DNA aptamer-enabled intraoperative surgical pathology

DNA aptamers targeting CK8 and CK18 enhance intraoperative cancer diagnosis by enabling rapid and accurate detection of cancer cells, addressing the limitations of traditional methods and reducing false-negative rates.

AU2025283633A1Pending Publication Date: 2026-07-09DEAKIN UNIVERSITY

Patent Information

Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
DEAKIN UNIVERSITY
Filing Date
2025-12-19
Publication Date
2026-07-09

Smart Images

  • Figure 00000002_0000
    Figure 00000002_0000
  • Figure 00000096_0000
    Figure 00000096_0000
  • Figure 00000097_0000
    Figure 00000097_0000
Patent Text Reader

Abstract

Abstract A method for detecting a biological marker in a sample, preferably a biological marker on a cancer cell, the method comprising: (i) contacting the sample with at least one DNA aptamer coupled to a first reagent and wherein the aptamer specifically binds to a first biological marker in the sample to form a first complex; (ii) contacting the first complex of (i) with a second binding agent that specifically binds to the first reagent such that a second complex is formed, wherein the second binding agent is coupled to a reporter molecule; (iii) contacting the second complex (ii) with a substrate for the reporter molecule of the at least one second binding agent; and (iv) detecting the substrate reaction by formation of a reaction product thereby detecting the biological marker in the sample. Biological markers include cytokeratin 8 (CK8), cytokeratin 18 (CK18), human epidermal growth factor receptor 2 (HER2) and epithelial cell adhesion molecule (EpCAM). Abstract 41 / 50 FIGURE 40 Frozen section preparation 4 Sample fixation + Wash (10 dips in PBS) DNA aptamer staining DAB Substrate DAB substrate HRP FAM Anti-FITC conjugated with HRP FAM DNA Aptamer conjugated with FAM HRP Frozen section slide / Touch imprint slide / Cytology slide / Direct smear slide Anti-FITC-HRP Wash (10 dips in PBS) DAB Wash (10 dips in PBS) Hematoxylin counter-staining Wash under tap water Cove rs lip DAB brown precipitate at the location of the aptamer B o min 1 min 15 sec 5 min 15 sec 5 min 15 sec 5 min 15 sec 10 sec 1 min 1 min A + Wash (10 dips in PBS) Total time for aptamer-DAB staining: —18 min 4 1 / 5 0 A B 1 0 m i n 1 m i n D A B s u b s t r a t e 1 5 s e c H R P A n t i - F I T C 5 m i n D N A a p t a m e r s t a i n i n g H R P 1 5 s e c 5 m i n 1 5 s e c D N A A p t a m e r c o n j u g a t e d w i t h F A M 5 m i n D A B W a s h ( 1 0 d i p s i n P B S ) F r o z e n s e c t i o n s l i d e / T o u c h i m p r i n t s l i d e / C y t o l o g y s l i d e / D i r e c t s m e a r s l i d e c o u n t e r - s t a i n i n g 1 m i n W a s h u n d e r t a p w a t e r 1 m i n C o v e r s l i p F I G U R E 4 020 25 28 36 33 19 D ec 2 02 5 1 9 D e c 2 0 2 5 A B 1 0 m i n F r o z e n s e c t i o n p r e p a r a t i o n 1 m i n S a m p l e f i x a t i o n D A B 2 0 2 5 2 8 3 6 3 3 s u b s t r a t e 1 5 s e c W a s h ( 1 0 d i p s i n P B S ) H R P A n t i - F I T C 5 m i n D N A a p t a m e r s t a i n i n g H R P 1 5 s e c 5 m i n A n t i - F I T C - H R P T o t a l t i m e f o r 1 5 s e c D N A A p t a m e r W a s h ( 1 0 d i p s i n P B S ) c o n j u g a t e d w i t h F A M 5 m i n D A B s t a i n i n g : ~ 1 8 m i n W a s h ( 1 0 d i p s i n P B S ) F r o z e n s e c t i o n s l i d e / T o u c h i m p r i n t s l i d e / 1 0 s e c H e m a t o x y l i n C y t o l o g y s l i d e / D i r e c t s m e a r s l i d e c o u n t e r - s t a i n i n g 1 m i n W a s h u n d e r t a p w a t e r 1 m i n C o v e r s l i p F I G U R E 4 0
Need to check novelty before this filing date? Find Prior Art

Description

Incorporation by reference All documents cited or referenced herein, and all documents cited or referenced in herein cited documents, together with any manufacturer’s instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference in their entirety. Reference to priority document This application claims priority from Australian Provisional application no. 2024904253 filed 20 December 2024. The entire contents are incorporated herein. Reference to sequence listing The entire content of the electronic submission of the sequence listing is incorporated by reference in its entirety for all purposes. Field The present disclosure is directed to aptamers that specifically bind to cytokeratin 8 (CK8) and / or cytokeratin 18 (CK18) and their use in detecting a biological marker of cancer, preferably a carcinoma or adenocarcinoma. The present disclosure is also directed to an intraoperative surgical pathology method that provides for the rapid identification of cancer cells, particularly carcinoma or adenocarcinoma in a biological sample. Background During cancer surgery, a surgeon will pass a small block of tissue to a pathologist to ask (1) if there are any cancer cells left behind (surgical margin); and (2) whether cancer has spread to lymph nodes (metastasis). During this “intraoperative surgical pathology consultation”, a frozen section examination is usually performed on the specimen and the examination report will then be conveyed within approximately 30 min to the operating surgeon. The report from the pathologist will greatly influence the surgeon’s intra-operational decision. Currently, all pathologists use a 120-year old method in which a frozen tissue section is stained with hematoxylin and eosin (H&E). The stained sample is manually examined with the naked eye and the presence or absence of cancer cells is based on the cellular morphology (Gal A et al., (2005) Arch Pathol Lab Med 129:1532). This procedure is a challenging task for pathologists, as they have to arrive at a correct decision in a shorter duration under pressure based on their experience, judgement and the knowledge of their pathology specialty and clinical medicine. In 2025283633   19 Dec 2025 the absence of the assistance from probing the slide with affinity ligands against cancer biomarkers as in the case of immunohistochemistry using permanently fixed tissue sections, the false-negative rates, which result in re-operation, are about 25% ,and about 15% and about 20% for breast, colorectal and stomach cancer, respectively (Ogrinc N et al., (2021) Trends Mol Med 27:602). For example, the false negative rates of frozen-section analysis of sentinel lymph node and lumpectomy margin status in patients undergoing breast-conservation therapy is about 42% at Memorial Sloan-Kettering Cancer Centre, New York, US (McLaughlin SA et al., (2008) J Am Coll Surg 206:76) which is the first hospital in the United States dedicated specifically for the treatment of cancer, and the second in the world after the London Cancer Hospital. Such false-negative diagnoses impose significant negative impact on patients’ survival rates, mental health and quality of life as well as a waste of precious healthcare resources due to the need for further surgery. Over the past five decades, efforts have been made to improve the sensitivity and accuracy (specificity) of intraoperative surgical pathology via the introduction of antibody staining into the frozen section diagnosis. This has resulted in various forms of rapid immunohistochemistry (Rapid IHC) tests. Invariably, all rapid IHC procedures operate by using the same antibodies on the market but introducing multiple units of reporter molecules termed poly-HRP (horse radish peroxidase) into the antibody staining. The poly-HRP consists of one or several polymer-HRP conjugates either attached to the primary antibody or, more frequently, attached to a secondary antibody. There are at least seven reported systems of antibody-based rapid IHC. Sakura Finetek in Japan has developed a Histo-Tek® R-IHC® utilizing Agilent / Dako’s EnVision HRP-labelled polymer which is conjugated with secondary antibodies. The Histo-Tek® R-IHC® uses an electric field to achieve fast antibody staining of frozen sections (Toda H et al., (2011) Acta Histochem Cytochem 44:133) in which the microscope slides are placed between the electrodes followed by the delivery of a high voltage (4.0-4.5 kV, offset 2.25 kV) and low-high frequency (5-90 Hz) alternating current electric field by the proprietary instrument. Sakura Finetek also developed a special fixation method for frozen section involving the use acetic acid, formalin and ethanol (described in JP2020108336). The RAFT-[cRGD]-ICG system involves the intravenous injection of RAFT scaffold linked to a ligand of the av£3 integrins followed by visualizing tumour margins using a near infrared light and camera (WO2010 / 076334). The Direct Immunohistochemistry Assay developed by Novodiax Inc utilizes a polymeric enzyme-antibody conjugate for frozen section IHC (WO2015171938A1). This procedure involves fixation of slides in glacial acetic acid, 37% formaldehyde and methyl alcohol. It is marketed with its proprietary apparatus (WO2023 / 076000). Guizhou Meixinda Medical Technology Co., Ltd. has developed a rapid IHC by using polyenzyme-antibody combinations some of which are obtained from Novodiax ,Inc (CN112236677A). Shanghai Baiying Biotechnology Co. Ltd has 2025283633   19 Dec 2025 developed a micropolymer-HRP-nano antibody as a reporter for the primary antibody to achieve rapid IHC (CN202110651244.6 and CN113391059). Bio SB Inc (CA, US) has developed a SB Mohs PolyDetector technology with its proprietary Micropolymer backbone, conjugated to AntiMouse and Anti-Rabbit Fab fraction of IgG’s, plus multiple units of HRP. The elimination of the immunoglobulin Fc region aims at reducing non-specific reactions and background. It is marketed with its proprietary instrument. Of note, under this system, the frozen section slide needs to be heated at 60 °C for 3 min followed by fixing in 100% acetone followed by 10% neutral buffered formalin. Finally, a rapid micro-immunohistochemistry system was developed by using a microfluidic device which consists of a horizontally oriented microfluidic probe (Lovchik, RD et al., (2020) Microsys Nanoeng 6:94). Despite the efforts, none of these antibody-based rapid IHC system has been widely adopted by anatomical pathologists due to either the lack of rigorous clinical verification and validation or the infeasibility / impossibility to be incorporated into the routine workflow in intraoperative surgical pathology practice. Given the limitations and challenges of the prior art methods, there is a need in the art for alternative methods that provide rapid and accurate diagnosis of cancer in a tissue sample during an intraoperative surgical pathology consultation (i.e. while the subject is still in surgery so that the surgeon knows whether additional resection of tumour is required). Summary Chemical antibodies, termed aptamers have been increasingly utilised for clinical applications. Due to their small size, they are able to bind to targets not bound by antibodies. Furthermore, they exhibit little immunogenicity and are more stable than conventional antibodies. Advantageously, aptamers can be attached to nanoparticles, drugs or imaging agents without loss of function. The present disclosure is based on the generation of novel aptamers to cytokeratin 8 (CK8) and cytokeratin 18 (CK18) and the use of these aptamers in an aptamerbased intraoperative histochemistry method of surgical pathology. Advantageously, the aptamer-based histochemistry method may also be utilised with other aptamers that bind to a target of interest which is exemplified herein with aptamers that bind HER2, EpCAM and Nucleolin. Aptamer-enabled intraoperative surgical pathology Disclosed herein are also methods of performing histochemistry using the aptamers described herein. Advantageously, the use of DNA aptamers facilitates more rapid and accurate detection of cancer cells compared to traditional surgical pathology methods. 2025283633   19 Dec 2025 In one aspect, there is provided a method for detecting a biological marker in a sample, the method comprising: (i) contacting the sample with at least one DNA aptamer coupled to a first reagent and wherein the aptamer specifically binds to a first biological marker in the sample to form a first complex; (ii) contacting the first complex of (i) with a second binding agent that specifically binds to the first reagent such that a second complex is formed, wherein the second binding agent is coupled to a reporter molecule; (iii) contacting the second complex of (ii) with a substrate for the reporter molecule of the at least one second binding agent; and (iv) detecting a reaction between the reporter molecule and the substrate by formation of a reaction product thereby detecting the biological marker in the sample. In some examples, the substrate for the reporter molecule is a chromogen. In one example, the chromogen is 3,3'-Diaminobenzidine (DAB). In one example, the sample is obtained from a subject undergoing a surgical procedure. In one example, the sample is a biological sample. In one example, the method is performed during surgery, for example while the subject is undergoing surgery for surgical removal of a tumour or suspected tumour. In one example, the biological marker is a marker present on a cancer cell, such as a carcinoma or adenocarcinoma cell. In one example, the marker is a cancer marker. In some examples, the method further comprises performing counterstaining of the sample. Preferably, the counterstaining is performed with a dye that allows for cellular morphology to be visualised under a microscope. In one example, counterstaining is performed by hematoxylin and eosin. In one example, method steps (i) to (v) are performed within 20 minutes, more preferably within 17 minutes. In one example, the biological marker is a protein marker. In one example the biological marker is a cell surface marker. In one example, the method further comprises harvesting a biological sample from a subject having, or suspected of having cancer. The sample may be a tissue sample or a cell sample containing suspected cancerous cells. More particularly, the cancer is a carcinoma or adenocarcinoma, for example selected from a hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma 2025283633   19 Dec 2025 of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma or basal cell carcinoma (BCC) or squamous cell carcinoma (SCC) in various sites. The sample may be selected from a frozen section, a tissue touch imprint, a cellular smear (aspiration cytology), or a fresh tissue sample. The sample may be provided on, or placed onto a solid support. In a further example, the solid support is a microscope slide or a solid support capable of being inspected under a microscope. The sample may be placed onto a microscope slide by various means known in the art, for example by performing a cytospin of a cellular suspension obtained from the biological sample. Preferably, the sample is fixed to the slide. Various methods of fixing are known in the art, for example acetone, ethanol or methanol or the like. Typically, fixation is performed at a temperature of about -20°C. In a preferred example, the sample is fixed with methanol. Endogenous biotin in the sample can be blocked by incubating samples with excess streptavidin followed by excess of biotin; while the endogenous peroxidase activities may be blocked with hydrogen peroxide and sodium azide. Thus, it is understood that the present methods may include such processing steps. In one example, the at least one DNA aptamer is an aptamer that specifically binds to CK8 as described herein according to the disclosure, more preferably human CK8. In a further example, the DNA aptamer comprises or consists of the sequence of 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTCTTTACGCACC-3’ (SEQ ID NO:11). In a further example, the DNA aptamer comprises one or more oligo dT (i.e. TTTTT) spacer sequences. In a further example, the DNA aptamer is dual labelled with biotin and thus comprises a biotin sequence at the 3’ and 5’ ends of the aptamer. In a further example, the DNA aptamer comprises or consists of the sequence 5’- X-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTCTTTACG CACCTTTTT-X-3’ (SEQ ID NO:55), wherein X is biotin. In a further example, the DNA aptamer is dual labelled with FAM. In a further example, the DNA aptamer comprises or consists of the sequence 5’- Y-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCG CCTTTCTTTACGCACCTTTTT-Y-3’, wherein Y is FAM (SEQ ID NO:57). In one example, the at least one DNA aptamer is an aptamer that specifically binds to CK18 as described herein according to the disclosure, more preferably human CK18. In a further example, the DNA aptamer comprises or consist of the sequence of 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50). In a further example, the DNA aptamer comprises one or more oligo dT (i.e. TTTTT) spacer 2025283633   19 Dec 2025 sequences. In a further example, the DNA aptamer is dual labelled with biotin and comprises or consists of the sequence 5’-X-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACC GAATGGTATTCGTTTTT-X-3’, wherein X is biotin (SEQ ID NO:56). In a further example, the DNA aptamer is dual labelled with FAM and comprises or consists of the sequence 5’-Y-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT-Y-3’ (SEQ ID NO:58), wherein Y is FAM. In one example, the at least one DNA aptamer is an aptamer that specifically binds to HER2, more preferably human HER2. In a further example, the DNA aptamer comprises or consists of the sequence of 5’-TTTTTTTTCCTCCATTGGTTTTTTT-3’ (SEQ ID NO:59). In a further example, the DNA aptamer comprises or consists of the sequence 5’-TTTTTGCAGCGGTGTGGGGGCAGCGGTGTGGGGGCAGCGGTGTGGGG-3’ (SEQ ID NO:60). The aptamer may be coupled to a reagent (e.g. biotin or FAM) as described herein. In one example, the at least one DNA aptamer is an aptamer that specifically binds to EpCAM, more preferably human EpCAM. In a further example, the DNA aptamer comprises or consists of the sequence 5’-TTTCACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTTTTT-3’ (SEQ ID NO:61). The aptamer may be coupled to a reagent (e.g. biotin or FAM) as described herein. In one example, the at least one DNA aptamer is an aptamer that specifically binds to nucleolin, more preferably human nucleolin. In a further example, the DNA comprises or consists of the sequence 5’-TTTTTGGTGGTGGTGGTTGTGGTGGTGGTGGTTT-3’ (SEQ ID NO:62). The aptamer may be coupled to a reagent (e.g. biotin or FAM) as described herein. The method may be performed with aptamers that bind to either CK8 or CK18 or both CK8 and CK18 in combination with one or more of an aptamer that binds the HER2, EpCAM or nucleolin. In one example, the at least one DNA aptamer has been prior folded prior to contacting the sample. In a particular example, the DNA aptamer is prior folded by heating in the presence of MgCl2 as described in the methods herein. In some embodiments, the DNA aptamer is coupled to a reagent selected from the group consisting of biotin or an analog thereof or fluorescein amidite (FAM) or an analog thereof. Examples of suitable biotin analogs includes desthiobiotin, iminobiotin, biotin-NHS ester, biotin-PEG-oxyamine, biotin hyrazide or biotin HPDP. Examples of suitable FAM analogs include 6-FAM (6-carboxyfluorescein) and FAM isothiocynate or fluorescein derivative such as FITC (fluorescein-5,6-isothiocyanate). More particularly, the reagent may be coupled to each nucleotide strand comprising a stem region of the aptamer, wherein the stem region comprises complementary nucleic acid bases. 2025283633   19 Dec 2025 The person skilled in the art will be familiar with other reagents that may be suitable in the disclosed methods, particularly where the reagent has a corresponding binding partner. Examples include DNP, digoxigenin, avidin, streptavidin, neutravidin, or an antibody that binds to the reagent. In another example, second binding agent is coupled to a reporter molecule which may be an enzyme. In a further example, the enzyme is horseradish peroxidase (HRP), alkaline phosphatase (AP), beta-galactosidase, glucose-6-phosphate dehydrogenase or luciferase. Preferably, the second binding agent is compatible with the first reagent such that the second binding agent specifically binds to the first reagent. In a particular example, the first reagent is biotin or an analog thereof and the second binding agent is streptavidin or neutravidin. In a further particular example, the first reagent is FAM or an analog thereof and the second binding agent is anti-FITC. The inventor has found that in certain embodiments of the method that are biotin free, the method is optimised when the aptamer buffer comprises 1% Triton X-100. Thus, in a further aspect, there is provided a composition comprising a DNA aptamer described herein in a buffer comprising about 1% Triton X-100. The substrate chromogen is preferably a compound that develops a colour when contacted with the reporter molecule. In some examples, the chromogen forms a permanent brown precipitate when contacted with the reporter molecule. In a further example, the chromogen is 3,3'Diaminobenzidine (DAB) or an analog thereof. In some examples, the chromogen emits a fluorescence when contacted with the reporter molecule. In some examples, the method comprises counterstaining the sample. Preferably, the counterstaining shows cellular morphology. In some examples, the counterstaining is performed with hematoxylin and eosin using standard methods in the art. Examples of hematoxylin stains include Gill’s No.1, Gill’s No.2 and Gill’s No.3, Harris and Mayer’s. In some examples, the method may be performed with more than one DNA aptamer that binds to a biological marker of interest. In one example, step (i) comprises contacting the sample with DNA aptamer that specifically binds to CK8 and a second DNA aptamer that specifically binds to CK18. In some examples, step (i) comprises contacting the sample with two or more aptamers selected from the group consisting of an aptamer that specifically binds to CK8, an aptamer that specifically binds to CK18, an aptamer that specifically binds to HER2, an aptamer that specifically binds to EpCAM and an aptamer that specifically binds to nucleolin as described herein. In some examples, the DNA aptamer binds to a cancer marker selected from the group consisting of TRA-1-60, SSEA-1, ALDH1A1, Lgr5, CD13, CD19, CD20, CD24, CD26, CD27, CD34, CD38, CD44, CD45, CD47, CD49f, CD66c, CD90, TNFRSF16, CD105, CD133, CD117 / c-kit, CD138, CD151 and CD166. 2025283633   19 Dec 2025 In one example, the second DNA aptamer is coupled to a second reagent. The first and second reagents may be the same or different. In some examples, the method is performed at room temperature. It will be appreciated that the methods of the disclosure provide rapid and sensitive detection of cancer cells in a sample. Furthermore, the methods of the disclosure allow for quantitative determination of a biomarker in the sample. Preferably, the methods further include one or more washing steps. Preferably, the method further comprises applying a coverslip to the microscope slide. In another aspect, there is provided a method for detecting a biological marker in a sample, the method comprising: (i) contacting the sample with a DNA aptamer that specifically binds to CK8 and optionally at least one further DNA aptamer that binds a cancer marker, wherein the DNA aptamer is coupled to biotin and wherein the aptamer specifically binds to CK8 in the sample to form a complex; (ii) contacting the first complex of (i) with a second binding agent that specifically binds to biotin such that a second complex is formed, wherein the second binding agent comprises streptavidin or neutravidin coupled to HRP; (iii) contacting the second complex (ii) with a DAB substrate; (iv) optionally counterstaining the sample with hematoxylin and eosin; and (v) detecting the DAB precipitate formed by reaction with HRP thereby detecting the biological marker in the sample. In one example, the method further comprises fixing the sample in methanol as described herein. In another example, the method comprises (i) contacting the sample with a DNA aptamer that specifically binds to CK8 and a DNA aptamer that specifically binds to CK18 wherein each DNA aptamer is coupled to biotin. In one example, the aptamer is dual labelled with biotin (i.e. biotin bound to 3’ and 5’ ends of the aptamer). In one example, the method further comprises one or more washing steps, preferably between each of steps (i) to (iv) above. In one example, the CK8 aptamer comprises or consists of SEQ ID NO:11 or SEQ ID NO:55. In one example, the CK18 aptamer comprises or consists of SEQ ID NO:50 or SEQ ID NO:56. In some examples, the method comprises (i) contacting the sample with a DNA aptamer that binds to CK8 and a further DNA aptamer that binds to a biological marker of interest. In some examples, the further DNA aptamer is selected from one or more of SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61 and SEQ ID NO:62. 2025283633   19 Dec 2025 In another aspect, there is provided a method for detecting a biological marker in a sample, the method comprising: (i) contacting the sample with a DNA aptamer that specifically binds to CK8, and optionally at least one further DNA aptamer that binds a cancer marker wherein the DNA aptamer is coupled to FAM and wherein the aptamer specifically binds to CK8 in the sample to form a complex; (ii) contacting the first complex of (i) with a second binding agent that specifically binds to FAM such that a second complex is formed, wherein the second binding agent comprises an anti-FITC antibody coupled to HRP; (iii) contacting the second complex (ii) with a DAB substrate; (iv) optionally counterstaining the sample with hematoxylin and eosin; and (v) detecting the DAB precipitate formed by reaction with HRP thereby detecting the biological marker in the sample. In one example, the method further comprises fixing the sample in methanol as described herein. In another example, the method comprises (i) contacting the sample with a DNA aptamer that specifically binds to CK8 and a DNA aptamer that specifically binds to CK18 wherein each DNA aptamer is coupled to FAM. In one example, the aptamer is dual labelled with FAM (i.e. FAM bound to 3’ and 5’ ends of the aptamer). In one example, the method further comprises one or more washing steps, preferably between each of steps (i) to (iv) above. In one example, the CK8 aptamer comprises or consists of SEQ ID NO:11 or SEQ ID NO:57. In one example, the CK18 aptamer comprises or consists of SEQ ID NO:50 or SEQ ID NO:58. In some examples, the method comprises (i) contacting the sample with a DNA aptamer that binds to CK8 and a further DNA aptamer that binds to a biological marker of interest. In some examples, the further DNA aptamer is selected from one or more of SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61 and SEQ ID NO:62. In another aspect, there is provided a method for detecting a biological marker in a sample, the method comprising: (i) contacting the sample with a DNA aptamer that specifically binds to CK18 and optionally at least one further DNA aptamer that binds a cancer marker, wherein the DNA aptamer is coupled to biotin and wherein the aptamer specifically binds to CK18 in the sample to form a complex; 2025283633   19 Dec 2025 (ii) contacting the first complex of (i) with a second binding agent that specifically binds to biotin such that a second complex is formed, wherein the second binding agent comprises streptavidin or neutravidin coupled to HRP; (iii) contacting the second complex (ii) with a DAB substrate; 5 (iv) optionally counterstaining the sample with hematoxylin and eosin; and (v) detecting the DAB precipitate formed by reaction with HRP thereby detecting the biological marker in the sample. In one example, the method further comprises fixing the sample in methanol as described herein. 10 In another example, the method comprises (i) contacting the sample with a DNA aptamer that specifically binds to CK18 and a DNA aptamer that specifically binds to CK8 wherein each DNA aptamer is coupled to biotin. In one example, the aptamer is dual labelled with biotin (i.e. biotin bound to 3’ and 5’ ends of the aptamer). In one example, the method further comprises one or more washing steps, preferably 15 between each of steps (i) to (iv) above. In one example, the CK18 aptamer comprises or consists of SEQ ID NO:50 or SEQ ID NO:56. In one example, the CK8 aptamer comprises or consists of SEQ ID NO:11 or SEQ ID NO:55. In some examples, the method comprises (i) contacting the sample with a DNA aptamer that binds to CK18 and a further DNA aptamer that binds to a biological marker of interest. In 20 some examples, the further DNA aptamer is selected from one or more of SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61 and SEQ ID NO:62. In another aspect, there is provided a method for detecting a biological marker in a sample, the method comprising: (i) contacting the sample with a DNA aptamer that specifically binds to CK18, and 25 optionally at least one further DNA aptamer that binds a cancer marker wherein the DNA aptamer is coupled to FAM and wherein the aptamer specifically binds to CK18 in the sample to form a complex; (ii) contacting the first complex of (i) with a second binding agent that specifically binds to FAM such that a second complex is formed, wherein the second binding agent comprises an 30 anti-FITC antibody coupled to HRP; (iii) contacting the second complex (ii) with a DAB substrate; (iv) optionally counterstaining the sample with hematoxylin and eosin; and (v) detecting the DAB precipitate formed by reaction with HRP thereby detecting the biological marker in the sample. 35 In one example, the method further comprises fixing the sample in methanol as described herein. 2025283633   19 Dec 2025 In another example, the method comprises (i) contacting the sample with a DNA aptamer that specifically binds to CK18 and a DNA aptamer that specifically binds to CK8 wherein each DNA aptamer is coupled to FAM. In one example, the aptamer is dual labelled with FAM (i.e. FAM bound to 3’ and 5’ ends of the aptamer). In one example, the method further comprises one or more washing steps, preferably between each of steps (i) to (iv) above. In one example, the CK18 aptamer comprises or consists of SEQ ID NO:50 or SEQ ID NO:58. In one example, the CK8 aptamer comprises or consists of SEQ ID NO:11 or SEQ ID NO:57. In some examples, the method comprises (i) contacting the sample with a DNA aptamer that binds to CK18 and a further DNA aptamer that binds to a biological marker of interest. In some examples, the further DNA aptamer is selected from one or more of SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61 and SEQ ID NO:62. Uses In a further aspect, the present disclosure provides a method for diagnosing a subject with cancer, the method comprising: (i) contacting a sample obtained from the subject with at least one DNA aptamer coupled to a first reagent and wherein the aptamer specifically binds to a first biological marker in the sample to form a first complex; (ii) contacting the first complex of (i) with a second binding agent that specifically binds to the first reagent such that a second complex is formed, wherein the second binding agent is coupled to a reporter molecule; (iii) counterstaining the sample; (iii) contacting the second complex (ii) with a substrate chromogen for the reporter molecule of the at least one second binding agent; and (iv) detecting the substrate chromogen reaction by formation of a reaction product thereby diagnosing the subject with cancer. In one example, the sample is obtained from a subject undergoing a surgical procedure. In one example, the method is performed during surgery. In another example, the method is performed during intraoperative surgical pathology consultation. In one example, the method further comprises harvesting a sample as described herein. In a further example, the time from harvesting the sample to obtaining a result is less than 30 minutes, preferably about 20 mins. In one example, the subject is suspected of having cancer, for example a carcinoma or adenocarcinoma. 2025283633   19 Dec 2025 In one example, the sample is a cell or tissue sample, for example a biopsy sample. In one example, the DNA aptamer is an aptamer described herein. In another example, the at least one aptamer comprises an aptamer that binds to CK8 and an aptamer that binds to CK18. In some examples, the at least one DNA aptamer comprises an aptamer that binds to CK8 and one or more aptamers selected from CK18, HER2, nucleolin and EpCAM. In some examples, the at least one DNA aptamer comprises an aptamer that binds to CK18 and one or more aptamers selected from CK8, HER2, nucleolin and EpCAM. In another aspect, the present disclosure provides a method of treating cancer in a subject, the method comprising: (i) detecting or diagnosing cancer according to a method described herein and (ii) subsequently treating the subject. In some examples, treating the subject comprises one or more of surgery, chemotherapy, radiotherapy, immunotherapy, or drug therapy. CK 8 aptamer In one aspect, there is provided an isolated aptamer which specifically binds to a cytokeratin 8 (CK8) peptide comprising or consisting of the sequence QRGELAIKDANAKLSELEAALQRAKQ (SEQ ID NO:63). In one example, binding is determined by ELISA using human CK8 protein. In one example, the aptamer comprises or consists of a sequence selected from the group consisting of: (i) 5’-TATGGGGTCGACTAAATTATGTATATGTCTAAAATGGATCATAACGGGTCTAT GCGTTTCG-3’ (SEQ ID NO:1); (ii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCATGTTTTATGTTCGCCTTTCTT TACGCACC-3’ (SEQ ID NO:2); (iii) 5’-ATTCTCTAAAAACGTTTTATGGAGTTTTTATCTTGTCTTGCTGTGTTAGCTCAA TATCCATG-3’ (SEQ ID NO:3); (iv) 5’-TGTAGAATTATTACCATGCTGAGAGGTTGGTAGTGCGGTCCTATGCGGGAG GTGGGTCGCTT-3’ (SEQ ID NO:4); (v) 5’-ATTTATAGTTATGAGTCGCTTGACGCTAACCCTCCGCCTATAGGCAAAGTAG GCACCTTATC-3’ (SEQ ID NO:5); (vi) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCATGTTTTATGGTCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:7); (vii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTAACATGTTTTATGTTCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:8); (viii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCGTGTTTTACGTTCGCCTTTC 2025283633   19 Dec 2025 TTTACGCACC-3’ (SEQ ID NO:9); (ix) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGTCGCCTTTCTTT ACGCACC-3’ (SEQ ID NO:10); (x) 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTCT TTACGCACC-3’ (SEQ ID NO:11); (xi) 5’-AATTGTCTATGACCCTCCTAACCATGTTTTATGGTTCGCCTTTCTTTACGCA CC-3’ (SEQ ID NO:12); (xii) 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATATTTTATGGTTCGCCTTTCT TTACGCACC-3’ (SEQ ID NO:13); (xiii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGCCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:14); (xiv) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGCCGCCC-3’ (SEQ ID NO:15); and (xv) 5’- AATTGTCTATGACCCTATTCAGTTCCTTGCAATATTTTATTGCCGCCTTTCT TTACGCACC-3’ (SEQ ID NO:16); or a sequence at least 90% identical thereto to any one of SEQ ID NOs 1-16. In a particular example, the aptamer comprises or consists of the sequence 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTCTTTACGCACC-3’ (SEQ ID NO:11). In a further particular example, the aptamer comprises or consists of the sequence 5’-X-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTCTTTAC GCACCTTTTT-X-3’ (SEQ ID NO:55), wherein X is biotin. In a further particular example, the aptamer comprises or consist of the sequence 5’-Y-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTCTTTAC GCACCTTTTT-Y-3’ (SEQ ID NO:57), wherein Y is FAM. In a particular example, the aptamer is a DNA aptamer. The aptamer may comprise one or more modifications that improve aptamer stability in vitro. For example, the aptamer may comprise a modification of one or more pyrimidine bases (cytosine (C) and thymine (T)) that are 2’-fluoro (2’-F) modified or 2’-O-methyl modification. In another example, the aptamer may comprise one or more sugar modifications, for example, the 4’-oxygen atom of the sugar unit may be replaced with a sulfur atom to increase stability. In another example, the aptamer may comprise a phosphorothioate (PS) and / or phosphorodiothioate (PS2) linkage. In another example, the aptamer may comprise a 3’ or 5’ cap (e.g. 3’ biotin) to protect the aptamer from nuclease digestion. In another example, the aptamer may comprise a terminal alkyne to enhance binding affinity. In another example, the aptamer comprises a histidine tag. Other suitable modifications will be familiar to persons skilled in the art, for example, 2’-deoxy, 2’-halo (including 2025283633   19 Dec 2025 2’-fluoro), 2’-amino (preferably not substituted or mono- or disubstituted), 2’-mono-, di- or tri-halomethyl, 2‘-alkyl, azido, phosphorothioate, sulfhydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diamino purine, 2-hydroxy-6-mercaptopurine and pyrimidine bases substituted at the 6-position with sulfur or 5 position with halo or C15 alkyl groups, abasic linkers, 3‘-deoxy-adenosine as well as other available “chain terminator” or “non-extendible” analogs, or labels such as 32P, 33P and the like. All of the foregoing can be incorporated into an DNA using the standard synthesis techniques disclosed herein. In a particular example, the aptamer is biotinylated. In one example, the aptamer binds to human CK8. In another example, the aptamer binds to a cancer cell expressing CK8 but does not substantially bind to a cell that does not express CK8. In another example, the aptamer binds to CK8 but does not substantially bind to CK17, CK18, CK19 and / or CK20. In another example, the aptamer does not substantially bind to CD9, CD80, EpCAM, Herceptin 2 (HER2) or Ectodysplasin A receptor (EDAR). In another example, the aptamer binds to a carcinoma or an adenocarcinoma. In another example, the carcinoma or adenocarcinoma is selected from one or more of hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma as well as basal cell carcinoma or squamous cell carcinoma (in various sites). In another example, the aptamer does not bind glioblastoma. In one example, the aptamer binds to CK8 with a Kd of about 121nM or less. In another example, the aptamer binds to CK8 with a Kd or 100 nM or less or 50nM or less. In another example, the aptamer binds to CK8 with a Kd or about 46nM. In one example, the aptamer is coupled to a detectable label. Examples of detectable labels include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, electron dense labels, labels for MRI and radioactive materials, or labels for histochemistry. In some examples, the aptamer is coupled to a reagent. In some examples, the reagent is biotin or 6-carboxyfluorescein (FAM) / fluorescein 5(6)-isothiocyanate (FITC). In another aspect, there is provided a diagnostic agent comprising a DNA aptamer described herein coupled to a detectable label or reagent described herein. In a particular example, the diagnostic agent is for use in histological examination of a biological sample, 2025283633   19 Dec 2025 preferably a cancer sample. In one example, the CK8 aptamer is coupled to biotin. In one example, the CK8 aptamer is coupled to FAM. In one example, biotin or FAM is coupled to the 5’ end or the 3’ end of the aptamer. In another aspect, there is provided a method for identifying a cancer cell expressing CK8 in a biological sample obtained from a subject having, or suspected of having cancer, the method comprising contacting the sample with a DNA aptamer described herein or a diagnostic agent described herein. In one example, the biological sample is a frozen section. In one example, the biological sample is cytospun to a slide (e.g. cytospin slide). In another example, the biological sample has been subjected to fixation following removal from the subject. CK18 aptamer In one aspect, there is provided an isolated aptamer which specifically binds to a cytokeratin 18 (CK18) peptide comprising or consisting of the sequence KVKLEAEIATYRRLLE (SEQ ID NO:64). In one example, binding is determined by ELISA using human CK18 protein. In one example, the aptamer comprises or consists of a sequence selected from the group consisting of: (i) 5’-CGGCACGTGGAGGGTGATGGGGGGGGCAACGGGGACTTACATCCGTATGCT GGGGGGAGCGA-3’ (SEQ ID NO:17); (ii) 5’-GCAAATGGCACCGCTTCACCCGAGGTGGATTGAATGGTCGCATGACGCGTG GGCCAGCCCAG-3’ (SEQ ID NO:18); (iii) 5’-AAGGCTGCAATCCGTTGTGTAACGGCGACCTTCAACTACTAACCTACAACT TAGGGTCTA-3’ (SEQ ID NO:19); (iv) 5’-GTTATGTCGGAGCTCGTATGATACAGGCCCAAGTCGGCTA-3’ (SEQ ID NO:20); (v) 5’-AGGGGTAACTGCGATTTTAAATGTCGCTCCCCCTGCGTG-3’ (SEQ ID NO:21); (vi) 5’-TACGGGGCTGATGCTTTTTGCTCACGCGAAGAGACGATCCAACCTAGTTCTC CACGTCACCT-3’ (SEQ ID NO:68); (vii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22); (viii) 5’-AAAGGTTGATCTTGTTTCGACTAGAAATTTGGTCATAAAC-3’ (SEQ ID NO:23); (ix) 5’-GTCTAGACCGTACATATTGGATCTCACCTAATCACCTTTGTAACCCGCGAGC ACAAATATCCA-3’ (SEQ ID NO:24); (x) 5’-TACACACTTTGAGTTTTTGAATTCGGTATGTATCAGCTCCGGCTTATCTTGTG GTCCTTTTG-3’ (SEQ ID NO:25); (xi) 5’-GGAATGAGATCAATTATCGTGCATAGGATGCGGAAATTGGACCGCTTTGAC 2025283633   19 Dec 2025 ACTTATTTCAT-3’ (SEQ ID NO:26); (x) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGAC TTATAATTCCC-3’ (SEQ ID NO:27); (xi) 5’-TTAGATGTTGATCCAAGTGGCTGCTGAGCGAAAAGGGGTCTTTTCTTCAGT AGCTACGTCCT-3’ (SEQ ID NO:28); (x) 5’-TTAAGGCATCGATTGATCTCGTTGTCTAGCCCCAGGATTCCGTATTTGAGTA CTCTGTAGAA-3’ (SEQ ID NO:29); (xi) 5’-CCACAATGCCTCTCGCCGAATGCGGTGCGACAGTAAACTACTGGTCATCG GGATCTCGGAGT-3’ (SEQ ID NO:30); (xii) 5’-GTGCGTAGGTAACACAGGAATACGTAACTCTCAATCCTA-3’ (SEQ ID NO:31); (xiii) 5’-GCGGCGATTTCGCAAAACCTCAGGACGTCACGTGAGGGAAATTACCGCT TCTGTTGAGTATG-3’ (SEQ ID NO:32); (xiv) 5’-AGGCCTCTCATACCGAATCTGTACTAATTCTAAGACTCTGGCTCCAGACCT CGCGTTTTA-3’ (SEQ ID NO:33); (xv) 5’-GTGTAATATCTCAAAAGCCTAGCTATCATACGGAAAAGGCTGCATCCTAATG CCGGCCGCCC-3’ (SEQ ID NO:34); (xvi) 5’-CCGAGTGGGGACAAGGCATGAGGAATCTTAGTTGCGGCGG-3’ (SEQ ID NO:35); (xvii) 5’-TGGTGGCGGTATTCGTGCGATGTCGGAGTGTGTTGGGAAATCCAGGGGT CGCTCGCAAGGTA-3’ (SEQ ID NO:36); (xviii) 5’-GAGAGGGTTAGTCTACTGTATACGCCTTTAACATGGATCTATCCTACCACC TTTTCGACTTT-3’ (SEQ ID NO:37); (xix) 5’-GACTAGGCTCAGGATTGTAATTGTGTCTTCACCCACGCGGGCCGTCCGCT GGTCCGCTCGGG-3’ (SEQ ID NO:38); and (xx) 5’-CAAAGTGCTAGCAGTCGACGCGGTGGAACAGTAGCTTGGAAGTAAACTGAA TCCGGCGGTCT-3’ (SEQ ID NO:39); or a sequence at least 90% identical thereto to any one of SEQ ID NOs 17-39 and 68. In one example, the aptamer comprises or consists of a sequence selected from the group consisting of: (i) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22); (ii) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGACT TATAATTCCC-3’ (SEQ ID NO:27); (iii) 5’-ACCTCGAATGGTATTCG-3’ (SEQ ID NO:40); (iv) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACCGAATGG TATTCG-3’ (SEQ ID NO:41); 2025283633   19 Dec 2025 (v) 5’-TGCAATGATGTAAAACGTGATCATG-3’ (SEQ ID NO:42); (vi) 5’-CAATGATGTGAAACGTGATCATGGAATCATACACCGAATGGTATTCG-3’ (SEQ ID NO:43); (vii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44); (viii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGACCGAATGGTATTCG-3’ (SEQ ID NO:45); (ix)    5’-ATGTTGCAATGCTGTGAAACGTGAGCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:46); (x)    5’-ATGTTGCAAGGATGTGAAACGTGATCCTGGACACCGAATGGTATTCG-3’ (SEQ ID NO:47); (xi)   5’-ATGTTGCAGGGATGTGAAACGTGATCCCGGACACCGAATGGTATTCG-3’ (SEQ ID NO:48); (xii) 5’-ATGTTGCAATGAAGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:49); (xiii) 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50); (xiv) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGATGGTATCCG-3’ (SEQ ID NO:51); (xv)    5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCAAATGGTATTTG-3’ (SEQ ID NO:52); (xvi)    5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACAAAATGGTATTTT-3’ (SEQ ID NO:53); and (xvii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGGTGGTACCCG-3’ (SEQ ID NO:54); or a sequence at least 90% identical thereto to any one of SEQ ID NOs 40-54. In one example, the aptamer comprises or consists of a sequence selected from: (i) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22); (ii) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGAC TTATAATTCCC-3’ (SEQ ID NO:27); (iii)    5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44); (iv)    5’-ATGTTGCAAGGATGTGAAACGTGATCCTGGACACCGAATGGTATTCG-3’ (SEQ ID NO:47); 2025283633   19 Dec 2025 (v)    5’-ATGTTGCAGGGATGTGAAACGTGATCCCGGACACCGAATGGTATTCG-3’ (SEQ ID NO:48); (vi)    5’-ATGTTGCAATGAAGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:49); (vii) 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50); (viii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGATGGTATCCG-3’ (SEQ ID NO:51); (vix) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCAAATGGTATTTG-3’ (SEQ ID NO:52); (x) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACAAAATGGTATTTT-3’ (SEQ ID NO:53); and (xi) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGGTGGTACCCG-3’ (SEQ ID NO:54); or a sequence at least 90% identical thereto to any one of SEQ ID NOs 44 or 47-54. In a particular example, the aptamer comprises or consists of the sequence 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44). In another particular example, the aptamer comprises or consists of the sequence 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50). In another particular example, the aptamer comprises or consists of the sequence 5’-X- TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT-X-3’ (SEQ ID NO:56), wherein X is biotin. In another particular example, the aptamer comprises or consists of the sequence 5’-Y- TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT-Y-3’ (SEQ ID NO:58), wherein Y is FAM. In a particular example, the aptamer is a DNA aptamer. The aptamer may comprise one or more modifications that improve aptamer stability in vitro. For example, the aptamer may comprise a modification of one or more pyrimidine bases (cytosine (C) and thymine (T)) that are 2’-fluoro (2’-F) modified. In another example, the aptamer may comprise one or more sugar modifications, for example, the 4’-oxygen atom of the sugar unit may be replaced with a sulfur atom to increase stability. In another example, the aptamer may comprise a phosphorothioate (PS) and / or phosphorodiothioate (PS2) linkage. In another example, the aptamer may comprise a 3’ or 5’ cap (e.g. 3’ biotin) to protect the aptamer from nuclease digestion. In another example, the aptamer may comprise a terminal alkyne to enhance binding affinity. In another example, the aptamer comprises a histidine tag. Other suitable modifications will be familiar to persons skilled in the art, including, but not limited to 2’-deoxy, 2’-amino (preferably not substituted or 2025283633   19 Dec 2025 mono- or disubstituted), 2’-mono-, di- or tri-halomethyl, 2‘-alkyl, azido, phosphorothioate, sulfhydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diamino purine, 2-hydroxy-6-mercaptopurine and pyrimidine bases substituted at the 6-position with sulfur or 5 position with halo or C15 alkyl groups, abasic linkers, 3‘-deoxy-adenosine as well as other available “chain terminator” or “non-extendible” analogs (at the 3‘-end of the DNA). All of the foregoing can be incorporated into an DNA using the standard synthesis techniques disclosed herein. In a particular example, the aptamer is biotinylated. In one example, the aptamer binds to human CK18. In another example, the aptamer binds to a cancer cell expressing CK18 but does not substantially bind to a cell that does not express CK18. In another example, the aptamer binds to CK18 but does not substantially bind to CK5, CK17, CK19, CK20 or CK8. In another example, the aptamer does not substantially bind to membrane proteins B2M, SPP1, CRISP3, or CD80. In another example, the aptamer does not substantially bind to extracellular proteins EDAR, FABP2, PD-L1, HER2, or EpCAM. In one example, the aptamer binds to CK18 with a Kd of about 200nM or less, preferably about 196 nM. In another example, the aptamer binds to a carcinoma or an adenocarcinoma cell. In another example, the carcinoma or adenocarcinoma is selected from one or more of hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma as well as basal cell carcinoma or squamous cell carcinoma (in various sites). In another example, the aptamer does not bind glioblastoma. In one example, the aptamer is coupled to a detectable label. Examples of detectable labels include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, electron dense labels, labels for MRI and radioactive materials, or labels for histochemistry. In another example, the aptamer is coupled to a reagent. In some examples, the reagent is biotin or FAM / FITC. In another aspect, there is provided a diagnostic agent comprising a DNA aptamer described herein coupled to a detectable label. In a particular example, the diagnostic agent is for use in histological examination of a biological sample, preferably a cancer sample. In one example, the CK18 aptamer is coupled to biotin. In one example, the CK18 aptamer is coupled to FAM. In one example, biotin or FAM is coupled to the 5’ end or the 3’ end of the aptamer. 2025283633   19 Dec 2025 In another aspect, there is provided a method for identifying a cancer cell expressing CK18 in a biological sample obtained from a subject having, or suspected of having cancer, the method comprising contacting the sample with a DNA aptamer described herein or a diagnostic agent described herein. In one example, the biological sample is a frozen section. In one example, the biological sample is cytospun to a slide (e.g. cytospin slide). In another example, the biological sample has been subjected to fixation following removal from the subject. Each example of the disclosure shall be taken to apply mutatis mutandis to all methods described herein. Figures Figure 1 shows a schematic representation of the CK8 / CK18 protein-based ELISA according to a preferred embodiment of the disclosure. Figure 2 shows screening of CK8 aptamer candidates via ELISA. The bar represents fold change of the binding of full-length CK8 aptamer candidates to the immobilized recombinant CK8 protein (Abcam, Cat No.: ab156970) when compared with the negative control protein ectodysplasin A receptor (EDAR) (Sino Biological, Cat No.: 11577-H08H). The data shown are means ± SD (n=3). Figure 3 shows secondary structure of SEQ ID NO: 2 and its first round mutagenesis. The secondary structure of SEQ ID NO: 2 is modelled using UNAFold (Integrated DNA Technologies, Inc.). The positions and the nature of mutation introduced are overlayed onto the secondary structure of SEQ ID NO: 2. Figure 4 shows CK8 protein binding by clones of first round mutagenesis of SEQ ID NO: 2. The bar represents fold change of the binding of the derivatives of CK8 SEQ ID NO: 2 aptamer after first round mutagenesis to immobilized recombinant CK8 protein (Abcam, Cat No.: ab156970) when compared with the negative control protein EDAR (Sino Biological, Cat No.: 11577-H08H). The data shown are means ± SD (n=3). Figure 5 shows schematic illustration of the second round of mutagenesis via deletion or point mutation for aptamers SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 10. Figure 6 shows the binding of the engineered aptamers in the second round of mutagenesis to the immobilized recombinant cytokeratin 8 protein. The bar represents fold change of the binding of the derivatives of CK8 SEQ ID NO: 2 aptamer after first round mutagenesis to recombinant 2025283633   19 Dec 2025 CK8 protein (Abcam, Cat No.: ab156970) when compared with the negative control protein EDAR (Sino Biological, Cat No.: 11577-H08H). The data shown are means ± SD (n=3). Figure 7 shows the specificity of to the recombinant cytokeratin 8 binding of selected CK8 5 aptamers. The bar represents fold change of the binding of the selected CK8 aptamers (500 nM) to immobilized recombinant CK8 protein (Abcam, Cat No.: ab156970) when compared with the negative control protein EDAR (Sino Biological, Cat No.: 11577-H08H). The data shown are means ± SD (n=3). 10 Figure 8 shows confirmation of the absence of cytokeratin 8 mRNA or protein in A549-CK8 gene knockout cells. The CK8 gene was knocked out using standard CRISPR gene editing technology. (A) RT-PCR using primers that cover the KRT8 cDNA from Exon 2 to Exon 9 using the primer pair of WT up: 5’-CAAAGGCCCACTGCTGACTAAT-3’ (SEQ ID NO:65) and WT down: 5’-CCGACTCCCAGAAACTTCACTCT-3’ (SEQ ID NO:66). A band of 1143 bp is only present in the 15 parenteral WT cells and absent in all of the 6 CK8-KO clones. (B) RT-PCR to verify the absence or presence of CK8 mRNA in A549 CK8 gene knockout (KO) cell clones. Top panel: the CK8 mRNA was only present in wild-type A549 cells. Bottom panel: RT-PCR procedure positive control. Hypoxanthine phosphoribosyl transferase (HPRT)-specific primers were used in RT-PCR with the mRNA extracted from all eight samples as loading controls: A 168 bp band is 20 present in all of the 6 KO clones as well as the parenteral wild-type A549 cells. (C) Confirmation of the absence of CK8 protein in A549-CK8-KO clones. The wildtype A549 cells were used as a CK8-positive control while U-118 MG was used as a CK8-negtaive control along with six CK8-KO clones. Anti -CK8 tagged with HRP (1:2500, Abcam, Cat No.: ab193094) was used to test the absence of CK8 protein (52 kDa). Presence of proteins in all the cell lines was confirmed 25   using anti-p-actin antibody (1:1000, Sigma, Cat No.: A5441). Image captured in ImageQuant LAS 4000. Figure 9 shows the validity of intracellular flow cytometry assay for ligand binding to cytokeratin. Median fluorescent intensity (MFI) ratio of the binding of anti-CK8-TS1 antibody labelled with PE 30 (1:200 dilution, Leica Biosystems,Cat # NCL-L-CK8-TS1) with multiple CK8-positive and CK8-negative cell lines with respect to that to U-118 MG which was used as a baseline for the background binding. Statistical analysis was carried out using One-way ANOVA with Dunnett’s multiple comparison test where **, p<0.006; and ns, non-statistically significant. Data shown are means ± SD, n=3. 2025283633   19 Dec 2025 Figure 10 shows confirmation of the binding of CK8 aptamer to native human cytokeratins via intracellular flow cytometry assay. (A) Median fluorescent intensity (MFI) ratio of SEQ ID NO: 6 aptamer (500 nM) labelled with FAM in multiple CK8-positive and CK8-negative cell lines to that in U-118 MG. (B) MFI ratio of 500 nM SEQ ID NO: 11 aptamer labelled with FAM in multiple CK8-positive and CK8-negative cell lines to that in U-118 MG. Statistical analysis was carried out using One-way ANOVA with Dunnett’s multiple comparison test, ***, p< 0.0002; **, p<0.009; and ns, non-statistically significant. Data shown are means ± SD, n=3. Figure 11 shows the specificity of CK8 aptamer SEQ ID NO: 11. The specificity of CK8 aptamer was verified using an aptamer-ELISA assay. (A) Absorbance at 450 nm for 500 nM of CK8 aptamer SEQ ID NO: 11 binding to various His-tagged cytokeratin proteins via ELISA using TMB as a substrate. (B) Absorbance at 450 nm for 500 nM of CK8 aptamer SEQ ID NO: 11 binding with non-cytokeratin proteins via ELISA using TMB as a substrate. Statistical analysis was carried out using One-way ANOVA with Dunnett’s multiple comparison test, **, p<0.005; and ****, p<0.0001; and ***, p<0.0003 and ns, non-statistically significant. Data shown are means ± SD (n=3). Figure 12 shows the apparent dissociation constant of the CK8 aptamers towards CK8 protein. The same concentration of the negative control aptamer (SEQ ID NO: 6) was used for each of the matching input concentration of aptamers for the six data points. For each data point, the value of OD450nm of the negative control aptamer (SEQ ID NO: 6) was subtracted from that of the aptamers being studied. (A) KD curve of the parental aptamer SEQ ID NO: 2 to CK8 protein. (B) KD curve of aptamer SEQ ID NO: 11 to CK8 protein. KD was derived by non-linear fit (one-site specific binding) using GraphPad Prism 8.0 software. Data shown are means ± SD, n=3. Figure 13 shows amino acid sequence alignment of diagnostically relevant type I and type II cytokeratins. * indicates the amino acids shared by all cytokeratins. The region highlighted by the red box represents the 15 amino acids common to most cytokeratins. The numbers to the left of the amino acid sequences next to each cytokeratin indicate the amino acid sequence position of each human cytokeratin listed. Figure 14 shows determination of the binding of candidate aptamers to full-length CK18 protein via ELISA. The binding CK18 aptamers candidate (1 pM) to CK18 protein is shown as the ratio (fold change) of the binding to CK18 protein over that to the negative control (EDAR) protein. Data shown are means ± SD, n=3. 2025283633   19 Dec 2025 Figure 15 shows truncation of CK18 aptamer SEQ ID NO: 22 and the CK18 protein binding analysis for the truncated clones. (A) Schematic illustration of truncation of CK18 aptamer SEQ ID NO: 22 based on the secondary structure, which was generated using the program NUPACK (Beckman Institute at Caltech, US). (B) Aptamer-ELISA assay binding for the binding to CK18 recombinant protein. The binding activities were quantified and expressed as the fold change of binding to His-CK18 protein over that to the negative control (His-EDAR). Data shown are the means ± SD, (n=3). Figure 16 shows a schematic of rational for second round truncation of CK18 aptamer SEQ ID NO: 41. The secondary structure was generated using NUPACK program (Beckman Institute at Caltech, US). Figure 17 shows aptamer-ELISA analysis of second round of deletion of CK18 aptamer SEQ ID NO: 41. The binding activities were quantified and expressed as the fold change of binding to His-CK18 protein over that to the negative control (His-EDAR). Data shown are the means ± SD, (n=3). Figure 18 shows third round of aptamer engineering of CK18 aptamer SEQ ID NO: 44. The base pair mutations introduced are highlighted with circles of matching colours as well as arrows. The nucleotide bases are color-coded, with green representing adenine (A), blue representing cytosine (C), black representing guanine (G), and red representing thymine (T). The secondary structures of aptamers were generated using NUPACK program (Beckman Institute at Caltech, US). Figure 19 shows aptamer-ELISA analysis of subclones of CK18 aptamers derived from mutagenesis of SEQ ID NO: 44. The binding activities were quantified and expressed as the fold change of binding to His-CK18 protein over that to the negative control (His-EDAR). Data shown are the means ± SD, (n=3). Figure 20 shows specificity of CK18 aptamer SEQ ID NO: 44. The binding to the proteins under study was measured the aptamer ELISA assay with 1 pM CK18 aptamer SEQ ID NO: 44 and TMB as a reporting substrate for HRP. Data shown are means ± SD, each with duplicate samples, n=3. ****, P < 0.0001. Figure 21 shows intracellular flow cytometry for CK18 binding. (A) and (B), schematic illustrations of principles of intracellular flow cytometric analysis. (C) Histograms represent the 2025283633   19 Dec 2025 intracellular binding of PE-CK18 antibody to the intracellular CK18 protein. The red peak represents the binding signal from non-permeabilized cells, while the blue peak corresponds to permeabilized cells for each cell line. The histograms shown are representative of data from at least three experiments. (D) Median fluorescence intensity for PE-CK18 antibody across the four cell lines used (excitation at 488 nm and an emission of 585±42 nm). Data shown are means ± SD, n=3. ***, P < 0.001; **, P < 0.01 compared with that in CK18-negative cells. Figure 22 shows binding of CK18 aptamer SEQ ID NO: 50 to native human cytokeratins. (A) Histograms showing the intracellular binding of 1 pM FAM-labelled CK18 aptamer in CK18-positive and -negative cell lines. The red peak represents the binding signal from non-permeabilized cells used as a negative control, while the blue peak corresponds to permeabilized cells, indicating intracellular binding. (B) Median fluorescent intensity (MFI) of intracellular binding of FAM-labelled CK18 aptamer in CK18-positive and -negative cell lines. Statistical analysis was performed using one-way ANOVA: ****, P < 0.0001; ***, P < 0.001; **, P < 0.01 compared with cells that do not express CK18. Data were analysed using FlowJo software (Becton Dickinson) and are shown as means ±S.D., n=3. Figure 23 shows determination of the apparent dissociation constant (KD) of CK18 aptamer SEQ ID NO: 50. The KD of the CK18 aptamer to immobilized His-CK18 protein was derived using nonlinear fitting (one-site specific binding) in GraphPad Prism 8.0 software. (A) the binding of the CK18 aptamer SEQ ID NO: 50. (B) The binding of CK18 negative control aptamer with a scrambled sequence. Data shown are means ± SD (n=3). Figure 24 shows schematic illustration of DNA aptamer-enabled intraoperative surgical pathology. (A) The principle of DNA aptamer-enabled intraoperative aptahistochemistry. (B) Step-by-step protocol of DNA aptamer-enabled intraoperative aptahistochemistry with the timing for each step. Figure 25 shows determination of the best fixation method for DNA aptamer-based intraoperative surgical pathology. A MCF-7 cytospin slide was fixed with indicated agent for 1 min, followed by staining with 400 nM CK8 aptamer (SEQ ID NO: 55) for 5 min, neutravidin-HRP for 2 min, DAB for 5 min and counterstained with Mayer’s hematoxylin for 10 sec. Data shown are representative of at least 3 independent experiments. Figure 26 shows determination of the best counterstaining method for DNA aptamer-based intraoperative surgical pathology. A MCF-7 cytospin slide was fixed with methanol (-20 °C) for 1 2025283633   19 Dec 2025 min, followed by staining with 400 nM CK8 aptamer (SEQ ID NO: 55) for 5 min, neutravidin-HRP for 2 min, DAB for 5 min and counterstained with indicated hematoxylin for 10 sec. Data shown are representative of at least 3 independent experiments. Figure 27 shows CK8 DNA aptamer-based intraoperative surgical pathology using MCF-7 breast carcinoma cytospin slides. (A) and (B) The biotinylated CK8 aptamer (SEQ ID NO: 55) was used to stain MCF-7 cell cytospin slides. (C) and (D) In the absence of the CK8 aptamer, there was no observable DAB deposit, confirming that the brown DAB deposit is not derived from endogenous biotin or endogenous peroxidase. Data shown are representative of at least 6 independent experiments. Figure 28 shows CK18 DNA aptamer-based intraoperative surgical pathology using MCF-7 breast carcinoma cytospin slides. The biotinylated CK18 aptamer (SEQ ID NO: 56) was used to stain MCF-7 cell cytospin slides. Data shown are representative of at least 6 independent experiments. Figure 29 shows the sensitivity of CK8 DNA aptamer-based intraoperative surgical pathology using HEK293 cytospin slides. The biotinylated CK8 aptamer (400 nM, SEQ ID NO: 55) was used to stain cytospin slides of immortalized human embryonic kidney cells (HEK293). Data shown are representative of at least 3 independent experiments. Figure 30 shows the sensitivity of CK18 DNA aptamer-based intraoperative surgical pathology using HK293 cytospin slides. The biotinylated CK18 aptamer (400 nM, SEQ ID NO: 56) was used to stain cytospin slides of immortalized human embryonic kidney cells (HEK293). Data shown are representative of at least 3 independent experiments. Figure 31 shows staining of MCF-7 cytospin slide with pan-keratin antibody mixture AE1:AE3. Figure 32 shows H & E staining of the frozen section (OriGene, CAT#: CS539088) of lymph node from a 53-year-old patient with a stage IIB metastatic ductal / lobular adenocarcinoma (triple negative breast cancer). The magnification is shown on top of the micrographs. Figure 33 shows CK8 aptamer staining of the frozen section of a lymph node with metastatic breast carcinoma cells (OriGene, CAT#: CS539088). (A) and (B) biotinylated CK8 aptamer (600 nM, SEQ ID NO: 55) was used to stain the slides. (C) and (D) the biotinylated CK8 aptamer was 2025283633   19 Dec 2025 replaced by PBS in the staining. Data shown are representative of at least 3 independent experiments. Figure 34 shows CK18 aptamer staining of the frozen section of a lymph node with metastatic 5 breast carcinoma cells (OriGene, CAT#: CS539088). (A) and (B) biotinylated CK18 aptamer (400 nM, SEQ ID NO: 56) was used to stain the slides. (C) and (D) the CK18 aptamer was replaced by PBS in the staining. Data shown are representative of at least 3 independent experiments. 10 Figure 35 shows AE1:AE3 antibody staining of the frozen section of a lymph node with metastatic breast carcinoma cells (OriGene, CAT#: CS539088). Figure 36 shows H&E staining of a frozen section of normal lymph node (OriGene, Cat CS617686). The magnification is shown on top of the micrographs. 15 Figure 37 shows biotinylated CK8 (600 nM, SEQ ID NO: 55) and biotinylated CK18 aptamer (400 nM, SEQ ID NO: 56) staining of a frozen section of normal lymph node (OriGene, Cat CS617686). Data shown are representative of at least 3 independent experiments. 20 Figure 38 shows H&E staining of a frozen section of fibrosarcoma (OriGene, Cat# CS536784). The magnification is shown on top of the micrographs. Figure 39 shows biotinylated CK8 (600 nM, SEQ ID NO: 55) and biotinylated CK18 aptamer (400 pM, SEQ ID NO 56) staining of a frozen section of fibrosarcoma (OriGene, Cat CS536784). 25 Figure 40 shows schematic illustration of DNA aptamer-enabled intraoperative surgical pathology using FAM-labelled aptamers. (A) The principle of FAM-conjugated aptamer-enabled intraoperative aptahistochemistry. (B) Step-by-step protocol of FAM-aptamer-enabled intraoperative aptahistochemistry with the timing for each step. 30 Figure 41 shows the FAM-CK8 DNA aptamer-based intraoperative surgical pathology using MCF-7 cytospin slides. The dual FAM-conjugated CK8 aptamer (500 nM, SEQ ID NO: 57) and anti-fluorescein Fab-HRP was used to stain cytospin slides of breast carcinoma (MCF-7) cells. Data shown are representative of at least 3 independent experiments. 2025283633   19 Dec 2025 Figure 42 shows the FAM-CK8 DNA aptamer-based intraoperative surgical pathology. Staining of a frozen section of a lymph node with ~50% metastatic breast carcinoma cells (OriGene, Cat. No. CS530098) with 500 nM FAM-CK8 aptamer (SEQ ID NO: 57) and anti-fluorescein Fab-HRP. Data shown are representative of at least 3 independent experiments. Figure 43 shows the FAM-CK18 DNA aptamer-based intraoperative surgical pathology. Staining of a frozen section of a lymph node with ~50% metastatic breast carcinoma cells (OriGene, Cat. No. CS530098) with 500 nM FAM-CK18 aptamer (SEQ ID NO: 58) and anti-fluorescein Fab-HRP. Data shown are representative of at least 3 independent experiments. Figure 44 shows the FAM-CK8 DNA aptamer-based intraoperative surgical pathology. Staining of a frozen section of a lymph node with ~15% metastatic breast carcinoma cells (OriGene, Cat. No. CS557928) with 500 nM FAM-CK8 aptamer (SEQ ID NO: 57) and anti-fluorescein Fab-HRP. Data shown are representative of at least 3 independent experiments. Figure 45 shows the FAM-CK18 DNA aptamer-based intraoperative surgical pathology. Staining of a frozen section of a lymph node with ~15% metastatic breast carcinoma cells (OriGene, Cat. No. CS557928) with 500 nM FAM-CK8 aptamer (SEQ ID NO: 58) and anti-fluorescein Fab-HRP. Data shown are representative of at least 3 independent experiments. Figure 46 shows biotinylated HER2 aptamer HER2-2A (1 pM, SEQ ID NO: 59) staining of cytospin slides of four different breast cancer cell lines. (A) and (B) MDA-MB-231 cytospin slides, (C) and (D): MCF-7 cytospin slides; (E) and (F): T47D cytospin slides; (G) and (H): SKRB3 cytospin slides. Arrows: HER2 aptamer staining in perinuclear, cytoplasmic or plasma membrane area. Data shown are representative of at least 3 independent experiments. Figure 47 shows biotinylated HER2 aptamer HER2-HApt (500 nM, SEQ ID NO: 60) staining of cytospin slides of MCF7 cells, four different breast cancer cell lines. (A) and (B): MDA-MB-231 cytospin slides, (C) and (D): MCF-7 cytospin slides; (E) and (F): T47D cytospin slides; (G) and (F): SKRB3 cytospin slides. Arrows: HER2 aptamer staining in perinuclear, cytoplasmic or plasma membrane area. Data shown are representative of at least 3 independent experiments. Figure 48 shows biotinylated EpCAM aptamer SYL3C (50 nM, SEQ ID NO: 61) staining of cytospin slides of MCF-7 cells (A and B); the frozen section of a lymph node with metastatic breast carcinoma cells (C and D; OriGene, CAT#: CS539088) and cytospin slides HEK293 cells 2025283633   19 Dec 2025 (E and F). Arrows: EpCAM aptamer staining in cytoplasmic or plasma membrane area. Data shown are representative of at least 3 independent experiments. Figure 49 shows biotinylated nucleolin aptamer AS1411 (400 nM, SEQ ID NO: 62) staining of cytospin slides of MCF-7 cells. Data shown are representative of at least 3 independent experiments. Key to Sequence Listing SEQ ID NO:1 Sequence of DNA aptamer binding cytokeratin 8 (CK8). SEQ ID NO:2 Sequence of DNA aptamer binding CK8. SEQ ID NO:3 Sequence of DNA aptamer binding CK8. SEQ ID NO:4 Sequence of DNA aptamer binding CK8. SEQ ID NO:5 Sequence of DNA aptamer binding CK8. SEQ ID NO:6 negative control aptamer. SEQ ID NO:7 Sequence of DNA aptamer binding CK8. SEQ ID NO:8 Sequence of DNA aptamer binding CK8. SEQ ID NO:9 Sequence of DNA aptamer binding CK8. SEQ ID NO:10 Sequence of DNA aptamer binding CK8. SEQ ID NO:11 Sequence of a DNA aptamer binding CK8. SEQ ID NO:12 Sequence of a DNA aptamer binding CK8. SEQ ID NO:13 Sequence of a DNA aptamer binding CK8. SEQ ID NO:14 Sequence of a DNA aptamer binding CK8. SEQ ID NO:15 Sequence of a DNA aptamer binding CK8. SEQ ID NO:16 Sequence of a DNA aptamer binding CK8. SEQ ID NO:17 Sequence of a DNA aptamer binding CK18. SEQ ID NO:18 Sequence of a DNA aptamer binding CK18. SEQ ID NO:19 Sequence of a DNA aptamer binding CK18. SEQ ID NO:20 Sequence of a DNA aptamer binding CK18. SEQ ID NO:21 Sequence of a DNA aptamer binding CK18. SEQ ID NO:22 Sequence of a DNA aptamer binding CK18. SEQ ID NO:23 Sequence of a DNA aptamer binding CK18. SEQ ID NO:24 Sequence of a DNA aptamer binding CK18. SEQ ID NO:25 Sequence of a DNA aptamer binding CK18. SEQ ID NO:26 Sequence of a DNA aptamer binding CK18. SEQ ID NO:27 Sequence of a DNA aptamer binding CK18. SEQ ID NO:28 Sequence of a DNA aptamer binding CK18. 2025283633   19 Dec 2025 SEQ ID NO:29 Sequence of a DNA aptamer binding CK18. SEQ ID NO:30 Sequence of a DNA aptamer binding CK18. SEQ ID NO:31 Sequence of a DNA aptamer binding CK18. SEQ ID NO:32 Sequence of a DNA aptamer binding CK18. SEQ ID NO:33 Sequence of a DNA aptamer binding CK18. SEQ ID NO:34 Sequence of a DNA aptamer binding CK18. SEQ ID NO:35 Sequence of a DNA aptamer binding CK18. SEQ ID NO:36 Sequence of a DNA aptamer binding CK18. SEQ ID NO:37 Sequence of a DNA aptamer binding CK18. SEQ ID NO:38 Sequence of a DNA aptamer binding CK18. SEQ ID NO:39 Sequence of a DNA aptamer binding CK18. SEQ ID NO:40 Sequence of a DNA aptamer binding CK18. SEQ ID NO:41 Sequence of a DNA aptamer binding CK18. SEQ ID NO:42 Sequence of a DNA aptamer binding CK18. SEQ ID NO:43 Sequence of a DNA aptamer binding CK18. SEQ ID NO:44 Sequence of a DNA aptamer binding CK18. SEQ ID NO:45 Sequence of a DNA aptamer binding CK18. SEQ ID NO:46 Sequence of a DNA aptamer binding CK18. SEQ ID NO:47 Sequence of a DNA aptamer binding CK18. SEQ ID NO:48 Sequence of a DNA aptamer binding CK18. SEQ ID NO:49 Sequence of a DNA aptamer binding CK18. SEQ ID NO:50 Sequence of a DNA aptamer binding CK18. SEQ ID NO:51 Sequence of a DNA aptamer binding CK18. SEQ ID NO:52 Sequence of a DNA aptamer binding CK18. SEQ ID NO:53 Sequence of a DNA aptamer binding CK18. SEQ ID NO:54 Sequence of a DNA aptamer binding CK18. SEQ ID NO:55 Sequence of a DNA aptamer binding CK8. SEQ ID NO:56 Sequence of a DNA aptamer binding CK18. SEQ ID NO:57 Sequence of a DNA aptamer binding CK8. SEQ ID NO:58 Sequence of a DNA aptamer binding CK18. SEQ ID NO:59 Sequence of a DNA aptamer binding to HER2. SEQ ID NO:60 Sequence of a DNA aptamer binding to HER2. SEQ ID NO:61 Sequence of a DNA aptamer binding to EpCAM. SEQ ID NO:62 Sequence of a DNA aptamer binding to nucleolin. SEQ ID NO:63 Sequence of CK8 peptide. SEQ ID NO:64 Sequence of CK18 peptide. 2025283633   19 Dec 2025 SEQ ID NO:65 Sequence of a primer. SEQ ID NO:66 Sequence of a primer. SEQ ID NO:67 Sequence of scrambled peptide. SEQ ID NO:68 Sequence of a DNA aptamer binding CK18. Detailed Description General Techniques and Selected Definitions The term “and / or”, e.g., “X and / or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning. Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter. Each example described herein is to be applied mutatis mutandis to each and every other example of the disclosure unless specifically stated otherwise. Those skilled in the art will appreciate that the disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features. The present disclosure is performed without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology, recombinant DNA technology, cell biology and immunology. Such procedures are described, for example, in Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Second Edition (1989), whole of Vols I, II, and III; DNA Cloning: A Practical Approach, Vols. I and II (D. N. Glover, ed., 1985), IRL Press, Oxford, whole of text; Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed, 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, ppl-22; Atkinson et al, pp35-81; Sproat et al, pp 83-115; and Wu et al, pp 135-151; 4. Nucleic Acid Hybridization: A Practical Approach (B. D. Hames & S. J. Higgins, eds., 1985) IRL Press, Oxford, whole of text; Immobilized Cells and Enzymes: A Practical Approach (1986) IRL Press, Oxford, whole of text; Perbal, B., A Practical Guide to Molecular Cloning (1984); Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.), whole of series, Sakakibara, D., Teichman, J., Lien, E. Land Fenichel, R.L. (1976). Biochem. Biophys. Res. Commun. 73 336-342; Merrifield, R.B. (1963). J. Am. Chem. Soc. 85, 2149-2154; Barany, G. and Merrifield, R.B. (1979) in The Peptides (Gross, E. and Meienhofer, J. eds.), vol. 2, pp. 1284, Academic Press, New York. 12. Wunsch, E., ed. (1974) Synthese von Peptiden in Houben- 2025283633   19 Dec 2025 Weyls Metoden der Organischen Chemie (Muler, E., ed.), vol. 15, 4th edn., Parts 1 and 2, Thieme, Stuttgart; Bodanszky, M. (1984) Principles of Peptide Synthesis, Springer-Verlag, Heidelberg; Bodanszky, M. & Bodanszky, A. (1984) The Practice of Peptide Synthesis, SpringerVerlag, Heidelberg; Bodanszky, M. (1985) Int. J. Peptide Protein Res. 25, 449-474; Handbook of Experimental Immunology, VoIs. I-IV (D. M. Weir and C. C. Blackwell, eds., 1986, Blackwell Scientific Publications); and Animal Cell Culture: Practical Approach, Third Edition (John R. W. Masters, ed., 2000), ISBN 0199637970, whole of text. Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers. The term “consists of” or “consisting of” shall be understood to mean that a method, process or composition of matter has the recited steps and / or components and no additional steps or components. The term “about”, as used herein when referring to a measurable value such as an amount of weight, time, dose, etc. is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method. The term “aptamer” as used herein refers to a single stranded nucleic acid molecule comprising a loop-like single-stranded region, and wherein regions adjacent to the both ends of the single-stranded region, respectively, preferably form a double-stranded stem region. An aptamer is known to comprise the so called “stem-loop structure” like this in many cases, and also known to bind specifically to a target substance mainly through the single-stranded loop structure region. The secondary structure of the aptamer can be determined easily by a conventional method using a computer. As a software for analysis of the secondary structure of the aptamer, well-known Mfold, for example, can be utilized, which software is freely available in the Mfold web server. The double stranded stem region comprises paired bases. For example, the paired bases may be either A-T base pairs or C-G base pairs. The term “oligonucleotide” as used herein is generic to polydeoxyribonucleotides (containing 2’-deoxy-D-ribose or modified forms thereof), i.e. DNA and to any other type of polynucleotide which is an N-glycoside or C-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base or abasic nucleotide. According to the present disclosure the term “oligonucleotide” includes not only those with conventional bases, sugar residues and internucleotide linkages, but also those that contain modifications. The term “DNA aptamer” as used herein is an aptamer comprising polydeoxyribonucleotide units. 2025283633   19 Dec 2025 As used herein the term “binding affinity” and binding activity” are intended to refer to the tendency of a ligand molecule / aptamer to bind or not bind a target and describes the measure of the strength of the binding or affinity of the ligand molecule / aptamer to bind the target. The energetics of said interactions are significant in “binding activity” and “binding affinity” because they define the necessary concentrations of interacting partners, the rates at which these partners are capable of associating, and the relative concentrations of bound and free molecules in a solution. The energetics are characterized herein through, among other ways, the determination of a dissociation constant, Kd. As is known in the art, a low dissociation constant indicates stronger binding and affinity of the molecules to each other. A dissociation constant in the nanomolar (nM) range indicates strong binding affinity. Kd values can be measured for example using either polarization-modulated oblique-incidence reflectivity difference (OI-RD) or Biacore. As used herein, the term “biological sample” refers to a cell or population of cells or a quantity of tissue or fluid from a subject. Most often, the sample has been removed from a subject, but the term “biological sample” can also refer to cells or tissue analyzed in vivo, i.e. without removal from the subject. Often, a “biological sample” will contain cells from the subject, but the term can also refer to non-cellular biological material, such as non-cellular fractions of blood, saliva, or urine. Biological samples include, but are not limited to, tissue biopsies, needle biopsies, scrapes (e.g. buccal scrapes), whole blood, plasma, serum, lymph, bone marrow, urine, saliva, sputum, cell culture, pleural fluid, pericardial fluid, ascitic fluid or cerebrospinal fluid. Biological samples also include tissue biopsies. A biological sample or tissue sample can refer to a sample of tissue or fluid isolated from an individual, including but not limited to, for example, blood, plasma, serum, tumor biopsy, urine, stool, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, cells (including but not limited to blood cells), tumors, or organs. In some examples, the sample is from a resection, bronchoscopic biopsy, or core needle biopsy of a primary or metastatic tumor, or a cellblock from pleural fluid. In addition, fine needle aspirate samples can be used. Samples may be paraffin-embedded or frozen tissue. The sample can be obtained by removing a sample of cells from a subject. The term “coupled to” as used herein is intended to encompass any construction whereby the DNA aptamer is linked, attached or joined to a detection agent or moiety. Methods for effecting coupling will be known to persons skilled in the art and include, but are not limited to conjugation, linking via peptide linker or by direct chemical synthesis of the DNA and agent as a whole chain. The term “isolated” as used herein is intended to refer to the DNA aptamer isolatable or purified from other components. The aptamer or aptamer conjugate of the present disclosure is 2025283633   19 Dec 2025 preferably chemically synthesised using methods known in the art. Reference to the term ‘isolated’ in the context of the aptamer conjugate refers to an aptamer which is purified from other components which may be present during synthesis of the aptamer (e.g. SELEX method). The term ”ligand” as used herein refers to a molecule or other chemical entity having a capacity for binding to a target. A ligand can comprise a peptide, an oligomer, a nucleic acid (e.g. an aptamer), a small molecule (e.g. a chemical compound), an antibody or fragment thereof, nucleic acid-protein fusion and / or any other affinity agent. Thus, a ligand can come from any source, including libraries, particularly combinatorial libraries, such as the aptamer libraries disclosed herein below, phage display libraries, or any other library as would be apparent to one of ordinary skill in the art after review of the disclosure herein. As used herein, the term “specifically binds” shall be taken to mean that the DNA aptamer reacts or associates more frequently, more rapidly, with greater duration and / or with greater affinity with a particular cell or substance than it does with alternative cells or substances. For example, a DNA aptamer that specifically binds to a target protein binds that protein or an epitope or immunogenic fragment thereof with greater affinity, avidity, more readily, and / or with greater duration than it binds to unrelated protein and / or epitopes or immunogenic fragments thereof. It is also understood by reading this definition that, for example, a DNA aptamer that specifically binds to a first target may or may not specifically bind to a second target. As such, "specific binding" does not necessarily require exclusive binding or non-detectable binding of another molecule, this is encompassed by the term “selective binding”. Generally, but not necessarily, reference to binding means specific binding. The specificity of binding is defined in terms of the comparative dissociation constants (Kd) of the aptamer for a target as compared to the dissociation constant with respect to the aptamer and other materials in the environment or unrelated molecules in general. Typically, the Kd for the aptamer with respect to the target will be 2-fold, 5-fold, or 10-fold less than the Kd with respect to the target and the unrelated material or accompanying material in the environment. Even more preferably, the Kd will be 50-fold, 100fold or 200-fold less. As used herein, the term “identity” means the percentage of identical nucleotide or amino acid residues at corresponding portions in two or more sequences when sequences are aligned to maximise sequence matching, i.e. taking into account gaps and insertions. Identity can be readily calculated using known methods, including, but not limited to those described in Computational Molecular Biology, Lesk AM ed. Oxford University Press New York, 1988; Computer Analysis of Sequence data, Part I Griffin AM and Griffin HG eds., Humana Press, New Jersey, 1994; Sequence analysis in molecular biology, von Heinje G, Academic Press, New Jersey, 1994). Methods to determine identity are designed to give the largest match between the sequences tested. Moreover, methods to determined identity are codified in publicly available 2025283633   19 Dec 2025 computer programs. Computer program methods to determine identity between two sequence include, but are not limited to, the GCG program package, BLASTP, BLASTN and FASTA. The well-known Smith Waterman algorithm may also be used to determine identity. The term “cancer cell expressing CK8” or “cancer cell expressing CK18” refers to cell surface expression of the cytokeratin proteins CK8 or CK18 respectively which can be detected by any suitable means e.g. ELISA or histochemistry. Reference to a cell being positive for a given marker means it may be either a low (Io or dim) or a high (bright, bri) expresser of that marker depending on the degree to which the marker is present on the cell surface, where the terms relate to intensity of fluorescence. As used herein, the term “subject” shall be taken to mean any subject, including a human or non-human subject. The non-human subject may include non-human primates, ungulate (bovines, porcines, ovines, caprines, equines, buffalo and bison), canine, feline, lagomorph (rabbits, hares and pikas), rodent (mouse, rat, guinea pig, hamster and gerbil), avian, and fish. In a particular example, the subject is a human, including paediatric or adult humans. Aptamers Aptamers are small oligonucleotides that are capable of binding to a specific target. They bind to the complementary ligand due to the interaction of the 3D structure with the target in a similar manner to antibodies, rather than by complementary base pairing. Aptamers have two unique domains: the non-binding stem region and the binding loop; and can be either DNA or RNA. DNA aptamers are more stable and inexpensive than RNA aptamers. Aptamers are produced by a process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Aptamers have a number of features that make them superior to antibodies for therapeutic applications. Firstly, they are smaller than their antibody protein counterparts (5-25 kDa vs 125 kDa), and thus are capable of penetrating deeper into a tissue and even through to the core of a tumour (Shigdar S et al, (2013) Cancer Letters 330(1):84-95). Also, unlike antibodies, aptamers have not been documented to produce an immune response. The production of aptamers is also a simpler process, as SELEX is an in vitro process, as opposed to antibodies, which are produced using the immune system of an animal. This ensures that aptamers can be manufactured against a wide range of epitopes and that there is limited batch-to-batch variation, both aspects which make them superior to antibodies. However, there are a number of limitations associated with aptamers. Aptamers have a reduced circulatory half-life due to two factors. Firstly, being oligonucleotides, they are susceptible to nuclease degradation. Moreover, the smaller size of aptamers makes them susceptible to glomerular filtration, and so are easily passed out in the urine. Any post-SELEX 2025283633   19 Dec 2025 modification to an aptamer has the potential to alter the binding affinity. Aptamers also have delivery problems, in part because of repulsion of the nucleic acid by the negatively-charged cell membrane. Aptamers have the potential to be used for a multitude of purposes in a similar way to antibodies. An aptamer has already been approved by the FDA for clinical use in the treatment in macular degeneration (Rinaldi M et al, (2012) British Journal of Clinical Pharmacology 74(6):940-6), and several are currently undergoing clinical trials for a range of uses. Preclinical studies in vitro and in vivo have illustrated the therapeutic applications of aptamers in treating conditions from diabetes to HIV and prion diseases. These chemical antibodies, as they are sometimes known, are especially promising in the field of cancer research, as they can be used to target a specific marker on the surface of cancer cells to deliver a payload designed to elicit a cytotoxic effect. This approach has the potential to limit the systemic toxicity of a chemotherapeutic regime, by focusing the drugs towards the site of cancer. If such a technique could be applied clinically, it would limit patient side effects and enable the use of a higher drug dose. In addition, targeted treatments could be directed towards the tumorigenic CSCs, which would improve patient outcomes. Cytokeratin (CK8) and cytokeratin 18 (CK18) CK8 and CK18 are intermediate filament proteins that are found in epithelial cells. They are essential for tissue integrity and play a role in regulating cell growth, death and response to injury. Cytokeratins share a homologous basis structure with all intermediate filament proteins. The central alpha helical rod domain, composed of 310-315 amino acids is responsible for dimerization and high order polymerisation and is composed of four highly conserved domains 1A, 1B, 2A and 2B. The alpha helix consists of heptad amino acid repeats in which the first and the fourth residues are hydrophobic, residing close together on the surface of the helix and enabling two adjacent polypeptides to create a coiled coil. There is a stagger sequence in the helix 2B domain that is associated with reversal of direction of the alpha helix. The four highly conserved domains are separated by non-helical linker domains, (L1, L12, L2). The amino terminal head and carboxy terminal tail regions, which confer antigenic specificity to individual keratins consists of two highly homologous subdomains (H), two variable subdomains (V), and two highly charged end subdomains (E). CK8 in humans has a MW of 52.5 kDa and an isoelectric pH of 6.1. CK8 and its acidic partner CK18 are considered primary keratins because they are the first to be produced in the simple epithelia of embryos. In human CK18 has a MW of 44 kDa and an isoelectric pH of 5.5. The epithelial cells of the ectoderm and periderm of the human fetal skin express K18. K18 is a constituent of the cytoskeleton in the cells of simple epithelia, such as the hepatocytes, the cells 2025283633   19 Dec 2025 lining the bile duct and renal tubules, and the cells of the intestinal, bronchial and alveolar epithelia. In normal tissues, CK8 / K18 are expressed in all simple and glandular epithelium. In neoplastic tissues, they are expressed in most squamous cell carcinomas and adenocarcinomas, but are absent from keratinizing squamous carcinomas. CK8 / CK18 expression is associated with a poor prognosis in carcinoma and adenocarcinoma. As demonstrated herein, the inventor has shown that the aptamers described herein have significantly greater sensitivity of detection compared to the corresponding antibodies. As expression of CK8 and CK18 is correlated with poor cancer prognosis, the use of aptamers binding to these biological markers allows for more accurate detection of cancer cells in a biological sample the providing greater certainty of diagnosis. Aptamer selection to a given target Aptamers that bind to virtually any particular target can be selected by using an iterative process called SELEXTM (Systemic Evolution of Ligands by EXponential Enrichment). The process is described in, for example US 5270163 and US 5475096. The SELEXTM process is based on the unique insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (i.e., form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets. The SELEXTM process relies, as a starting point, upon a large library or pool of single stranded oligonucleotides comprising randomised sequences. The oligonucleotides can be modified or unmodified DNA, RNA, or DNA / RNA hybrids. In some examples, the pool comprises 100% random or partially random oligonucleotides. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed sequence and / or conserved sequence incorporated within randomized sequence. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed sequence and / or conserved sequence at its 5' and / or 3' end which may comprise a sequence shared by all the molecules of the oligonucleotide pool. Fixed sequences are sequences common to oligonucleotides in the pool which are incorporated for a preselected purpose such as, CpG motifs, hybridization sites for PCR primers, promoter sequences for RNA / DNA polymerases (e.g., T3, T4, T7, and SP6), restriction sites, or homopolymeric sequences, such as poly A or poly T tracts, catalytic cores, sites for selective binding to affinity columns, and other sequences to facilitate cloning and / or sequencing of an oligonucleotide of interest. Conserved sequences 2025283633   19 Dec 2025 are sequences, other than the previously described fixed sequences, shared by a number of aptamers that bind to the same target. The oligonucleotides of the pool preferably include a randomised sequence portion as well as fixed sequences necessary for efficient amplification. Typically, the oligonucleotides of the starting pool contain fixed 5' and 3' terminal sequences which flank an internal region of 3050 random nucleotides. The randomised nucleotides can be produced in a number of ways including chemical synthesis and size selection from randomly cleaved cellular nucleic acids. Sequence variation in the test nucleic acids can also be introduced or increased by mutagenesis before or during the selection / amplification iterations. The random sequence portion of the oligonucleotide can be of any length and can comprise ribonucleotides and / or deoxyribonucleotides and can include modified or non-natural nucleotides or nucleotide analogs (see for example US 5958691, US 5660985 and WO92 / 07065). Random oligonucleotides can be synthesized from phosphodiester-linked nucleotides using solid phase oligonucleotide synthesis techniques well known in the art. See, for example, Froehler et al., (1986). Nucl. Acid Res. 14:5399-5467 and Froehler et al (1986) Tet. Lett. 27:5575-5578. Random oligonucleotides can also be synthesized using solution phase methods such as triester synthesis methods. See, e.g., Sood et al (1977). Nucl. Acid Res. 4:2557 and Hirose et al (1978). Tet. Lett., 28:2449. Typical syntheses carried out on automated DNA synthesis equipment yield 1014-1016 individual molecules, a number sufficient for most SELEXTM experiments. The starting library of oligonucleotides may be generated by automated chemical synthesis on a DNA synthesiser. Partially random sequences can be created by adding the four nucleotides in different molar ratios at each addition step. The starting library of oligonucleotides may be either RNA or DNA. In those instances where an RNA library is to be used as the starting library it is typically generated by transcribing a DNA library in vitro using T7 RNA polymerase or modified T7 RNA polymerases and purified. The RNA or DNA library is then mixed with the target under conditions favourable for binding and subjected to step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. More specifically, starting with a mixture containing the starting pool of nucleic acids, the SELEXTM method includes steps of: (a) contacting the mixture with the target under conditions favourable for binding; (b) partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules; (c) dissociating the nucleic acid-target complexes; (d) amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids; and (e) reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid 2025283633   19 Dec 2025 ligands to the target molecule. In those instances where RNA aptamers are being selected, the SELEXTM method further comprises the steps of: (i) reverse transcribing the nucleic acids dissociated from the nucleic acid-target complexes before amplification in step (d); and (ii) transcribing the amplified nucleic acids from step (d) before restarting the process. Cycles of selection and amplification are repeated until a desired goal is achieved. Generally this is until no significant improvement in binding strength is achieved on repetition of the cycle. Typically, nucleic acid aptamer molecules are selected in a 5 to 20 cycle procedure. A variety of nucleic acid primary, secondary and tertiary structures are known to exist. The structures or motifs that have been shown most commonly to be involved in non-Watson-Crick type interactions are referred to as hairpin loops, symmetric and asymmetric bulges, pseudoknots and myriad combinations of the same. Almost all known cases of such motifs suggest that they can be formed in a nucleic acid sequence of no more than 30 nucleotides. For this reason, it is often preferred that SELEXTM procedures with contiguous randomized segments be initiated with nucleic acid sequences containing a randomized segment of between about 20 to about 50 nucleotides. The core SELEXTM method has been modified to achieve a number of specific objectives. For example, US 5707796 describes the use of SELEXTM in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. US 5763177 describes SELEXTM based methods for selecting nucleic acid ligands containing photo reactive groups capable of binding and / or photo-crosslinking to and / or photoinactivating a target molecule. US 5567588 and US 5861254 describe SELEXTM based methods which achieve highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. US 5496938 describes methods for obtaining improved nucleic acid ligands after the SELEXTM process has been performed. US 5705337 describes methods for covalently linking a ligand to its target. Counter-SELEXTM is a method for improving the specificity of nucleic acid ligands to a target molecule by eliminating nucleic acid ligand sequences with cross-reactivity to one or more non-target molecules. Counter-SELEXTM is comprised of the steps of: (a) preparing a candidate mixture of nucleic acids; (b) contacting the candidate mixture with the target, wherein nucleic acids having an increased affinity to the target relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; (c) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; (d) dissociating the increased affinity nucleic acids from the target; (e) contacting the increased affinity nucleic acids with one or more non-target molecules such that nucleic acid ligands with specific affinity for the non-target molecule(s) are removed; and (f) amplifying the nucleic acids with specific affinity only to the target molecule to yield a mixture of nucleic acids enriched for nucleic acid sequences with a 2025283633   19 Dec 2025 relatively higher affinity and specificity for binding to the target molecule. As described above for SELEXTM, cycles of selection and amplification are repeated as necessary until a desired goal is achieved. In a representative example, an aptamer is synthesized on a solid support column, using conventional techniques such as those described by Beaucage et al. (1981) Tetrahedr. Letters 22:1859-1862 and Sinha et al., (1984) Nucleosides and Nucleotides 3:157- 30 171. Alternately, if large scale synthesis is used, the aptamer can be made by scale-up of the solid support method or the aptamer can be made by using solution phase techniques, particularly if the desired endproduct is a relatively short oligonucleotide. A starting material for the synthesis process can be a 5'-non-tritylated RNA oligoribo-nucleotide or analog of the desired primary structure, which preferably can have protected bases, and which is preferably bound to a solid-support. Any conventionally used protecting groups can be used. Typically N 6-benzoyl is used for adenine, N 4-benzoyl for cytosine, N 2-isobutyryl for guanine and N 2-benzoyl for 2-amino purine. Other useful protecting groups include phenoxyacetyl (PAC) and t-butoxyacetyl (TAC). Conveniently, the more base labile protection groups should be used for the synthesis of the aptamer; those of ordinary skill in the art know these groups. Such groups can help to prevent hydrolysis of the generated tri- or diphosphates, which are generally quite stable under basic conditions, but could be subject to some hydrolysis. Other envisioned modifications are disclosed in U.S. Pat. No. 6,011,020, and include but are not limited to the incorporation of bioavailability enhancing molecules such as PEG or cholesterol via a covalent linkage. In addition, nucleoside analogs such as 2'-deoxy, 2'-halo, 2'-amino (not substituted or mono- or disubstituted), 2'-mono, di- or trihalomethyl, 2'-0-alkyl, 2'-0-halo-substituted alkyl, 2'-alkyl, azido, phosphorothioate, sulfhydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diamino purine, 2-hydroxy-6-mercaptopurine and pyrimidine bases substituted at the 6-position with sulfur or 5 position with halo or C1-5 alkyl groups, abasic linkers, 3'-deoxy-adenosine as well as other available "chain terminator" or "non-extendible" analogs (at the 3'-end of the aptamer), and the like can be incorporated during the synthesis. Further, various labels such as 32P or 33P and the like can likewise be incorporated during the synthesis, resulting in novel analogs produced by this process. Other envisioned modifications are disclosed in U.S. Pat. No. 6,011,020, and include but are not limited to the incorporation of 3' caps, such an inverted DT cap, or an inverted abasic cap, or combination thereof. Binding affinity of aptamers The binding affinity describes the measure of the strength of the binding or affinity of molecules to each other. Binding affinity of the aptamer herein with respect to targets and other molecules is defined in terms of dissociation constant (Kd) or equilibrium dissociation constant 2025283633   19 Dec 2025 (Kd). The dissociation constant can be determined by methods known in the art and can be computed even for complex mixtures by methods such as those, for example, set forth in Caceci, M., et al., Byte (1984) 9:340-362. Examples of measuring dissociation constants are described for example in US 7602495 which describes surface Plasmon resonance analysis, US 6562627, US 6562627, and US 2012 / 00445849. In another example, the dissociation constant is established using a doublefilter nitrocellulose filter binding assay such as that disclosed by Wong and Lohman, (1993). Proc. Natl. Acad. Sci. USA 90, 5428-5432. It has been observed, however, that for some small oligonucleotides, direct determination of dissociation constant is difficult, and can lead to misleadingly high results. Under these circumstances, a competitive binding assay for the target molecule or other candidate substance can be conducted with respect to substances known to bind the target or candidate. The value of the concentration at which 50% inhibition occurs (K) is, under ideal conditions, equivalent to Kd. A K value can also be used to confirm that an aptamer of the present invention binds a target. Improving aptamer stability One potential problem encountered in the use of nucleic acids as therapeutics is that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. The present disclosure also includes analogs as described herein and / or additional modifications designed to improve one or more characteristics of the aptamer such as protection from nuclease digestion. Oligonucleotide modifications contemplated in the present disclosure include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Modifications to generate oligonucleotides which are resistant to nucleases can also include one or more substitute internucleotide linkages, altered sugars, altered bases, or combinations thereof. Such modifications include 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanosine; 3' and 5' modifications such as capping; conjugation to a high molecular weight, non-immunogenic compound; conjugation to a lipophilic compound; and phosphate backbone modification or 3’ inverted dT modification. 2025283633   19 Dec 2025 Sample isolation and preparation The methods of the present disclosure comprise obtaining a sample, preferably a biological sample from a subject. The subject may be a subject with known cancer or suspected of having cancer. In one example, the subject has, or is suspected of having a cancer that expresses CK8 and CK18. In one example, the subject has, or is suspected of having carcinoma or adenocarcinoma. The biological samples is any sample obtained from the subject in which cancer cells may be present. As used herein, the term “obtained” is defined broadly and refers to cells, tissue or organs derived from a subject directly, as well as cells, including those derived from the tissue or organ which have been processed in some way. In some examples, the biological sample selected from the group consisting of, but not limited to bone marrow, spleen, lymph nodes, Peyer’s patches, mucosal associated lymphoid tissue, gut-associated lymphoid tissue, blood, organ tissue (e.g. lung, kidney, spleen, liver, pancreas etc.), breast tissue, ovarian tissue or other tissue in which carcinoma or adenocarcinoma is present. Biological samples may be obtained from a subject by a variety of techniques including, for example, by venepuncture, by scraping or swabbing an area or by using a needle to aspirate body fluids or tissues. In some examples, the sample is obtained during surgery. Methods for collecting various biological samples are well known in the art. In some example, the samples are frozen sections, cell smear slides, fine-needle biopsy slides, tissue imprint slides, or cytospin cell slides. In some examples, the cells are purified. As used herein, “purified ” refers to cells that have been at least partially separated from other cell types with which they are normally associated in their naturally occurring state. Typically, the selected cell type is purified when it is at least 50% or 60%, by number, of total cells present. For example, the selected cell type is at least 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, by number, of total cells present. The purity of the cells can be checked by flow cytometry and other suitable techniques. In some example, the sample is freeze-dried. In some examples, the sample is fixed according to a method known in the art. Suitable fixation agents include formalin, methanol, acetone or the like. In some examples, the sample is subjected to one or more further steps including dehydration, clearing (to remove alcohol), infiltration (e.g. paraffin wax), embedding, and sectioning (e.g. using a microtome). In some examples, the sample is prepared for viewing under a microscope. This may include cytospin preparations, whole mounts, squash preparations and smears. 2025283633   19 Dec 2025 It will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the above-described embodiments, without departing from the broad general scope of the present disclosure. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive. 5 2025283633   19 Dec 2025 The disclosure may be defined by the following paragraphs. 1. A method for detecting a biological marker in a sample, the method comprising: (i) contacting the sample with at least one DNA aptamer coupled to a first reagent and wherein the aptamer specifically binds to a first biological marker in the sample to form a first complex; (ii) contacting the first complex of (i) with a second binding agent that specifically binds to the first reagent such that a second complex is formed, wherein the second binding agent is coupled to a reporter molecule; (iii) contacting the second complex (ii) with a substrate for the reporter molecule of the at least one second binding agent; and (iv) detecting the substrate reaction by formation of a reaction product thereby detecting the biological marker in the sample. 2. The method of item 1, wherein the biological marker is present on a cancer cell. 3.     The method of item 1 or 2, wherein the cancer is a carcinoma or adenocarcinoma. 4.     The method of any one of items 1 to 3, wherein the method further comprises performing counterstaining of the sample. 5. The method of any one of items 1 to 4, wherein method steps (i) to (iv) are performed within 20 minutes. 6. The method according to any one of items 1 to 5, wherein the biological marker is a cell surface or intracellular marker. 7. The method of any one of items 1 to 6, wherein the method further comprises harvesting a biological sample from a subject having, or suspecting of having cancer. 8. The method of any one of items 1 to 7, wherein the sample is a tissue sample or a cell sample. 9. The method of item 3, wherein the carcinoma or adenocarcinoma is selected from the group consisting of a hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal 2025283633   19 Dec 2025 carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma basal cell carcinoma or squamous cell carcinoma (in various sites). 10. The method of any one of items 1 to 9, wherein the sample is selected from a frozen section, a tissue touch imprint, a cellular smear (aspiration cytology), or a fresh tissue sample. 11. The method of any one of items 1 to 10, wherein the sample is provided on, or placed onto a microscope slide or a solid support capable of being inspected under a microscope. 12. The method of any one of items 1 to 11, wherein the sample is a cytospin of a cellular suspension obtained from the biological sample. 13. The method of any one of items 1 to 12, wherein the sample is fixed to a microscope slide. 14. The method of any one of items 1 to 13, further comprising counterstaining the sample with hematoxylin and eosin. 15. The method of any one of items 1 to 14, wherein the at least one DNA aptamer is an aptamer that specifically binds to CK8. 16. The method of item15, wherein the aptamer comprises or consists of the sequence of 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTCTTTACGC ACC-3’ (SEQ ID NO:11). 17. The method of item15 or 16, wherein the aptamer comprises or consists of the sequence 5’- X-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTC TTTACGCACCTTTTT-X-3’ (SEQ ID NO:55), wherein X is biotin. 18. The method of item 15 or 16, wherein the aptamer comprises or consists of the sequence 5’- Y-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTT CTTTACGCACCTTTTT-Y-3’ (SEQ ID NO:57), wherein Y is FAM. 2025283633   19 Dec 2025 19. The method of any one of items 1 to 14, wherein the at least one DNA aptamer is an aptamer that specifically binds to CK18. 5 20. The method of item 19, wherein the aptamer comprises or consist of the sequence of 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50). 21. The method of item 19 or 20, wherein the aptamer comprises or consists of the sequence 5’-X-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT- 10 X-3’ (SEQ ID NO:56), wherein X is biotin. 22. The method of item 19 or 20, wherein the aptamer comprises or consists of the sequence 5’-Y-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT-Y-3’ (SEQ ID NO:58), wherein Y is FAM. 15 23. The method of any one of items 1 to 22, comprising contacting the sample with a further DNA aptamer that binds to a biological marker of interest. 24. The method of item 23, wherein the aptamer specifically binds to HER2. 20 25. The method of item 24, wherein the aptamer comprises or consists of the sequence 5’-TTTTTTTTCCTCCATTGGTTTTTTT-3’ (SEQ ID NO:59). 26. The method of item 24, wherein the aptamer comprises or consists of the sequence 5’25 TTTTTGCAGCGGTGTGGGGGCAGCGGTGTGGGGGCAGCGGTGTGGGG-3’ (SEQ ID NO:60). 27.    The method of item 23, wherein the aptamer specifically binds to EpCAM. 30 28.    The method of item 27, wherein the aptamer comprises or consists of the sequence 5’- TTTCACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTTTTT-3’ (SEQ ID NO:61). 29. The method of item 23, wherein the aptamer specifically binds to Nucleolin. 2025283633   19 Dec 2025 30. The method of item 29, wherein the aptamer comprises or consists of the sequence 5’-TTTTTGGTGGTGGTGGTTGTGGTGGTGGTGGTTT-3’ (SEQ ID NO:62). 31.    The method of any one of items 1 to 30, wherein the aptamer is coupled to a reagent. 32. The method of item 31, wherein the reagent is selected from the group consisting of biotin or an analog thereof or fluorescein amidite (FAM) or an analog thereof. Examples of suitable biotin analogs includes desthiobiotin, iminobiotin, biotin-NHS ester, biotin-PEG-oxyamine, biotin hyrazide or biotin HPDP. 33. The method of item 32, wherein the FAM analog is 6-FAM (6-carboxyfluorescein) or FAM isothiocynate or a fluorescein derivative such as FITC (fluorescein-5,6-isothiocyanate). 34. The method of item 1, wherein the second binding agent is coupled to a reporter molecule. 35. The method of item 34, wherein the reporter molecule is an enzyme selected from is horseradish peroxidase (HRP), alkaline phosphatase (AP), beta-galactosidase, glucose-6-phosphate dehydrogenase and luciferase. 36. The method of any one of items 1 to 35, wherein the first reagent is biotin or an analog thereof and the second binding agent is streptavidin or neutravidin. 37. The method of any one of items 1 to 35, wherein the first reagent is FAM or an analog thereof and the second binding agent is anti-FITC. 38. The method of any one of items 1 to 37, wherein the aptamer is provided in a buffer comprising 1% Triton X-100. 39.    The method of item 1, wherein the substrate is a chromogen. 40.    The method of item 39, wherein the chromogen is compatible with the reporter molecule. 41.    The method of item 39 or 40, wherein the chromogen is 3,3'Diaminobenzidine (DAB) or an analog thereof. 2025283633   19 Dec 2025 42. The method of any one of items 1 to 41, wherein step (i) comprises contacting the sample with DNA aptamer that specifically binds to CK8 and a second DNA aptamer that specifically binds to CK18. 5 43. The method of any one of items 1 to 41, wherein step (i) comprises contacting the sample with two or more aptamers selected from the group consisting of an aptamer that specifically binds to CK8, an aptamer that specifically binds to CK18, an aptamer that specifically binds to HER2, an aptamer that specifically binds to EpCAM and an aptamer that specifically binds to 10 nucleolin. 44. The method of item 42 or 43, further comprising contacting the sample with a DNA aptamer that binds to a cancer marker selected from the group consisting of TRA-1-60, SSEA-1, ALDH1A1, Lgr5, CD13, CD19, CD20, CD24, CD26, CD27, CD34, CD38, CD44, CD45, CD47, 15 CD49f, CD66c, CD90, TNFRSF16, CD105, CD133, CD117 / c-kit, CD138, CD151 and CD166. 45.    The method of item 42, wherein the second DNA aptamer is coupled to a second reagent. 46.    The method of item 43, wherein the first and second reagents are the same or different. 20 47.    The method of any one of items 1 to 46, wherein the method further comprises quantifying the biomarker in the sample. 48. The method of item 1, wherein the sample is contacted with a DNA aptamer that 25 specifically binds to CK8, wherein the aptamer is coupled to biotin and wherein the aptamer specifically binds to CK8 in the sample to form a first complex. 49. The method of item 1, wherein the second binding agent comprises streptavidin or neutravidin coupled to HRP. 30 50.    The method of item 1, wherein the second complex (ii) is contacted with a DAB substrate. 51.    The method of item 50, comprising detecting the DAB precipitate formed by reaction with HRP thereby detecting the biological marker in the sample. 2025283633   19 Dec 2025 52. The method of item 1, comprising (i) contacting the sample with a DNA aptamer that specifically binds to CK8 and a DNA aptamer that specifically binds to CK18 wherein each DNA aptamer is coupled to biotin. 53. The method of item 52, wherein the CK8 aptamer comprises or consists of SEQ ID NO:11 or SEQ ID NO:56 and the CK18 aptamer comprises or consists of SEQ ID NO:50 or SEQ ID NO:56. 54. The method of item 1, wherein the sample is contacted with a DNA aptamer that specifically binds to CK8, wherein the aptamer is coupled to FAM and wherein the aptamer specifically binds to CK8 in the sample to form a first complex. 55. The method of item 1 or 54, wherein the second binding agent comprises an anti-FITC antibody coupled to HRP. 56. The method of item 1, comprising (i) contacting the sample with a DNA aptamer that specifically binds to CK8 and a DNA aptamer that specifically binds to CK18 wherein each DNA aptamer is coupled to FAM. 57. The method of item 56, wherein the CK8 aptamer comprises or consists of SEQ ID NO:11 or SEQ ID NO:56 and the CK18 aptamer comprises or consists of SEQ ID NO:50 or SEQ ID NO:58. 58. The method of item 1, wherein the sample is contacted with a DNA aptamer that specifically binds to CK18, wherein the aptamer is coupled to biotin and wherein the aptamer specifically binds to CK18 in the sample to form a first complex. 59. The method of item 1, wherein the sample is contacted with a DNA aptamer that specifically binds to CK18, wherein the aptamer is coupled to FAM and wherein the aptamer specifically binds to CK18 in the sample to form a first complex. 60. A method of diagnosing a subject with cancer, the method comprising: (i) contacting a sample obtained from the subject with at least one DNA aptamer coupled to a first reagent and wherein the aptamer specifically binds to a first biological marker in the sample to form a first complex; 2025283633   19 Dec 2025 (ii) contacting the first complex of (i) with a second binding agent that specifically binds to the first reagent such that a second complex is formed, wherein the second binding agent is coupled to a reporter molecule; (iii) counterstaining the sample; (iii) contacting the second complex (ii) with a substrate chromogen for the reporter molecule of the at least one second binding agent; and (iv) detecting the substrate chromogen reaction by formation of a reaction product thereby diagnosing the subject with cancer. 61. A method of treating cancer in a subject, the method comprising: (i) detecting cancer according to a method described in any one of claims 1 to 59; and (ii) subsequently treating the subject. 62. The method of item 61, wherein treating the subject comprises one or more of surgery, chemotherapy, radiotherapy, immunotherapy, or drug therapy. 63.    An isolated aptamer which specifically binds to a cytokeratin 8 (CK8) peptide comprising or consisting of the sequence QRGELAIKDANAKLSELEAALQRAKQ (SEQ ID NO:63). 64. The aptamer according to item 1, comprising or consisting of a sequence selected from the group consisting of: (i) 5’-TATGGGGTCGACTAAATTATGTATATGTCTAAAATGGATCATAACGGGTCTAT GCGTTTCG-3’ (SEQ ID NO:1); (ii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCATGTTTTATGTTCGCCTTTCTT TACGCACC-3’ (SEQ ID NO:2); (iii) 5’-ATTCTCTAAAAACGTTTTATGGAGTTTTTATCTTGTCTTGCTGTGTTAGCTCAA TATCCATG-3’ (SEQ ID NO:3); (iv) 5’-TGTAGAATTATTACCATGCTGAGAGGTTGGTAGTGCGGTCCTATGCGGGAG GTGGGTCGCTT-3’ (SEQ ID NO:4); (v) 5’-ATTTATAGTTATGAGTCGCTTGACGCTAACCCTCCGCCTATAGGCAAAGTAG GCACCTTATC-3’ (SEQ ID NO:5); (vi) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCATGTTTTATGGTCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:7); (vii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTAACATGTTTTATGTTCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:8); (viii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCGTGTTTTACGTTCGCCTTTC 2025283633   19 Dec 2025 TTTACGCACC-3’ (SEQ ID NO:9); (ix) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGTCGCCTTT CTTTACGCACC-3’ (SEQ ID NO:10); (x) 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTT 5 CTTTACGCACC-3’ (SEQ ID NO:11); (xi) 5’-AATTGTCTATGACCCTCCTAACCATGTTTTATGGTTCGCCTTTCTTTACGCA CC-3’ (SEQ ID NO:12); (xii) 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATATTTTATGGTTCGCCTTTCT TTACGCACC-3’ (SEQ ID NO:13); 10 (xiii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGCCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:14); (xiv) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGCCGC CC-3’ (SEQ ID NO:15); and (xv) 5’- AATTGTCTATGACCCTATTCAGTTCCTTGCAATATTTTATTGCCGCCTTTCT 15 TTACGCACC-3’ (SEQ ID NO:16), or a sequence at least 90% identical thereto. 65. The aptamer according to item 63 or 64, wherein the aptamer comprises or consists of the sequence 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCC TTTCTTTACGCACC-3’ (SEQ ID NO:11). 20 66. The aptamer of any one of items 63 or 64, wherein the aptamer comprises or consists of the sequence 5’-X-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTT TTATGGTTCGCCTTTCTTTACGCACCTTTTT-X-3’ (SEQ ID NO:55), wherein X is biotin. 25 67. The aptamer of any one of items 63 to 66, wherein the aptamer comprises one or more modifications that improve aptamer stability in vitro. 68.    The aptamer of any one of items 63 to 66, wherein the aptamer binds to human CK8. 30 69.    The aptamer of item 68, wherein the aptamer binds to a cancer cell expressing CK8 but does not substantially bind to a cell that does not express CK8. 70. The aptamer of any one of items 63 to 69, wherein the aptamer binds to a carcinoma or an adenocarcinoma. 2025283633   19 Dec 2025 71. The aptamer according to item 70, wherein the carcinoma or adenocarcinoma is selected from one or more of hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma, basal cell carcinoma and squamous cell carcinoma (in various sites). 72. The aptamer of any one of items 63 to 71, wherein the aptamer binds to CK8 with a Kd of about 50nM or less. 73. The aptamer of any one of items 63 to 72, wherein the aptamer is coupled to a detectable label. 74. The aptamer of item 73, wherein the detectable label is selected from an enzyme, prosthetic group, fluorescent material, luminescent material, bioluminescent material, electron dense label, label for MRI, radioactive material or label for histochemistry. 75    The aptamer of any one of items 63 to 72, wherein the aptamer is coupled to a reagent. 76.    The aptamer of item 75, wherein the reagent is biotin or FAM. 77.    The aptamer of item 76, wherein the aptamer comprises or consists of the sequence 5’- Y-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTT CGCCTTTCTTTACGCACCTTTTT-Y-3’, wherein Y is FAM (SEQ ID NO:57). 78. A diagnostic agent comprising a DNA aptamer according to any one of items 1 to 59 coupled to a detectable label or reagent for use in histological examination of a biological sample. 79. A method for identifying a cancer cell expressing CK8 in a biological sample obtained from a subject having, or suspected of having cancer, the method comprising contacting the sample with a DNA aptamer according to any one of items 1 to 59 or a diagnostic agent according to item 78. 2025283633   19 Dec 2025 80. An isolated aptamer which specifically binds to a cytokeratin 18 (CK18) peptide comprising or consisting of the sequence KVKLEAEIATYRRLLE (SEQ ID NO:64). 81. The aptamer of item 80, comprising or consisting of a sequence selected from the group consisting of: (i) 5’-CGGCACGTGGAGGGTGATGGGGGGGGCAACGGGGACTTACATCCGTATGCT GGGGGGAGCGA-3’ (SEQ ID NO:17); (ii) 5’-GCAAATGGCACCGCTTCACCCGAGGTGGATTGAATGGTCGCATGACGCGTG GGCCAGCCCAG-3’ (SEQ ID NO:18); (iii) 5’-AAGGCTGCAATCCGTTGTGTAACGGCGACCTTCAACTACTAACCTACAACT TAGGGTCTA-3’ (SEQ ID NO:19); (iv) 5’-GTTATGTCGGAGCTCGTATGATACAGGCCCAAGTCGGCTA-3’ (SEQ ID NO:20); (v) 5’-AGGGGTAACTGCGATTTTAAATGTCGCTCCCCCTGCGTG-3’ (SEQ ID NO:21); (vi) 5’-TACGGGGCTGATGCTTTTTGCTCACGCGAAGAGACGATCCAACCTAGTTCTC CACGTCACCT-3’ (SEQ ID NO:68); (vii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22); (viii) 5’-AAAGGTTGATCTTGTTTCGACTAGAAATTTGGTCATAAAC-3’ (SEQ ID NO:23); (ix) 5’-GTCTAGACCGTACATATTGGATCTCACCTAATCACCTTTGTAACCCGCGAGC ACAAATATCCA-3’ (SEQ ID NO:24); (x) 5’-TACACACTTTGAGTTTTTGAATTCGGTATGTATCAGCTCCGGCTTATCTTGTG GTCCTTTTG-3’ (SEQ ID NO:25); (xi) 5’-GGAATGAGATCAATTATCGTGCATAGGATGCGGAAATTGGACCGCTTTGAC ACTTATTTCAT-3’ (SEQ ID NO:26); (x) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGAC TTATAATTCCC-3’ (SEQ ID NO:27); (xi) 5’-TTAGATGTTGATCCAAGTGGCTGCTGAGCGAAAAGGGGTCTTTTCTTCAGT AGCTACGTCCT-3’ (SEQ ID NO:28); (x) 5’-TTAAGGCATCGATTGATCTCGTTGTCTAGCCCCAGGATTCCGTATTTGAGTA CTCTGTAGAA-3’ (SEQ ID NO:29); (xi) 5’-CCACAATGCCTCTCGCCGAATGCGGTGCGACAGTAAACTACTGGTCATCG GGATCTCGGAGT-3’ (SEQ ID NO:30); (xii) 5’-GTGCGTAGGTAACACAGGAATACGTAACTCTCAATCCTA-3’ (SEQ ID NO:31); (xiii) 5’-GCGGCGATTTCGCAAAACCTCAGGACGTCACGTGAGGGAAATTACCGCT 2025283633   19 Dec 2025 TCTGTTGAGTATG-3’ (SEQ ID NO:32); (xiv) 5’-AGGCCTCTCATACCGAATCTGTACTAATTCTAAGACTCTGGCTCCAGA CCTCGCGTTTTA-3’ (SEQ ID NO:33); (xv) 5’-GTGTAATATCTCAAAAGCCTAGCTATCATACGGAAAAGGCTGCATCCTAATG CCGGCCGCCC-3’ (SEQ ID NO:34); (xvi) 5’-CCGAGTGGGGACAAGGCATGAGGAATCTTAGTTGCGGCGG-3’ (SEQ ID NO:35); (xvii) 5’-TGGTGGCGGTATTCGTGCGATGTCGGAGTGTGTTGGGAAATCCAGGGGT CGCTCGCAAGGTA-3’ (SEQ ID NO:36); (xviii) 5’-GAGAGGGTTAGTCTACTGTATACGCCTTTAACATGGATCTATCCTACCACC TTTTCGACTTT-3’ (SEQ ID NO:37); (xix) 5’-GACTAGGCTCAGGATTGTAATTGTGTCTTCACCCACGCGGGCCGTCCGCT GGTCCGCTCGGG-3’ (SEQ ID NO:38); and (xx) 5’-CAAAGTGCTAGCAGTCGACGCGGTGGAACAGTAGCTTGGAAGTAAACTGAA TCCGGCGGTCT-3’ (SEQ ID NO:39), or a sequence at least 90% identical thereto. 82. The aptamer of item 80, comprising or consisting of a sequence selected from the group consisting of: (i) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22); (ii) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGACT TATAATTCCC-3’ (SEQ ID NO:27); (iii) 5’-ACCTCGAATGGTATTCG-3’ (SEQ ID NO:40); (iv) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACCGAATGG TATTCG-3’ (SEQ ID NO:41); (v) 5’-TGCAATGATGTAAAACGTGATCATG-3’ (SEQ ID NO:42); (vi) 5’-CAATGATGTGAAACGTGATCATGGAATCATACACCGAATGGTATTCG-3’ (SEQ ID NO:43); (vii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44); (viii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGACCGAATGGTATTCG-3’ (SEQ ID NO:45); (ix) 5’-ATGTTGCAATGCTGTGAAACGTGAGCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:46); (x) 5’-ATGTTGCAAGGATGTGAAACGTGATCCTGGACACCGAATGGTATTCG-3’ (SEQ ID NO:47); 2025283633   19 Dec 2025 (xi)   5’-ATGTTGCAGGGATGTGAAACGTGATCCCGGACACCGAATGGTATTCG-3’ (SEQ ID NO:48); (xii) 5’-ATGTTGCAATGAAGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:49); (xiii) 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50); (xiv) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGATGGTATCCG-3’ (SEQ ID NO:51); (xv)    5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCAAATGGTATTTG-3’ (SEQ ID NO:52); (xvi)    5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACAAAATGGTATTTT-3’ (SEQ ID NO:53); and (xvii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGGTGGTACCCG-3’ (SEQ ID NO:54), or a sequence at least 90% identical thereto. 83. The aptamer of item 80, comprising or consisting of a sequence selected from: (i) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22); (ii) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGAC TTATAATTCCC-3’ (SEQ ID NO:27); (iii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44); (iv) 5’-ATGTTGCAAGGATGTGAAACGTGATCCTGGACACCGAATGGTATTCG-3’ (SEQ ID NO:47); (v)    5’-ATGTTGCAGGGATGTGAAACGTGATCCCGGACACCGAATGGTATTCG-3’ (SEQ ID NO:48); (vi)    5’-ATGTTGCAATGAAGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:49); (vii) 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50); (viii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGATGGTATCCG-3’ (SEQ ID NO:51); (vix) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCAAATGGTATTTG-3’ (SEQ ID NO:52); (x) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACAAAATGGTATTTT-3’ (SEQ ID NO:53); and 2025283633   19 Dec 2025 (xi) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGGTGGTACCCG-3’ (SEQ ID NO:54), or a sequence at least 90% identical thereto. 84.    The  aptamer  of  item  80,  comprising or consisting  of the sequence 5’- ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44). 85.    The  aptamer  of  item  80,  comprising or consisting  of the sequence 5’- ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50). 86.    The  aptamer  of  item  80,  comprising  or  consisting  of the sequence 5’-Y- TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT-Y-3’ (SEQ ID NO:58), wherein Y is FAM. 87. The aptamer of any one of items 80 to 86, wherein the aptamer comprises one or more modifications that improve aptamer stability in vitro. 88.    The aptamer of any one of items 80 to 87, wherein the aptamer binds to human CK18. 89.    The aptamer of any one of items 80 to 88, wherein the aptamer binds to a cancer cell expressing CK18 but does not substantially bind to a cell that does not express CK18. 90. The aptamer of one of items 80 to 89, wherein the aptamer binds to CK18 with a KD of about 200 nM. 91. The aptamer of any one of items 80 to 90, wherein the aptamer binds to a carcinoma or adenocarcinoma cell. 92. The aptamer of item 91 wherein the carcinoma or adenocarcinoma is selected from one or more of hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma, basal cell carcinoma or squamous cell carcinoma (in various sites). 2025283633   19 Dec 2025 93. The aptamer of any one of items 80 to 92, wherein the aptamer is coupled to a detectable label. 94. The aptamer of item 93, wherein the detectable label is selected from an enzyme, prosthetic group, fluorescent material, luminescent material, bioluminescent material, electron dense label, label for MRI, radioactive material or label for histochemistry. 95.    The aptamer of any one of items 80 to 94, wherein the aptamer is coupled to a reagent. 96.    The aptamer of item 95, wherein the reagent is biotin or FAM. 97.    The  aptamer of item 96, comprising or consisting of the sequence X- TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT-X, (SEQ ID NO:56), wherein X is biotin. 98. A diagnostic agent comprising a DNA aptamer according to any one of items 1 to 59 coupled to a detectable label or reagent for use in histological examination of a biological sample. 99. A method for identifying a cancer cell expressing CK18 in a biological sample obtained from a subject having, or suspected of having cancer, the method comprising contacting the sample with a DNA aptamer according to any one of items 1 to 59 or a diagnostic agent according to item 60. areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma basal cell carcinoma or squamous cell carcinoma (in various sites). 2025283633   19 Dec 2025 EXAMPLES Example 1 Development of a DNA aptamer to cytokeratin 8 The epitope on human cytokeratin for the widely used anti-cytokeratin antibodies, i.e. Cam 5.2 or AE1:AE3, has remained elusive since their initial description (Makin CA et al., (1982) J Clin Pathol 37:975). In histopathology, the anti-CK8 antibodies are used to confirm epithelial nature of tissue or tumours and employed to assess cancer metastasis in sentinel lymph nodes (Kelder W et al., (2006) Scand J Gastroenterol 41:1073). Therefore, the inventor decided to develop a novel DNA aptamer against cytokeratin 8 by using a human cytokeratin 8 peptide as the target in the SELEX process. For this purpose, the epitope of a known CK8 monoclonal antibody TS1 was utilised. This CK8 peptide is 26 amino acid residues in length and having the sequence QRGELAIKDANAKLSELEAALQRAKQ (Johansson A et al., (1999) Cancer research 59:48; SEQ ID NO:63). The CK8 peptide corresponds to amino acid residues 368-393 in human cytokeratin 8 (NCBI Reference Sequence: NP_001243211.1). Upon FASTA analysis, this peptide has 77% sequence identity to human cytokeratin 7 or cytokeratin 5 and 69% sequence identity to cytokeratin 6. The systematic evolution of ligands by exponential enrichment (SELEX) method was utilised as detailed in Wang T et al., (2019) Hum Gene Ther Methods 30:1-16 to select DNA aptamers against human cytokeratin 8. The CK8 peptide, QRGELAIKDANAKLSELEAALQRAKQ (SEQ ID NO:63), was used as a target or bait. A 20-amino acid residue scrambled peptide, GSFCDVIPITDQEKGKFVGA (SEQ ID NO:67), was a counter-selection negative control for the non-specific binding of selection matrix. These peptides were incubated to a N40 random DNA oligo library and the SELEX was proceeded with 14 cycles. The candidate aptamers were cloned into a DNA sequencing vector followed by DNA sequencing. Six potential CK8 aptamers were identified (Table 1), via microplate-based ELISA assays using recombinant human CK8 protein as a target (Figure 1). Biotin was attached to the 5’ end of the aptamers. In this assay, the aptamers were dissolved in phosphate buffered saline (pH 7.4) containing 5 mM MgCl2. Aptamer (2 pM) were folded by heating at 95°C for 5 min, chilling on ice for 10 min followed by incubation at 37°C for 15 min. Table 1______Sequence of candidate full length CK8 aptamers Aptamers No. of nucleotides Sequences (5’ ^ 3’) SEQ ID NO: 1 61 TATGGGGTCGACTAAATTATGTATATGTCTAAAATGGATCATAAC GGGTCTATGCGTTTCG 2025283633   19 Dec 2025 SEQ ID NO: 2 61 AATTGTCTATGACCCTATTCAGTTCCTTGCCATGTTTTATGTTCG CCTTTCTTTACGCACC SEQ ID NO: 3 62 ATTCTCTAAAAACGTTTTATGGAGTTTTTATCTTGTCTTGCTGTGT TAGCTCAATATCCATG SEQ ID NO: 4 62 TGTAGAATTATTACCATGCTGAGAGGTTGGTAGTGCGGTCCTAT GCGGGAGGTGGGTCGCTT SEQ ID NO: 5 62 ATTTATAGTTATGAGTCGCTTGACGCTAACCCTCCGCCTATAGG CAAAGTAGGCACCTTATC SEQ ID NO: 6 61 AGGAACAGTCGGTGTACTTTTGAATCCGGAAAAAGTAATGGACA GACGATAGTAGAAAAGC The folded (500 nM) biotinylated aptamers were allowed to bind to the His-tagged CK8 proteins immobilized on the 96-well. The signals for the binding of biotin-labelled aptamer to the his-tagged CK8 proteins was assayed by the addition of neutravidin-HRP with 3, 3', 5, 5'-tetramethylbenzidine (TMB) as a substrate. A recombinant His-tagged irrelevant ectodysplasin A receptor (EDAR) protein was used as a negative control. As shown in Figure 2, five of these six aptamers (SEQ ID NO: 1 to SEQ ID NO: 5) were able to bind to immobilized human cytokeratin 8 protein. Of those, aptamer SEQ ID NO: 2 emerged as the most promising candidate as it showed the highest binding amongst the six aptamer clones studied in Figure 2. The aptamer SEQ ID NO: 6 showed hardly any binding to cytokeratin 8, thus it was used as a negative control aptamer because it is of similar length to the other cytokeratin-binding aptamers. The aptamer-ELISA procedure involves the following. Nine pmoles of His-tagged CK8 protein (Abcam, Cat No.: ab156970) was coated onto each Pierce™ Nickel-coated well (Catalogue number: 15242) overnight in cold room. On the next day, these wells were washed for 3 min with 200 pL of washing buffer (1* PBS with 0.05% Tween-20) at 600 rpm on a Thermo Digital Plate Shaker (Cat No.: 88882006). The washing buffer was discarded, and the washing was repeated twice. After the addition of 200 pL of blocking buffer (1* PBS with 1:1000 StartingBlock™ (Thermo Scientific, Cat No.: 37539)) supplemented with 100 pg / mL of sheared salmon sperm DNA (Thermo Fisher Scientific Cat No.: AM9680) to each CK8-protein coated well, the wells were incubated for 30 min at room temperature on the plate shaker at 400 rpm, followed by washing once with washing buffer. Next, 100 pL (500 nM) of folded 5’-biotinylated CK8-aptamers were incubated with the wells containing immobilized His-tagged CK8 protein for 15 min at room temperature on the plate shaker at 400 rpm. As a positive control, 100 pL of biotinylated anti-CK8 antibody (15 nM, Invitrogen, Cat No.: MA5-14425) was used. The aptamer / antibody solution was discarded, and the wells were washed with 250 pL washing buffer (supplemented with 5 mM MgCl2) for 3 min at 600 rpm for 3 times. Upon the removal of the 2025283633   19 Dec 2025 washing buffer, 100 pL of 400 pM NeutrAvidin protein-HRP (Thermo Fisher Scientific™, Cat No.: 31001) was added and incubated at room temperature for 30 min at 400 rpm. After five 3 min washes with 250 pL washing buffer (supplemented with 5 mM MgCl2), 100 pL of 1-Step Ultra TMB-ELISA Substrate Solution (ThermoFisher Scientific, Cat# 34028) was added to each well 5 and incubated for 15 min at room temperature on the plate shaker at 400 rpm. The reaction was terminated by addition of 100 pL of 2M sulphuric acid per well. The absorbance at 450 nm in each well was recorded using a plate reader (BMG Labtech CLARIOstar). As illustrated in Figure 3, the secondary structure of SEQ ID NO: 2 consists of three stemloop structures as modelled using the software UNAFold (Integrated DNA Technologies, Inc.). 10 Next, aptamer SEQ ID NO 2 was engineered by mutating residues at the stems of SEQ ID NO 2 while keeping three loops unchanged. The sequences of these aptamers are provided in Table 2. Biotin was attached to the 5’ end of the aptamers. Table 2 Sequence of aptamers in the first round of mutagenesis of SEQ ID NO:2. Aptamers No. of nucleotides Sequences (5’ ^ 3’) SEQ ID NO: 7 61 AATTGTCTATGACCCTATTCAGTTCCTTGCCATGTTTTATGGTCG CCTTTCTTTACGCACC SEQ ID NO: 8 61 AATTGTCTATGACCCTATTCAGTTCCTTAACATGTTTTATGTTCG CCTTTCTTTACGCACC SEQ ID NO: 9 61 AATTGTCTATGACCCTATTCAGTTCCTTGCCGTGTTTTACGTTCG CCTTTCTTTACGCACC SEQ ID NO: 10 61 AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGTCG CCTTTCTTTACGCACC 15 The residues in the parental aptamer SEQ ID NO:2 that were changed is underlined. Encouragingly, mutations in one of the stems seemed to result in new aptamers which showed an increase in activity after engineering as shown in Figure 4. The increased binding to CK8 protein by the initially engineered derivatives of SEQ ID 20 NO: 2 were likely derived from the strengthened stems in the three stem-loop structures in the aptamer. In order to further enhance the performance of engineered aptamers, the inventor proceeded with the second of mutagenesis by either introducing point mutations in the stem or loops or deleting a part of the nucleotide sequence in the unstructured portion of SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 10.aptamers (Table 3 and Figure 5). Biotin was attached to the 25 5’ end of the aptamers. 2025283633   19 Dec 2025 Table 3 Sequences of the engineered CK8 aptamers in the second round of mutagenesis of SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:10 Aptamers No. of nucleotides Sequences (5’ ^ 3’) SEQ ID NO: 11 62 AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTT CGCCTTTCTTTACGCACC SEQ ID NO: 12 54 AATTGTCTATGACCCTCCTAACCATGTTTTATGGTTCGCCTTTC TTTACGCACC SEQ ID NO: 13 62 AATTGTCTATGACCCTATTCAGTTCCTAACCATATTTTATGGTT CGCCTTTCTTTACGCACC SEQ ID NO: 14 61 AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGCC GCCTTTCTTTACGCACC SEQ ID NO: 15 48 AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGCC GCCC SEQ ID NO: 16 61 AATTGTCTATGACCCTATTCAGTTCCTTGCAATATTTTATTGCC GCCTTTCTTTACGCACC Encouragingly, when the engineered biotinylated CK8 aptamers (500nM) were screened via ELISA using the recombinant His-tagged CK8 protein as the target protein and the recombinant His-tagged EDAR protein as the negative control protein, a clear winner (SEQ ID NO: 11) emerged (Figure 6). To ensure the binding to the recombinant His-tagged CK8 protein in our ELISA assay is specific, we repeated the binding assay by including a biotinylated negative control aptamer (SEQ ID NO: 6) which is of similar length (61 nt) as the best performing CK8-binding aptamer (SEQ ID NO: 11) which is 62 nt in length. As shown in Figure 7, the CK8 protein binding activity of SEQ ID NO:11 was 35% higher than that of the other parental full-length CK8-6 aptamers and was 175% higher than that of the negative control aptamer SEQ ID NO: 6. Next, intracellular flow cytometry was conducted to verify that the capacity of CK8 aptamers in the binding to the native human cytokeratin protein within cancer cells. Three CK8-positive cancer cell lines, i.e. A549 (lung adenocarcinoma), HT-29 (colorectal adenocarcinoma) and MDA-MB-231 (breast adenocarcinoma) were chosen. To ensure the specificity and selectivity of CK8 aptamer, three CK8-negative cancer cell lines were also included, i.e. A549-CK8-KO Clone 101 (A549 cells with its CK8 gene knocked out), T98G (glioblastoma) and U-118 MG (glioblastoma). The absence of the expression of cytokeratin 8 in CK8 gene knockout A549 cell line (A549-CK8-KO Clone 101) has been confirmed by RT-PCR, western analysis (Figure 8) as well as flow cytometry using TS1 anti-CK8 monoclonal antibody . 2025283633   19 Dec 2025 As cytokeratins are intracellular proteins, cells need to be first permeabilized to allow the entry of affinity ligands, e.g. antibodies or aptamers, before the commencement of the affinity ligand binding. The intracellular flow cytometry procedure used was as follows. Cells were harvested and fixed using 200 pL of ice-cold 100% ethanol for 10 min with intermittent tapping . The fixation buffer was removed and cells were washed twice with ice-cold 1x PBS, followed by resuspending in 200 pL of permeabilization buffer (0.3% Saponin, 5% FBS, 2 mM EDTA, and 0.05% NaN3 in 1x PBS) for 10 min on ice with intermittent tapping. Following centrifugation at 800 x g for 3 min, cells were blocked with 200 pL of blocking buffer (0.1 mg / mL sheared salmon sperm DNA (Thermo Fisher Scientific, Cat No.: AM9680) and 1 mg / mL BSA in 1x PBS) for 15 min on ice. Non-permeabilized cell controls were directly subjected to blocking after being harvested. To remove the blocking buffer, cells (both permeabilized and non-permeabilized) were centrifuged at 800 x g for 3 min and incubated with 1 pL of TS1 CK8 monoclonal antibody labelled with PE (Leica Biosystems, Cat No.: NCL-L-CK8-TS1) labelled with PE in 200 pL of 1x PBS for 15 min on ice. Another set of permeabilized cells were treated with anti—p—actin antibody (Biolegend, Cat No.: 643810) labelled with Alexa Fluor® 647 (Control) to confirm that permeabilization has occurred and intra-cellular proteins are exposed in all the cells. After two washes with 1x PBS, the cells were re-suspended in 200 pL of 1x PBS and analysed using BD FACSCanto™ II flow cytometer. A minimum of 10,000 events were collected for each assay. We established the validity of the intra-cellular binding assay using the anti-CK8 TS1 monoclonal antibody as the TS1 antibody targets the epitope on cytokeratin 8 from which we used to develop aptamers via SELEX. In addition, anti-p-actin antibody was used as a positive control for all the cell lines to demonstrate the completeness of the permeabilization of the plasma membrane. As shown in Figure 9, the anti-CK8-TS1 monoclonal antibody shows very little binding to all the CK8-negative cell lines as compared to that in the CK8-positive cells. Such a strictly CK8-dependent binding to CK8-positive cancer cells but not to CK8-negative cells, including the A549 CK8 gene knockout cells demonstrates the validity of this assay. Next, the inventor studied the binding specificity of aptamer SEQ ID NO 2 (full-length) which was a CK8-aptamer candidate obtained from SELEX and aptamer SEQ ID NO: 11, the most promising CK8 aptamer after engineering. In this study, non-permeabilized cells were used as a negative control to show that there was no binding between the aptamers and the CK8 proteins if the cells had not been permeabilized, thus demonstrating that aptamer of SEQ ID NO:11 binds to an intracellular protein. In addition to this, an aptamer (SEQ ID NO: 6) that showed no binding to recombinant CK8 protein in aptamer-ELISA, was used as an additional control for the background non-specific binding of an oligonucleotide. The median fluorescent intensity (MFI) of the aptamer (SEQ ID NO: 6) was always subtracted from the MFI of the CK8-6 and 2025283633   19 Dec 2025 CK6AB aptamers to obtain the true binding of the aptamers to the cells. As shown in Figure 10, there was no statistically significant difference in the binding of the parental aptamer (SEQ ID NO:2) between the CK8-positive cells and that in CK8-negative cells, evident from a very slight increase in fold change of the CK8-positive cell lines as compared to that in the CK8-negative cell lines. Remarkably, after engineering, the aptamer derivative (SEQ ID NO: 11) showed 2.31 times higher binding to HT-29 cells and 1.65 times higher binding to A549 cells as compared to that in cytokeratin-negative U-118 MG cells. Thus, a significant improvement in the binding of (SEQ ID NO: 11) aptamer to cytokeratin 8 was achieved after the aptamer engineering. Furthermore, the binding pattern of CK8-6AB aptamer follows the trend displayed by the anti-CK8 antibodies. Therefore, the binding of the engineered (SEQ ID NO: 11) aptamer to the native human CK8 protein in cancer cells was confirmed using multiple CK8-positive and CK8-negative cell lines. To further ascertain the specificity of CK8 aptamer (SEQ ID NO: 11), the inventor conducted aptamer-based ELISA binding assay using a series of carefully chosen His-tagged recombinant cytokeratin proteins, i.e. CK5, CK17, CK18, CK19 and CK20 to determine the specificity of the developed CK8 aptamer. In addition, the same assay was performed by testing other His-tagged non-cytokeratin proteins, i.e. CD9, CD80, EpCAM, Her-2 and EDAR, to demonstrate the specificity of the aptamer. As shown in Figure 11A, aptamer SEQ ID NO: 11 showed a very high and preferential binding to CK8 protein compared to other type I cytokeratin such as CK17, CK18, CK19 and CK20. Interestingly, it showed moderate binding to CK5 which is a diagnostic marker of squamous carcinomas. The binding of aptamer SEQ ID NO: 11 might be attributed to the 76% of amino acid sequence similarity between the target epitope in CK8 and CK5 protein. Nonetheless, this is considered not to be an issue as the inventor’s CK8 aptamer is designed to stain CK8-positive cells present in the epithelial lining of tissues. It would be advantageous if the aptamer SEQ ID NO: 11 could react with squamous cell carcinomas in addition to carcinomas. Furthermore, binding of the aptamer SEQ ID NO: 11 to other tumor-associated proteins, namely CD9, CD80, EpCAM, HER-2 and EDAR, was only less than half of that to the CK8 protein as shown in Figure 11B. Of note, the absorbance at 450 nm for the binding of the aptamer to other tumor-associated proteins was around 0.1, which is usually regarded as the cut-off threshold for background noise in spectrophotometry. Thus, the aptamer SEQ ID NO: 11 binds to cytokeratin 8 with high specificity and selectivity. Next, the inventor proceeded to determine the apparent dissociation constant (Kd) of aptamer SEQ ID NO: 11 to human CK8 protein using aptamer-ELISA as outlined in Figure 1. Specifically, nine pmoles of his-tagged CK8 protein (Abcam, Cat No.: ab156970) was coated onto each Pierce™ Nickel-coated well overnight in a cold room. On the next day, the binding assay with CK8 aptamers was performed by using a series of concentrations of biotinylated 2025283633   19 Dec 2025 aptamers that spans at least concentration ranges that are 10-fold higher and lower than the Kd (determined in pilot experiment). The same concentration of the negative control aptamer (SEQ ID NO: 6) was used for each of the matching input concentration of aptamer SEQ ID NO: 11. As shown in Figure 12, the apparent Kd of the CK8-6AB SEQ ID NO: 11 towards CK8 protein is 46 5 nM, while the apparent KD of its parental aptamer SEQ ID NO: 2 towards CK8 protein is 3 times lower at 121 nM. Taken together, the robust Kd plus high specificity suggests the superiority of the engineered aptamer SEQ ID NO: 11. Therefore, this CK8 aptamer was chosen as a molecular probe for CK8 protein to spearhead the development of aptamer-enabled intraoperative surgical pathology for cancer. 10 Example 2 Development of a DNA aptamer to cytokeratin 18 The type I cytokeratin intermediate filament CK18 is co-expressed complementary with the type II cytokeratin CK8. Most normal cells and carcinomas expressing CK18 protein also express CK8 protein (Weng YR et al., (2012) Mol Cancer Res 10:485). Therefore, the application 15 of anti-CK8 aptamer together with anti-CK18 aptamer may boost the signal output. Moreover, high CK18 expression independently predicts poor prognosis for lung adenocarcinoma patients (Xie et al. 2019; Wang et al. 2020). The power of aptamer technology lies in its ability to generate epitope-specific affinity ligand by design, as the SELEX can be used to generate aptamers to any target molecules 20 presented to the initial large random aptamer pool. With the aim of identifying a peptide sequence within the CK18 protein that is conserved across other diagnostically relevant type I and type II cytokeratin proteins, the inventor developed an aptamer against CK18 by performing a BLAST analysis of the amino acid sequences of human cytokeratins. As shown in Figure 13, a 15-amino acid segment in cytokeratin 18 (amino acid residue number 327-342, 25 KVKLEAEIATYRRLLE) was identified as the epitope for the development of CK18 aptamers. This CK18 epitope displays a higher percentage identity to some of the type I and type II cytokeratins (Table 4). Therefore, the anti-CK18 aptamers selected using this CK18 epitope will bind to CK18 at a well-defined epitope. In addition, the aptamer thus developed may cross-react with other cytokeratins, and thus functions as an “Pan-keratin” aptamer. 2025283633   19 Dec 2025 Table 4 Percentage identity of the CK18 aptamer epitope sequence to that of other diagnostically relevant cytokeratins Type I cytokeratins                  Type II cytokeratins Identity %___________________________Identity % CK10-isoform I 62.5 CK1 68.7 CK10-isoform II 62.5 CK5 68.7 CK15 75 CK2 68.7 CK16 81.25 CK3 75 CK19 75 CK4 68.7 CK6A 68.7 CK6B 68.7 CK6C 68.7 Systematic evolution of ligands by exponential enrichment (SELEX) method was used as 5 detailed in our previous publications (Wang et al. (2019 supra) to select DNA aptamers against human cytokeratin 18. The CK18 peptide, KVKLEAEIATYRRLLE, was used as a target. A 16-amino acid residue scrambled peptide, TERYLRLKLVEKAEIA, was utilized as a counterselection negative control for the non-specific binding of selection matrix. These peptides were incubated to a N40 random DNA oligo library and the SELEX was proceeded with 14 cycles. The 10 candidate aptamers were cloned into a DNA sequencing vector followed by DNA sequencing. A total of 24 candidate CK18 aptamer were identified (Table 5). Table 5 Candidate CK18 aptamers Aptamers Sequences (5’ to 3’) SEQ ID No 17 CGGCACGTGGAGGGTGATGGGGGGGGCAACGGGGACTTACATCCGTATGCTGGGGG GAGCGA SEQ ID No 18 GCAAATGGCACCGCTTCACCCGAGGTGGATTGAATGGTCGCATGACGCGTGGGCCAG CCCAG SEQ ID No 19 AAGGCTGCAATCCGTTGTGTAACGGCGACCTTCAACTACTAACCTACAACTTAGGGTC TA SEQ ID No 20 GTTATGTCGGAGCTCGTATGATACAGGCCCAAGTCGGCTA SEQ ID No 21 AGGGGTAACTGCGATTTTAAATGTCGCTCCCCCTGCGTG SEQ ID No 68 TACGGGGCTGATGCTTTTTGCTCACGCGAAGAGACGATCCAACCTAGTTCTCCACGTC ACCT SEQ ID No 22 ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGAATGGTAT TCG SEQ ID No 23 AAAGGTTGATCTTGTTTCGACTAGAAATTTGGTCATAAAC 2025283633   19 Dec 2025 SEQ ID No 24 GTCTAGACCGTACATATTGGATCTCACCTAATCACCTTTGTAACCCGCGAGCACAAATA TCCA SEQ ID No 25 TACACACTTTGAGTTTTTGAATTCGGTATGTATCAGCTCCGGCTTATCTTGTGGTCCTT TTG SEQ ID No 26 GGAATGAGATCAATTATCGTGCATAGGATGCGGAAATTGGACCGCTTTGACACTTATTT CAT SEQ ID No 27 AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGACTTATAATT CCC SEQ ID No 28 TTAGATGTTGATCCAAGTGGCTGCTGAGCGAAAAGGGGTCTTTTCTTCAGTAGCTACG TCCT SEQ ID No 29 TTAAGGCATCGATTGATCTCGTTGTCTAGCCCCAGGATTCCGTATTTGAGTACTCTGTA GAA SEQ ID No 30 CCACAATGCCTCTCGCCGAATGCGGTGCGACAGTAAACTACTGGTCATCGGGATCTC GGAGT SEQ ID No 31 GTGCGTAGGTAACACAGGAATACGTAACTCTCAATCCTA SEQ ID No 32 GCGGCGATTTCGCAAAACCTCAGGACGTCACGTGAGGGAAATTACCGCTTCTGTTGA GTATG SEQ ID No 33 AGGCCTCTCATACCGAATCTGTACTAATTCTAAGACTCTGGCTCCAGACCTCGCGTTTT A SEQ ID No 34 GTGTAATATCTCAAAAGCCTAGCTATCATACGGAAAAGGCTGCATCCTAATGCCGGCC GCCC SEQ ID No 35 CCGAGTGGGGACAAGGCATGAGGAATCTTAGTTGCGGCGG SEQ ID No 36 TGGTGGCGGTATTCGTGCGATGTCGGAGTGTGTTGGGAAATCCAGGGGTCGCTCGCA AGGTA SEQ ID No 37 GAGAGGGTTAGTCTACTGTATACGCCTTTAACATGGATCTATCCTACCACCTTTTCGAC TTT SEQ ID No 38 GACTAGGCTCAGGATTGTAATTGTGTCTTCACCCACGCGGGCCGTCCGCTGGTCCGC TCGGG SEQ ID No 39 CAAAGTGCTAGCAGTCGACGCGGTGGAACAGTAGCTTGGAAGTAAACTGAATCCGGC GGTCT Next the candidate CK18 aptamers selected based on the binding of the CK18 peptide were further studied for their ability to bind to the full-length recombinant human CK18 protein 2025283633   19 Dec 2025 (RayBiotech, Cat No. 230-00702-10) using an aptamer-ELISA as outlined in Figure 1. As shown in Figure 14, two aptamers (SEQ ID NO: 22 and SEQ ID NO: 27) demonstrated significant above background binding to the full-length CK18 protein. As CK18 aptamer SEQ ID NO: 22 binds to the full-length CK18 protein much better than SEQ ID NO: 27, the former was chose for further aptamer development. First, the inventor generated rational truncations of CK18 aptamer SEQ ID NO: 22 based on the secondary structure of this aptamer (Figure 15A and Table 6). Table 6 Aptamer clones derived from truncation of CK18 aptamer SEQ ID NO:22 Aptamers No. of nucleotides Sequences (5’ to 3’) SEQ ID No 40 17 ACCTCGAATGGTATTCG SEQ ID No 41 53 ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACCGAATGGTA TTCG SEQ ID No 42 25 TGCAATGATGTAAAACGTGATCATG As shown in Figure 15B, the truncation of either the first loop-stem (SEQ ID NO: 42) or the second loop-stem (SEQ ID NO: 40) diminished the binding to the CK18 protein. Interestingly, the removal of a 9-nt segment near the 3’-end of the parental aptamer (SEQ ID NO: 22) resulted in a clone (SEQ ID NO: 41) that has a 20% increase in the binding to the full-length CK18 protein (Figure 15B). To explore if the removal of additional nucleotides in the newly engineered CK18 aptamer (SEQ ID NO: 41) could result in further improvement of binding to CK18, three new subclones with various truncation / deletions were generated as shown in Figure 16 and Table 7. Biotin was attached to the 5’ end of the aptamers. Table 7 Further truncation / deletion of CK18 aptamer (SEQ ID NO:41) Aptamers No. of nucleotid es Sequences (5’ to— 3’) SEQ ID No 43 47 CAATGATGTGAAACGTGATCATGGAATCATACACCGAATGGTATTCG SEQ ID No 44 47 ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG SEQ ID No 45 47 ATGTTGCAATGATGTGAAACGTGATCATGACCGAATGGTATTCG Interestingly, the removal of a 7-nucleotide segment between the first and the second loop-stem structures resulted in a clone (SEQ ID NO: 44) that had an approximately 30% 2025283633   19 Dec 2025 increase in the binding to the CK18 protein compared to that of its parental aptamer SEQ ID NO: 41 (Figure 17). Finally, various point mutations to CK18 aptamer SEQ ID NO: 44 were introduced to see if binding of the resultant new aptamers to CK18 protein could be increased (Figure 18 and Table 8). Biotin was attached to the 5’ end of the aptamers. Of the nine mutants generated, 5 eight of them either retained or had improved binding to CK18 protein (Figure 19). One of the mutants, SEQ ID NO: 50, had most pronounced increase in its ability to bind to CK18 protein. Thus, CK18 aptamer SEQ ID NO: 50 was chosen for further characterization. Table 8 Aptamer sequences of the subclones derived from engineering of CK18 aptamer SEQ 10 ID NO: 44 via point mutation ____________________________________________________________ Aptamers No. of nucleotides Sequences (5’ to 3’) SEQ ID No 46 47 ATGTTGCAATGCTGTGAAACGTGAGCATGGACACCGAATGGTATT CG SEQ ID No 47 47 ATGTTGCAAGGATGTGAAACGTGATCCTGGACACCGAATGGTATT CG SEQ ID No 48 47 ATGTTGCAGGGATGTGAAACGTGATCCCGGACACCGAATGGTATT CG SEQ ID No 49 47 ATGTTGCAATGAAGTGAAACGTGATCATGGACACCGAATGGTATT CG SEQ ID No 50 47 ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATT CG SEQ ID No 51 47 ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGATGGTATC CG SEQ ID No 52 47 ATGTTGCAATGATGTGAAACGTGATCATGGACACCAAATGGTATTT G SEQ ID No 53 47 ATGTTGCAATGATGTGAAACGTGATCATGGACACAAAATGGTATTT T SEQ ID No 54 47 ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGGTGGTACC CG In order to assess the specificity and selectivity of CK18 aptamer SEQ ID NO: 50, the inventor carefully examined its binding to three groups of human recombinant and His-tagged proteins. The first group includes relevant cytokeratin proteins, including: CK5 (Novus Biologicals, Cat No.: NBP2-51653), CK17 (Novus Biologicals, Cat No.: NBP2-51594), CK19 15 (Novus Biologicals, Cat No.: NBP2-23164), CK20 (GeneTex, Cat No.: GTX68550-pro), and CK8 (Abcam, Cat No.: ab156970). The send groups include membrane proteins, i.e. p2-microglobulin 2025283633   19 Dec 2025 (Creative Biomart, Cat No.: B2M-1905H), Osteopontin / SPP1 (Sino Biological, Cat No.: 10352-H08H), CRISP3 (Sino Biological, Cat No.: 10996-H08H), and CD80 (Sino Biological, Cat No.: 10698-H08H). The third group included membrane proteins, i.e. EDAR (Sino Biological, Cat No.: 11577-H08H), FABP2 (fatty acid-binding protein 2, Sino Biological, Cat: HG10130-CH), PD-L1 (Sinobiological, Cat No.:10084-H08H), HER2 (Sino Biological, Cat No.: 10004-H08H) and EpCAM (extracellular domain, Sino Biological, Cat No.:10694-H08H). As shown in Figure 20, the CK18 aptamer SEQ ID NO: 50 has excellent specificity in its binding to all the 15 His-tagged recombinant human proteins. Specifically, this aptamer does not bind to the 13 different proteins as the OD450 nm readings is below 0.1. There was a statistically insignificant cross reaction to EpCAM protein—which is also a marker for epithelial cells or carcinoma. Of note, optical density (OD) absorbance measurements below 0.1 has been universally regarded as the background noise for spectrophotometric analysis. Next, the inventor proceeded to demonstrate the CK18 aptamer SEQ ID NO: 50 was able to bind to native human cytokeratin in tumour cells. As illustrated in Figure 21A and B, the intracellular flow cytometric assay was designed in a way that only membrane permeabilized cells will bind to fluorescently labelled CK18 affinity ligand (antibody or aptamer). Thus, this assay reports intracellular binding but not cell surface binding or attachment of affinity ligand. Indeed, a PE-labelled CK18 antibody (Sigma-Aldrich, CAT NO.: SAB4700671) bound to permeabilized and cytokeratin 18-positive breast cancer cells (MDA-MB-231) as well as lung carcinoma cells (A549) but not to the un-permeabilized cells. No binding of PE-labelled CK18 antibody to even permeabilized glioma cells (T98G or U-118 MG) was detected as these two cell lines do not express cytokeratin (Figure 21 C and D). When PE-labelled CK18 antibody was replaced by FAM-labelled CK18 aptamer SEQ ID NO: 50, a very similar binding pattern was observed with these two groups keratin-positive and -negative cells lines (Figure 22). Of note, in CK18 antibody mediated assay (Figure 21 C and D), the signal for CK18 in MDA-MB-231 cells was about 80% higher than that in A549 cells. Whereas in CK18 aptamer SEQ ID NO: 50-mediated assay, the similar higher signal MDA-MB-231 cells over that in A549 cells was recorded (Figure 22), taking into account that the stain index (brightness) of PE is 50-times higher than that of FAM. These data indicate that CK18 aptamer SEQ ID NO: 50 is not only capable to selectively bind to native human cytokeratin but also binds its target protein quantitatively. The apparent dissociation constant (Kd) CK18 aptamer SEQ ID NO: 50 was determined to be about 195.8 nM (Figure 23). This analysis in Figure 23A uncovered a typical concentrationdependent interaction between the aptamer and the recombinant CK18 protein. Such a saturable binding is a clear indication of specific binding. In contrast, the negative control aptamer that has a scrambled nucleotide sequences exhibited a non-saturable, i.e. linear, binding pattern (Figure 23B), which is characteristic of non-specific binding. Therefore, the inventor established that the 2025283633   19 Dec 2025 CK18 aptamer SEQ ID NO 50 binds CK18 protein in a saturable fashion which strongly suggests that the binding is specific. Example 3 Development of DNA aptamer-enabled intraoperative surgical pathology 5 method Having developed DNA aptamers against CK8 and CK18, the inventor proceeded to develop an DNA aptamer-enabled intraoperative aptamer-histochemistry system (referred to herein as “aptahistochemistry”). Through reiterative circles of experimentation and optimisation, the inventor developed a novel system for carrying out aptahistochemistry in the intraoperative 10 setting. The molecular histochemistry design of the system is depicted in Figure 24A. For aptahistochemistry, both the 5’-end and the 3’-end of the CK8 or CK18 DNA aptamer were biotinylated. Importantly, five additional oligo dT residues have been incorporated to both 5’- and 3’- of the CK8 and CK18 aptamer to maximize the accessibility of the biotin moiety to streptavidin or neutravidin (Table 9). 15 Table 9 Optimised aptahistochemical version of CK8 and CK18 DNA aptamers Aptamers No. of nucleotides Sequences (5’ Biotin ---- 3’- Biotin-) CK8 aptamer SEQ ID No 55 72 X- T T T T T AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTT ATGGTTCGCCTTTCTTTACGCACCTTTTT-X, wherein X is biotin CK18 aptamer SEQ ID No 56 57 X-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACC GAATGGTATTCGTTTTT-X, wherein X is biotin This empowers the system with two functions, 1) each target-bound aptamer will attract two reporter molecules; and 2) it protects the DNA aptamer from attack or degradation by exonucleases, as the main group of nucleases that degrade DNA in vitro and in the serum is the 20 exonucleases (Shaw JP et al., (1991) Nucleic acids Res 19:747. The specificity is provided by the DNA aptamer (e.g. CK8 or CK18 aptamers described herein). The sensitivity and the efficiency of the detection are afforded two critical elements in the system, 1) The small size of aptamers. The CK8 aptamer and CK18 aptamer have a molecular mass of 22 kDa and 16 kDa, respectively. Compared to the molecular mass of 150 kDa of an antibody, the CK8 and CK18 25 aptamers are 7-times and 9.4-times, respectively, smaller than an antibody. In intraoperative histochemistry, all affinity probes in the solution diffuse via random diffusion or Brownian motion (Kozack RE et al., (1993) Protein Sci 2:915) during which the smaller molecules, having less 2025283633   19 Dec 2025 mass, possess higher kinetic energy and thus, diffuse faster than larger molecules. 2) A single horseradish peroxidase (HRP) is utilized as a reporter. Most antibody-based “Rapid Immunohistochemistry” systems utilize a polymer linking to multiple HRPs (up to 80 HRPs) as a reporter. The huge size (up to 3350 kDa) of the HRP polymer complex will significantly slow its rate of diffusion. Finally, DAB is chosen as the chromogen to report the binding of DNA aptamers to their target protein as it provides strong and permanent stains. As shown in Figure 24B, our ‘small-and-simple’ DNA aptamer-based intraoperative histochemistry system completes the entire staining of cyto- or histopathology slides within 16 min. The aptamers (400 nM ) used in the disclosed procedure have been prior folded in 1x PBS with 5 mM MgCl2 by heating at 95°C for 5 min, chilling in ice-water for 10 min followed by incubation at 37°C for 15 min. The standard operating protocol (Figure 24) developed for DNA-enabled intraoperative histopathology starts with the fixation in methanol (-20°C, Sigma-Aldrich, Cat # 439193) for 1 min, followed by 10 dips in PBS. The slide is stained with aptamer by adding 200 pl of folded aptamer in 1x PBS with 5 mM MgCl2 and incubated at room temperature (R.T.) for 5 min. After washing via 10 dips in 1x PBS with 5 mM MgCl2, 200 pl of 10 nM neutravidin-HRP (Thermo Fisher Scientific, Cat #31001) or streptavidin-HRP (Agilent-Dako, Cat # P0397012) is added to the slide and incubated at R.T. for 2~5 min, followed by washing via 10 dips in 1x PBS with 5 mM MgCl2. The Liquid DAB+ (100 pl from Agilent-Dako, Cat # K3468) is then added to the slide and incubated at R.T. for about 4-5 min. After washing via 10 dips in 1x PBS with 5 mM MgCl2, the slide is counterstained with 200 pl of hematoxylin at R.T. After washing under tap water for 1 min, the slide is blot dry followed by mounting with 50 pL of DPX mountant (Sigma-Aldrich, cat # 317616) and coverslip. In antibody-based “rapid immunohistochemistry”, various fixation agents for frozen sections have been used. Mohs PolyDetector Plus DAB HRP system (Bio SB, Doc # PIO355, Version #5) heats the slides at 60°C for 3 min followed by fixation in 100% acetone. The Direct IHC system (Novodiax Inc, Hayward, CA, USA) fixes the frozen section in 25 ml glacial acetic acid, 75 ml formaldehyde and 400 ml of 95% alcohol (Liu M et al., (2019) Discov Med 28:29). An ’ultrarapid’ IHC method employing alternating current electric field fixes the slide in acetone for 2 min (Toda H et al., (2011) Acta Histochem Cytochem 44:133) as does the system using EnVision Antibody Complex (Kammerer U et al., (2001) J Histochem Cytochem 49:623). As for the ‘rapid immunohistochemistry’ using LEICA BOND-III Autostainer (takes 54 min), the slides are fixed with 4% paraformaldehyde for 1 minute (Pyo JY et al., (2017) J Pathol Transl Med 51:463). The inventor first investigated the most suitable fixation method for DNA aptamer-based histochemistry by the utilization of a cytospin method (Koh CM (2013) Methods Enzymol 533:235) with MCF-7 breast carcinoma cells. MCF-7 cells express cytokeratin (Joosse SA et al., (2012) Clin Cancer Res 18:993) and are of breast cancer luminal A intrinsic subtype (Paik S et 2025283633   19 Dec 2025 al., (2004) N Engl J Med 351:2817) which accounts for around about 45% of all breast cancers diagnosed. The effect of three commonly used fixation agents were studied, i.e. acetone, ethanol and methanol on the final staining pattern of the slide by DNA aptamer followed by counterstaining with Mayer’s hematoxylin. As shown in Figure 25, fixation with acetone resulted in an under-stained nuclei by Mayer’s hematoxylin, while the fixation with ethanol resulted in better staining of the nuclei but less contrast between the DAB deposit and that of hematoxylin stained nuclei compared with methanol. Fixation with cold methanol generated an DNA aptamer stained slide with excellent marking of the nuclei without compromising the DAB staining in the cytoplasm / membrane. This data is consistent with that of antibody-based IHC in which different fixation methods used for frozen section have been shown to have significant impact on the strength of signal, the extent of background as well as resultant cell morphology (Shi SR et al., (2008) Am J Clin Pathol 129:358). The inventor has established that fixation of slides with cold (-20°C) methanol for 1 min is best suited for DNA aptamer-enabled intraoperative surgical pathology. It is important to note that the flashing point, the temperature at which a substance generates a sufficient amount of vapor to form a mixture that can be ignited, for acetone and methanol is -20°C and 11 °C, respectively. Moreover, acetone is more cardiotoxic than methanol (https: / / hero.epa.gov / hero / index.cfm / reference / details / reference id / 1620660 and https: / / www.atsdr.cdc.gov / ToxProfiles / tp21.pdf). Therefore, the use of methanol as the fixation agent is much safer than acetone and hence is more practical and user friendly to be incorporated into routine pathology workflow. For counterstaining, hematoxylin is used to counterstain nuclei in IHC, due to its relatively high level of contrast produced between the brown (DAB) and the blue colour of hematoxylin. The hematoxylin stain provides a contrast to the chromogen and also helps the pathologist visualize the underlying tissue structure. The types of hematoxylin commercially available include, Mayer’s, Harris’s, Gill’s, Cole’s. Delafield’s and Carazzi’s hematoxylin. The inventor wanted to identify a type of hematoxylin that clearly marks the nuclei in the inventors aptamer-stained slides but at the same time does not interfere with the perception of the brown precipitate of DAB in the cytoplasm or the membrane. To this end, the outcome of counterstaining of MCF-7 cytospin slides with CK8 aptamer with commonly employed hematoxylin stains was examined, namely Mayer’s (Trajan Scientific Australia, Cat# YAMS-MHM) Harris (Sigma-Aldrich, Cat# HHS32), Gill’s No. I (Trajan Scientific Australia, Cat# YAMS-9064482), Gill’s No. II (Trajan Scientific Australia, Cat# YAMS-9062212), and Gill’s No. III (Trajan Scientific Australia, Cat# YAMS-9062216) hematoxylin. As shown in Figure 26, the counterstaining of DNA aptamer / DAB-stained slide with Gill’s No. I resulted in a under-stained nuclei, staining with Gill’s No II resulted in better stained nuclei but with altered hue of DAB and staining with Gill’s No III had a 2025283633   19 Dec 2025 suppressed hue of DAB. The counterstaining of DNA aptamer / DAB stained with Harris resulted in a vastly overstained nuclei. The Mayer’s hematoxylin was found to be the most suitable hematoxylin for counterstaining of DNA aptamer / DAB-stained slides as it does not only mark all nuclei but also does not stain the cytoplasm or membrane. Importantly, staining with Mayer’s hematoxylin resulted in a well-balanced hue between the blue (nuclei) and the brown (DAB deposit) which significantly facilitates the identification of carcinoma cells marked by DAB via manual scanning of the frozen section by naked eye under microscope. Thus, Mayer’s hematoxylin was established as best suited for DNA aptamer-enabled intraoperative surgical pathology. Next, performance of the DNA aptamer-enabled intraoperative surgical pathology that follows a 16 min protocol as shown in Figure 24 was examined. To this end, the inventors first used cytospin slides of breast carcinoma cells MCF-7 as the cytospin slides are a mimetic of touch imprint slides or cytology (direct smear) slides on which an intact layer of unsectioned cells is subject to anatomical pathology examination. As shown in Figure 27 A and B as well as in Figure 28, the biotinylated CK8 and biotinylated CK18 aptamers readily react with MCF-7 cells. Remarkably, the binding of the biotinylated CK8 or CK18 aptamer to the breast carcinoma cells is strictly aptamer dependent, as there was no DAB staining at all in the negative control slides in which the aptamer was replaced with PBS (Figure 27 C and D). The data in Figure 27 C & D uncover an inconspicuous feature of the DNA aptamer-enabled intraoperative surgical pathology in which the endogenous biotin or peroxidase is unable to instigate DAB staining even in the absence of blocking of endogenous biotin or peroxidase. Strictly aptamer-dependent DAB staining is afforded by one or more features of the disclosed method, including double biotinylation of the aptamer, the introduction of 5x-oligo-dT spacer between biotin and the aptamer, the adoption of a single HRP molecule as a reporter, the fine-tuned concentration of streptavidin-HRP applied, the short duration of exposure of the slide to streptavidin-HRP and carefully calibrated time allowed for the exposure of DAB substrate. To explore the sensitivity the DNA aptamer-enabled histochemistry, the inventors utilized cytospin slides of HEK293 cells, which are immortalized human embryonic kidney cells. It has been well established that HEK293 cells do not express epithelial cell-adhesion molecule (EpCAM) (Tretter JY et al., (2018) J Biol Chem 293:8994) and possess a neuronal lineage phenotype (Stepanenko AA et al., (2015) Gene 569:182). Importantly, HEK293 cells have been shown to contain very low level of CK8 protein (Wu MS et al., (2013) Biochem Biophy Res Commun 441:618). Thus, these cells are an excellent model for the evaluation of the analytical sensitivity of DNA aptamer-enabled intraoperative histochemistry. As shown in Figure 29 and Figure 30, both the CK8 aptamer and the CK18 aptamer clearly bind to at least some HEK293 cells. Thus, the CK8 / CK18 DNA aptamer-enabled intraoperative histochemistry is highly 2025283633   19 Dec 2025 sensitive based on international IHC guidelines (Torlakovic EE et al., (2015) J Clin Pathol 68:879) in that it can detect cells with a very low level of CK8 / CK18 expression. Furthermore, comparing the staining patten and staining intensity between that in Figures 27 / 28 and that in Figures 29 / 30, it becomes apparent that the overall DAB staining of cytokeratin by CK8 / CK18 aptamer is not only robust and highly sensitive but also semi-quantitative. When developing new anatomical pathology assays, it is critically important to compare the staining pattern of the new probes / ligands with that of the prevailing gold standard (Goldsmith JD et al., (2024) Arch Pathol Lab Med 148:e111). The mixture of two cytokeratin antibodies, AE1:AE3, has been used as the gold standard for the staining of cytokeratin world-wide (Listrom MB et al., (1987) Am J Clin Pathol 88:297). Therefore, we performed the AE1:AE3 antibody staining of the MCF-7 cytospin slides using the protocol shown in Figure 24 with some modifications. After fixation in cold methanol for 1 min, the slide was incubated with HRP-conjugated AE1:AE3 (1:100 dilution, Santa Cruz Biotechnology, Cat# SC-81714) for 20 min, followed by 10 min with DAB substrate and 10 sec with Mayer’s hematoxylin. As shown in Figure 31, the subcellular pattens of DAB staining by the AE1:AE3 antibody (Figure 31) is very similar to that by CK8 or CK18 aptamer (Figures 26728). These data provide strong support to the validity of CK8 / CK18 DNA aptamer-enabled intraoperative histochemistry for its clinical use. Cancer cell lines are important models in clinical research, however, they do have inherit limitations (Sinha R et al., (2021) Cell Rep Methods 1:100039). Verification of the analytical performance of the DNA aptamer-enabled intraoperative histochemistry using the real-world clinical frozen sections was commenced. To this end, a number of human frozen sections were obtained and freshly cut onto a SuperFrost positively-charged glass slide from OriGene Technologies (Rockville, MD 20850, USA). These sections were collected from major US institutions under strict Institutional Review Board / NIH guidelines and ethical consenting practices. Each slide is accompanied by an abstract of pathology report with all relevant clinical / pathological information. A frozen section of lymph node from a 53-year-old patient with stage IIB metastatic ductal / lobular adenocarcinoma (triple negative breast cancer) was used. This 5 pm frozen section of lymph node (OriGene, CAT#: CS539088) consists of 40% normal lymphoid cells, 50% breast cancer cells and 10% tumor hypercellular stroma with no discernible necrosis. The H&E staining of this lymph node (supplied by OriGene, USA) is shown in Figure 32. Of note, all frozen section of tissue from OriGene have two pieces of 5 pm frozen section deposited on the same SuperFrost positively-charged glass slide with a well separated distance between them. This configuration for frozen section slides allows one to use one section for detection and the other as a negative control. This allows more vigorous control of a number of factors as both samples are subjected to the same experimental conditions simultaneously except for the factors to be controlled with (Goldsmith JD et al., (2024) Arch Pathol Lab Med 2025283633   19 Dec 2025 148:e111; Torlakovic EE et al., (2014) Appl Immunohistochem Mol Morphol, 22:241). In validating the analytical performance of the DNA aptamer-enabled intraoperative histochemistry, the inventors utilized this dual frozen section-positioned slide to control for potential interference from endogenous biotin or endogenous peroxidase. Figure 34 shows an example of staining of a lymph node with metastatic breast carcinoma cells (OriGene, CAT#: CS539088) with biotinylated CK8 aptamer suing the protocol outlined in Figure 24. The CK8 aptamer robustly stained the breast carcinoma cells spread to the lymph node with very high specificity. The specificity of the CK8 aptamer in staining only carcinoma cells is supported by the findings of (1) no adjacent lymphoid cells were stained in Figure 24 A and B. (2) on the separate frozen section of the same cancer infiltrated lymph node on the same slide, there was no staining of DAB at all when the CK8 aptamer was replaced by PBS (Figure 24 C and D). The capability of CK18 aptamer in selectively identifying breast carcinoma cells in the lymph node is also demonstrated. As shown in Figure 34, CK18 aptamer stained carcinoma cells in the lymph nodes with high specificity. No adjacent lymphoid cells were stained in Figure 34 A and B. Importantly, there was no DAB staining at all in the frozen section of the same lymph node on the same slide when CK18 aptamer was omitted (Figure 34 C and D). Taken together, Figure 33 and Figure 34 have demonstrated that the staining of carcinoma cells by the inventor’s biotinylated CK8 / 18 aptamers is definitely not an artefact from endogenous biotin or peroxidase in human tissues. Thus, this is a unique feature of aptamer-based histochemistry in that it is less likely to have non-specific staining due to the presence of endogenous peroxidase. This advantage is afforded by the small size and the charge distribution on the surface of the folded aptamer which result in minimal physical trapping and / or electrovalent bonding to the proteins on the slides. Therefore, these data have provided unequivocal evidence that the inventor’s biotinylated DNA aptamer-based novel intraoperative surgical pathology procedure will not be affected by endogenous biotin or endogenous peroxidase in human lymph nodes. To evaluate if the CK8 and CK18 aptamers produced the same subcellular staining patten as that by the current gold standard antibody, the same frozen section of the lymph node with metastatic breast carcinoma cells (OriGene, CAT#: CS539088) as used in Figure 33 and Figure 34 was stained. As shown in Figure 35, the pan-cytokeratin antibodies, AE1:AE3 (Listrom et al., (1987) supra) produced a staining pattern highly similar to that produced by CK8 or CK18 aptamers (Figure 33 / 34). Therefore, the CK8 and CK18 aptamer have produced highly similar subcellular patterns as that by the AE1:AE3 antibodies in both MCF-7 breast cancer cell line and the real-world frozen section of lymph nodes with metastatic breast cancer cells. These data provide a solid foundation for the application of CK8 / CK18 DNA aptamer-enabled intraoperative histochemistry in anatomical pathology practice. 2025283633   19 Dec 2025 The analytical specific and selectivity of the DNA aptamer-enabled intraoperative histochemistry were further validated by the absence of aptamer-DAB staining of the frozen sections structures (OriGene, Cat CS617686) of normal human lymph node with lymphadenitis consisting of 100% normal architecture and no tumor (Figure 36 / 37). Of note, it has been well documented that fibrosarcoma is cytokeratin-negative (Folpe AL (2014) Histopathology 64:12; Hoshina H et al., (2023) Surg Case Rep 9:50; Murshed KA et al., (2021) Apmis 129:455). As demonstrated in Figure 38 and Figure 39, the specificity of CK8 / CK18 aptamer staining was further corroborated with the absence of CK8 / CK18 aptamer staining in frozen sections of fibrosarcoma (OriGene, Cat CS536784). The endogenous biotin and peroxidase on tissue samples can be blocked using standard method that flushes the slides with access amounts of streptavidin / biotin and / or hydrogen peroxide and sodium azide. Example 4 Development of a biotin-free system for DNA aptamer-enabled intraoperative surgical pathology As endogenous biotin is present in some human tissues / cells (Kim, S et al., (2016) J Pathol Transl Med 50:411), a biotin-free histochemistry system is desirable, particularly in tissues with high endogenous biotin such as the liver and kidney. Thus, the inventor developed an alternative detection system for DNA aptamer-enabled intraoperative surgical pathology. As shown in Figure 40 and Table 10, 6-carboxyfluorescein (FAM) (Sigma Aldrich) was selected to replace biotin as the tagging moiety to be conjugated to both the 5’-and and the 3’-end of DNA aptamers. Table 10 FAM-labelled CK8 and CK18 DNA aptamers No. of Aptamers nucleotide Sequences (5’ FAM ----3’ FAM) s SEQ ID No 57 72 Y- T T T T T AA T T G T C T A T GACCC T A T T CAG T T CC T AACCA T G T T T T ATGGTTCGCCTTTCTTTACGCACCTTTTT-Y, wherein Y is FAM SEQ ID No 58 57 Y-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGA ATGGTATTCGTTTTT-Y, wherein Y is FAM An anti-fluorescein antibody or the fragment antigen-binding region (Fab) of the antifluorescein antibody was conjugated with HRP as the reporter. After extensive research, the 2025283633   19 Dec 2025 inventor developed a unique protocol for FAM-conjugated DNA aptamer enabled intraoperative histopathology starting with the fixation in methanol (-20°C, Sigma-Aldrich, Cat # 439193) for 1 min, followed by 10 dips in PBS. The slide was stained with 100 pl of folded FAM-aptamer (in 1x PBS with 5 mM MgCl2 and 1% Triton X1000 at room temperature (R.T.) for 5 min. After washing via 10 dips in 1x PBS with 5 mM MgCl2, 100 pl of 1.5 Unit / ml anti-fluorescein Fab fragment-HRP (Roche Diagnostics, Cat. #11426346910) in 100 mM Tris-HCl, pH 7.5, 150 mM NaCl and 0.1% Triton X-100 was added to the slide and incubated at R.T. for 5 min, followed by washing via 10 dips in 1x PBS with 5 mM MgCl2. The Liquid DAB+ (100 pl from Agilent-Dako, Cat # K3468) was then added to the slide and incubated at R.T. for 5 min. After washing via 10 dips in 1x PBS with 5 mM MgCl2, the slide was counterstained with 100 pl of hematoxylin at R.T. After washing under tap water for 1 min, the slide was blotted dry followed by mounting with 50 pL of DPX mountant (Sigma-Aldrich, cat # 317616) and coverslipped. As shown in Figure 41, the FAM-conjugated CK8 aptamer (SEQ ID NO: 57) stained the MCF-7 breast carcinoma cytospin well with anti-fluorescein Fab-HRP and DAB (Figure 41A & B). The specificity of the staining was confirmed by the absence of DAB deposit in the negative control samples where the FAM-aptamer is absent (Figure 41 C & D). This novel FAM-aptamer / anti-FITC-HRP system was then used to stain frozen sections of a lymph node with ~50% metastatic breast carcinoma cells (OriGene, Cat. No. CS530098). As demonstrated in Figure 42 and Figure 43, both the FAM-CK8 aptamer and FAM-CK18 aptamer stained cytokeratin specifically. To confirm that the novel FAM-aptamer / anti-FITC-HRP system works consistently, another set of frozen sections of a lymph node were utilised. This 5 pm frozen section of lymph node (OriGene, CAT#: CS557928) consists of 80% normal lymphoid cells (80% Follicles, 20% Inter-follicular zone) and 15% breast cancer cells. Indeed, as shown in Figure 44 and Figure 45, both the FAM-CK8 aptamer (SEQ ID NO 57)and FAM-CK18 aptamer (SEQ ID NO 58) stained cytokeratin specifically. Thus, the inventor has developed two different versions of a novel DNA aptamer-enabled intraoperative surgical pathology system that are highly robust, sensitive and specific. The entire aptamer staining procedure can be completed within about 16 to 18 min or so without the need for any special equipment beyond what is already available in a pathology laboratory. Importantly, these systems can be easily incorporated into the current routine anatomical pathology workflow. Example 5 The DNA aptamer-enabled intraoperative surgical pathology can be applied to other DNA aptamers that bind to a protein on human tissue slide As a generally applicable method, the DNA aptamer-enabled intraoperative surgical pathology procedure is not restricted to the use of aptamers against CK8 or CK18. In fact, any 2025283633   19 Dec 2025 DNA aptamer against a cancer-related antigen can be utilized using the procedure described in Figure 24 and / or Figure 40. This example demonstrates the applicability of the disclosed methods with aptamers to HER2, EpCAM and Nucleolin. The sequence are shown in Table 11. Biotin was attached to both the 5’ and 3’ ends of the aptamer. Table 11 DNA aptamers Aptamers No. of nucleotides Sequences (5’ Biotin ---- 3’ Biotin) SEQ ID No 59 25 T T T T T T T T CC T CCA T T GG T T T T T T T SEQ ID No 60 47 TTTTTGCAGCGGTGTGGGGGCAGCGGTGTGGGGGCAGCGGTGTGG GG SEQ ID No 61 56 TTTCACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTG GCCTGTTTTT SEQ ID No 62 34 T T T T T GGTGGTGGTGGTTGTGGTGGTGGTGGTTT To demonstrate the broad applicability of the DNA aptamer-enabled intraoperative surgical pathology system, breast cancer cells were first utilised to demonstrate the universality of the invention. Breast cancer is the most frequently diagnosed cancer and the leading cause of cancer-related death among females worldwide. Approximately 20% of breast cancer overexpress human epidermal growth factor receptor 2 (HER2). Historically, overexpression of this receptor has been associated with an increased risk of disease recurrence and it is a strong predictive factor for sensitivity to HER2-targeted agents. It has now been established that the treatment of patients of HER2-low metastatic breast cancer with trastuzumab deruxtecan (Enhertu) will significantly prolong the progression-free and overall survival (Modi S et al., (2022) N Engl J Med 387:9). Intraoperative radiation therapy among low-risk early breast cancer patients seems to be a safe and more convenient alternative to traditional whole breast radiation, with low toxicity rate, acceptable cosmetic results, and good oncologic outcomes (Friedman-Eldar O et al., (2023) Am Surg 89:920). Therefore, ascertaining the HER2 status during intraoperative surgical pathology would provide invaluable real-time precision medicine information to radiation oncologists to boost the efficacy of intraoperative brachytherapy. 2025283633   19 Dec 2025 In immunohistochemistry, breast cancer cell lines are used as quality control for HER2 IHC assay sensitivity (Rhodes, A et al., (2002) Am J Clin Pathol 118:408). The commonly used breast cancer cell lines for this purpose include MDA-MB-231, MCF-4, T47D and SKRB-3. It has been well established that HER2 cell surface density in MCF-7, T47D and SKRB-3 is 31646 copies / cell, 6124 copies / cell and 1517135 copies / cell, respectively (Li JY et al., (2016) Cancer Cell 29:117). While the actual HER2 copy / cell for MDA-MB-231 is yet to measured, semi-quantitative studies using flow cytometry have confirmed that the cell surface density of HER2 in MDA-MB-231 is at least 2-5 fold lower than that in MCF-7 (Lopez-Albaitero A et al., (2017) Oncoimmunology 6:e1267891); In IHC for formalin-fixed and paraffin-embedded specimens, MCF-7 and MDA-MB-231 cannot be measured by IHC and are both IHC negative by a variety of diagnostic kit or antibodies, e.g. HercepTest Kit, VENTANA anti-HER2 / new (4B5) rabbit monoclonal antibody; Novocastra (CB11) HER2 antibody, Novocastra (10A7) HER2 antibody, Dako polyclonal HER2 antibody A0485, Oncogene Research HER2 antibody clone 3B5 (Jensen KR et al., (2017) Mod Pathol 30:180; Garrido C et al., (2024) Virchows Arch 484:1005; Rhodes, A et al., (2002) Am J Clin Pathol 117:81; Rhodes A et al., (2002) Am J Clin Pathol 118:408; Rhodes A et al., (2004) Am J Clin Pathol 122:51). To demonstrate the sensitivity and the generalizability of the present invention, the inventor used a biotin-labelled HER-2 DNA aptamer (Her2-2A, Chinese Patent #CN202111267773.2) using the system outlined in Figure 24 to stain cytospin slides of four different breast carcinoma cells that express varying levels of HER-2 on their cell surface. As shown in Figure 46, the HER2-2A (SEQ ID NO: 59) aptamer not only stained HER-2 in SKRB3 and T47D cells with very high and medium levels of HER2 respectively, it also readily stained HER2 in MCF-7 and MDA-MB-231 cells that are impervious to staining by any HER2 antibodies in immunohistochemistry (Jensen K et al., (2017) Mod Pathol 30:180; Garrido et al., (2024) supra; Rhodes, Jasani, Couturier, et al. (2002) supra; Rhodes et al. (2004) supra; Rhodes, Jasani, Anderson, et al. (2002) supra. Reassuringly, staining of these four types of breast cancer cytospin samples were readily reproduced with another HER-2 DNA aptamer, HER2-HApt (Lee H et al., (2015) ACS Nano 9:9859) using the system outlined in Figure 24. As shown in Figure 47, the HER2-HApt aptamer, with a totally unrelated primary sequence and 2-D structure from that of the HER2-2A aptamer, efficiently detected HER2 in MDA-MB-231 and MCF-7 cells, achieving what immunohistochemistry has never been able to. Given MDA-MB-231 has approximately 730 copies HER2 / cell and SKEB3 cells have 1517135 copies of HER2 / cell, the data in Figures 46 and 47 have indicated that the HER2 DNA aptamer-enabled histochemistry can detect HER2 in cancer cells not only in an unsurpassed sensitivity but also with a dynamic range of 2070-fold, in 2025283633   19 Dec 2025 sharp contrast to the 400-fold dynamic range in antibody-based HER2 IHC (Jensen K et al., Mod Pathol (2017) 30:180 To further ascertain the broadly applicable characteristic of the DNA aptamer enabled aptahistochemistry, the inventor used a DNA aptamer against epithelial cell adhesion molecule (EpCAM) termed SYL3C (Pu Y et al., (2015) Anal Chem 87:1919) to stain MCF-7 breast carcinoma cells and lymph node with metastatic breast cancer cells using the system outlined in Figure 24. The epithelial cell adhesion molecule (EpCAM) is a well-known and widely accepted tumor-associated antigen in head and neck squamous cell carcinoma (Andratschke, Hagedorn, and Nerlich (2015) Anticancer Res 35:3953). The EpCAM IHC is used by pathologists as a sensitive and specific marker to distinguish long adenocarcinoma from mesothelioma (Carella R et al., (2001) Am J Surg Pathol 25:43). In addition, EpCAM is also utilized to distinguish hepatocellular carcinoma from metastatic adenocarcinoma to liver or cholangiocarcinoma (Morrison, Marsh, and Frankel (2002) Mod Pathol 15:1279) as well as to predict the survival in carcinomas of breast and gallbladder (Prince S et al., (2008) Am J Clin Pathol 129:424). As shown Figure 48, the SYLC3 EpCAM aptamer optimized for aptahistochemistry (SEQ ID NO: 61) efficiently stained EpCAM protein in both the MCF-7 breast cancer cytospin (Figure 48, A&B) but also in metastatic breast carcinoma cells in the frozen section of lymph node (Figure 48, C&D). Importantly, the staining of EpCAM protein in cells by the DNA aptamer SYLC3 is highly specific as it does not stain any cells in the cytospin of HEK293 cells which is known for the absence of expression of EpCAM (Kim Y et al., (2009) Anticancer Res 29:1817). These data confirm that the method of the invention can be applied universally. As conclusive validation of the versatility of the universal application of the methods of the invention, aptahistochemistry was performed using a DNA aptamer against nucleolin, which is expressed in the nucleoplasm, cytoplasm as well as on the cell membrane. The overexpression and its increased localization at the cell membrane is a common feature of several tumor cells. In cancer cells, the overexpression of nucleolin influences cell survival, proliferation and invasion through its action on different cellular pathways (Berger, Gaume, and Bouvet (2015) Biochimie 113:78). The AS1411 nucleolin aptamer (SEQ ID NO: 62, Bates et al., (2009) Exp Mol Pathol 86:151) was first engineered to enable the aptahistochemistry and used to stain MCF-7 cytospin slides based on the methods outlined in Figure 24. In accord with all previous examples, the AS1411 DNA aptamer robustly stained MCF-7 breast carcinoma cells (Figure 49). Therefore, DNA aptamer-enabled aptahistochmistry is highly sensitive and specific with wider dynamic range of detection. In addition to a limit of detection previously unattainable in antibody-based immunohistochemistry, DNA aptamer-enabled aptahistochmistry is applicable to any DNA aptamer in intraoperative surgical pathology.

Claims

1. A method for detecting a biological marker in a sample, the method comprising:(i) contacting the sample with at least one DNA aptamer coupled to a first reagent and wherein the aptamer specifically binds to a first biological marker in the sample to form a first complex;(ii) contacting the first complex of (i) with a second binding agent that specifically binds to the first reagent such that a second complex is formed, wherein the second binding agent is coupled to a reporter molecule;(iii) contacting the second complex (ii) with a substrate for the reporter molecule of the at least one second binding agent; and(iv) detecting the substrate reaction by formation of a reaction product thereby detecting the biological marker in the sample.

2. The method of claim 1, wherein the biological marker is present on a cancer cell.

3. The method of claim 1 or 2, wherein the cancer is a carcinoma or adenocarcinoma.

4. The method of any one of claim 1 to 3, wherein the method further comprises performingcounterstaining of the sample.

5. The method of any one of claims 1 to 4, wherein method steps (i) to (iv) are performed within 20 minutes.

6. The method according to any one of claims 1 to 5, wherein the biological marker is a cell surface or intracellular marker.

7. The method of any one of claims 1 to 6, wherein the method further comprises harvesting a biological sample from a subject having, or suspecting of having cancer.

8. The method of any one of claims 1 to 7, wherein the sample is a tissue sample or a cell sample.

9. The method of claim 3, wherein the carcinoma or adenocarcinoma is selected from the group consisting of a hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell2025283633   19 Dec 2025carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma basal cell carcinoma or squamous cell carcinoma (in various sites).

10. The method of any one of claims 1 to 9, wherein the sample is selected from a frozen section, a tissue touch imprint, a cellular smear (aspiration cytology), or a fresh tissue sample.

11. The method of any one of claims 1 to 10, wherein the sample is provided on, or placed onto a microscope slide or a solid support capable of being inspected under a microscope.

12. The method of any one of claims 1 to 11, wherein the sample is a cytospin of a cellular suspension obtained from the biological sample.

13. The method of any one of claims 1 to 12, wherein the sample is fixed to a microscope slide.

14. The method of any one of claims 1 to 13, further comprising counterstaining the sample with hematoxylin and eosin.

15. The method of any one of claims 1 to 14, wherein the at least one DNA aptamer is an aptamer that specifically binds to CK8.

16. The method of claim 15, wherein the aptamer comprises or consists of the sequence of 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTTCTTTACGCACC-3’ (SEQ ID NO:11).

17. The method of claim 15 or 16, wherein the aptamer comprises or consists of the sequence 5’- X-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTC GCCTTTCTTTACGCACCTTTTT-X-3’ (SEQ ID NO:55), wherein X is biotin.

18. The method of claim 15 or 16, wherein the aptamer comprises or consists of the sequence 5’- Y-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTC GCCTTTCTTTACGCACCTTTTT-Y-3’ (SEQ ID NO:57), wherein Y is FAM.2025283633   19 Dec 202519. The method of any one of claims 1 to 14, wherein the at least one DNA aptamer is an aptamer that specifically binds to CK18.

20. The method of claim 19, wherein the aptamer comprises or consist of the sequence of 5  5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’  (SEQ IDNO:50).

21. The method of claim 19 or 20, wherein the aptamer comprises or consists of the sequence 5’-X-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTA10 TTCGTTTTT-X-3’ (SEQ ID NO:56), wherein X is biotin.

22. The method of claim 19 or 20, wherein the aptamer comprises or consists of the sequence 5’-Y-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTA TTCGTTTTT-Y-3’ (SEQ ID NO:58), wherein Y is FAM.1523. The method of any one of claims 1 to 22, comprising contacting the sample with a further DNA aptamer that binds to a biological marker of interest.

24. The method of claim 23, wherein the aptamer specifically binds to HER2.2025. The method of claim 24, wherein the aptamer comprises or consists of the sequence 5’-TTTTTTTTCCTCCATTGGTTTTTTT-3’ (SEQ ID NO:59).

26. The method of claim 24, wherein the aptamer comprises or consists of the sequence 5’25 TTTTTGCAGCGGTGTGGGGGCAGCGGTGTGGGGGCAGCGGTGTGGGG-3’ (SEQ ID NO:60).

27. The method of claim 23, wherein the aptamer specifically binds to EpCAM.30 28.    The method of claim 27, wherein the aptamer comprises or consists of the sequence 5’-TTTCACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTTTTT-3’ (SEQ ID NO:61).

29. The method of claim 23, wherein the aptamer specifically binds to Nucleolin.2025283633   19 Dec 202530. The method of claim 29, wherein the aptamer comprises or consists of the sequence 5’-TTTTTGGTGGTGGTGGTTGTGGTGGTGGTGGTTT-3’ (SEQ ID NO:62).

31. The method of any one of claims 1 to 30, wherein the aptamer is coupled to a reagent.

32. The method of claim 31, wherein the reagent is selected from the group consisting of biotin or an analog thereof or fluorescein amidite (FAM) or an analog thereof. Examples of suitable biotin analogs includes desthiobiotin, iminobiotin, biotin-NHS ester, biotin-PEG-oxyamine, biotin hyrazide or biotin HPDP.

33. The method of claim 32, wherein the FAM analog is 6-FAM (6-carboxyfluorescein) or FAM isothiocynate or a fluorescein derivative such as FITC (fluorescein-5,6-isothiocyanate).

34. The method of claim 1, wherein the second binding agent is coupled to a reporter molecule.

35. The method of claim 34, wherein the reporter molecule is an enzyme selected from is horseradish peroxidase (HRP), alkaline phosphatase (AP), beta-galactosidase, glucose-6-phosphate dehydrogenase and luciferase.

36. The method of any one of claims 1 to 35, wherein the first reagent is biotin or an analog thereof and the second binding agent is streptavidin or neutravidin.

37. The method of any one of claims 1 to 35, wherein the first reagent is FAM or an analog thereof and the second binding agent is anti-FITC.

38. The method of any one of claims 1 to 37, wherein the aptamer is provided in a buffer comprising 1% Triton X-100.

39. The method of claim 1, wherein the substrate is a chromogen.

40. The method of claim 39, wherein the chromogen is compatible with the reporter molecule.

41. The method of claim 39 or 40, wherein the chromogen is 3,3'Diaminobenzidine (DAB) oran analog thereof.2025283633   19 Dec 202542. The method of any one of claims 1 to 41, wherein step (i) comprises contacting the sample with DNA aptamer that specifically binds to CK8 and a second DNA aptamer that specifically binds to CK18.

43. The method of any one of claims 1 to 41, wherein step (i) comprises contacting the sample with two or more aptamers selected from the group consisting of an aptamer that specifically binds to CK8, an aptamer that specifically binds to CK18, an aptamer that specifically binds to HER2, an aptamer that specifically binds to EpCAM and an aptamer that specifically binds to nucleolin.

44. The method of claim 42 or 43, further comprising contacting the sample with a DNA aptamer that binds to a cancer marker selected from the group consisting of TRA-1-60, SSEA-1, ALDH1A1, Lgr5, CD13, CD19, CD20, CD24, CD26, CD27, CD34, CD38, CD44, CD45, CD47, CD49f, CD66c, CD90, TNFRSF16, CD105, CD133, CD117 / c-kit, CD138, CD151 and CD166.

45. The method of claim 42, wherein the second DNA aptamer is coupled to a secondreagent.

46. The method of claim 43, wherein the first and second reagents are the same or different.

47. The method of any one of claims 1 to 46, wherein the method further comprisesquantifying the biomarker in the sample.

48. The method of claim 1, wherein the sample is contacted with a DNA aptamer that specifically binds to CK8, wherein the aptamer is coupled to biotin and wherein the aptamer specifically binds to CK8 in the sample to form a first complex.

49. The method of claim 1, wherein the second binding agent comprises streptavidin or neutravidin coupled to HRP.

50. The method of claim 1, wherein the second complex (ii) is contacted with a DAB substrate.

51. The method of claim 50, comprising detecting the DAB precipitate formed by reaction with HRP thereby detecting the biological marker in the sample.2025283633   19 Dec 202552. The method of claim 1, comprising (i) contacting the sample with a DNA aptamer that specifically binds to CK8 and a DNA aptamer that specifically binds to CK18 wherein each DNA aptamer is coupled to biotin.

53. The method of claim 52, wherein the CK8 aptamer comprises or consists of SEQ ID NO:11 or SEQ ID NO:56 and the CK18 aptamer comprises or consists of SEQ ID NO:50 or SEQ ID NO:56.

54. The method of claim 1, wherein the sample is contacted with a DNA aptamer that specifically binds to CK8, wherein the aptamer is coupled to FAM and wherein the aptamer specifically binds to CK8 in the sample to form a first complex.

55. The method of claim 1 or 54, wherein the second binding agent comprises an anti-FITC antibody coupled to HRP.

56. The method of claim 1, comprising (i) contacting the sample with a DNA aptamer that specifically binds to CK8 and a DNA aptamer that specifically binds to CK18 wherein each DNA aptamer is coupled to FAM.

57. The method of claim 56, wherein the CK8 aptamer comprises or consists of SEQ ID NO:11 or SEQ ID NO:56 and the CK18 aptamer comprises or consists of SEQ ID NO:50 or SEQ ID NO:58.

58. The method of claim 1, wherein the sample is contacted with a DNA aptamer that specifically binds to CK18, wherein the aptamer is coupled to biotin and wherein the aptamer specifically binds to CK18 in the sample to form a first complex.

59. The method of claim 1, wherein the sample is contacted with a DNA aptamer that specifically binds to CK18, wherein the aptamer is coupled to FAM and wherein the aptamer specifically binds to CK18 in the sample to form a first complex.

60. A method of diagnosing a subject with cancer, the method comprising:(i) contacting a sample obtained from the subject with at least one DNA aptamer coupled to a first reagent and wherein the aptamer specifically binds to a first biological marker in the sample to form a first complex;2025283633   19 Dec 2025(ii) contacting the first complex of (i) with a second binding agent that specifically binds to the first reagent such that a second complex is formed, wherein the second binding agent is coupled to a reporter molecule;(iii) counterstaining the sample;(iii) contacting the second complex (ii) with a substrate chromogen for the reporter molecule of the at least one second binding agent; and(iv) detecting the substrate chromogen reaction by formation of a reaction product thereby diagnosing the subject with cancer.

61. A method of treating cancer in a subject, the method comprising:(i) detecting cancer according to a method described in any one of claims 1 to 59; and(ii) subsequently treating the subject.

62. The method of claim 61, wherein treating the subject comprises one or more of surgery, chemotherapy, radiotherapy, immunotherapy, or drug therapy.

63. An isolated aptamer which specifically binds to a cytokeratin 8 (CK8) peptide comprisingor consisting of the sequence QRGELAIKDANAKLSELEAALQRAKQ (SEQ ID NO:63).

64. The aptamer of claim 63, comprising or consisting of a sequence selected from the group consisting of:(i) 5’-TATGGGGTCGACTAAATTATGTATATGTCTAAAATGGATCATAACGGGTCTAT GCGTTTCG-3’ (SEQ ID NO:1);(ii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCATGTTTTATGTTCGCCTTTCTT TACGCACC-3’ (SEQ ID NO:2);(iii) 5’-ATTCTCTAAAAACGTTTTATGGAGTTTTTATCTTGTCTTGCTGTGTTAGCTCAA TATCCATG-3’ (SEQ ID NO:3);(iv) 5’-TGTAGAATTATTACCATGCTGAGAGGTTGGTAGTGCGGTCCTATGCGGGAG GTGGGTCGCTT-3’ (SEQ ID NO:4);(v) 5’-ATTTATAGTTATGAGTCGCTTGACGCTAACCCTCCGCCTATAGGCAAAGTAG GCACCTTATC-3’ (SEQ ID NO:5);(vi) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCATGTTTTATGGTCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:7);(vii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTAACATGTTTTATGTTCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:8);(viii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCCGTGTTTTACGTTCGCCTTTC2025283633   19 Dec 2025TTTACGCACC-3’ (SEQ ID NO:9);(ix) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGTCGCCTTT CTTTACGCACC-3’ (SEQ ID NO:10);(x) 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTT5 CTTTACGCACC-3’ (SEQ ID NO:11);(xi) 5’-AATTGTCTATGACCCTCCTAACCATGTTTTATGGTTCGCCTTTCTTTACGCA CC-3’ (SEQ ID NO:12);(xii) 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATATTTTATGGTTCGCCTTTCT TTACGCACC-3’ (SEQ ID NO:13);10 (xiii) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGCCGCCTTTC TTTACGCACC-3’ (SEQ ID NO:14);(xiv) 5’-AATTGTCTATGACCCTATTCAGTTCCTTGCAATGTTTTATTGCCGCCC-3’ (SEQ ID NO:15); and(xv) 5’- AATTGTCTATGACCCTATTCAGTTCCTTGCAATATTTTATTGCCGCCTTTCT 15 TTACGCACC-3’ (SEQ ID NO:16), or a sequence at least 90% identical thereto.

65. The aptamer of claim 63 or 64, wherein the aptamer comprises or consists of the sequence 5’-AATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTTCGCCTTT CTTTACGCACC-3’ (SEQ ID NO:11).2066. The aptamer of any one of claims 63 or 64, wherein the aptamer comprises or consists of the sequence 5’-X-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTT TTATGGTTCGCCTTTCTTTACGCACCTTTTT-X-3’ (SEQ ID NO:55), wherein X is biotin.25 67.    The aptamer of any one of claims 63 to 66, wherein the aptamer comprises one or moremodifications that improve aptamer stability in vitro.

68. The aptamer of any one of claims 63 to 66, wherein the aptamer binds to human CK8.30 69.    The aptamer of claim 68, wherein the aptamer binds to a cancer cell expressing CK8 butdoes not substantially bind to a cell that does not express CK8.

70. The aptamer of any one of claims 63 to 69, wherein the aptamer binds to a carcinoma or an adenocarcinoma.2025283633   19 Dec 202571. The aptamer of claim 70, wherein the carcinoma or adenocarcinoma is selected from one or more of hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma, basal cell carcinoma and squamous cell carcinoma (in various sites).

72. The aptamer of any one of claims 63 to 71, wherein the aptamer binds to CK8 with a Kd of about 50nM or less.

73. The aptamer of any one of claims 63 to 72, wherein the aptamer is coupled to a detectable label.

74. The aptamer of claim 73, wherein the detectable label is selected from an enzyme, prosthetic group, fluorescent material, luminescent material, bioluminescent material, electron dense label, label for MRI, radioactive material or label for histochemistry.

75. The aptamer of any one of claims 63 to 72, wherein the aptamer is coupled to a reagent.

76. The aptamer of claim 75, wherein the reagent is biotin or FAM.

77. The aptamer of claim 76, wherein the aptamer comprises or consists of the sequence 5’-Y-TTTTTAATTGTCTATGACCCTATTCAGTTCCTAACCATGTTTTATGGTT CGCCTTTCTTTACGCACCTTTTT-Y-3’, wherein Y is FAM (SEQ ID NO:57).

78. A diagnostic agent comprising a DNA aptamer according to any one of claims 1 to 59 coupled to a detectable label or reagent for use in histological examination of a biological sample.

79. A method for identifying a cancer cell expressing CK8 in a biological sample obtained from a subject having, or suspected of having cancer, the method comprising contacting the sample with a DNA aptamer according to any one of claims 1 to 59 or a diagnostic agent according to claim 78.2025283633   19 Dec 202580. An isolated aptamer which specifically binds to a cytokeratin 18 (CK18) peptide comprising or consisting of the sequence KVKLEAEIATYRRLLE (SEQ ID NO:64).

81. The aptamer of claim 80, comprising or consisting of a sequence selected from the groupconsisting of:(i) 5’-CGGCACGTGGAGGGTGATGGGGGGGGCAACGGGGACTTACATCCGTATGCT GGGGGGAGCGA-3’ (SEQ ID NO:17);(ii) 5’-GCAAATGGCACCGCTTCACCCGAGGTGGATTGAATGGTCGCATGACGCGTG GGCCAGCCCAG-3’ (SEQ ID NO:18);(iii) 5’-AAGGCTGCAATCCGTTGTGTAACGGCGACCTTCAACTACTAACCTACAACT TAGGGTCTA-3’ (SEQ ID NO:19);(iv) 5’-GTTATGTCGGAGCTCGTATGATACAGGCCCAAGTCGGCTA-3’ (SEQ ID NO:20);(v) 5’-AGGGGTAACTGCGATTTTAAATGTCGCTCCCCCTGCGTG-3’ (SEQ ID NO:21);(vi) 5’-TACGGGGCTGATGCTTTTTGCTCACGCGAAGAGACGATCCAACCTAGTTCTC CACGTCACCT-3’ (SEQ ID NO:68);(vii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22);(viii) 5’-AAAGGTTGATCTTGTTTCGACTAGAAATTTGGTCATAAAC-3’ (SEQ ID NO:23);(ix) 5’-GTCTAGACCGTACATATTGGATCTCACCTAATCACCTTTGTAACCCGCGAGC ACAAATATCCA-3’ (SEQ ID NO:24);(x) 5’-TACACACTTTGAGTTTTTGAATTCGGTATGTATCAGCTCCGGCTTATCTTGTG GTCCTTTTG-3’ (SEQ ID NO:25);(xi) 5’-GGAATGAGATCAATTATCGTGCATAGGATGCGGAAATTGGACCGCTTTGAC ACTTATTTCAT-3’ (SEQ ID NO:26);(x) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGAC TTATAATTCCC-3’ (SEQ ID NO:27);(xi) 5’-TTAGATGTTGATCCAAGTGGCTGCTGAGCGAAAAGGGGTCTTTTCTTCAGT AGCTACGTCCT-3’ (SEQ ID NO:28);(x) 5’-TTAAGGCATCGATTGATCTCGTTGTCTAGCCCCAGGATTCCGTATTTGAGTA CTCTGTAGAA-3’ (SEQ ID NO:29);(xi) 5’-CCACAATGCCTCTCGCCGAATGCGGTGCGACAGTAAACTACTGGTCATCG GGATCTCGGAGT-3’ (SEQ ID NO:30);(xii) 5’-GTGCGTAGGTAACACAGGAATACGTAACTCTCAATCCTA-3’ (SEQ ID NO:31);(xiii) 5’-GCGGCGATTTCGCAAAACCTCAGGACGTCACGTGAGGGAAATTACCGCT2025283633   19 Dec 2025TCTGTTGAGTATG-3’ (SEQ ID NO:32);(xiv) 5’-AGGCCTCTCATACCGAATCTGTACTAATTCTAAGACTCTGGCTCCAGA CCTCGCGTTTTA-3’ (SEQ ID NO:33);(xv) 5’-GTGTAATATCTCAAAAGCCTAGCTATCATACGGAAAAGGCTGCATCCTAATG CCGGCCGCCC-3’ (SEQ ID NO:34);(xvi) 5’-CCGAGTGGGGACAAGGCATGAGGAATCTTAGTTGCGGCGG-3’ (SEQ ID NO:35);(xvii) 5’-TGGTGGCGGTATTCGTGCGATGTCGGAGTGTGTTGGGAAATCCAGGGGT CGCTCGCAAGGTA-3’ (SEQ ID NO:36);(xviii) 5’-GAGAGGGTTAGTCTACTGTATACGCCTTTAACATGGATCTATCCTACCACC TTTTCGACTTT-3’ (SEQ ID NO:37);(xix) 5’-GACTAGGCTCAGGATTGTAATTGTGTCTTCACCCACGCGGGCCGTCCGCT GGTCCGCTCGGG-3’ (SEQ ID NO:38); and(xx) 5’-CAAAGTGCTAGCAGTCGACGCGGTGGAACAGTAGCTTGGAAGTAAACTGAA TCCGGCGGTCT-3’ (SEQ ID NO:39), or a sequence at least 90% identical thereto.

82. The aptamer of claim 80, comprising or consisting of a sequence selected from the group consisting of:(i) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22);(ii) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGACT TATAATTCCC-3’ (SEQ ID NO:27);(iii) 5’-ACCTCGAATGGTATTCG-3’ (SEQ ID NO:40);(iv) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACCGAATGG TATTCG-3’ (SEQ ID NO:41);(v) 5’-TGCAATGATGTAAAACGTGATCATG-3’ (SEQ ID NO:42);(vi) 5’-CAATGATGTGAAACGTGATCATGGAATCATACACCGAATGGTATTCG-3’ (SEQ ID NO:43);(vii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44);(viii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGACCGAATGGTATTCG-3’ (SEQ ID NO:45);(ix) 5’-ATGTTGCAATGCTGTGAAACGTGAGCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:46);(x) 5’-ATGTTGCAAGGATGTGAAACGTGATCCTGGACACCGAATGGTATTCG-3’ (SEQ ID NO:47);2025283633   19 Dec 2025(xi)   5’-ATGTTGCAGGGATGTGAAACGTGATCCCGGACACCGAATGGTATTCG-3’(SEQ ID NO:48);(xii) 5’-ATGTTGCAATGAAGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:49);(xiii) 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50);(xiv) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGATGGTATCCG-3’ (SEQ ID NO:51);(xv)    5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCAAATGGTATTTG-3’(SEQ ID NO:52);(xvi)    5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACAAAATGGTATTTT-3’(SEQ ID NO:53); and(xvii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGGTGGTACCCG-3’ (SEQ ID NO:54), or a sequence at least 90% identical thereto.

83. The aptamer of claim 80, comprising or consisting of a sequence selected from:(i) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGAATCATACACTTAAAACCTCGA ATGGTATTCG-3’ (SEQ ID NO:22);(ii) 5’-AAATAAAGCATGCGCCCTCATTTTTGGCTCCATGCAACGGAACACCGTGAC TTATAATTCCC-3’ (SEQ ID NO:27);(iii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44);(iv) 5’-ATGTTGCAAGGATGTGAAACGTGATCCTGGACACCGAATGGTATTCG-3’ (SEQ ID NO:47);(v)    5’-ATGTTGCAGGGATGTGAAACGTGATCCCGGACACCGAATGGTATTCG-3’(SEQ ID NO:48);(vi)    5’-ATGTTGCAATGAAGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’(SEQ ID NO:49);(vii) 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50);(viii) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGATGGTATCCG-3’ (SEQ ID NO:51);(vix) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCAAATGGTATTTG-3’ (SEQ ID NO:52);(x) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACAAAATGGTATTTT-3’ (SEQ ID NO:53); and2025283633   19 Dec 2025(xi) 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGGGTGGTACCCG-3’ (SEQ ID NO:54), or a sequence at least 90% identical thereto.

84. The  aptamer  of  claim  80,  comprising  or  consisting of the sequence 5’-ATGTTGCAATGATGTGAAACGTGATCATGGACACCGAATGGTATTCG-3’ (SEQ ID NO:44).

85. The  aptamer  of  claim  80,  comprising  or  consisting of the sequence 5’-ATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCG-3’ (SEQ ID NO:50).

86. The  aptamer of claim  80,  comprising  or consisting of the sequence 5’-Y-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT-Y-3’ (SEQ ID NO:58), wherein Y is FAM.

87. The aptamer of any one of claims 80 to 86, wherein the aptamer comprises one or more modifications that improve aptamer stability in vitro.

88. The aptamer of any one of claims 80 to 87, wherein the aptamer binds to human CK18.

89. The aptamer of any one of claims 80 to 88, wherein the aptamer binds to a cancer cellexpressing CK18 but does not substantially bind to a cell that does not express CK18.

90. The aptamer of one of claims 80 to 89, wherein the aptamer binds to CK18 with a KD of about 200 nM.

91. The aptamer of one of claims 80 to 90, wherein the aptamer binds to a carcinoma or adenocarcinoma cell.

92. The aptamer of claim 91, wherein the carcinoma or adenocarcinoma is selected from one or more of hepatocellular carcinoma, colorectal adenocarcinoma, adenocarcinoma of stomach, ductal adenocarcinoma of pancreas, adenocarcinoma of lung, invasive ductal carcinoma of breast, adenocarcinoma of endometrium, adenocarcinoma of ovary, renal cell carcinoma (clear cell type), renal cell carcinoma (papillary type), renal cell carcinoma (chromophobe type), malignant mesothelioma, small cell carcinoma of lung, Merkel cell carcinoma, transitional cell carcinoma, Rhabdoid tumor, Ameloblastoma (stellate reticulum-like areas), spindle squamous cell carcinoma, Kaposiform hemangioendothelioma, basal cell carcinoma or squamous cell carcinoma (in various sites).2025283633   19 Dec 202593. The aptamer of any one of claims 80 to 92, wherein the aptamer is coupled to a detectable label.5 94. The aptamer of claim 93, wherein the detectable label is selected from an enzyme, prosthetic group, fluorescent material, luminescent material, bioluminescent material, electron dense label, label for MRI, radioactive material or label for histochemistry.

95. The aptamer of any one of claims 80 to 94, wherein the aptamer is coupled to a reagent. 1096. The aptamer of claim 95, wherein the reagent is biotin or FAM.

97. The aptamer according to claim 96, comprising or consisting of the sequence X-TTTTTATGTTGCGGGGATGTGAAACGTGATCCCCGACACCGAATGGTATTCGTTTTT-X,15 (SEQ ID NO:56), wherein X is biotin.

98. A diagnostic agent comprising a DNA aptamer according to any one of claims 1 to 59 coupled to a detectable label or reagent for use in histological examination of a biological sample.20 99. A method for identifying a cancer cell expressing CK18 in a biological sample obtained from a subject having, or suspected of having cancer, the method comprising contacting the sample with a DNA aptamer according to any one of claims 1 to 59, or a diagnostic agent according to claim 60.25