SSR molecular markers of Callicarpa nudiflora and their core primer pairs, kits and applications

Abstract

The present invention provides SSR molecular markers for Callicarpa nudiflora, core primer pairs, kits, and applications thereof, belonging to the field of molecular biology technology. The present invention develops and screens 14 pairs of SSR molecular marker primers with excellent amplification effects and high polymorphism from the transcriptome sequence of Callicarpa nudiflora. These SSR molecular marker primers can be used to evaluate the genetic diversity of Callicarpa nudiflora germplasm resources, perform cluster analysis, construct SSR fingerprints, and perform molecular-assisted breeding. These markers are of great significance for subsequent Callicarpa nudiflora germplasm resource management, breeding, genetic conservation, and genetic diversity analysis between and within populations.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a Callicarpa nudiflora SSR molecular marker, a core primer pair, a kit and applications thereof. Background Art

[0002] Callicarpa nudiflora is a plant of the genus Callicarpa in the Verbenaceae family. Its dried leaves are used as medicine, boasting anti-inflammatory, hemostatic, antibacterial, and detoxifying properties. It is listed in the 2020 edition of the Chinese Pharmacopoeia and is also included in the 2015 supplement to the Chinese Pharmacopoeia. Callicarpa nudiflora is primarily produced in Hainan, Guangdong, and Guangxi provinces, with distribution primarily in India, Vietnam, and Malaysia. Callicarpa nudiflora contains flavonoids, phenylethanoid glycosides, and terpenes. As a Class B national medical insurance product, a protected Traditional Chinese Medicine, and a basic medicine in many provinces, it enjoys significant market demand and holds promising application prospects.

[0003] Currently, the Callicarpa nudiflora cultivated by herbalists are all wild domesticated cultivars, and the current lack of high-quality varieties remains. This creates a significant contradiction between the demand for varieties in the Callicarpa nudiflora industry and the significant lag in the exploration and utilization of germplasm resources. Callicarpa nudiflora germplasm resource populations are highly variable, with significant differences in the active ingredients of Callicarpa nudiflora from different origins. Furthermore, quality traits are all quantitative, controlled by multiple genes, and susceptible to environmental influences. Therefore, establishing a simple, rapid, and reliable Callicarpa nudiflora germplasm resource identification technology system for use in breeding and variety identification is of great significance for improving breeding efficiency, accelerating the breeding process, and ensuring the healthy and rapid development of the Callicarpa nudiflora industry.

[0004] SSR molecular marker technology is widely used in germplasm molecular marker research due to its advantages such as high polymorphism, good repeatability, and simple testing. Yu Fulai et al. conducted a genome survey and SSR feature analysis on Callicarpa nudiflora, suggesting that Callicarpa nudiflora has a highly heterozygous and highly repetitive complex genome. The study found that single, double, and trinucleotide repeat motifs accounted for a high proportion. Peng Yunlu et al. sequenced the transcriptomes of six Callicarpa nudiflora samples from different regions and developed some SSR markers. However, the diversity of the markers was poor. Among the 22 pairs of marker primers, only one pair had three observed alleles, while the rest had 1 to 2. The Shannon index and expected heterozygosity were both low, which could not meet the requirements for subsequent research such as Callicarpa nudiflora germplasm identification and fingerprint construction.

[0005] Based on this, the present invention developed and screened SSR molecular markers and their core primer pairs with clear bands, high polymorphism and good stability based on the collection of 103 natural populations from the main production areas of Callicarpa nudiflora, such as Hainan, Guangdong and Guangxi, and applied them to the fields of genetic diversity evaluation, cluster analysis, construction of SSR fingerprint maps, and molecular-assisted breeding of Callicarpa nudiflora germplasm resources. Summary of the Invention

[0006] (1) Technical problems solved

[0007] In response to the shortcomings of the existing technology, the present invention provides SSR molecular markers for Callicarpa nudiflora and their core primer pairs, kits and applications, which solve the problems of unclear bands, low polymorphism, poor stability of core primer pairs developed by the existing technology, and poor analytical effects when applying core primer pairs to the field of germplasm resource identification.

[0008] (2) Technical solution

[0009] A Callicarpa nudiflora SSR molecular marker, comprising 14 SSR molecular markers, specifically including:

[0010]

[0011]

[0012]

[0013] Among them, n≥5.

[0014] A core primer pair for SSR molecular markers of Callicarpa nudiflora, comprising a primer pair amplified using the above-mentioned SSR molecular markers:

[0015] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH147 is:

[0016] F:CCGAGGCAAAGTTCCAACCA;

[0017] R:CCACTGATAAACCAACGAGCC;

[0018] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH138 is:

[0019] F:GGCTGTGGTCCAAGAAAGGT;

[0020] R:AGAAGTTACAGAGCCAAACCA;

[0021] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH182 is:

[0022] F:ATCTCTGTCTCACAAGCGCC;

[0023] R:CACCGGAACCCTGCATGTAA;

[0024] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH107 is:

[0025] F:ACGCCTTCCATTATGCACGA;

[0026] R:GCCCGAGTTTGTAGTGGTGA;

[0027] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH220 is:

[0028] F:CCCAAGAAGAGCTGTCCACA;

[0029] R:CCTCAGCATGCAGAAACTGG;

[0030] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH205 is:

[0031] F:GGTATGTCTCATGTCGCCGA;

[0032] R:TTGCGTTCACGATGCTTTGG;

[0033] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH078 is:

[0034] F:AGGCACCTAGCTAGACACCA;

[0035] R:ACGCTCAGGTAGTTGGTGTG;

[0036] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH275 is:

[0037] F:GAGGCTGGTTTGGAGTGGAA;

[0038] R:TGTGTCCAAAGGCATCGTGA;

[0039] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH080 is:

[0040] F:ACATCCGGTGCATCCTTTCT;

[0041] R:TTCCTTCAAGCACCTGTCCC;

[0042] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH357 is:

[0043] F:CCCACCAGTGAAAGGCTTCT;

[0044] R:CGATGTGGGCTGTGATCGTA;

[0045] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH155 is:

[0046] F:CACAGAAACAACACGGCCAG;

[0047] R:GCGTTTCGACTGCATTCGAT;

[0048] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH305 is:

[0049] F:CAGCGCAGGATTGTTGATCA;

[0050] R:GGGTAAACAGTGGGTGGAGG;

[0051] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH304 is:

[0052] F:ACCAAGCTGCAATTCCCAAG;

[0053] R:ACCAAATCTTAGGTCCACATCCT;

[0054] The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH156 is:

[0055] F:GGCCCTGATGCTTCTTCTGT;

[0056] R:CCTTATAACGCACGCATGGC.

[0057] Preferably, the 5' end of the forward sequence of the primer is labeled with a fluorescent group, and the fluorescent group is FAM, HEX or TAMRA.

[0058] A method for preparing a core primer pair of SSR molecular markers of Callicarpa nudiflora, comprising the following steps:

[0059] S1. Extract RNA from different tissues of Callicarpa nudiflora and perform transcriptome sequencing to obtain transcriptome sequencing data;

[0060] S2. Use microsatellite identification tools to search for at least five repeat units at trinucleotide, tetranucleotide, and pentanucleotide SSR loci and design SSR typing primers;

[0061] S3. Total DNA was extracted from Callicarpa nudiflora material, and the quality of DNA was detected by 1% agarose gel electrophoresis. The concentration and purity of nucleic acid were detected by UV spectrophotometer. The absorbance was A260 / A280 = 1.8 to 2.0.

[0062] S4. Using the DNA of Callicarpa nudiflora as a template, PCR amplification was performed. After electrophoresis detection, primary screening, and secondary screening, core primer pairs with clear bands, high polymorphism, and good stability were selected.

[0063] Preferably, the PCR amplification reaction system in S4 is: the amplification system is 10 μL, including 5.0 μL of 2×Taq PCR Master Mix, 1 μL of genomic DNA (~20 ng), 0.5 μL of upstream primer (concentration 10 pmol / μL), 0.5 μL of downstream primer (concentration 10 pmol / μL), and 3.0 μL of ddH2O.

[0064] Preferably, the PCR amplification program in S4 is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, extension at 72°C for 30 s, running for 10 cycles, decreasing by 1°C each cycle; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, running for 25 cycles; extension at 72°C for 20 min, and finally storage at 4°C.

[0065] A detection kit for Callicarpa nudiflora contains the core primer pair of the above-mentioned SSR molecular marker.

[0066] Application of SSR molecular markers of Callicarpa nudica in germplasm genetic diversity, genetic distance analysis of germplasm resources, cluster analysis, construction of SSR characteristic fingerprint maps of germplasm resources, and molecular breeding.

[0067] Application of core primer pairs of SSR molecular markers of Callicarpa nudica in germplasm genetic diversity, genetic distance analysis of germplasm resources, cluster analysis, construction of SSR characteristic fingerprint map of germplasm resources, and molecular breeding.

[0068] Application of the detection kit of Callicarpa nudiflora in germplasm genetic diversity, genetic distance analysis of germplasm resources, cluster analysis, construction of SSR characteristic fingerprint map of germplasm resources, and molecular breeding.

[0069] (3) Beneficial effects

[0070] The present invention provides a Callicarpa nudiflora SSR molecular marker, its core primer pair, kit, and application. Compared with the prior art, it has the following advantages:

[0071] 1. The present invention discloses molecular markers of Callicarpa nudiflora and 14 pairs of core primer pairs with clear bands, high polymorphism and stability amplified and screened by the molecular markers, as well as a kit containing the core primer pairs. The molecular markers can be used to evaluate the genetic diversity of germplasm resources of Callicarpa nudiflora, perform cluster analysis, construct SSR fingerprint maps, and perform molecular-assisted breeding. These markers are of great significance for improving breeding efficiency, accelerating breeding progress, and ensuring the healthy and rapid development of the Callicarpa nudiflora industry.

[0072] 2. The SSR molecular markers and core primer pairs disclosed in the present invention have good amplification effect and high polymorphism in Callicarpa nudiflora, and can be used to identify Callicarpa nudiflora germplasm resources simply, accurately, efficiently and stably. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0074] Figure 1 This is a capillary electrophoresis detection diagram of the CnH220 primer amplification product in an embodiment of the present invention.

[0075] Figure 2 This is the genetic distance analysis of 103 Callicarpa nudiflora germplasm resources in the examples of the present invention.

[0076] Figure 3 This is a cluster diagram of 103 naked-flowered Callicarp materials analyzed by SSR markers in the examples of the present invention. DETAILED DESCRIPTION

[0077] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0078] In order to better understand the above technical solution, the above technical solution will be described in detail below with reference to the accompanying drawings and specific implementation methods.

[0079] Example

[0080] 1. Source of Materials

[0081] A total of 103 accessions of Callicarpa nudiflora germplasm resources were deposited in the Tropical Medicinal Plant Germplasm Resource Nursery of the Ministry of Agriculture (Danzhou), of which 93 were from Hainan, 5 from Guangdong, and 5 from Guangxi. Specific source information is shown in Table 1. Ten accessions of Callicarpa nudiflora with significant genetic differences were selected (numbered 1, 2, 8, 12, 50, 54, 61, 77, 81, and 86).

[0082] Table 1-103 parts of Callicarpa nudiflora plant materials

[0083]

[0084]

[0085] 2. Preparation and screening of core primer pairs

[0086] 2.1 SSR locus search and typing primer design:

[0087] RNA was extracted from different tissue parts of Callicarpa nudiflora, and transcriptome sequencing was performed to obtain transcriptome sequencing data. The transcriptome data were analyzed using MISA software. 233,662 Unigene sequences of the Callicarpa nudiflora transcriptome were searched. After filtering out single-base, double-base, six-base, and composite SSR molecular marker sites, primers were designed at 4,492 SSR molecular marker sites, including 3,962 trinucleotide repeat types, 439 tetranucleotide repeat types, and 91 pentanucleotide repeat types.

[0088] Primers were designed in the Unigene sequence containing SSR loci using the Primer 6.0 primer batch design program. The main parameters for primer design were:

[0089] (1) Annealing temperature is between 57 and 63°C;

[0090] (2) The PCR product size is 100 to 300 bp;

[0091] (3) Primer length is between 18 and 27 bp;

[0092] (4) GC content is between 40% and 60%.

[0093] Blast validation of SSR primers was performed in the Unigene library, and finally 384 pairs of primers suitable for typing detection were selected for marker screening experiments.

[0094] 2.2 Extraction and detection of total DNA from Callicarpa nudiflora

[0095] (1) DNA extraction method: After leaf samples were collected and frozen in liquid nitrogen, total DNA from 103 Callicarpa nudiflora leaf samples was extracted using a magnetic bead genomic DNA extraction kit equipped with an automated workstation. The specific steps are as follows:

[0096] ① Take a batch of leaf samples with a fresh weight of 20-50 mg and place them in a new grinding plate. Add steel balls to the grinding plate. Add 500 μL of lysis buffer and 5 μL of RNase A to the centrifuge tube. Use a tissue disruptor to disrupt the leaves. Place the leaves at 65°C for 30 minutes and shake them every 10 minutes to mix them.

[0097] ②After the lysis begins, shake each component and dispense it into different deep-well plates, dispensing according to the following: 500 μL / well of magnetic beads, 500 μL / well of washing solution I, 500 μL / well of washing solution II, 500 μL / well of washing solution III, and 100 μL / well of elution solution, and mark them well;

[0098] ③ After lysis, centrifuge at 4000 rpm for 10 min, transfer 300 μL of supernatant to a new deep-well plate (marked as No. 1) and add 300 μL of isopropanol to each well.

[0099] ④ Place deep-well plate No. 1 on station 1 of the nucleic acid extraction instrument, and place the deep-well plates containing magnetic beads, washing solution I, washing solution II, washing solution III, and eluent on stations 2 to 6 respectively, and run the zhiwu-nc program;

[0100] ⑤ After the program is completed, the instrument will automatically stop and station 6 will enter the 4℃ storage program to temporarily store the sample.

[0101] (2) DNA Detection Method: Take 2 μL of DNA sample and add 2 μL of 6× Loading Buffer. Check DNA quality by electrophoresis on a 1% agarose gel. The main band should be bright and clear, without dragging, and the main band size should be around 10 kb. Take 2 μL of DNA sample and measure nucleic acid concentration and purity using a NanoDROP 8000 ultramicro-spectrophotometer. The absorbance should be A260 / A280 = 1.8-2.0, and the DNA concentration should be ≥30 ng / μL.

[0102] 2.3 Core primer screening

[0103] (1) Ten mixed DNA samples of Callicarpa nudiflora germplasms with large genetic background differences, numbered 1, 2, 8, 12, 50, 54, 61, 77, 81, and 86, were selected for preliminary screening of synthesized SSR primers. The preliminary screened primers were then rescreened and verified to select core primers with clear bands, high polymorphism, and good stability.

[0104] The SSR PCR amplification reaction system consisted of a 10-μL total volume, including 5.0 μL of 2× Taq PCR Master Mix, 1 μL of genomic DNA (~20 ng), 0.5 μL of upstream primer (10 pmol / μL), 0.5 μL of downstream primer (10 pmol / μL), and 3.0 μL of ddH₂O. PCR reactions were performed on a Veriti 96 PCR instrument (Applied Biosystems).

[0105] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, extension at 72°C for 30 s, run 10 cycles, with a decrease of 1°C each cycle; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, run 25 cycles; extension at 72°C for 20 min, and finally storage at 4°C.

[0106] After the fluorescent PCR amplification is completed, 3 μL of PCR product is taken and tested on a 1% agarose gel electrophoresis to check whether the PCR conditions are single and whether the fragment size is consistent with expectations. If the band is single and the size is consistent, the concentration of the control DNA Marker is quantified and all products are diluted to the same concentration range. Take 10 μL of formamide and 0.5 μL of internal standard and mix them, add 1 μL of PCR diluted product, and perform capillary electrophoresis detection on the ABI 3730xl instrument. Export the .fsa format raw data from the ABI 3730xl instrument, classify and archive them according to the detection site, and import them into the GeneMarker analysis software to read the genotype data, and export the Excel genotype raw data and PDF typing peak map files according to the site name.

[0107] (2) The remaining 93 samples of Callicarpa nudiflora were subjected to marker analysis using core SSR primers as described in step (1).

[0108] (3) Data collation and analysis:

[0109] GenALEx 6.5 was used to convert the results of SSR molecular markers into txt format for genetic diversity analysis;

[0110] Popgene 32 (version 1.32) software was used to calculate the number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon's information index (I), and Nei's gene diversity index (H) of each SSR locus;

[0111] PIC values were calculated using PowerMarker 3.25;

[0112] NTSYS-version 2.10e software was used to calculate genetic distances and construct genetic distance matrices. Excel 2019 was used to produce three-dimensional genetic distance graphs, and MEGA 6.06 software was used to produce circular genetic cluster maps.

[0113] (4) Primer amplification: Of the 384 primer pairs selected for typing, 130 pairs were able to amplify the target bands in 10 samples of Callicarpa nudiflora, accounting for 33.85% of the total primers. Among them, 14 primer pairs shown in Table 3 amplified the target bands in 10 samples of Callicarpa nudiflora, exhibited polymorphism, and had good stability, accounting for 3.65% of the total primers. The molecular markers and left and right flanking sequences of these 14 primer pairs are shown in Table 2.

[0114] Table 2 - Molecular markers of Callicarpa nudiflora

[0115]

[0116]

[0117]

[0118] Among them, n≥5.

[0119] Table 3 - 14 pairs of core primer pairs with clear bands, high polymorphism and good stability in Callicarpa nudiflora

[0120]

[0121]

[0122] Among them, the primer CnH147 consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.29 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.30;

[0123] Primer CnH138 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.31 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.32;

[0124] Primer CnH182 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.33 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.34;

[0125] Primer CnH107 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.35 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.36;

[0126] Primer CnH220 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.37 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.38;

[0127] Primer CnH205 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.39 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.40;

[0128] Primer CnH078 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.41 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.42;

[0129] Primer CnH275 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.43 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.44;

[0130] Primer CnH080 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.45 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.46;

[0131] Primer CnH357 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.47 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.48;

[0132] Primer CnH155 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.49 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.50;

[0133] Primer CnH305 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.51 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.52;

[0134] Primer CnH304 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.53 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.54;

[0135] Primer CnH156 consists of an upstream primer having a nucleotide sequence as shown in SEQ ID NO.55 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.56.

[0136] 3. Rapid test kit

[0137] The rapid detection kit contains the above 14 pairs of core primer pairs, which can be used for new analysis of genetic diversity of naked flower callicarp, genetic distance analysis, cluster analysis, SSR characteristic fingerprint map construction, and molecular breeding.

[0138] 4. Genetic Diversity Analysis

[0139] PCR amplification was performed on 103 Callicarpa nudiflora samples using these 14 primer pairs, and genetic diversity analysis was carried out.

[0140] A total of 92 alleles (Na) were amplified by the 14 primer pairs, with an average of 6.5714 alleles amplified per primer pair, ranging from 3 to 13; the number of effective alleles (Ne) ranged from 1.0818 to 4.9472, and the proportion of effective allele variation was 39.37%; the Shannon's information index (I) ranged from 0.2113 to 1.8085, and 4 primer pairs reached above 1.5; the expected heterozygosity (He) ranged from 0.076 to 0.8018, with an average of 0.5075 (He > 0.5), indicating a relatively high genetic diversity of the tested materials. The observed heterozygosity (Ho) ranged from 0.0097 to 0.87, with an average of 0.3570. Except for the expected heterozygosity of only 1 primer pair being less than the observed heterozygosity, the expected heterozygosity of the remaining primer pairs was greater than the observed heterozygosity, indicating that there was less excess heterozygosity within the tested germplasm. The PIC value ranged from 0.0747 to 0.7684, with an average of 0.4682, showing moderate polymorphism (0.25 < PIC < 0.5). Among them, 6 primer pairs had high polymorphism (PIC > 0.5), and 6 primer pairs had moderate polymorphism (0.25 < PIC < 0.5).

[0141] As shown in Table 4, in this invention, the primers with high PIC values accounted for 42.9%, indicating that these SSR loci can explain genotype differences at the molecular level, have rich genetic differences, and can be used as effective markers to construct the DNA fingerprint map of Callicarpa nudiflora germplasm.

[0142] Table 4 - Genetic Diversity Analysis of 14 SSR Primer Pairs

[0143]

[0144] 5. Genetic Distance Analysis

[0145] The genetic distances among 103 Callicarpa nudiflora germplasms were calculated using NTSYS-pc 2.10 software, and a genetic distance matrix was constructed. A three-dimensional surface plot was made using Excel 2019, as Figure 2 shown.

[0146] The genetic distances among the 103 accessions ranged from 0 to 2.7917, with an average of 0.6342. This high genetic distance indicates rich genetic diversity among the accessions. Accessions numbered 93 (Changjiang County, Hainan) and 2 (Wuzhishan City, Hainan) had the largest genetic distances, indicating significant genetic differences and distant relationships between the two accessions. Furthermore, the average genetic distances among accessions from Guangdong, Guangxi, and Hainan were 0.6443, 0.6613, and 0.6165, respectively. The differences in average genetic distances among accessions from the three provinces were small, indicating the high accuracy and reliability of the genetic distance analysis.

[0147] 6. Cluster analysis

[0148] According to the genetic distance between germplasms, the test materials were classified by the UPGMA method using the analysis software MEGA 6.06 and a cluster diagram was obtained, as shown in Figure 2. Figure 3 shown.

[0149] The results showed that 101 accessions of Callicarpa nudica were effectively distinguished, while accessions No. 4 and No. 8 (both from Baisha, Hainan) were not distinguished. Clustering divided the 103 accessions into two major categories (Group I and Group II) at a confidence level of 0.3515. Cluster I included two accessions of Callicarpa nudiflora, numbered 11 and 12 (both from Wuzhishan, Hainan). Cluster II was divided into two subclusters (II-1 and II-2): subcluster II-1 included accessions numbered 2 (Baisha, Hainan) and 64 (Dongfang, Hainan), and subcluster II-2 included the other 99 accessions. Subcluster II-2 was further divided into three subclusters at a confidence level of 0.0937. Subcluster II-2-1 included accessions numbered 68 and 69 (both from Dongfang, Hainan), subcluster II-2-2 included accessions numbered 54 (Ledong, Hainan), 66 (Wanning, Hainan), 57 (Haikou, Hainan), and 82 (Nanning, Guangxi), and subcluster II-2-3 contained the other 93 accessions, including four accessions from Beihai, Guangxi and Qinzhou, Guangxi, five accessions from Guangdong Province, and 84 accessions from 18 cities (counties) in Hainan Province. From the cluster analysis, it can be seen that some germplasms located in the same region are not completely clustered together, while some germplasms from different regions are clustered into one category. This may be due to the fact that the germplasms in different regions have the same evolutionary source, or it may be due to the phenomenon of gene exchange between different germplasms during the long-term natural selection process.

[0150] 7. Construction of SSR feature fingerprint

[0151] Based on the amplification results, the presence of a band and the absence of a band were recorded as "1" and "0," respectively. After performing diversity analysis on the 14 primer pairs, the primers with high polymorphism were selected to distinguish all germplasms. If all germplasms could not be identified, an additional primer was added until all germplasms were distinguished.

[0152] As can be seen from Table 4, primers CnH80, CnH107, CnH156, CnH182, CnH220, and CnH304 had high polymorphism information content (PIC>0.5). Using these six primer pairs, a total of 99 accessions were distinguished, while four accessions were not distinguished. Therefore, considering factors such as the PIC value and the number of alleles, primer CnH78 was added for identification, and a total of 101 accessions were distinguished. When all 14 primer pairs were converted into fingerprints, as shown in Table 5, two accessions (numbers 4 and 8) could not be completely distinguished. This is consistent with the results of cluster analysis, indicating that the two materials may be the same accession. It may also be related to the large number of test accessions and the reduced discriminatory power of the primers. This study used 14 pairs of primers for the first time to construct DNA fingerprint map codes for 101 germplasm resources of naked beetle, so that each germplasm has its own unique set of DNA fingerprints. This can help solve the germplasm confusion such as homonymous and heteronymous species of naked beetle or homonymous and heteronymous species of naked beetle at the molecular level, and also make the identification of naked beetle germplasm more accurate and efficient.

[0153] Table 5-103 fingerprints of Callicarpa nudiflora germplasm resources

[0154]

[0155]

[0156]

[0157]

[0158]

[0159] In summary, compared with the existing technology, the present invention has the following beneficial effects:

[0160] 1. The present invention discloses molecular markers of Callicarpa nudiflora and 14 pairs of core primer pairs with clear bands, high polymorphism and stability amplified and screened by the molecular markers, as well as a kit containing the core primer pairs. The molecular markers can be used to evaluate the genetic diversity of Callicarpa nudiflora germplasm resources, perform cluster analysis, construct SSR fingerprint maps, and perform molecular-assisted breeding. These markers are of great significance for improving breeding efficiency, accelerating breeding progress, and ensuring the healthy and rapid development of the Callicarpa nudiflora industry.

[0161] 2. The SSR molecular markers and core primer pairs disclosed in the present invention have good amplification effect and high polymorphism in Callicarpa nudiflora, and can be used to identify Callicarpa nudiflora germplasm resources simply, accurately, efficiently and stably.

[0162] It should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply the existence of any such actual relationship or order between these entities or operations. Moreover, the terms "comprises," "comprising," or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article, or device comprising a series of elements includes not only those elements, but also other elements not explicitly listed, or elements inherent to such process, method, article, or device. In the absence of further limitations, an element defined by the phrase "comprising a ..." does not exclude the presence of other identical elements in the process, method, article, or device comprising the element.

[0163] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention. SEQUENCE LISTING <110> Institute of Tropical Crops Germplasm Resources, Chinese Academy of Tropical Agricultural Sciences <120> SSR molecular markers of Callicarpa nudiflora and its core primer pairs, kits and applications <130> 20220518 <160> 56 <170> PatentIn version 3.3 <210> 1 <211> 48 <212> DNA <213> Artificial sequence <400> 1 ccgaggcaaa gttccaacca atattatgcc cgctgaaaat tttgcctg 48 <210> 2 <211> 76 <212> DNA <213> Artificial sequence <400> 2 aagagatatg gaagattata tgttcaaata cctttaggtt tgaaccaatt tgtttggctc 60 gttggtttat cagtgg 76 <210> 3 <211> 133 <212> DNA <213> Artificial sequence <400> 3 ggctgtggtc caagaaaggt aaattcccta gttccacagc tacacattat tctaatgcta 60 ttaatgtaag tttaccatga aaatcattta agttcaggct atacaagata ctaatgtagg 120 gtatgagcag ttc 133 <210> 4 <211> 27 <212> DNA <213> Artificial sequence <400> 4 tttttttggt ttggctctgt aacttct 27 <210> 5 <211> 58 <212> DNA <213> Artificial sequence <400> 5 atctctgtct cacaagcgcc tcttacttca actggtacta cctctctatt ctatcaaa 58 <210> 6 <211> 147 <212> DNA <213> Artificial sequence <400> 6 ttgctaatcc tatctgcttg gttttcttat cttgtcactg gataactctg tgcatgcatc 60 attgggttta tctaagcttc aacttgactg gattggaggt tttcaaatta acagattttg 120 cacttaatta catgcagggt tccggtg 147 <210> 7 <211> 75 <212> DNA <213> Artificial sequence <400> 7 acgccttcca ttatgcacga tccagtcatt gaaatgacca aaacaccctt acaaataaaa 60 aaaaatgacc atgct 75 <210> 8 <211> 34 <212> DNA <213> Artificial sequence <400> 8 tggtccatgt ttactcacca ctacaaactc gggc 34 <210> 9 <211> 96 <212> DNA <213> Artificial sequence <400> 9 cccaagaaga gctgtccaca tatacagaca catgtattca taaatgccat tcaacggctt 60 caagatttag ccatttttct tcgttcttat gctagg 96 <210> 10 <211> 38 <212> DNA <213> Artificial sequence <400> 10 tgctgtatct gctgtcatcc agtttctgca tgctgagg 38 <210> 11 <211> 73 <212> DNA <213> Artificial sequence <400> 11 ggtatgtctc atgtcgccga tacatgaatg ctagtgggtg tttctacttc ctgaatcaat 60 gattcaatgt tac 73 <210> 12 <211> 125 <212> DNA <213> Artificial sequence <400> 12 tgtactaagt atgatgtttc ttttagggtg cgggacatta tttctgttcg agctggtctt 60 agaaaggtgc cctggggatgg atatttgaag tactctcgcc ccagcccaaa gcatcgtgaa 120 cgcaa 125 <210> 13 <211> 47 <212> DNA <213> Artificial sequence <400> 13 aggcacctag ctagacacca ccatgccctc caccaaagcc gccttct 47 <210> 14 <211> 103 <212> DNA <213> Artificial sequence <400> 14 tcgccgcctt gctcctcctc cacgtcccaa ccatccatgc cgatttcaaa gagaagggca 60 agatcgtcat tctaaccaac aaccacacca actacctgag cgt 103 <210> 15 <211> 98 <212> DNA <213> Artificial sequence <400> 15 gaggctggtt tggagtggaa tgggctattt cctttgcaag aaaggagatg aaaggcttga 60 aaatggagtt atgactgtga gtagtaatac tattagtg 98 <210> 16 <211> 101 <212> DNA <213> Artificial Sequence <400> 16 atggattgcg gccggatgct aaaaccgtga tggcggttca agggctgagt gcagccatgg 60 ccggaggggt ttcagctttg atcacgatgc ctttggacac a 101 <210> 17 <211> 61 <212> DNA <213> Artificial Sequence <400> 17 acatccggtg catcctttct ttagtgagtg gcctacgact aaggaatcat ggtccactct 60 g 61 <210> 18 <211> 192 <212> DNA <213> Artificial Sequence <400> 18 ggttggtcct acaaaaatct cttctcctcc acctagctat ccatctcaat tctgagggca 60 tcgtctaatt tttctttgag tggttactct ccaaacggta agtcaaaaga gttctaatcg 120 accaaataac taaagtttag cgtgttaatt gatacttttg aattcatttt gagggacagg 180 tgcttgaagg aa 192 <210> 19 <211> 31 <212> DNA <213> Artificial sequence <400> 19 cccaccagtg aaaggcttct ctgtattgtc a 31 <210> 20 <211> 144 <212> DNA <213> Artificial sequence <400> 20 attagtatta ctaccaaaca aaaacgagtg tctttgcaat aatgaaagtt caaaatgtcc 60 catcaaactc agactcagat ctccaaaagc aaaatcccat tttcaaaatt ttggatttca 120 catctacgat cacagcccac atcg 144 <210> twenty one <211> 166 <212> DNA <213> Artificial sequence <400> twenty one cacagaaaca acacggccag cttcggcaaa gatttcagac aactgagcag acgtcattga 60 aaatggcaag ttgccgacgt acagcctccc agcttccgca gattgtgaca cgtcattttc 120 ctcctccgca gcttcggaaa cagttccttg aataccgttt aatggg 166 <210> twenty two <211> 37 <212> DNA <213> Artificial sequence <400> twenty two tgattcaact caacgctatc gaatgcagtc gaaacgc 37 <210> twenty three <211> 36 <212> DNA <213> Artificial Sequence <400> 23 cagcgcagga ttgttgatca tggattaccc ccatgg 36 <210> 24 <211> 186 <212> DNA <213> Artificial Sequence <400> 24 ccctcaccct ggtcggagag aagaagacga atacccaccg ccggcacgac cacccccgcc 60 ccccttctac ggcgggaatg agccgccgcc accgtttcct cctccgccgc cgcaagtcta 120 tcatacctcc catataggcc ccggaccaga ctcataccct ccgccgcctc cacccactgt 180 ttaccc 186 <210> 25 <211> 148 <212> DNA <213> Artificial Sequence <400> 25 accaagctgc aattcccaag aaactgttac agaaacaaaa taatcacatc aatatttttg 60 aacttatatt tgaagattta gagcaaataa ttcagcaatt atttctttta tagatgtaca 120 ttgtatttca ttagtaatcc cgttccat 148 <210> 26 <211> 74 <212> DNA <213> Artificial Sequence <400> 26 cgtaagtact attgtaataa ttgtacagta atatagctat tcaatgatgt aaggatgtgg 60 acctaagatt tggt 74 <210> 27 <211> 144 <212> DNA <213> Artificial sequence <400> 27 ggccctgatg cttcttctgt cgcaaacagt gtatcactat gaagacaata acagctagga 60 aaatctcaat catctgaatt tcagaaaaga atgagaagaa attgaaacca ccgaaccgag 120 tactagaaga agaattatta caaa 144 <210> 28 <211> 97 <212> DNA <213> Artificial sequence <400> 28 aattcatgat tctggaatga agaagatggt gattaggaat ggaggagtag ttcaagaaat 60 ggtaattctg tgctgtagcc atgcgtgcgt tataagg 97 <210> 29 <211> 20 <212> DNA <213> Artificial sequence <400> 29 ccgaggcaaa gttccaacca 20 <210> 30 <211> 21 <212> DNA <213> Artificial sequence <400> 30 ccactgataa accaacgagc c 21 <210> 31 <211> 20 <212> DNA <213> Artificial sequence <400> 31 ggctgtggtc caagaaaggt 20 <210> 32 <211> twenty one <212> DNA <213> Artificial sequence <400> 32 agaagttaca gagccaaacc a 21 <210> 33 <211> 20 <212> DNA <213> Artificial sequence <400> 33 atctctgtct cacaagcgcc 20 <210> 34 <211> 20 <212> DNA <213> Artificial sequence <400> 34 caccggaacc ctgcatgtaa 20 <210> 35 <211> 20 <212> DNA <213> Artificial sequence <400> 35 acgccttcca ttatgcacga 20 <210> 36 <211> 20 <212> DNA <213> Artificial sequence <400> 36 gcccgagttt gtagtggtga 20 <210> 37 <211> 20 <212> DNA <213> Artificial sequence <400> 37 cccaagaaga gctgtccaca 20 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <400> 38 cctcagcatg cagaaactgg 20 <210> 39 <211> 20 <212> DNA <213> Artificial sequence <400> 39 ggtatgtctc atgtcgccga 20 <210> 40 <211> 20 <212> DNA <213> Artificial sequence <400> 40 ttgcgttcac gatgctttgg 20 <210> 41 <211> 20 <212> DNA <213> Artificial sequence <400> 41 aggcacctag ctagacacca 20 <210> 42 <211> 20 <212> DNA <213> Artificial sequence <400> 42 acgctcaggt agttggtgtg 20 <210> 43 <211> 20 <212> DNA <213> Artificial sequence <400> 43 gaggctggtt tggagtggaa 20 <210> 44 <211> 20 <212> DNA <213> Artificial sequence <400> 44 tgtgtccaaa ggcatcgtga 20 <210> 45 <211> 20 <212> DNA <213> Artificial sequence <400> 45 acatccggtg catcctttct 20 <210> 46 <211> 20 <212> DNA <213> Artificial sequence <400> 46 ttccttcaag cacctgtccc 20 <210> 47 <211> 20 <212> DNA <213> Artificial sequence <400> 47 cccaccagtg aaaggcttct 20 <210> 48 <211> 20 <212> DNA <213> Artificial sequence <400> 48 cgatgtgggc tgtgatcgta 20 <210> 49 <211> 20 <212> DNA <213> Artificial sequence <400> 49 cacagaaaca acacggccag 20 <210> 50 <211> 20 <212> DNA <213> Artificial sequence <400> 50 gcgtttcgac tgcattcgat 20 <210> 51 <211> 20 <212> DNA <213> Artificial sequence <400> 51 cagcgcagga ttgttgatca 20 <210> 52 <211> 20 <212> DNA <213> Artificial sequence <400> 52 gggtaaacag tgggtggagg 20 <210> 53 <211> 20 <212> DNA <213> Artificial sequence <400> 53 accaagctgc aattcccaag 20 <210> 54 <211> twenty three <212> DNA <213> Artificial sequence <400> 54 accaaatctt aggtccacat cct 23 <210> 55 <211> 20 <212> DNA <213> Artificial sequence <400> 55 ggccctgatg cttcttctgt 20 <210> 56 <211> 20 <212> DNA <213> Artificial sequence <400> 56 ccttataacg cacgcatggc 20

Claims

1. A SSR molecular marker for Callicarpa nudiflora, characterized in that: Includes 14 SSR molecular markers, including: Among them, n≥5.

2. A core primer pair for SSR molecular markers of Callicarpa nudiflora, characterized in that: The core primer pair is the amplification primer pair for 1-14 SSR molecular markers according to claim 1: The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH147 is: F:CCGAGGCAAAGTTCCAACCA; R:CCACTGATAAACCAACGAGCC; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH138 is: F:GGCTGTGGTCCAAGAAAGGT; R:AGAAGTTACAGAGCCAAACCA; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH182 is: F:ATCTCTGTCTCACAAGCGCC; R:CACCGGAACCCTGCATGTAA; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH107 is: F:ACGCCTTCCATTATGCACGA; R:GCCCGAGTTTGTAGTGGTGA; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH220 is: F:CCCAAGAAGAGCTGTCCACA; R:CCTCAGCATGCAGAAACTGG; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH205 is: F:GGTATGTCTCATGTCGCCGA; R:TTGCGTTCACGATGCTTTGG; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH078 is: F:AGGCACCTAGCTAGACACCA; R:ACGCTCAGGTAGTTGGTGTG; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH275 is: F:GAGGCTGGTTTGGAGTGGAA; R:TGTGTCCAAAGGCATCGTGA; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH080 is: F:ACATCCGGTGCATCCTTTCT; R:TTCCTTCAAGCACCTGTCCC; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH357 is: F:CCCACCAGTGAAAGGCTTCT; R:CGATGTGGGCTGTGATCGTA; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH155 is: F:CACAGAAACAACACGGCCAG; R:GCGTTTCGACTGCATTCGAT; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH305 is: F:CAGCGCAGGATTGTTGATCA; R:GGGTAAACAGTGGGTGGAGG; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH304 is: F:ACCAAGCTGCAATTCCCAAG; R:ACCAAATCTTAGGTCCACATCCT; The primer sequence (5'-3') for amplifying the SSR molecular marker LHZZCnH156 is: F:GGCCCTGATGCTTCTTCTGT; R:CCTTATAACGCACGCATGGC.

3. The core primer pair for the SSR molecular marker of Callicarpa nudiflora according to claim 2, characterized in that: The 5' end of the forward sequence of the primer is labeled with a fluorescent group, and the fluorescent group is FAM, HEX or TAMRA.

4. A method for preparing the core primer pair of SSR molecular markers of Callicarpa nudiflora according to any one of claims 2 or 3, characterized in that: The following steps are involved: S1. Extract RNA from different tissues of Callicarpa nudiflora and perform transcriptome sequencing to obtain transcriptome sequencing data; S2. Use microsatellite identification tools to search for at least five repeat units at trinucleotide, tetranucleotide, and pentanucleotide SSR loci and design SSR typing primers; S3. Total DNA was extracted from Callicarpa nudiflora material, and the quality of DNA was detected by 1% agarose gel electrophoresis. The concentration and purity of nucleic acid were detected by UV spectrophotometer. The absorbance was A260 / A280 = 1.8 to 2.

0. S4. Using the DNA of Callicarpa nudiflora as a template, PCR amplification was performed. After electrophoresis detection, primary screening, and secondary screening, core primer pairs with clear bands, high polymorphism, and good stability were selected.

5. The method for preparing the core primer pair of SSR molecular markers of Callicarpa nudiflora according to claim 4, characterized in that: The PCR amplification reaction system in S4 is as follows: the amplification system is 10 μL, including 5.0 μL of 2×Taq PCR Master Mix, 1 μL of genomic DNA (~20 ng), 0.5 μL of upstream primer (concentration 10 pmol / μL), 0.5 μL of downstream primer (concentration 10 pmol / μL), and 3.0 μL of ddH2O.

6. The method for preparing the core primer pair of SSR molecular markers of Callicarpa nudiflora according to claim 4, characterized in that: The PCR amplification program in the S4 was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, extension at 72°C for 30 s, running for 10 cycles, with a decrease of 1°C each cycle; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, running for 25 cycles; extension at 72°C for 20 min, and finally storage at 4°C.

7. A detection kit for Callicarpa nudiflora, characterized in that: A core primer pair containing the SSR molecular marker according to any one of claims 2 or 3.

8. Application of the SSR molecular marker of Callicarpa nudiflora according to claim 1 in germplasm genetic diversity, genetic distance analysis of germplasm resources, cluster analysis, construction of SSR characteristic fingerprint map of germplasm resources, and molecular breeding.

9. Application of the core primer pair of SSR molecular markers of Callicarpa nudiflora according to any one of claims 2 to 3 in germplasm genetic diversity, genetic distance analysis of germplasm resources, cluster analysis, construction of SSR characteristic fingerprint maps of germplasm resources, and molecular breeding.

10. Use of the detection kit for Callicarpa nudiflora according to claim 7 in germplasm genetic diversity, genetic distance analysis of germplasm resources, cluster analysis, construction of SSR characteristic fingerprint maps of germplasm resources, and molecular breeding.

Images