phosphate (N:P) of about 4.5.

[00246] In some embodiments, LNPs associated with the gRNAs disclosed herein are for use in preparing a medicament for treating a disease or disorder.

[00247] Electroporation is a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver any one of the gRNAs disclosed herein and Cas9 or an mRNA encoding Cas9. 2024201264   26 Feb 2024

[00248] In some embodiments, the invention comprises a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is associated with an LNP or not associated with an LNP. In some embodiments, the gRNA / LNP or gRNA is also associated with a Cas9 or an mRNA encoding Cas9. 4. Methods of Gene Modulation

[00249] In some embodiments, the invention comprises a pharmaceutical formulation comprising any one of the gRNAs disclosed herein together with a pharmaceutically acceptable carrier. In some embodiments, the invention comprises a pharmaceutical formulation comprising any one of the gRNAs disclosed herein and an LNP together with a pharmaceutically acceptable carrier. In some embodiments, the invention comprises a pharmaceutical formulation comprising any one of the gRNAs disclosed herein, a Cas9 protein or an mRNA encoding a Cas9 protein, and a LNP together with a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical formulation is for use in preparing a medicament for treating a disease or disorder. In some embodiments, the invention comprises a method of treating a human patient comprising administering any one of the gRNAs or pharmaceutical formulations described herein.

[00250] In some embodiments, the invention comprises a method or use of modifying a target DNA comprising, administering or delivering a Cas protein or Cas mRNA and any one or more of the gRNAs disclosed herein.

[00251] In some embodiments, the invention comprises a method or use for modulation of a target gene comprising, administering or delivering a Cas protein or Cas mRNA and any one or more of the gRNAs disclosed herein. In some embodiments, the modulation is editing of the target gene. In some embodiments, the modulation is a change in expression of the protein encoded by the target gene.

[00252] In some embodiments, the method or use results in gene editing. In some embodiments, the method or use results in a double-stranded break within the target gene. In some embodiments, the method or use results in formation of indel mutations during non-homologous end joining of the DSB. In some embodiments, the method or use results in an insertion or deletion of nucleotides in a target gene. In some embodiments, the insertion or deletion of nucleotides in a target gene leads to a frameshift mutation or premature stop codon that results in a non-functional protein. In some embodiments, the insertion or deletion of nucleotides in a target gene leads to a knockdown or elimination of target gene expression. In some embodiments, the method or use comprises homology directed repair of a DSB. In 2024201264   26 Feb 2024 some embodiments, the method or use further comprises delivering to the cell a template, wherein at least a part of the template incorporates into a target DNA at or near a double strand break site induced by the Cas protein.

[00253] In some embodiments, the method or use results in gene modulation. In some embodiments, the gene modulation is an increase or decrease in gene expression, a change in methylation state of DNA, or modification of ahistone subunit. In some embodiments, the method or use results in increased or decreased expression of the protein encoded by the target gene.

[00254] In some embodiments, any of the gRNAs disclosed herein may be useful in preparing a medicament for treating a disease or disorder. A. Measures of Gene Modulation

[00255] The efficacy of modified gRNAs can be tested in vitro and in vivo. In some embodiments, the invention comprises one or more of the gRNAs disclosed herein, wherein the gRNA results in gene modulation when provided to a cell together with Cas9. In some embodiments, the efficacy of gRNA can be measured in in vitro or in vivo assays. 1. In vitro measurement of Cas efficacy

[00256] In some embodiments, the activity of a Cas RNP comprising a modified sgRNA is compared to the activity of a Cas RNP comprising an unmodified sgRNA.

[00257] In some embodiments, the activity of a Cas RNP comprising a dgRNA comprising a modified trRNA is compared to the activity of a Cas RNP comprising a dgRNA comprising an unmodified trRNA.

[00258] In some embodiments, the activity of a Cas RNP comprising a dgRNA comprising a modified crRNA is compared to the activity of a Cas RNP comprising a dgRNA comprising an unmodified crRNA.

[00259] In some embodiments, the activity of a Cas RNP comprising a dgRNA comprising a modified crRNA and a modified trRNA is compared to the activity of a Cas RNP comprising an unmodified crRNA and an unmodified trRNA.

[00260] In some embodiments, the efficiency of a gRNA in increasing or decreasing target protein expression is determined by measuring the amount of target protein. In some embodiments, the invention comprises any one of the gRNAs described herein, wherein the gRNA increases or decreases the amount of protein produced from the targeted gene. In some embodiments, the invention comprises a method of modulating protein expression 2024201264   26 Feb 2024 comprising administering any one of the gRNAs disclosed herein to a subject, wherein the gRNA directs Cas9 to the gene encoding the target protein, and the target protein expression is increased or decreased as compared to a gRNA control that does not target Cas9 to that gene.

[00261] In some embodiments, the efficiency of editing with specific gRNAs is determined by the editing present at the target location in the genome following delivery of Cas9 and the gRNA (either sgRNA or dgRNA comprising a crRNA and trRNA). In some embodiments, the efficiency of editing with specific gRNAs is measured by next-generation sequencing. In some embodiments, the editing percentage of the target region of interest is determined. In some embodiments, the total number of sequence reads with insertions or deletions of nucleotides into the target region of interest over the total number of sequence reads is measured following delivery of a gRNA and Cas9. In some embodiments, the invention comprises a method of increasing the efficiency of gene editing comprising, administering or delivering any one of the modified gRNAs described herein to a cell, wherein the percentage of gene editing is increased as compared to a control gRNA that is not similarly modified.

[00262] In some embodiments, the efficiency of editing with specific gRNAs is measured by the presence of insertions or deletions of nucleotides introduced by successful gene editing. In some embodiments, the invention comprises a method of creating insertions or deletions of nucleotides in genes comprising, administering or delivering any one of the modified gRNAs described herein to a cell, wherein the nucleotides are inserted or deleted as compared to a control gRNA that is not similarly modified. In some embodiments, activity of a Cas9 and gRNAs is tested in biochemical assays. In some embodiments, activity of a Cas9 and gRNAs is tested in a cell-free cleavage assay. In some embodiments, activity of a Cas9 and gRNAs is tested in Neuro2A cells.

[00263] In some embodiments, Cas 9 and sgRNA or dgRNA comprising modified crRNA and / or trRNA shows similar, greater, or reduced activity compared to the unmodified sgRNA or dgRNA comprising unmodified crRNA and trRNA. In some embodiments, Cas9 and modified sgRNA or dgRNA comprising modified crRNA and / or trRNA shows enhanced activity compared to the unmodified sgRNA or dgRNA comprising unmodified crRNA and trRNA. 2024201264   26 Feb 2024 2. In vivo measurement of Cas efficacy

[00264] In some embodiments, the activity of modified gRNAs is measured after in vivo dosing of LNPs comprising modified gRNAs and Cas protein or mRNA encoding Cas protein.

[00265] In some embodiments, in vivo efficacy of a gRNA or composition provided herein is determined by editing efficacy measured in DNA extracted from tissue (e.g., liver tissue) after administration of gRNA and Cas9. 3. In vivo measurement of immune system activation

[00266] Modifications to gRNA as disclosed herein may reduce the subject’s immune response to in vivo dosing of gRNAs. In some embodiments, activation of the subject’s immune response is measured by serum concentrations of cytokine(s) following in vivo dosing of sgRNA or dgRNA comprising trRNA and crRNA together with Cas9 mRNA or protein (e.g., formulated in a LNP). In some embodiments, the cytokine is interferon-alpha (IFN-alpha), interleukin 6 (IL-6), monocyte chemotactic protein 1 (MCP-1), and / or tumor necrosis factor alpha (TNF-alpha). In some embodiments, the invention comprises a method of reducing a subject’s immune response to delivery of a gRNA comprising, administering any one of the gRNAs disclosed herein, wherein the gRNA produces a reduced response by the subject’s immune system following administration. In some embodiments, the invention comprises a method of reducing activation of the subject’s immune system following administration as compared to a control gRNA that is not similarly modified.

[00267] In some embodiments, administration of Cas RNP or Cas9 mRNA together with the modified gRNA (e.g., sgRNA or dgRNA) produces lower serum concentration(s) of immune cytokines compared to administration of unmodified sgRNA. In some embodiments, the invention comprises a method of reducing a subject’s serum concentration of immune cytokines comprising, administering any one of the gRNAs disclosed herein, wherein the gRNA produces a lower concentration of immune cytokines in a subject’s serum as compared to a control gRNA that is not similarly modified.

[00268] This description and exemplary embodiments should not be taken as limiting. For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing quantities, percentages, or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about,” to the extent they are not already so modified. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached 2024201264   26 Feb 2024 claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[00269] It is noted that, as used in this specification and the appended claims, the singular forms “a,” “an,” and “the,” and any singular use of any word, include plural referents unless expressly and unequivocally limited to one referent. As used herein, the term “include” and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items. EXAMPLES

[00270] The following examples are provided to illustrate certain disclosed embodiments and are not to be construed as limiting the scope of this disclosure in any way. Example 1 - Materials and Methods A. Synthetic guide RNA (gRNA)

[00271] gRNA in both dual (dgRNA, i.e., crRNA and trRNA) and single guide (sgRNA) format were chemically synthesized by commercial vendors with modified nucleotides and linkages as provided in Table 4. B. In vitro transcription (“IVT”) of Cas9 mRNA

[00272] Capped and poly adenylated Cas9 mRNA containing N1 -methyl pseudo-U was generated by in vitro transcription using a linearized plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing a T7 promoter and a 100 nucleotide (nt) poly(A / T) region was linearized by Xbal and obtained from a commercial manufacturer. The IVT reaction to generate Cas9 modified mRNA was incubated at 37 °C for 4 hours in the following conditions: 50 ng / pL linearized plasmid; 2 mM each of GTP, ATP, CTP, and Nl-methyl pseudo-UTP (Trilink); 10 mM ARCA (Trilink); 5 U / pL T7 RNA polymerase (NEB); 1 U / pL Murine RNase inhibitor (NEB); 0.004 U / pL Inorganic E. coli pyrophosphatase (NEB); and lx reaction buffer. After the 4 hr incubation, TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / pL, and the reaction was incubated for an additional 30 minutes to remove the DNA template. The Cas9 mRNA was purified from enzyme and nucleotides using standard protocols, including silica binding columns such as a 2024201264   26 Feb 2024 MegaClear Transcription Clean-up kit (ThermoFisher) or precipitation steps using LiCl followed by EtOH with NaOAc. The transcript concentration was determined by measuring the light absorbance at 260 nm (Nanodrop), and the transcript was analyzed by capillary electrophoresis by Bioanlayzer (Agilent). C. Cas9 mRNA and gRNA Transfections in Neuro2A Cells

[00273] The mouse cell line Neuro2A was cultured in DMEM media supplemented with 10% fetal bovine serum and was plated at a density of 15,000 cells / well in a 96-well plate 24 hours prior to transfection. On the day of transfection, the media was aspirated from cells and replaced with fresh media. Lipofectamine-2000 (Invitrogen) was diluted 1:50 (v / v) in Opti-MEM (Invitrogen). Cas9 mRNA and single guide RNA were diluted separately in Opti-MEM. For the dual guide format, crRNA and trRNA were diluted together in 1:1 molar ratio in Opti-MEM. Both Cas9 mRNA and gRNA were mixed separately 1:1 (v / v) with diluted Lipofectamine-2000, producing two lipoplexes. After 5 minutes of incubation, lipoplexes were added in succession to cells, for a final concentration of 100 ng Cas9 mRNA / well and 0.4 pL total lipofection reagent. Guides were tested at two dose levels for each experiment, including 25 nM and 2.5 nM, 16.7 nM and 1.67 nM, 10 nM and 1 nM, 8.3 nM and 0.83 nM, and 3 nM and 0.3 nM. For dual guide, this concentration includes equimolar amounts of crRNA and trRNA, such that, for example, 25 nM crRNA and 25 nM trRNA produce 25 nM total dual guide. Cells were lysed 24 hours post transfection, and lysates were used directly in the PCR reaction that was analyzed for editing by NGS.

[00274] Cas9 mRNA with IxNLS (SEQ ID NO: 359): GGGUCCCGCAGUCGGCGUCCAGCGGCUCUGCUUGUUCGUGUGUGUGUCGUUGCAGGC CUUAUUCGGAUCCAUGGAUAAGAAGUACUCAAUCGGGCUGGAUAUCGGAACUAAUUC CGUGGGUUGGGCAGUGAUCACGGAUGAAUACAAAGUGCCGUCCAAGAAGUUCAAGGU CCUGGGGAACACCGAUAGACACAGCAUCAAGAAAAAUCUCAUCGGAGCCCUGCUGUU UGACUCCGGCGAAACCGCAGAAGCGACCCGGCUCAAACGUACCGCGAGGCGACGCUA CACCCGGCGGAAGAAUCGCAUCUGCUAUCUGCAAGAGAUCUUUUCGAACGAAAUGGC AAAGGUCGACGACAGCUUCUUCCACCGCCUGGAAGAAUCUUUCCUGGUGGAGGAGGA CAAGAAGCAUGAACGGCAUCCUAUCUUUGGAAACAUCGUCGACGAAGUGGCGUACCA C GAAAAGUAC C C GAG GAU CUAC CAUCU GC GGAAGAAGUU GGUU GACU CAACU GACAA GGCCGACCUCAGAUUGAUCUACUUGGCCCUCGCCCAUAUGAUCAAAUUCCGCGGACA CUUCCUGAUCGAAGGCGAUCUGAACCCUGAUAACUCCGACGUGGAUAAGCUUUUCAU UCAACUGGUGCAGACCUACAACCAACUGUUCGAAGAAAACCCAAUCAAUGCUAGCGG CGUCGAUGCCAAGGCCAUCCUGUCCGCCCGGCUGUCGAAGUCGCGGCGCCUCGAAAA CCUGAUCGCACAGCUGCCGGGAGAGAAAAAGAACGGACUUUUCGGCAACUUGAUCGC UCUCUCACUGGGACUCACUCCCAAUUUCAAGUCCAAUUUUGACCUGGCCGAGGACGC GAAGCUGCAACUCUCAAAGGACACCUACGACGACGACUUGGACAAUUUGCUGGCACA AAUUGGCGAUCAGUACGCGGAUCUGUUCCUUGCCGCUAAGAACCUUUCGGACGCAAU CUUGCUGUCCGAUAUCCUGCGCGUGAACACCGAAAUAACCAAAGCGCCGCUUAGCGC CUCGAUGAUUAAGCGGUACGACGAGCAUCACCAGGAUCUCACGCUGCUCAAAGCGCU 2024201264   26 Feb 2024 C GU GAGACAGCAACU GCCU GAAAAGUACAAGGAGAU CUU CUU C GAG CAGU C CAAGAA UGGGUACGCAGGGUACAUCGAUGGAGGCGCUAGCCAGGAAGAGUUCUAUAAGUUCAU CAAGCCAAUCCUGGAAAAGAUGGACGGAACCGAAGAACUGCUGGUCAAGCUGAACAG GGAGGAUCUGCUCCGGAAACAGAGAACCUUUGACAACGGAUCCAUUCCCCACCAGAU CCAUCUGGGUGAGCUGCACGCCAUCUUGCGGCGCCAGGAGGACUUUUACCCAUUCCU CAAGGACAACCGGGAAAAGAUCGAGAAAAUUCUGACGUUCCGCAUCCCGUAUUACGU GGGCCCACUGGCGCGCGGCAAUUCGCGCUUCGCGUGGAUGACUAGAAAAUCAGAGGA AACCAUCACUCCUUGGAAUUUCGAGGAAGUUGUGGAUAAGGGAGCUUCGGCACAAAG CUU CAU C GAAC GAAU GAC CAACUU CGACAAGAAU CU C C CAAAC GAGAAGGU GCUU C C UAAGCACAGC CUCCUUUAC GAAUACUU CACU GUCUACAAC GAACU GACUAAAGU GAA AUACGUUACUGAAGGAAUGAGGAAGCCGGCCUUUCUGUCCGGAGAACAGAAGAAAGC AAUU GU C GAU CU GCU GUU CAAGAC CAAC C GCAAGGU GAC C GU CAAGCAGCUUAAAGA GGACUACUUCAAGAAGAUCGAGUGUUUCGACUCAGUGGAAAUCAGCGGGGUGGAGGA CAGAUUCAACGCUUCGCUGGGAACCUAUCAUGAUCUCCUGAAGAUCAUCAAGGACAA GGACUUCCUUGACAACGAGGAGAACGAGGACAUCCUGGAAGAUAUCGUCCUGACCUU GACCCUUUUCGAGGAUCGCGAGAUGAUCGAGGAGAGGCUUAAGACCUACGCUCAUCU CUUCGACGAUAAGGUCAUGAAACAACUCAAGCGCCGCCGGUACACUGGUUGGGGCCG CCUCUCCCGCAAGCUGAUCAACGGUAUUCGCGAUAAACAGAGCGGUAAAACUAUCCU GGAUUUCCUCAAAUCGGAUGGCUUCGCUAAUCGUAACUUCAUGCAAUUGAUCCACGA CGACAGCCUGACCUUUAAGGAGGACAUCCAAAAAGCACAAGUGUCCGGACAGGGAGA CUCACUCCAUGAACACAUCGCGAAUCUGGCCGGUUCGCCGGCGAUUAAGAAGGGAAU UCUGCAAACUGUGAAGGUGGUCGACGAGCUGGUGAAGGUCAUGGGACGGCACAAACC GGAGAAUAUCGUGAUUGAAAUGGCCCGAGAAAACCAGACUACCCAGAAGGGCCAGAA AAACUCCCGCGAAAGGAUGAAGCGGAUCGAAGAAGGAAUCAAGGAGCUGGGCAGCCA GAUCCUGAAAGAGCACCCGGUGGAAAACACGCAGCUGCAGAACGAGAAGCUCUACCU GUACUAUUUGCAAAAUGGACGGGACAUGUACGUGGACCAAGAGCUGGACAUCAAUCG GUU GUCU GAUUAC GAC GU GGAC CACAU C GUU C CACAGU C CUUU CU GAAGGAU GACU C GAU C GAUAACAAGGU GUU GACU C GCAGC GACAAGAACAGAGGGAAGU CAGAUAAU GU GCCAUCGGAGGAGGUCGUGAAGAAGAUGAAGAAUUACUGGCGGCAGCUCCUGAAUGC GAAGCUGAUUACCCAGAGAAAGUUUGACAAUCUCACUAAAGCCGAGCGCGGCGGACU CUCAGAGCUGGAUAAGGCUGGAUUCAUCAAACGGCAGCUGGUCGAGACUCGGCAGAU UACCAAGCACGUGGCGCAGAUCUUGGACUCCCGCAUGAACACUAAAUACGACGAGAA CGAUAAGCUCAUCCGGGAAGUGAAGGUGAUUACCCUGAAAAGCAAACUUGUGUCGGA CUUU C GGAAGGACUUU CAGUUUUACAAAGU GAGAGAAAU CAACAACUACCAU CAC GC GCAUGACGCAUACCUCAACGCUGUGGUCGGUACCGCCCUGAUCAAAAAGUACCCUAA ACUUGAAUCGGAGUUUGUGUACGGAGACUACAAGGUCUACGACGUGAGGAAGAUGAU AGCCAAGUCCGAACAGGAAAUCGGGAAAGCAACUGCGAAAUACUUCUUUUACUCAAA CAUCAUGAACUUUUUCAAGACUGAAAUUACGCUGGCCAAUGGAGAAAUCAGGAAGAG GCCACUGAUCGAAACUAACGGAGAAACGGGCGAAAUCGUGUGGGACAAGGGCAGGGA CUUCGCAACUGUUCGCAAAGUGCUCUCUAUGCCGCAAGUCAAUAUUGUGAAGAAAAC CGAAGUGCAAACCGGCGGAUUUUCAAAGGAAUCGAUCCUCCCAAAGAGAAAUAGCGA CAAGCUCAUUGCACGCAAGAAAGACUGGGACCCGAAGAAGUACGGAGGAUUCGAUUC GCCGACUGUCGCAUACUCCGUCCUCGUGGUGGCCAAGGUGGAGAAGGGAAAGAGCAA AAAGCUCAAAUCCGUCAAAGAGCUGCUGGGGAUUACCAUCAUGGAACGAUCCUCGUU CGAGAAGAACCCGAUUGAUUUCCUCGAGGCGAAGGGUUACAAGGAGGUGAAGAAGGA UCUGAUCAUCAAACUCCCCAAGUACUCACUGUUCGAACUGGAAAAUGGUCGGAAGCG CAUGCUGGCUUCGGCCGGAGAACUCCAAAAAGGAAAUGAGCUGGCCUUGCCUAGCAA GUACGUCAACUUCCUCUAUCUUGCUUCGCACUACGAAAAACUCAAAGGGUCACCGGA AGAUAACGAACAGAAGCAGCUUUUCGUGGAGCAGCACAAGCAUUAUCUGGAUGAAAU CAUCGAACAAAUCUCCGAGUUUUCAAAGCGCGUGAUCCUCGCCGACGCCAACCUCGA CAAAGUCCUGUCGGCCUACAAUAAGCAUAGAGAUAAGCCGAUCAGAGAACAGGCCGA GAACAUUAUCCACUUGUUCACCCUGACUAACCUGGGAGCCCCAGCCGCCUUCAAGUA CUUCGAUACUACUAUCGAUCGCAAAAGAUACACGUCCACCAAGGAAGUUCUGGACGC GACCCUGAUCCACCAAAGCAUCACUGGACUCUACGAAACUAGGAUCGAUCUGUCGCA GCUGGGUGGCGAUGGCGGUGGAUCUCCGAAAAAGAAGAGAAAGGUGUAAUGAGCUAG CCAUCACAUUUAAAAGCAUCUCAGCCUACCAUGAGAAUAAGAGAAAGAAAAUGAAGA 2024201264   26 Feb 2024

[00275] U CAAUAGCUUAUU CAU CUCUUUUUCUUUUUC GUU GGU GUAAAGC CAACAC C CU GU CU AAAAAACAUAAAUUU CUUUAAU CAUUUU GC CU CUUUUCUCUGUGCUU CAAUUAAUAA AAAAU GGAAAGAAC CU CGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAUCUAG Cas9 mRNA with 2xNLS and HA tag (SEQ ID NO: 360): GGGUCCCGCAGUCGGCGUCCAGCGGCUCUGCUUGUUCGUGUGUGUGUCGUUGCAGGC CUUAUUCGGAUCCAUGGAUAAGAAGUACUCAAUCGGGCUGGAUAUCGGAACUAAUUC CGUGGGUUGGGCAGUGAUCACGGAUGAAUACAAAGUGCCGUCCAAGAAGUUCAAGGU CCUGGGGAACACCGAUAGACACAGCAUCAAGAAAAAUCUCAUCGGAGCCCUGCUGUU UGACUCCGGCGAAACCGCAGAAGCGACCCGGCUCAAACGUACCGCGAGGCGACGCUA CACCCGGCGGAAGAAUCGCAUCUGCUAUCUGCAAGAGAUCUUUUCGAACGAAAUGGC AAAGGUCGACGACAGCUUCUUCCACCGCCUGGAAGAAUCUUUCCUGGUGGAGGAGGA CAAGAAGCAUGAACGGCAUCCUAUCUUUGGAAACAUCGUCGACGAAGUGGCGUACCA C GAAAAGUAC C C GAC CAU CUAC CAUCU GC GGAAGAAGUU GGUU GACU CAACU GACAA GGCCGACCUCAGAUUGAUCUACUUGGCCCUCGCCCAUAUGAUCAAAUUCCGCGGACA CUUCCUGAUCGAAGGCGAUCUGAACCCUGAUAACUCCGACGUGGAUAAGCUUUUCAU UCAACUGGUGCAGACCUACAACCAACUGUUCGAAGAAAACCCAAUCAAUGCUAGCGG CGUCGAUGCCAAGGCCAUCCUGUCCGCCCGGCUGUCGAAGUCGCGGCGCCUCGAAAA CCUGAUCGCACAGCUGCCGGGAGAGAAAAAGAACGGACUUUUCGGCAACUUGAUCGC UCUCUCACUGGGACUCACUCCCAAUUUCAAGUCCAAUUUUGACCUGGCCGAGGACGC GAAGCUGCAACUCUCAAAGGACACCUACGACGACGACUUGGACAAUUUGCUGGCACA AAUUGGCGAUCAGUACGCGGAUCUGUUCCUUGCCGCUAAGAACCUUUCGGACGCAAU CUUGCUGUCCGAUAUCCUGCGCGUGAACACCGAAAUAACCAAAGCGCCGCUUAGCGC CUCGAUGAUUAAGCGGUACGACGAGCAUCACCAGGAUCUCACGCUGCUCAAAGCGCU C GU GAGACAGCAACU GCCU GAAAAGUACAAGGAGAU CUU CUU C GAC CAGU C CAAGAA UGGGUACGCAGGGUACAUCGAUGGAGGCGCUAGCCAGGAAGAGUUCUAUAAGUUCAU CAAGCCAAUCCUGGAAAAGAUGGACGGAACCGAAGAACUGCUGGUCAAGCUGAACAG GGAGGAUCUGCUCCGGAAACAGAGAACCUUUGACAACGGAUCCAUUCCCCACCAGAU CCAUCUGGGUGAGCUGCACGCCAUCUUGCGGCGCCAGGAGGACUUUUACCCAUUCCU CAAGGACAACCGGGAAAAGAUCGAGAAAAUUCUGACGUUCCGCAUCCCGUAUUACGU GGGCCCACUGGCGCGCGGCAAUUCGCGCUUCGCGUGGAUGACUAGAAAAUCAGAGGA AACCAUCACUCCUUGGAAUUUCGAGGAAGUUGUGGAUAAGGGAGCUUCGGCACAAAG CUU CAU C GAAC GAAU GAC CAACUU CGACAAGAAU CU C C CAAAC GAGAAGGU GCUU C C UAAGCACAGC CUCCUUUAC GAAUACUU CACU GUCUACAAC GAACU GACUAAAGU GAA AUACGUUACUGAAGGAAUGAGGAAGCCGGCCUUUCUGUCCGGAGAACAGAAGAAAGC AAUU GU C GAU CU GCU GUU CAAGAC CAAC C GCAAGGU GAC C GU CAAGCAGCUUAAAGA GGACUACUUCAAGAAGAUCGAGUGUUUCGACUCAGUGGAAAUCAGCGGGGUGGAGGA CAGAUUCAACGCUUCGCUGGGAACCUAUCAUGAUCUCCUGAAGAUCAUCAAGGACAA GGACUUCCUUGACAACGAGGAGAACGAGGACAUCCUGGAAGAUAUCGUCCUGACCUU GACCCUUUUCGAGGAUCGCGAGAUGAUCGAGGAGAGGCUUAAGACCUACGCUCAUCU CUUCGACGAUAAGGUCAUGAAACAACUCAAGCGCCGCCGGUACACUGGUUGGGGCCG CCUCUCCCGCAAGCUGAUCAACGGUAUUCGCGAUAAACAGAGCGGUAAAACUAUCCU GGAUUUCCUCAAAUCGGAUGGCUUCGCUAAUCGUAACUUCAUGCAAUUGAUCCACGA CGACAGCCUGACCUUUAAGGAGGACAUCCAAAAAGCACAAGUGUCCGGACAGGGAGA CUCACUCCAUGAACACAUCGCGAAUCUGGCCGGUUCGCCGGCGAUUAAGAAGGGAAU UCUGCAAACUGUGAAGGUGGUCGACGAGCUGGUGAAGGUCAUGGGACGGCACAAACC GGAGAAUAUCGUGAUUGAAAUGGCCCGAGAAAACCAGACUACCCAGAAGGGCCAGAA AAACUCCCGCGAAAGGAUGAAGCGGAUCGAAGAAGGAAUCAAGGAGCUGGGCAGCCA GAUCCUGAAAGAGCACCCGGUGGAAAACACGCAGCUGCAGAACGAGAAGCUCUACCU GUACUAUUUGCAAAAUGGACGGGACAUGUACGUGGACCAAGAGCUGGACAUCAAUCG GUU GUCU GAUUAC GAC GU GGAC CACAU C GUU C CACAGU C CUUU CU GAAGGAU GACU C GAU C GAUAACAAGGU GUU GACU C GCAGC GACAAGAACAGAGGGAAGU CAGAUAAU GU 2024201264   26 Feb 2024 GCCAUCGGAGGAGGUCGUGAAGAAGAUGAAGAAUUACUGGCGGCAGCUCCUGAAUGC GAAGCUGAUUACCCAGAGAAAGUUUGACAAUCUCACUAAAGCCGAGCGCGGCGGACU CUCAGAGCUGGAUAAGGCUGGAUUCAUCAAACGGCAGCUGGUCGAGACUCGGCAGAU UACCAAGCACGUGGCGCAGAUCUUGGACUCCCGCAUGAACACUAAAUACGACGAGAA CGAUAAGCUCAUCCGGGAAGUGAAGGUGAUUACCCUGAAAAGCAAACUUGUGUCGGA CUUU C GGAAGGACUUU CAGUUUUACAAAGU GAGAGAAAU CAACAACUACCAU CAC GC GCAUGACGCAUACCUCAACGCUGUGGUCGGUACCGCCCUGAUCAAAAAGUACCCUAA ACUUGAAUCGGAGUUUGUGUACGGAGACUACAAGGUCUACGACGUGAGGAAGAUGAU AGCCAAGUCCGAACAGGAAAUCGGGAAAGCAACUGCGAAAUACUUCUUUUACUCAAA CAUCAUGAACUUUUUCAAGACUGAAAUUACGCUGGCCAAUGGAGAAAUCAGGAAGAG GCCACUGAUCGAAACUAACGGAGAAACGGGCGAAAUCGUGUGGGACAAGGGCAGGGA CUUCGCAACUGUUCGCAAAGUGCUCUCUAUGCCGCAAGUCAAUAUUGUGAAGAAAAC CGAAGUGCAAACCGGCGGAUUUUCAAAGGAAUCGAUCCUCCCAAAGAGAAAUAGCGA CAAGCUCAUUGCACGCAAGAAAGACUGGGACCCGAAGAAGUACGGAGGAUUCGAUUC GCCGACUGUCGCAUACUCCGUCCUCGUGGUGGCCAAGGUGGAGAAGGGAAAGAGCAA AAAGCUCAAAUCCGUCAAAGAGCUGCUGGGGAUUACCAUCAUGGAACGAUCCUCGUU CGAGAAGAACCCGAUUGAUUUCCUCGAGGCGAAGGGUUACAAGGAGGUGAAGAAGGA UCUGAUCAUCAAACUCCCCAAGUACUCACUGUUCGAACUGGAAAAUGGUCGGAAGCG CAUGCUGGCUUCGGCCGGAGAACUCCAAAAAGGAAAUGAGCUGGCCUUGCCUAGCAA GUACGUCAACUUCCUCUAUCUUGCUUCGCACUACGAAAAACUCAAAGGGUCACCGGA AGAUAACGAACAGAAGCAGCUUUUCGUGGAGCAGCACAAGCAUUAUCUGGAUGAAAU CAUCGAACAAAUCUCCGAGUUUUCAAAGCGCGUGAUCCUCGCCGACGCCAACCUCGA CAAAGUCCUGUCGGCCUACAAUAAGCAUAGAGAUAAGCCGAUCAGAGAACAGGCCGA GAACAUUAUCCACUUGUUCACCCUGACUAACCUGGGAGCCCCAGCCGCCUUCAAGUA CUUCGAUACUACUAUCGAUCGCAAAAGAUACACGUCCACCAAGGAAGUUCUGGACGC GACCCUGAUCCACCAAAGCAUCACUGGACUCUACGAAACUAGGAUCGAUCUGUCGCA GCUGGGUGGCGAUGGCUCGGCUUACCCAUACGACGUGCCUGACUACGCCUCGCUCGG AUCGGGCUCCCCCAAAAAGAAACGGAAGGUGGACGGAUCCCCGAAAAAGAAGAGAAA GGUGGACUCCGGAUGAGAAUUAUGCAGUCUAGCCAUCACAUUUAAAAGCAUCUCAGC CUAC CAU GAGAAUAAGAGAAAGAAAAU GAAGAUCAAUAGCUUAUU CAU CUCUUUUUC UUUUU C GUUGGU GUAAAGC CAACACC CU GU CUAAAAAACAUAAAUUU CUUUAAU CAU UUUGCCUCUUUUCUCUGUGCUUCAAUUAAUAAAAAAUGGAAAGAACCUCGAGAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAU CUAG D. Primary liver hepatocytes

[00276] Primary mouse liver hepatocytes (PMH) (Gibco) were cultured per the manufacturer’s protocol (Invitrogen, protocol 11.28.2012). In brief, the cells were thawed and resuspended in hepatocyte thawing medium with supplements (Gibco, Cat. CM7000) followed by centrifugation at 100 g for 10 minutes. The supernatant was discarded and the pelleted cells resuspended in hepatocyte plating medium plus supplement pack (Invitrogen, Cat. Al217601 and CM3000). Cells were counted and plated on Bio-coat collagen I coated 96-well plates (ThermoFisher, Cat. 877272) at a density of 15,000 cells / well and incubated for 5 hours at 37°C and 5% CO2 atmosphere to allow for monolayer formation. After 5 hours, the plating media was removed and replaced with supplemented hepatocyte culture medium (Invitrogen, Cat. A1217601 and CM4000) containing LNP formulated Cas9 mRNA and guide RNA plus 2024201264   26 Feb 2024 3% mouse serum. LNPs were diluted from a starting dose level of lOOng Cas9 mRNA and approximately 30nM guide RNA per well, carrying out serial dilutions down to O.lng mRNA and 0.03nM guide per well. Cells were incubated for approximately 48 hours at 37°C and 5% CO2 atmosphere before cell lysis and NGS analysis as described herein. E. Lipid Nanoparticle (“LNP”) Formulation

[00277] LNPs were formulated with a cationic lipid amine to RNA phosphate (N:P) molar ratio of about 4.5. The lipid nanoparticle components were dissolved in 100% ethanol with the following molar ratios: 45 mol-% (12.7 mM) cationic lipid (e.g., (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-di enoate, also called     3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z, 12Z)-octadeca-9,12-di enoate); 44 mol-% (12.4 mM) helper lipid (e.g., cholesterol); 9 mol-% (2.53 mM) neutral lipid (e.g., DSPC); and 2 mol-% (.563 mM) PEG (e.g., PEG2k-DMG). The RNA cargo were prepared in 25 mM sodium acetate buffer, pH 4.5, resulting in a concentration of RNA cargo of approximately 0.45 mg / mL.

[00278] The LNPs were formed by microfluidic mixing of the lipid and RNA solutions using a Precision Nanosystems NanoAssemblr™ Benchtop Instrument, according to the manufacturer's protocol. A 2:1 ratio of aqueous to organic solvent was maintained during mixing using differential flow rates.

[00279] LNP Formulation Procedure A: After mixing, the LNPs were collected, diluted in phosphate buffered saline (PBS, approximately 1:1), and then remaining buffer was exchanged into PBS (100-fold excess of sample volume), overnight at 4°C under gentle stirring using a 10 kDa Slide-a-LyzerTM G2 Dialysis Cassette (ThermoFisher Scientific). The LNPs were concentrated using lOkDa Amicon spin filter (centrifugation at 4000g at 4°C) to achieve the desired concentration. The resulting mixture was then filtered using a 0.2 pm sterile filter. The resulting filtrate was stored at 2-8 °C.

[00280] LNP Formulation Procedure B: After mixing, the LNPs were collected, diluted in 50mM Tris at pH 7.5 (approximately 1:1), and then LNPs were exchanged into 50mM Tris at pH 7.5 (100-fold excess of sample volume), overnight at 4°C under gentle stirring using a 10 kDa Slide-a-LyzerTM G2 Dialysis Cassette (ThermoFisher Scientific). The LNPs were concentrated using lOkDa Amicon spin filter (centrifugation at 4000g at 4°C) to achieve twice the desired concentration. These concentrated LNPs were mixed 1:1 with 50mM Tris, 90mM 2024201264   26 Feb 2024 NaCl, 10% sucrose at pH 7.5 (2X TSS). The resulting mixture was then filtered using a 0.2 pM sterile filter. The resulting filtrate was stored at -80°C.

[00281] LNP Formulation Procedure C: The RNA cargo were prepared in 25mM sodium citrate, lOOmM sodium chloride at pH 5 resulting in a concentration of RNA cargo of approximately 0.45 mg / mL. After mixing, the LNPs were collected in water at the ratio of 3:1. The LNPs were incubated for an hour at room temperature and mixed 1:1 with water. Then they were buffer-exchanged into IX TSS (50mM Tris, 45mM NaCl, 5% sucrose at pH 7.5) on PD-10 columns (GE Healthcare), using manufacturer’s protocol. The LNPs were concentrated using lOkDa Ami con spin filter (centrifugation at 4000g at 4°C) to achieve the desired concentration. The resulting mixture was then filtered using a 0.2 pm sterile filter. The resulting filtrate was stored at -80°C. F. Next-Generation Sequencing (“NGS”) and Analysis for On-Target Cleavage Efficiency

[00282] To quantitatively determine the efficiency of editing at the target location in the genome, deep sequencing was utilized to identify the presence of insertions and deletions introduced by gene editing.

[00283] PCR primers were designed around the target site (e.g., TTR, FVII), and the genomic area of interest was amplified. Primer sequences are provided below in Table 5. Table 5 Guide Gene Forward Primer (5’-3’) SEQ ID Reverse Primer (5’-3’) SEQ ID For experiments with guides based on CR000686 / G000209 targeting domains TTR AGTCAATAATCAGAATCAGCAGGT 333 AGAAGGCACTTCTTCTTTATCTAAGGT 337 For experiments with guides based on CR000705 / G000211 targeting domains TTR GTTTTGTTCCAGAGTCTATCACCG 334 ACACGAATAAGAGCAAATGGGAAC 338 For experiments with guides based on G000269 / G000285 targeting domains TTR ATTACCAGCTTAGCATCCTGTGAA 335 ACACGGTTTATAGAGCAAGAACAC 339 For experiments with guides based on CR000657 / G000208 targeting domains FVII AGCACATGAGACCTTCTGTTTCTC 336 GACATAGGTGTGACCCTCACAATC 340 Additional PCR was performed according to the manufacturer's protocols (Illumina) to add the necessary chemistry for sequencing. The amplicons were sequenced on an Illumina MiSeq instrument. The reads were aligned to the human reference genome (e.g, hg38) after eliminating those having low quality scores. The resulting files containing the reads were mapped to the reference genome (BAM files), where reads that overlapped the target region 2024201264   26 Feb 2024 of interest were selected and the number of wild type reads versus the number of reads which contain an insertion, substitution, or deletion was calculated.

[00284] The editing percentage (e.g, the “editing efficiency” or “percent editing”) is defined as the total number of sequence reads with insertions or deletions over the total number of sequence reads, including wild type. G. LNP Delivery in vivo

[00285] CD-I female mice, ranging 6-10 weeks of age were used in each study. Animals were weighed and grouped according to body weight for preparing dosing solutions based on group average weight. LNPs were dosed via the lateral tail vein in a volume of 0.2 mL per animal (approximately 10 mL per kilogram body weight). The animals were observed at approximately 6 hours post dose for adverse effects. Body weight was measured at twenty-four hours post-administration, and animals were euthanized at various time points by exsanguination via cardiac puncture under isoflourane anesthesia. Blood was collected into serum separator tubes or into tubes containing buffered sodium citrate for plasma as described herein. For studies involving in vivo editing, liver tissue was collected from the median lobe from each animal for DNA extraction and analysis. H. Cytokine induction analysis

[00286] For this analysis, approximately 50-100 pL of blood was collected by tail vein nick for serum cytokine measurements. Blood was allowed to clot at room temperature for approximately 2 hours, and then centrifuged at lOOOxg for 10 minutes before collecting the serum. A Luminex based magnetic bead multiplex assay (Affymetrix ProcartaPlus, catalog number Exp040-00000-801) measuring IL-6, TNF-alpha, IFN-alpha, and MCP-1 was used for cytokine analysis in collected in samples. Kit reagents and standards were prepared as directed in the manufacturer's protocol. 25 pL of mouse serum was added to wells containing 25 pL of the diluted antibody coated magnetic beads. The plate was incubated for 2 hours at room temperature and then washed. Diluted biotin antibody (50 pL) was added to the beads and incubated for 1 hour at room temperature. The beads were washed again before adding 50 pL of diluted streptavidin-PE to each well, followed by incubation for 30 minutes. The beads were washed once again and then suspended in 100 pL of wash buffer and read on the Bio-Plex 200 instrument (Bio-Rad). The data was analyzed using Bioplex Manager ver. 6.1 analysis package with cytokine concentrations calculated off a standard curve using a five parameter logistic curve fit. 2024201264   26 Feb 2024 I. Genomic DNA Isolation

[00287] For the in vivo studies, genomic DNA was extracted from 10 mg of tissue using a bead based extraction kit, MagMAX-96 DNA Multi-Sample Kit (ThermoFisher, Cat #4413020) according to manufacturer's protocol, which includes homogenizing the tissue in lysis buffer (approximately 400 pL / 10 mg tissue). All DNA samples were normalized to 100 ng / pL concentration for PCR and subsequent NGS analysis, as described herein. J. Transthyretin (TTR) ELISA analysis

[00288] Blood was collected and the serum was isolated as indicated. The total TTR serum levels were determined using a Mouse Prealbumin (Transthyretin) ELISA Kit (Aviva Systems Biology, Cat. OKIA00111). Kit reagents and standards were prepared according to the manufacture's protocol. Mouse serum was diluted to a final dilution of 10,000-fold with lx assay diluent. This was done by carrying out two sequential 50-fold dilutions resulting in a 2500-fold dilution. A final 4-fold dilution step was carried out for a total sample dilution of 10,000-fold. Both standard curve dilutions (100 pL each) and diluted serum samples were added to each well of the ELISA plate pre-coated with capture antibody. The plate was incubated at room temperature for 30 minutes before washing. Enzyme-antibody conjugate (100 pL per well) was added for a 20-minute incubation. Unbound antibody conjugate was removed and the plate was washed again before the addition of the chromogenic substrate solution. The plate was incubated for 10 minutes before adding 100 pL of the stop solution, e.g., sulfuric acid (approximately 0.3 M). The plate was read on a SpectraMax M5 plate reader at an absorbance of 450 nm. Serum TTR levels were calculated by SoftMax Pro software ver. 6.4.2 using a four parameter logistic curve fit off the standard curve. Final serum values were adjusted for the assay dilution. Example 2 - Engineering modified gRNA and in vitro testing

[00289] Modified gRNAs were designed in the dual guide format (dgRNA), as shown in Table 4. Accordingly, both modified crRNAs and trRNAs were designed and chemically synthesized to allow for the pairing of modified and unmodified components forming dgRNA. These pairings were transfected into Neuro2A cells at concentrations as indicated in the figures and editing efficiency (e.g., percent editing) was measured by NGS, as described in Example 1.

[00290] Certain modified crRNAs from Table 4 targeting the mouse TTR gene were transfected with Cas9 mRNA and unmodified trRNA (TR000002). Tested guides included 2024201264   26 Feb 2024 SEQ ID Nos: 1- 18. As shown in Figure 1, some of the modified crRNAs (together with unmodified trRNA) conferred similar or enhanced activity as compared to the unmodified control, while other modified crRNAs decreased activity.

[00291] In parallel, modified trRNAs from Table 4 were transfected with Cas9 mRNA along with an unmodified crRNA (CR000686) targeting the same sequence of the mouse TTR gene. Tested guides included SEQ ID Nos: 188 - 200, and 204. As shown in Figure 2, many of the modified trRNAs (together with unmodified crRNA) conferred similar or enhanced activity as compared to the unmodified control, while some of the modified trRNAs decreased activity.

[00292] In addition to substituting chemically modified nucleotides, some of the crRNA and trRNA pairings tested were also engineered with sequence substitutions, e.g., resulting in G-C pairings not found in the parental sequences. Tested guides included SEQ ID Nos: 15 and 201; 16 and 202; 1 and 188. As shown in Figure 3, one such pairing (SEQ ID Nos: 16 and 202) resulted in similar or enhanced activity as compared to the unmodified control, while two of the pairings decreased activity.

[00293] Next, pairings of modified crRNAs and modified trRNAs from Table 4 were tested. As shown in Figure 4, some of the pairings of modified crRNA with modified trRNA conferred similar or enhanced activity as compared to the unmodified controls, while some of the pairings decreased activity. In Figure 4, the column headings depict different trRNA used in the experiment, and the row headings depict different crRNA used. To determine the combination used in the experiment, you match column to row. TR000002 and CR000686 are the unmodified controls (see lower right cells).

[00294] Based on the dgRNA designs, corresponding single guide RNAs (sgRNAs) were engineered featuring aspects of some of the modified crRNAs and trRNAs, as depicted in Table 4 and Figure 15D. These sgRNAs, SEQ ID Nos: 228 - 234, were also tested in Neuro2A cells, and as shown in Figure 5, each of the modified sgRNAs displayed activities comparable to the controls containing only 5’ and 3’ end modifications (G0000209; SEQ ID NO: 228).

[00295] A similar set of experiments were conducted for additional dgRNAs guides depicted in Table 4 and Figure 6. Tested guides included SEQ ID Nos: 32 - 47, and 1. Modified crRNAs also targeting the mouse TTR gene were transfected with Cas9 mRNA and unmodified trRNA (TR000002). As shown in Figure 6, some of the modified crRNAs (together with unmodified trRNA) conferred similar or enhanced activity as compared to the unmodified control (CR000686), while other modified crRNAs decreased activity. 2024201264   26 Feb 2024

[00296] In parallel, as shown in Figure 7, modified trRNAs from Table 4 were transfected with Cas9 mRNA along with an unmodified crRNA (CR000686) targeting the same sequence of the mouse TTR gene. Tested guides included SEQ ID Nos: 205 - 222, and 1. As shown in Figure 7, many of the modified trRNAs (together with unmodified crRNA) conferred similar or enhanced activity as compared to the unmodified control (TR000002), while some of the modified trRNAs decreased activity.

[00297] In addition to substituting chemically modified nucleotides, some of the crRNA and trRNA pairings tested from Table 4 were also engineered with sequence substitutions, e.g., resulting in G-C pairings or G-U mismatches (“GU wobbles”) not found in the parental sequences. As shown in Figure 8, some of the modifications and pairings conferred similar or enhanced activity as compared to the unmodified control, while some (e.g., the “GU wobble” or mismatch pairings) decreased activity. Figure 8 shows results using trRNA guides shown in SEQ ID Nos: 223-227 and 188 with crRNA guides shown in SEQ ID Nos: 48-52, and 1.

[00298] Next, select pairings of the modified crRNAs and modified trRNAs from Table 4 were tested as shown in Figure 9. Some of the pairings of modified crRNA with modified trRNA conferred similar or enhanced activity as compared to the unmodified controls, while some of the pairings decreased activity. In Figure 9, the column headings depict different trRNA used in the experiment, and the row headings depict different crRNA used. To determine the combination used in the experiment, you match column to row. Unmodified controls are TR000002, and CR000686.

[00299] Some of the modified gRNAs (dgRNAs and sgRNAs) from Table 4 were also tested in a purely biochemical assay (i.e., cell free cleavage assay). Interestingly, many of the modified gRNAs that were largely inactive in the Neuro2A cells were active in the biochemical assay, indicating that such biochemical assays may not be predictive of modified gRNA activity in cells (data not shown). Example 3. Further testing of modified gRNAs to other targets

[00300] Having established that certain modifications affected gRNA activity, it was next tested whether these modifications would affect the activity when targeting (1) a separate sequence in the same gene or (2) a sequence in a different gene. Accordingly, gRNAs targeting another sequence in the mouse TTR gene as well as a sequence in the mouse Factor-VII (FVII) gene were engineered and synthesized having certain modification patterns tested in Example 2 (see Table 4). These gRNAs were transfected into Neuro2A 2024201264   26 Feb 2024 cells at the concentrations indicated in the figures and editing efficiency (e.g., percent editing) was measured by NGS, as described in Example 1.

[00301] Modified crRNAs from Table 4 targeting either the mouse TTR gene (different sequence as targeted in Example 2) or the mouse FVII gene, were transfected with Cas9 mRNA and unmodified trRNA (TR000002). Tested guides included those shown in Figures 12A and 12B. Some of the modified crRNAs (together with unmodified trRNA) conferred similar or enhanced activity as compared to the unmodified controls, while other modified crRNAs decreased activity.

[00302] In parallel, modified trRNAs from Table 4 were transfected with Cas9 mRNA along with an unmodified crRNA targeting the same sequence of the mouse TTR gene (CR000705; different sequence as targeted in Example 2) or the same sequence as the mouse FVII gene (CR000657). As shown in Figures 13A and 13B, many of the modified trRNAs (together with unmodified crRNAs) conferred similar or enhanced activity as compared to the unmodified controls, while some of the modified trRNAs decreased activity. This data shows that certain modification patterns tended to have similar effects over the different sequences.

[00303] Based on the dgRNA designs described above, corresponding single guide RNAs (sgRNAs) were engineered featuring aspects of some of the modified crRNAs and trRNAs. See, Table 4. These sgRNAs were also tested in Neuro2A cells. Results are shown in Figure 10 (mouse TTR) and Figure 11 (mouse FVII). These experiments show that some modification patterns result in similar effects even when targeting different genes. Example 4. Testing of modified gRNA in vivo

[00304] Following the in vitro testing, modified sgRNAs were delivered to animals in six separate studies in order to determine whether the modifications conferred any benefits for editing in vivo.

[00305] LNPs were formulated with IVT Cas9 mRNA together with chemically modified sgRNA (targeting TTR or FVII), as described in Example 1. The ratio of mRNA:sgRNA was approximately 1:1, by weight of the RNA components. Unless otherwise indicated, the Cas9 mRNA used in the studies described in this example had the sequence of SEQ ID NO: 360 and the LNPs were formulated using LNP Formulation Procedure A described above.

[00306] In one experiment, mice (n=5 per group) were administered a single dose of LNP at 2mg / kg and blood was collected four hours post dose for serum cytokine analysis. 7 days post dose at necropsy, livers and blood were collected for NGS measurements of editing 2024201264   26 Feb 2024 efficiency and serum TTR analysis, respectively. Each of the sgRNAs in this experiment targeted the same sequence in the TTR gene, the only difference between the sgRNAs being the modifications made to each (See Figures 14A-D and 15A-E; Table 4 SEQ ID Nos: 228 -234). G000209 (two lots tested) served as the less modified control, having only 2'-O-methyl modifications and phosphorothioate linkages at and between the three terminal nucleotides at both the 5' and 3' termini of the sgRNA, respectively. (See Figure 15D).

[00307] The results shown in Figures 14A-D, show that the more heavily modified sgRNAs tended to induce less of a response for each the cytokines assayed, as compared to the less modified G000209 controls. The more heavily modified sgRNAs also conferred larger editing efficiencies in the livers of treated animals, with percent editing reaching -60% for two of the more heavily modified sgRNAs (e.g., G000263 and G000267) as compared to -44-47% for the less modified controls (G000209 lots) (Figure 15A). Importantly, the editing efficiencies correlated with phenotypic changes as serum knockdown of TTR levels were comparable or significantly greater than the less modified controls (See e.g., G000263 and G000267 vs G000209 lots in Figures 15A-15B). The differences between the end-modified G000209 and highly-modified G000267 are summarized in Figure 15D and 15E (2’-O-Me modified nucleotides are shown in bold, and * represents phosphorothioate linkages).

[00308] In another in vivo study, three sgRNAs targeting a separate sequence in the mouse TTR gene were tested. Mice (n=5 per group) were administered a single dose of LNP at 2mg / kg, Img / kg, or 0.3mg / kg. Blood was collected four hours post dose for serum cytokine analysis. 7 days post dose at necropsy, livers and blood were collected for NGS measurements of editing efficiency and serum TTR analysis, respectively. In this study, each of the sgRNAs targeted the same sequence in the TTR gene (a different sequence from what was targeted in the previous in vivo study) with one sgRNA being completely unmodified (G000201 (SEQ ID NO: 243)), another having only end modifications (G000211 (SEQ ID NO: 241)), with 2'-O-methyl modifications and phosphorothioate linkages at and between the three terminal nucleotides at both the 5' and 3' termini of the sgRNA, respectively), and a third sgRNA having the same modification pattern as G000267 in the previous in vivo study (G000282 (SEQ ID NO: 242)).

[00309] As shown in Figures 16A-16D, each of the sgRNAs resulted in similar responses in a dose dependent manner for each of the cytokines tested. For editing efficiency, the unmodified sgRNA (G000201(SEQ ID NO: 243)) conferred little in vivo editing, while the heavily modified sgRNA (G000282 (SEQ ID NO: 242)) conferred levels 2024201264   26 Feb 2024 reaching -60% with a dose of 2mg / kg, which was significantly greater than the levels achieved with the less modified sgRNA (G000211 (SEQ ID NO: 241)) (Figure 17A and B). As with the previous in vivo study, the levels of editing correlated with the amount of serum TTR knockdown (Figure 17C and D).

[00310] A similar study as the second in vivo study was next conducted with another set of three sgRNAs targeting yet a different TTR sequence in the mouse TTR gene (targeting a different sequence then what was targeted in the two previous in vivo studies). Mice (n=5 per group) were administered a single dose of LNP at 2mg / kg, Img / kg, or 0.3mg / kg. Blood was collected four hours post dose for serum cytokine analysis. 7 days post dose at necropsy, livers and blood were collected for NGS measurements of editing efficiency and serum TTR analysis, respectively. In this study, each of the sgRNAs targeted the same sequence in the TTR gene (a different sequence from what was targeted in the previous two in vivo studies) with one sgRNA being completely unmodified (G000285; (SEQ ID NO: 332)), another having only end modifications (G000269 (SEQ ID NO: 330)), with 2'-O-methyl modifications and phosphorothioate linkages at and between the three terminal nucleotides at both the 5' and 3' ends of the sgRNA, respectively), and a third sgRNA having the same modification pattern as G000267 and G000282 in the previous two in vivo studies (G000283 (SEQ ID NO: 331)).

[00311] In this study, the unmodified sgRNA (G000285 (SEQ ID NO: 332)) conferred little in vivo editing, while the heavily modified sgRNA (G000283 (SEQ ID NO: 331)) conferred levels reaching -60% with a dose of 2mg / kg, which was significantly greater than the levels achieved with the less modified sgRNA (G000269 (SEQ ID NO: 330)) (Figures 18A-18B). As with the previous in vivo studies, the levels of editing correlated with the amount of serum TTR knockdown (Figure 18C).

[00312] In a fourth in vivo study, the effects of modifications to gRNAs was evaluated for another gene (FVII). For in-study comparison, two of the sgRNAs tested in the first in vivo study were included (G000209 and G000267). Mice (n=5 per group) were administered a single dose of LNP at 2mg / kg, Img / kg, or 0.3mg / kg, and blood was collected four hours post dose for serum cytokine analysis. 6 days post dose at necropsy, livers were collected for NGS measurements of editing efficiency. In this study, each of the sgRNAs targeted the same sequence in the TTR or FVII genes, with one sgRNA for each having only end modifications (G000208 (SEQ ID NO: 286)) for FVII, G000209 for TTR, both having 2'-O-methyl modifications and phosphorothioate linkages at and between the three terminal 2024201264   26 Feb 2024 nucleotides at both the 5' and 3' ends of the sgRNA, respectively), and a second sgRNA having the same modification patterns as G000267, G000282, and G000283 in the previous in vivo studies (G000373 (SEQ ID NO: 287) for FVII; G000267 (SEQ ID NO: 234) for TTR).

[00313] As shown in Figures 19A-19D, each of the sgRNAs resulted in similar responses in a dose dependent manner for each of the cytokines tested. For editing efficiency, the more heavily modified sgRNA targeting FVII (G000373 (SEQ ID NO: 287)) had an increase in editing efficiency as compared to the less modified version (G000208 (SEQ ID NO: 286)) across each of the doses tested (Figure 18A). These results were also observed for the sgRNAs targeting TTR (Figures 20A-20B).

[00314] In another in vivo study, ten additional sgRNAs targeting the same sequence in the mouse TTR gene as G000282 were tested. G000282 was also included in the study for comparative purposes. Mice (n=5 per group) were administered a single dose of LNP at Img / kg or 0.5mg / kg. The LNPs used in this study were formulated using LNP Formulation Procedure B described above. Seven (7) days post dose at necropsy, livers and blood were collected for NGS measurements of editing efficiency and serum TTR analysis, respectively. In this study, each of the sgRNAs targeted the same sequence in the TTR gene. The modification pattern of each sgRNA tested varied and included 2’-OMe, 2’-F, and PS modifications in the 5’ terminus, 3’ terminus, hairpin 1, hairpin 2, nexus, lower stem, bulge, and upper stem of the sgRNA. The results of this study are shown in Figures 22A-22C, including % editing (Figure 22A), average editing and standard deviation (Figure 22B), and serum TTR levels (Figure 22C). These same sgRNAs were tested in primary mouse hepatocytes as per the methods described herein. The results of this dose response TTR editing study are shown in Figures 24A-24C, including % editing (Figure 24A), dose response curves (Figure 24B), and EC50 values (Figure 24C).

[00315] In another in vivo study, thirteen sgRNAs targeting the same sequence in the mouse TTR gene as G000282 were tested. G000282 was also included in the study for comparative purposes. Mice (n=5 per group) were administered a single dose of LNP at Img / kg. The LNPs used in this study were formulated using LNP Formulation Procedure C described above. The Cas9 mRNA used in this study had the sequence of SEQ ID NO: 359. Blood was collected four hours post dose for serum cytokine analysis. 7 days post dose at necropsy, livers and blood were collected for NGS measurements of editing efficiency and serum TTR analysis, respectively. In this study, each of the sgRNAs targeted the same 2024201264   26 Feb 2024 sequence in the TTR gene. The sgRNAs tested include additional 2’-OMe and PS modifications in the 5’ terminus, 3’ terminus, hairpin 1, hairpin 2, and upper stem of the sgRNA. The results of this study are shown in Figures 23A-23C, including % editing (Figure 23A), average % editing (Figure 23B), and serum TTR levels (Figure 23C).

[00316] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[00317] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Claims

1. A single guide RNA (sgRNA) comprising a guide region and a conserved region,wherein the conserved region comprises, from 5’ to 3‘,(a) a lower stem region portion being nucleotides LS1 to LS6,(b) a bulge region portion being nucleotides B1 to B2,(c) an upper stem region being nucleotides US1 to US12,(d) a bulge region portion being nucleotides B3 to B6,(e) a lower stem region portion being nucleotides LS7 to LS12,(f) a nexus region being nucleotides N1 to N18,(g) a hairpin 1 region being nucleotides H1-1 to H1-12,(h) a nucleotide, and(i) a hairpin 2 region being nucleotides H2-1 to H2-15,wherein the sgRNA comprises a modification at one or more nucleotides in each of the hairpin 1 region and the hairpin 2 region, and a 3’ end modification in the 3’ terminus, and further comprises a modification at at least one nucleotide of the lower stem region or the nexus region,wherein the sgRNA further comprises one of the following:(i)    2‘-O-Me modifications at each nucleotide in the upper stem region; or(ii)    2‘-O-Me modifications at ten or eleven of the following nucleotides: US1, US2,US3, US4, US5, US6, US7, US8, US9, US10, US11, or US12.

2. The sgRNA of claim 1, wherein the modification at one or more nucleotides in each of the hairpin 1 region and the hairpin 2 region, or the 3’ end modification in the 3’ terminus, is 2‘-O-Me.

3. The sgRNA of claim 1 or claim 2, further comprising 2‘-O-Me modifications at the last three, last four, or last five nucleotides at the 3' end of the 3' terminus.

4. The sgRNA of any one of claims 1-3, further comprising PS bonds between two or more of the last four nucleotides at the 3' end of the 3' terminus or between the last three, four, or five nucleotides at the 3' end of the 3' terminus.2024201264   24 Jun 20265. The sgRNA of claim 4, wherein the last four nucleotides at the 3’ end of the 3’ terminus are linked with PS bonds.

6. The sgRNA of any one of claims 1-5, wherein the sgRNA forms a ribonucleoprotein complex with an S. pyogenes Cas9.

7. The sgRNA of any one of claims 1-6, wherein at least two of the last four nucleotides at the 3’ end of the 3’ terminus of the sgRNA are modified, optionally with 2’-O-Me, 2’-F, or 2’-O-moe.

8. The sgRNA of claim 7, wherein at least two of the last four nucleotides at the 3’ end of the 3’ terminus of the sgRNA are modified with 2’-O-Me.

9. The sgRNA of any one of claims 1-8, comprising 2‘-O-Me modifications at 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 96% or more of the nucleotides in the hairpin 1 and hairpin 2 regions.

10. The sgRNA of any one of claims 1-9, comprising:(i)    2‘-O-Me modifications at LS1, LS6, LS7, LS8, LS11, and / or LS12;(ii) a 2‘-O-Me modification at LS1 and / or LS6 and no modification at LS2-LS5;(iii) 2‘-O-Me modifications at LS9 and LS10; or(iv) 2‘-O-Me modified nucleotides at 2 or more of LS8, LS9, LS10, LS11, and / or LS12.

11. The sgRNA of claim 10, wherein at least LS8 and LS10 are modified.

12. The sgRNA of any one of claims 1-11, comprising:(i)    2‘-O-Me modifications at up to 50% of the nucleotides in the nexus region;(ii)    2‘-O-Me modifications at four or more nucleotides in the nexus region;2024201264   24 Jun 2026(iii) 2‘-O-Me modified nucleotides at ten or more nucleotides in the nexus region; or (iv) 2‘-O-Me modifications at one, two, three, four, or five of nucleotides N2-N6 in the nexus region.

13. The sgRNA of any one of claims 1-12, further comprising a modification at one or more nucleotides in the bulge region.

14. The sgRNA of claim 13, comprising(i)    2‘-O-Me modifications at 50% or more of the nucleotides in the bulge region; or(ii) 2‘-O-Me modified nucleotides at three or more nucleotides in the bulge region.

15. The sgRNA of any one of claims 1-14, comprising a modification at one or more nucleotides in the lower stem region, optionally wherein LS9 and LS10 are modified.

16. The sgRNA of claim 15, wherein the modification at one or more nucleotides in the lower stem region is selected from 2‘-O-Me and 2‘-F.

17. The sgRNA of any one of claims 1-16, comprising a modification at one or more nucleotides in the nexus region.

18. The sgRNA of claim 17, wherein the modification at one or more nucleotides in the nexus region is selected from 2‘-O-Me and 2‘-F.

19. The sgRNA of any one of claims 1-18, further comprising a 2‘-fluoro (2‘-F) modified nucleotide or a phosphorothioate (PS) bond between nucleotides.

20. The sgRNA of any one of claims 1-19, wherein the sgRNA comprises a modification at H2-1.

21. A composition comprising the sgRNA of any one of claims 1-20 and a lipid nanoparticle (LNP).2024201264   24 Jun 202622. A composition comprising the sgRNA of any one of claims 1-20 and a nuclease or an mRNA that encodes the nuclease.

23. The composition of claim 22, wherein the nuclease is a Cas protein.

24. The composition of claim 23, wherein the Cas protein is a Cas9 protein.

25. The composition of claim 24, wherein the Cas9 protein is an S. pyogenes Cas9 protein.

26. The composition of any one of claims 22-25, wherein the nuclease is a nickase.

27. The composition of any one of claims 22-26, wherein the nuclease is modified.

28. A pharmaceutical formulation comprising the sgRNA of any one of claims 1-20 and a pharmaceutically acceptable excipient or carrier.

29. A method of modifying a target DNA, comprising delivering to a cell: a Cas protein or a nucleic acid encoding a Cas protein, and the sgRNA of any one of claims 1-20, the composition of any one of claims 21-27, or the pharmaceutical formulation of claim 28.

30. The method of claim 29, wherein the Cas protein is an S. pyogenes Cas9 protein.

31. A single guide RNA (sgRNA) comprising a guide region and a conserved region, wherein the conserved region comprises, from 5’ to 3‘,(a) a lower stem region portion being nucleotides 1-6 of SEQ ID NO: 355,(b)    a bulge region portion being nucleotides 7-8 of SEQ ID NO: 355,(c)    an upper stem region being nucleotides 9-20 of SEQ ID NO: 355,(d) a bulge region portion being nucleotides 21-24 of SEQ ID NO: 355,(e) a lower stem region portion being nucleotides 25-30 of SEQ ID NO: 355,(f) a nexus region being nucleotides 31-48 of SEQ ID NO: 355,2024201264   24 Jun 2026(g) a hairpin 1 region being nucleotides 49-60 of SEQ ID NO: 355,(h) a nucleotide being nucleotide 61 of SEQ ID NO: 355, and(i) a hairpin 2 region being nucleotides 62-76 of SEQ ID NO: 355,wherein the sgRNA comprises one or more modifications at one or more nucleotides in each of the hairpin 1 region and the hairpin 2 region, and a 3’ end modification in the 3’ terminus, and further comprises a modification at one or more nucleotides in at least one of the lower stem region or the nexus region,wherein the sgRNA further comprises one of the following:(i)    2‘-O-Me modifications at each nucleotide in the upper stem region; or(ii) 2‘-O-Me modifications at ten or eleven nucleotides in the upper stem region.

32. The sgRNA of claim 31, further comprising one or more of:(a)     2‘-O-Me modifications at the last three, last four, or last five nucleotides at the 3’end of the 3’ terminus; or(b) PS bonds between the last three, four, or five nucleotides at the 3’ end of the 3’ terminus.

33. The sgRNA of claim 31 or claim 32, further comprising a modification at one or more nucleotides in the bulge region.

34. A composition comprising the sgRNA of any one of claims 31-33 and a lipid nanoparticle (LNP).

35. A composition comprising the sgRNA of any one of claims 31-33 and a nuclease or an mRNA which encodes the nuclease.

36. The composition of claim 35, wherein the nuclease is a Cas protein.

37. The composition of claim 36, wherein the Cas protein is a Cas9 protein.

38. The composition of claim 37, wherein the Cas9 protein is an S. pyogenes Cas9 protein.2024201264   24 Jun 202639.    The composition of any one of claims 35-38, wherein the nuclease is a nickase.

40. The composition of any one of claims 35-39, wherein the nuclease is modified.

41. A pharmaceutical formulation comprising the sgRNA of any one of claims 31-33 and a pharmaceutically acceptable excipient or carrier.

42. A method of modifying a target DNA, comprising delivering to a cell: a Cas protein or a nucleic acid encoding a Cas protein, and the sgRNA of any one of claims 31-33, the composition of any one of claims 34-40, or the pharmaceutical formulation of claim 41.

43. The method of claim 42, wherein the Cas protein is an S. pyogenes Cas9 protein.

44. The sgRNA of any one of claims 1-20 and 31-33, the composition of any one of claims21-27 and 34-40, or the pharmaceutical formulation of claim 28 or 41, for use in the treatment of a disease or disorder.

45. Use of the sgRNA of any one of claims 1-20 and 31-33, the composition of any one of claims 21-27 and 34-40, or the pharmaceutical formulation of claim 28 or 41, in the manufacture of a medicament for treating a disease or disorder.

46. A method of treating a disease or disorder, comprising administering to a subject in need thereof the sgRNA of any one of claims 1-20 and 31-33, the composition of any one of claims 21-27 and 34-40, or the pharmaceutical formulation of claim 28 or 41.

Citation Information

Patent Citations

  • Guide RNA with chemical modifications

    WO2016089433A1