Anti-human hvem (tnfrsf14) antibodies and uses thereof
By providing an antibody that can bind to HVEM and prevent BTLA binding, the problem of tumor cells evading immune surveillance is solved, the anti-tumor immune response is enhanced, and the therapeutic effect on tumors is improved.
Patent Information
- Application Number
- CN202080096588.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-12-24
- Filing Date
- 2020-12-24
- Publication Date
- 2026-06-12
- Estimated Expiration
- 2040-12-24
AI Technical Summary
Tumor cells evade immune surveillance by overexpressing HVEM, and current technologies are insufficient to effectively enhance anti-tumor immune responses.
An antibody is provided that can bind to HVEM, prevent BTLA from binding to HVEM, and may displace BTLA, thereby enhancing T cell activation signaling.
By blocking the inhibitory signal transduction of BTLA and HVEM, the anti-tumor T cell response is enhanced, thereby improving the immune response against tumors.
Smart Images

Figure BDA0003796343450000371 
Figure BDA0003796343450000381 
Figure BDA0003796343450000401
Abstract
Description
Technical Field
[0001] This invention relates to the field of antibodies and the uses of such antibodies. In particular, this invention provides antibodies that bind to HVEM. This invention also provides kits and compositions comprising anti-HVEM antibodies, and therapeutic methods using antibodies as described herein. Background Technology
[0002] T cell activation requires the concomitant activation of at least two signals: T cell receptor binding and additional signals delivered by co-stimulatory molecules. Some co-stimulatory molecules belong to the B7 / CD28 and TNF / TNFR families and play crucial roles in regulating immune responses and enhancing anti-tumor immunity. Tumors can evade immune surveillance by creating an immunosuppressive microenvironment in which anti-tumor T cell responses are attenuated due to the lack of co-stimulatory molecules and / or overexpression of co-inhibitory molecules such as PD-L1 / L2 on the surface of cancer cells. Targeting co-stimulatory and co-inhibitory pathways represents an attractive therapeutic strategy for enhancing anti-tumor immunity in several human cancers. Clinical trials targeting the co-inhibitory Ig molecules CTLA-4 and PD-1 have yielded promising results in patients with melanoma, renal cell carcinoma, prostate cancer, and non-Hodgkin's lymphoma, leading to... and Drug approval.
[0003] There is interest in evaluating the potential role of other co-stimulatory and co-inhibitory receptor / ligand interactions. One such molecule is the herpesvirus entry mediator (HVEM / CD270 / TNFRSF14) and its ligands. The interaction between HVEM and its ligands is more complex than, for example, PD-1 / PD-L1, due to evidence of bidirectional signaling. HVEM acts as a molecular switch between stimulatory and inhibitory signaling when interacting with its ligands, including BTLA (B- and T-lymphocyte attenuating factor), CD160, LIGHT (lymphotoxin-like receptor, exhibiting inducible expression and competing with herpes simplex virus glycoprotein D for HVEM, a receptor expressed by T lymphocytes), and TNFβ / LTα (tumor necrosis factor β / lymphotoxin α). HVEM and its ligands play a role in the pathophysiology of immune regulation. In this invention, it is shown that dysregulation of this network leads to various diseases.
[0004] HVEM was initially found to be a co-receptor for herpes simplex virus type 1 glycoprotein D, allowing the virus to enter cells. HVEM was found to be widely expressed in tissues, with the highest expression levels in the lungs, kidneys, and liver. HVEM was also found to be expressed on T cells, B cells, NK cells, and bone marrow cells. Notably, HVEM expression was upregulated in several cancers. HVEM is known to interact with BTLA, CD160, LIGHT, and TNFβ. Most ligands, as well as HVEM itself, can be expressed on either side of the immune synapse: CD160 was found to be expressed on NK cells, NKT cells, and T cells; BTLA was highly expressed on activated T cells and resting B cells, and less so on immature T cells, NK cells, dendritic cells (DCs), and macrophages. LIGHT was found to be expressed by immature DCs, granulocytes, monocytes, and activated T cells, and TNFβ was expressed on B cells, T cells, and NK cells.
[0005] Unbound by theory, it is believed that BTLA and CD160 provide co-inhibitory signals to T lymphocytes via HVEM binding on T lymphocytes, while HVEM delivers co-stimulatory signals via LIGHT and TNFβ binding on T lymphocytes. These interactions are bidirectional: HVEM induces inhibitory signals in T cells after interacting with BTLA and CD160 on T cells, while both BTLA and CD160 act as activating ligands of HVEM, leading to NFκB activation. Furthermore, LIGHT delivers co-stimulatory signals to T cells upon interaction with HVEM expressed on T cells, and HVEM is also thought to transmit co-stimulatory signals to T cells upon interaction with LIGHT expressed on T cells. However, LIGHT does not contain a clearly defined signal transduction motif, and its mechanism of signal transduction is not fully understood.
[0006] When LIGHT and / or TNFβ, BTLA and / or CD160 interact simultaneously with HVEM, the net effect is an inhibitory signal against T cell activation. Many tumors (e.g., melanoma, esophageal squamous cell carcinoma, hepatocellular carcinoma, and colorectal cancer) overexpress HVEM. Therefore, therapeutically blocking the inhibitory interaction between HVEM on cancer cells and BTLA / CD160 on T cells, while maintaining the integrity of LIGHT-mediated signaling in HVEM-expressing T cells, can enhance anti-tumor T cell responses. Antibodies that can interfere with the binding of BTLA to HVEM have been described (WO2014184360A1). In one embodiment, the present invention provides an antibody that can block the binding of BTLA to HVEM and displace BTLA bound to HVEM. These and other antibodies are the subject of this disclosure. Summary of the Invention
[0007] In one aspect, this disclosure provides an antibody that, when bound to the extracellular portion of a herpesvirus entry vector (HVEM), binds to the extracellular portion of HVEM on HVEM-expressing cells and prevents B- and T-lymphocyte attenuating factors (BTLA) from binding to HVEM. In another aspect, the antibody can displace BTLA bound to the extracellular portion of the HVEM.
[0008] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:26-28 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions, and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:29-31 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions.
[0009] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain region having an amino acid sequence of SEQ ID NO:24 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:25 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added.
[0010] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:42-44 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions, and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:45-47 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions.
[0011] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain region having an amino acid sequence of SEQ ID NO:40 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:41 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added.
[0012] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:18-20 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions, and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:21-23 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions.
[0013] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain region having an amino acid sequence of SEQ ID NO:16 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:17 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added.
[0014] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:34-36 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions, and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:37-39 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions.
[0015] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain region having an amino acid sequence of SEQ ID NO:32 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:33 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added.
[0016] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:50-52 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions, and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:53-55 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions.
[0017] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain region having an amino acid sequence of SEQ ID NO:48 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:49 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added.
[0018] In one aspect, this disclosure provides one or more nucleic acid molecules encoding antibodies or antigen-binding fragments as disclosed herein. A nucleic acid encoding a variable region as disclosed herein is also provided.
[0019] In one aspect, this disclosure provides a vector comprising a nucleic acid molecule as described herein. In another aspect, this disclosure provides a cell comprising an antibody, one or more nucleic acid molecules, and / or a vector as disclosed herein. Preferably, the host cell is a mammalian, insect, plant, bacterial, or yeast cell. More preferably, the cell is a human cell. Preferably, the host cell is a hybridoma cell, a Chinese hamster ovary (CHO) cell, an NSO cell, or a PER-C6 cell. TM cell.
[0020] In one aspect, this disclosure provides a method for producing antibodies as disclosed herein. The method includes harvesting the antibodies. Preferably, the antibodies are produced using cells and harvested from the cells. Preferably, the cells are hybridoma cells, Chinese hamster ovary (CHO) cells, NSO cells, or PER-C6 cells. TM Cells. Preferably, the antibody is synthetically produced.
[0021] In one aspect, this disclosure provides a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof as disclosed, nucleic acids, and / or cells. Preferably, the composition or antibody or antigen-binding fragment thereof disclosed herein is used to manufacture a medicament. Preferably, the medicament is used to treat and / or prevent cancer and immune-related conditions.
[0022] In one aspect, this disclosure provides a method for treating cancer and immune-related conditions in a subject, the method comprising administering to a subject in need a therapeutically effective amount of an antibody or antigen-binding fragment thereof, nucleic acid molecule or vector, as disclosed herein.
[0023] In one aspect, this disclosure provides an antibody or an antigen-binding fragment thereof for treating cancer and immune-related conditions.
[0024] In one aspect, this disclosure provides a method for modulating HVEM signaling activity, the method comprising contacting HVEM-expressing cells with an antibody or antigen-binding fragment thereof, a nucleic acid molecule, or a vector as disclosed herein.
[0025] In one aspect, this disclosure provides a method for enhancing the immune response of a subject, the method comprising administering to a subject in need a therapeutically effective amount of a composition comprising an antibody or an antigen-binding fragment thereof as disclosed herein, a nucleic acid molecule or a carrier.
[0026] In one aspect, this disclosure provides a method for reducing tumor growth in a subject, the method comprising administering a therapeutically effective amount of a composition to a subject in need, the composition comprising an antibody or an antigen-binding fragment thereof as disclosed herein, a nucleic acid molecule or a carrier. Detailed Implementation
[0027] This disclosure describes antibodies that bind to the extracellular portion of human HVEM and soluble HVEM on HVEM-expressing cells. When the antibody described herein binds to the extracellular portion of said human HVEM, said antibody can be used to prevent BTLA and CD160 from binding to HVEM. Several antibodies that bind to HVEM have been developed. Antibodies that specifically bind to HVEM are known in the art. For example, the antibody eBio HVEM-122 (eBiosciences) is commercially available and mentioned in Example 2. An antibody that can interfere with the binding of BTLA to HVEM has been described (WO2014184360A1). This invention provides an antibody that blocks the binding of BTLA to HVEM and displaces BTLA that has previously bound to HVEM.
[0028] In one aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells; when the antibody binds to the extracellular portion of HVEM, it prevents BTLA from binding to HVEM; and it replaces BTLA that had previously bound to the extracellular portion of HVEM.
[0029] The term "antibody" refers to an immunoglobulin molecule typically composed of two pairs of identical polypeptide chains, each pair having a "heavy" (H) chain and a "light" (L) chain. Human light chains are classified as kappa (κ) and lambda (λ). Heavy chains are classified as μ (mu), δ (delta), γ (gamma), α (alpha), or ε (epsilon), and antibody isotypes are defined as IgM, IgD, IgG, IgA, and IgE, respectively. Each heavy chain consists of a heavy chain variable region (abbreviated as HCVR or VH in this text) and a heavy chain constant region. The heavy chain constant regions of IgD, IgG, and IgA consist of three domains CH1, CH2, and CH3, while the heavy chain constant regions of IgM and IgE consist of four domains CH1, CH2, CH3, and CH4. Each light chain consists of a light chain variable region (abbreviated as LCVR or VL in this text) and a light chain constant region. The light chain constant region consists of one domain CL. The constant regions of an antibody mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells). The VH and VL regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the light and heavy chains together form the antibody binding site and define the specificity of the epitope. Various methods are known in the art for assigning amino acids to regions or domains within an antibody. Well-known methods include the Kabat method and the Chothia method (Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md.) (1987 and 1991; Chothia et al., Conformations of immunoglobulin hypervariable regions in Nature, 1989; 342(6252):877-83). The amino acid assignments for each region or domain in this disclosure are consistent with the Kabat definition.
[0030] The term "antibody" includes mouse antibodies, humanized antibodies, deimmunized human antibodies, and chimeric antibodies, as well as antibodies in multimeric forms (such as dimers, trimers, or higher-order multimers of monomeric antibodies). Antibodies also include monospecific, bispecific, or multispecific antibodies, and any other modified conformation of an immunoglobulin molecule containing an antigen recognition site having the desired specificity. It also includes antibodies linked to or attached to non-antibody portions. Furthermore, the term "antibody" is not limited to any particular method of producing said antibodies. For example, it includes monoclonal antibodies, recombinant antibodies, and polyclonal antibodies. This invention provides antibodies as described herein. Furthermore, this invention provides portions, derivatives, and / or analogs of antibodies as disclosed herein. These portions, derivatives, and / or analogs retain the antigen-binding properties of said antibodies in kind, but not necessarily in quantity. Non-limiting examples of portions and / or derivatives include portions of antibodies that are antigen-binding moieties and typically contain one or more variable domains of said antibody. Non-limiting examples are various Fab fragments. A portion can also be a so-called single-domain antibody fragment. Single-domain antibody fragments (sdAbs, which developers Ablynx call nanobodies) are antibody fragments with a single monomeric variable antibody domain. Like complete antibodies, they can selectively bind to specific antigens. Single-domain antibody fragments have a molecular weight of only 12-15 kDa, much smaller than typical antibodies (150-160 kDa) composed of two heavy protein chains and two light chains, and even smaller than Fab fragments (approximately 50 kDa, one light chain and half a heavy chain) and single-chain variable fragments (approximately 25 kDa, two variable regions, one from the light chain and one from the heavy chain). Single-domain antibodies themselves are not much smaller than typical antibodies (typically 90-100 kDa). Most single-domain antibody fragments are engineered from heavy-chain antibodies found in camels; these are called VHH fragments. Some fish also possess only heavy-chain antibodies (IgNAR, "immunoglobulin neoantigen receptor") from which single-domain antibody fragments called VNAR fragments can be obtained. An alternative approach is to split the dimeric variable region of ordinary immunoglobulin G (IgG) from humans or mice into monomers. Although most research on single-domain antibodies is currently based on heavy-chain variable domains, nanobodies derived from light chains have also shown specific binding to target epitopes. Non-limiting examples of antibody moieties contain variable domains of the heavy and / or light chains of the antibody or its equivalent. Non-limiting examples of such moieties are VHH, human domain antibodies (dAb), and unibodies. Preferred antibody moieties or derivatives have at least the variable domains of the heavy and light chains of the antibody as described herein. Non-limiting examples of derivatives or moieties are F(ab) fragments and single-chain Fv fragments. The functional moieties of bispecific antibodies comprise the antigen-binding portion of the bispecific antibody, or derivatives and / or analogs of the binding portion.
[0031] A “single-chain antibody” (scFv) has a single polypeptide chain containing a VL domain linked to a VH domain, wherein the VL and VH domains pair to form a monovalent molecule. Single-chain antibodies can be prepared according to methods known in the art (see, for example, Bird et al., (1988) Science 242:423-426 and Huston et al., (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). A “biantibody” has two chains, each containing a heavy chain variable region linked to a light chain variable region on the same polypeptide chain via a short peptide linker, wherein the two regions on the same chain do not pair with each other but instead pair with complementary domains on the other chain to form a bispecific molecule. Methods for preparing biantibodies are known in the art (see, for example, Holliger P. et al., (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448, and Poljak RJ et al., (1994) Structure 2:1121-1123). Domain-bound antibodies (dAbs) are small functional binding units of antibodies, corresponding to the variable regions of the antibody heavy or light chain. Domain-bound antibodies are well expressed in bacterial, yeast, and mammalian cell systems. Further details of domain-bound antibodies and their production methods are known in the art (see, for example, U.S. Patent Nos. 6,291,158; 6,582,915; 6,593,081; WO04 / 003019 and WO03 / 002609). Nanobodies are derived from the heavy chain of antibodies. Nanobodies typically contain a single variable domain and two constant domains (CH2 and CH3) and retain the antigen-binding ability of the original antibody. Nanobodies can be prepared by methods known in the art (see, for example, U.S. Patent Nos. 6,765,087, 6,838,254, and WO 06 / 079372). Monoantibodies have one light chain and one heavy chain of an IgG4 antibody. Monoantibodies can be prepared by removing the hinge region of an IgG4 antibody. More details about monoantibodies and their preparation methods can be found in WO2007 / 059782. The list of antibody analogs is growing annually. Utilizing the sequences of variable domains and the current extensive knowledge of the 3D structures of many different antibodies, those skilled in the art can convert the antibodies of the present invention into one or more antibody analogs, portions, or derivatives.
[0032] In addition to the binding molecule, the molecules of the present invention may also include portions for increasing the in vivo half-life of the molecule, such as, but not limited to, polyethylene glycol (PEG), human serum albumin, glycosylated groups, fatty acids, and dextran. Such additional portions may be conjugated to or otherwise combined with the binding portion using methods well known in the art. Chimeric antigen receptors (CARs) comprising variable domains of antibodies as described herein are also provided. CARs are engineered receptors that bind novel specificities (typically antigen-binding portions of antibodies or their derivatives) to target cells via immune cells. The receptors are referred to as chimeras because they are formed by the fusion of parts from different sources (T lymphocytes genetically modified to express one or more chimeric antigen receptors (CARs; see, for example, Eshhar, U.S. Patent No. 7,741,465; Eshhar, U.S. Patent Application Publication No. 2012 / 0093842). In some embodiments, antibodies as disclosed herein can be conjugated to active compounds such as toxins. Furthermore, antibodies or antigen-binding fragments as disclosed can be conjugated to labels (e.g., fluorescent proteins, chemical labels, organic dyes, colored particles, or enzymes). Antibodies as disclosed herein can be conjugated to drugs to form antibody-drug conjugates (ADCs). The present invention provides antibody analogs, antibody moieties, and antibody derivatives, as well as when these molecules are conjugated or incorporated into other molecules.
[0033] In some embodiments, the antibodies disclosed herein are chimeric antibodies. The term "chimeric antibody" refers to an antibody comprising amino acid sequences derived from two different species (e.g., human and mouse), typically a combination of mouse variable (from heavy and light chain) regions and human constant (heavy and light chain) regions. Non-limiting examples of generating such chimeric antibodies are described in working examples (e.g., Example 5). In such chimeric antibodies, the mouse IgG1 / κ constant region is replaced with the human IgG / κ constant region. In some embodiments, the antibodies disclosed herein are humanized antibodies. The term "humanized antibody" refers to an antibody containing some or all of the CDRs from a non-human animal antibody, wherein the frame and constant regions of said antibody contain amino acid residues derived from the human antibody sequence. Humanized antibodies are typically generated by transplanting a CDR from a mouse antibody into a human frame sequence, followed by back-substituting certain human frame residues back into the corresponding mouse residues from the original antibody. The term "deimmunized antibody" also refers to an antibody of non-human origin, wherein one or more epitopes have typically been removed in one or more variable regions, exhibiting a high tendency to constitute human T-cell and / or B-cell epitopes, with the aim of reducing immunogenicity. The amino acid sequence of the epitope may be completely or partially removed. However, the amino acid sequence is typically altered by replacing one or more amino acids constituting the epitope with one or more other amino acids, thereby changing the amino acid sequence to one that does not constitute a human T-cell and / or B-cell epitope. Depending on the application, the amino acid may be replaced by one or more corresponding amino acids present in the corresponding human variable heavy or variable light chain. In some embodiments, the antibody, as disclosed herein, is a human antibody. The term "human antibody" refers to an antibody consisting solely of the amino acid sequence of a human immunoglobulin. If produced in mice, mouse cells, or hybridomas derived from mouse cells, human antibodies may contain mouse sugar chains. Human antibodies can be prepared in a variety of ways known in the art. Chimeric antibodies, humanized antibodies, deimmunized antibodies, and human antibodies are all within the scope of this invention.
[0034] An antibody that binds to human HVEM binds to HVEM under conditions typically used for antibody binding. When the antibody and human HVEM come into contact with each other under conditions suitable for antibody binding, the antibody will bind to the human HVEM. The antibody binds to membrane-bound human HVEM expressed on HEK293F cells, while the antibody does not bind significantly to HEK293F cells that do not express human HVEM on their cell membranes. The binding of the antibody to cells expressing human HVEM can be detected by methods known to those skilled in the art. For example, by using a secondary antibody carrying a fluorescent label and measuring the labeled cells using flow cytometry (FACS).
[0035] HVEM, also known as tumor necrosis factor receptor superfamily member 14 (TNFRSF14) and CD270, is a human cell surface receptor of the TNF receptor (tumor necrosis factor) superfamily. In humans, the protein is encoded by the TNFRSF14 gene. HVEM can bind to at least four different ligands: TNFSF member LIGHT (TNFSF14) and TNFβ / LTα (tumor necrosis factor β / lymphotoxin α), and immunoglobulin superfamily members B- and T-lymphocyte attenuating factor (BTLA) and CD160. For a reference sequence of human HVEM, we refer to SEQ ID NO.:1 (Swiss-Prot No. Q92956.3; aa1-283). This reference is for identification of the HVEM gene / protein only. This is not intended to limit HVEM as described herein to the specific sequence of the database entry. Natural variants of HVEM that can bind BTLA, CD160, LIGHT, and TNFβ and can be bound by antibodies as described herein are within the scope of this invention. If recombinant human HVEM can bind to BTLA, CD160, LIGHT, and TNFβ, and can also bind to antibodies as described herein, then it is also within the scope of this invention.
[0036] HVEM is widely expressed in tissues, with the highest expression levels in the lungs, kidneys, and liver, and has also been found to be expressed on T cells, B cells, NK cells, and bone marrow cells. HVEM expression has been found to be upregulated in several cancers. The term "HVEM-expressing cells" refers to HVEM-expressing cells. Exemplary cells are T cells, B cells, NK cells, and bone marrow cells. Binding of BTLA and / or CD160 to HVEM may have an inhibitory effect, while binding of LIGHT and / or TNFβ to HVEM may have a stimulatory effect.
[0037] The term "extracellular" literally means outside the cell. The term "extracellular portion" refers to a part of a molecule that is outside the cell membrane. This part of the molecule can interact with other molecules outside the cell. HVEM has an extracellular portion defined by cysteine-rich domains. The extracellular domains of HVEM contain four cysteine-rich domains, namely CRD1-CRD4, and a linker. Unbound by theory, it is believed that the interactions between BTLA and CD160 and HVEM occur via CRD1 of HVEM, while the interactions between LIGHT and TNFβ and HVEM occur via CRD2 and CRD3 of HVEM.
[0038] In one embodiment, the antibody of the present invention binds to CRD1 of HVEM.
[0039] HVEM is present on the surface of cells in most hematopoietic cell lineages, including T cells, B cells, NK cells, and bone marrow cells. HVEM expression has been found to be downregulated upon T cell and B cell activation and upregulated in some cancers. Non-limiting examples include melanoma, esophageal squamous cell carcinoma, hepatocellular carcinoma, and colorectal cancer. The term "cells expressing human HVEM" refers to cells that express human HVEM. Exemplary cells are T cells, B cells, NK cells, and bone marrow cells.
[0040] The term "blocking binding" refers to the ability of an antibody or its antigen-binding fragment to prevent a ligand from binding to a protein when the protein is bound by an antibody. When "blocking binding" is mentioned, it can also be interpreted as "interception." If ligand binding is blocked by more than 70% compared to ligand binding in the absence of an antibody, the ligand binding is said to be blocked. If ligand binding is blocked by more than or equal to 30% but less than or equal to 70% compared to ligand binding in the absence of an antibody, the ligand binding is said to be partially blocked. When ligand binding is blocked by less than 30% compared to ligand binding in the absence of an antibody, the ligand binding is said to be unaffected. If ligand binding is increased by more than 30% compared to ligand binding in the absence of an antibody, the ligand binding is said to be enhanced.
[0041] When the antibody binds to the extracellular portion of HVEM, the antibody or antigen-binding fragment disclosed herein prevents BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 11H7, 36H12, 48H6, and 49G4.
[0042] In another embodiment, when the antibody binds to the extracellular portion of HVEM, anti-HVEM antibodies or their antigen-binding fragments disclosed herein prevent BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells, and do not prevent or partially prevent LIGHT from binding to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 11H7, 36H12, 48H6, and 49G4.
[0043] In another embodiment, when the antibody binds to the extracellular portion of HVEM, anti-HVEM antibodies or their antigen-binding fragments disclosed herein prevent BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells, and partially prevent LIGHT from binding to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 36H12, 48H6, and 49G4.
[0044] In another embodiment, when the antibody binds to the extracellular portion of HVEM, anti-HVEM antibodies or their antigen-binding fragments disclosed herein prevent BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells, and do not prevent LIGHT from binding to the extracellular portion of HVEM on HVEM-expressing cells. An exemplary antibody is 11H7.
[0045] In another embodiment, when the antibody binds to the HVEM extracellular portion, anti-HVEM antibodies as disclosed herein prevent BTLA from binding to the HVEM extracellular portion on HVEM-expressing cells and partially prevent CD160 from binding to the HVEM extracellular portion on HVEM-expressing cells. Exemplary antibodies are: 45H6, 11H7, 36H12, 48H6, and 49G4.
[0046] In another embodiment, when the antibody binds to the extracellular portion of HVEM, anti-HVEM antibodies or their antigen-binding fragments disclosed herein prevent BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells, and partially prevent CD160 and LIGHT from binding to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 36H12, 48H6, and 49G4.
[0047] In another embodiment, when the antibody binds to the extracellular portion of HVEM, the anti-HVEM antibody or its antigen-binding fragment disclosed herein prevents BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells, partially prevents CD160 from binding to the extracellular portion of HVEM on HVEM-expressing cells, and does not prevent LIGHT from binding to the extracellular portion of HVEM on HVEM-expressing cells. An exemplary antibody is 11H7.
[0048] Typically, as described above, anti-HVEM antibodies or their antigen-binding fragments bind to the CRD1 domain of the HVEM protein.
[0049] The combination of BTLA, CD160, and LIGHT with HVEM is preferably measured using the methods described in the embodiments. For example, an exemplary method is described in Example 6b, the results of which are... Figure 6Depicted in AD. HEK293F cells transfected with full-length HVEM are preferably used. Preferably, the cells stably express full-length HVEM on the plasma membrane. The test antibody is examined using HEK293F cells expressing HVEM. Cells are incubated with an anti-HVEM antibody of interest. After washing, cells are incubated with biotin-labeled or his-labeled human BTLA, CD160, or LIGHT. After washing, the label or tag is detected with fluorescently labeled streptavidin or an anti-his antibody. The binding of BTLA, CD160, or LIGHT to HVEM expressed on the cells can be measured by detecting fluorescence using flow cytometry (FACS). The ability to prevent binding is then determined by comparing the percentage of BTLA, CD160, or LIGHT binding to HVEM in the presence of the anti-HVEM antibody to the percentage binding in the presence of a control antibody that does not bind HVEM. The less BTLA, CD160, or LIGHT binds to HVEM, the stronger the blocking ability of the antibody.
[0050] The term "displacement" refers to the ability of a first entity to remove a second entity from its position, thereby replacing the second entity with the first entity. A ligand is said to be replaced if more than 70% of the ligand binding to the extracellular portion of the HVEM is replaced compared to the presence of the ligand in the absence of antibodies. A ligand is said to be partially replaced if more than 30% but less than or equal to 70% of the ligand binding to the extracellular portion of the HVEM is replaced compared to the presence of the ligand in the absence of antibodies. A ligand is said not replaced if less than 30% of the ligand binding to the extracellular portion of the HVEM is replaced compared to the presence of the ligand in the absence of antibodies. The binding of a ligand is said to be enhanced if the binding is increased by more than 30% compared to the presence of the ligand in the absence of antibodies.
[0051] The antibodies or antigen-binding fragments disclosed herein prevent BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells. The antibodies preferably replace BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 11H7, 36H12, 48H6, and 49G4.
[0052] In another embodiment, when the antibody binds to the extracellular portion of HVEM, anti-HVEM antibodies or their antigen-binding fragments disclosed herein prevent BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells, and do not prevent or partially prevent LIGHT from binding to the extracellular portion of HVEM on HVEM-expressing cells. Preferably, the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells, but does not replace LIGHT bound to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 11H7, 36H12, 48H6, and 49G4.
[0053] In another embodiment, when the antibody binds to the extracellular portion of HVEM, anti-HVEM antibodies or their antigen-binding fragments, as disclosed herein, prevent BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells and partially prevent LIGHT from binding to the extracellular portion of HVEM on HVEM-expressing cells. Preferably, the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells but does not replace LIGHT bound to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 36H12, 48H6, and 49G4.
[0054] In another embodiment, when the antibody binds to the extracellular portion of HVEM, the anti-HVEM antibody or its antigen-binding fragment disclosed herein prevents BTLA from binding to the extracellular portion of HVEM on HVEM-expressing cells, and does not prevent LIGHT from binding to the extracellular portion of HVEM on HVEM-expressing cells. Preferably, the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells, but does not replace LIGHT bound to the extracellular portion of HVEM on HVEM-expressing cells. An exemplary antibody is 11H7.
[0055] In another embodiment, when the antibody binds to the HVEM extracellular portion, the anti-HVEM antibody disclosed herein prevents BTLA from binding to the HVEM extracellular portion on HVEM-expressing cells and partially prevents CD160 from binding to the HVEM extracellular portion on HVEM-expressing cells. Preferably, the antibody replaces BTLA bound to the HVEM extracellular portion on HVEM-expressing cells and partially replaces CD160 bound to the HVEM extracellular portion on HVEM-expressing cells. Exemplary antibodies are: 45H6, 11H7, 36H12, 48H6, and 49G4.
[0056] In another embodiment, when the antibody binds to the HVEM extracellular portion, the anti-HVEM antibody or its antigen-binding fragment disclosed herein prevents BTLA from binding to the HVEM extracellular portion on HVEM-expressing cells, and partially prevents CD160 and LIGHT from binding to the HVEM extracellular portion on HVEM-expressing cells. Preferably, the antibody replaces BTLA bound to the HVEM extracellular portion on HVEM-expressing cells, partially replaces CD160 bound to the HVEM extracellular portion on HVEM-expressing cells, and does not replace LIGHT bound to the HVEM extracellular portion on HVEM-expressing cells. Exemplary antibodies are: 45H6, 36H12, 48H6, and 49G4.
[0057] In another embodiment, when the antibody binds to the HVEM extracellular portion, the anti-HVEM antibody or its antigen-binding fragment disclosed herein prevents BTLA from binding to the HVEM extracellular portion on HVEM-expressing cells, partially prevents CD160 from binding to the HVEM extracellular portion on HVEM-expressing cells, and does not prevent LIGHT from binding to the HVEM extracellular portion on HVEM-expressing cells. Preferably, the antibody replaces BTLA bound to the HVEM extracellular portion on HVEM-expressing cells, partially replaces CD160 bound to the HVEM extracellular portion on HVEM-expressing cells, and does not replace LIGHT bound to the HVEM extracellular portion on HVEM-expressing cells. An exemplary antibody is 11H7.
[0058] Typically, as described above, anti-HVEM antibodies or their antigen-binding fragments bind to the CRD1 domain of the HVEM protein.
[0059] To analyze whether the anti-HVEM antibody disclosed herein has the ability to displace ligands bound to the extracellular portion of HVEM, those skilled in the art can use many known suitable assays. A suitable method is disclosed in the Examples section. The assay is described in detail, for example, in Example 6c. HEK293F cells transfected with full-length HVEM are preferably used. Preferably, the cells stably express full-length HVEM on the plasma membrane. The cells are incubated with a soluble ligand (e.g., biotin-labeled or his-labeled BTLA, CD160, or LIGHT). Subsequently, the cells are incubated with the antibody of the present invention that binds to the extracellular portion of HVEM. After washing, the ligands bound to the cells are detected using fluorescently labeled streptavidin or an anti-his antibody. After washing, the fluorescence signal of the antibody bound to the ligand can be detected using flow cytometry (FACS). The amount of ligand bound to the extracellular portion of HVEM indicates the ability of the anti-HVEM antibody to displace ligands bound to the extracellular portion of the antibody's HVEM. The lower the fluorescence signal of the ligand, the stronger its ability to replace the anti-HVEM antibody. Preferred methods are described in the examples, and the results are, for example, in… Figure 7 Depicted in AD. All else being equal, the percentage of displacement is typically given as a percentage of ligand binding to HVEM in the presence of a nonspecific antibody. Displacement can be measured using metabolically active cells (e.g., incubated overnight at 37°C) or metabolically inactive cells (e.g., incubated at 4°C in the presence of sodium azide).
[0060] Unbound by theory, it is believed that T cell activation is inhibited even in the presence of LIGHT and / or TNFβ when BTLA and / or CD160 interact with HVEM. Antibodies as disclosed herein can be used to target HVEM-expressing cells. The antibodies disclosed herein bind to BTLA, and preferably at least partially to CD160 bound to the extracellular portion of HVEM, but not to LIGHT bound to the extracellular portion of HVEM. As a result, the inhibitory effect of BTLA and CD160 on T cell activation is suppressed due to their ability to prevent the binding of BTLA and CD160, and their ability to replace BTLA and preferably partially replace CD160. Cells bound to antibodies as disclosed herein can respond to other stimuli, such as the binding of LIGHT or TNFβ to HVEM.
[0061] The full-length cynomolgus macaque (Macaca fascicularis) HVEM protein (Met1-Ser280; NCBI reference sequence: XP_005545061.1, see SEQ ID NO.5) has an amino acid sequence similar to human HVEM and shows 82% homology with human HVEM protein (Met1-His283; Swiss-Prot No. Q92956.3, see SEQ ID NO.1). The predicted amino acid sequence of the extracellular domain of the cynomolgus macaque HVEM (i.e., Leu39-Val203; NCBI reference sequence: XP_005545061.1) showed 87% homology with the amino acid sequence of the extracellular domain of human HVEM protein (i.e., Leu 39-Val202; Swiss-Prot No. Q92956.3). Replacing the amino acids of human HVEM with corresponding amino acids from cynomolgus monkey HVEM can be used to test the specificity and cross-specificity of the antibodies. In one embodiment, the antibodies of the present invention bind to human HVEM and exhibit cross-specificity to cynomolgus monkey (Macacafascicularis) HVEM. Exemplary antibodies are: 45H6, 11H7, 48H6, and 49G4. Without being bound by theory, such antibodies are believed to be particularly suitable for binding to human HVEM carrying mutations. Furthermore, such antibodies are suitable for toxicity testing.
[0062] One aspect of this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:26-28 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions; and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:29-31 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:26-28 and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:29-31.
[0063] In another aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having an amino acid sequence of SEQ ID NO:24 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:25 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added. In a preferred embodiment, the 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 9, or 10 amino acids inserted, deleted, substituted, or added are located in the frame region of the light chain and / or heavy chain variable regions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having an amino acid sequence of SEQ ID NO:24 and a light chain variable region having an amino acid sequence of SEQ ID NO:25. An exemplary antibody having these features is 45H6.
[0064] One aspect of this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:42-44 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions; and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:45-47 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:42-44 and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:45-47.
[0065] In another aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having an amino acid sequence of SEQ ID NO:40 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:41 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added. In a preferred embodiment, the 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 9, or 10 amino acids inserted, deleted, substituted, or added are located in the frame region of the light chain and / or heavy chain variable regions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having an amino acid sequence of SEQ ID NO:40 and a light chain variable region having an amino acid sequence of SEQ ID NO:41. An exemplary antibody having these features is 11H7.
[0066] One aspect of this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:18-20 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions; and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:21-23 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:18-20 and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:21-23.
[0067] In another aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having an amino acid sequence of SEQ ID NO:16 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:17 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added. In a preferred embodiment, the 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 9, or 10 amino acids inserted, deleted, substituted, or added are located in the frame region of the light chain and / or heavy chain variable regions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having an amino acid sequence of SEQ ID NO:16 and a light chain variable region having an amino acid sequence of SEQ ID NO:17. An exemplary antibody having these features is 36H12.
[0068] One aspect of this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:34-36 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions; and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:37-39 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:34-36 and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:37-39.
[0069] In another aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having an amino acid sequence of SEQ ID NO:32 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:33 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added. In a preferred embodiment, the 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 9, or 10 amino acids inserted, deleted, substituted, or added are located in the frame region of the light chain and / or heavy chain variable regions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having an amino acid sequence of SEQ ID NO:32 and a light chain variable region having an amino acid sequence of SEQ ID NO:33. An exemplary antibody having these features is 48H6.
[0070] One aspect of this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, said antibody comprising: a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:50-52 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions; and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:53-55 containing 0, 1, or 2 amino acid insertions, deletions, substitutions, or additions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:50-52 and a light chain variable region having CDR1, CDR2, and CDR3 sequences of SEQ ID NO:53-55.
[0071] In another aspect, this disclosure provides an antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody comprising: a heavy chain variable region having an amino acid sequence of SEQ ID NO:48 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added; and a light chain variable region having an amino acid sequence of SEQ ID NO:49 containing 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids inserted, deleted, substituted, or added. In a preferred embodiment, the 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 9, or 10 amino acids inserted, deleted, substituted, or added are located in the frame region of the light chain and / or heavy chain variable regions. Preferably, the antibody that binds to the extracellular portion of HVEM on HVEM-expressing cells comprises a heavy chain variable region having an amino acid sequence of SEQ ID NO:48 and a light chain variable region having an amino acid sequence of SEQ ID NO:49. An exemplary antibody having these features is 49G4.
[0072] In one aspect, when an anti-HVEM antibody mentioned herein binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody or antigen-binding fragment prevents BTLA from binding to the extracellular portion of HVEM. Preferably, the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 11H7, 36H12, 48H6, and 49G4.
[0073] On the other hand, when the anti-HVEM antibody mentioned herein binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody or antigen-binding fragment prevents BTLA from binding to the extracellular portion of HVEM and partially prevents LIGHT from binding to the extracellular portion of HVEM. Preferably, the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells, but does not replace LIGHT bound to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 36H12, 48H6, and 49G4.
[0074] On the other hand, when the anti-HVEM antibody mentioned herein binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody or antigen-binding fragment prevents BTLA from binding to the extracellular portion of HVEM, but does not prevent LIGHT from binding to the extracellular portion of HVEM. Preferably, the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells, but does not replace LIGHT bound to the extracellular portion of HVEM on HVEM-expressing cells. An exemplary antibody is 11H7.
[0075] On the other hand, when the anti-HVEM antibody mentioned herein binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody or antigen-binding fragment prevents BTLA from binding to the extracellular portion of HVEM and partially prevents CD160 from binding to the extracellular portion of HVEM. Preferably, the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells and partially replaces CD160 bound to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 11H7, 36H12, 48H6, and 49G4.
[0076] On the other hand, when the anti-HVEM antibody mentioned herein binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody or antigen-binding fragment prevents BTLA from binding to the extracellular portion of HVEM and partially prevents CD160 and LIGHT from binding to the extracellular portion of HVEM. Preferably, the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells, partially replaces CD160 bound to the extracellular portion of HVEM on HVEM-expressing cells, and does not replace LIGHT bound to the extracellular portion of HVEM on HVEM-expressing cells. Exemplary antibodies are: 45H6, 36H12, 48H6, and 49G4.
[0077] On the other hand, when the anti-HVEM antibody mentioned herein binds to the extracellular portion of HVEM on HVEM-expressing cells, the antibody or antigen-binding fragment prevents BTLA from binding to the extracellular portion of HVEM, partially prevents CD160 from binding to the extracellular portion of HVEM, and does not prevent LIGHT from binding to the extracellular portion of HVEM, wherein the antibody replaces BTLA bound to the extracellular portion of HVEM on HVEM-expressing cells, partially replaces CD160 bound to the extracellular portion of HVEM on HVEM-expressing cells, and does not replace LIGHT bound to the extracellular portion of HVEM on HVEM-expressing cells. An exemplary antibody is: 11H7.
[0078] Typically, this article describes how anti-HVEM antibodies or their antigen-binding fragments bind to the CRD1 domain of the HVEM protein via the sequence-mentioned anti-HVEM antibody or its antigen-binding fragment.
[0079] The anti-HVEM antibody or its antigen-binding fragment disclosed herein preferably comprises a heavy chain variable region and a light chain variable region as described herein. Such an antibody possesses desirable characteristics. Of course, it is possible to generate variants of this original antibody by modifying one or more amino acids therein. Many such variants will exhibit more or less similarity when compared to the original. Such variants are also included within the scope of this disclosure.
[0080] Variants can have amino acid substitutions, insertions, deletions, or additions relative to the original antibody sequence. An amino acid substitution is replacing one amino acid with another. Preferably, the amino acid is pre-substituted with an amino acid having similar chemical properties; this is often referred to as a conserved substitution. An amino acid deletion results in the removal of one or more amino acids from the sequence. An amino acid insertion results in the presence of one or more additional amino acids in the sequence. An amino acid addition results in the presence of one or more amino acids at the beginning or end of the amino acid sequence.
[0081] A non-limiting example of this modification is an antibody containing pyroglutamate instead of glutamate. Other non-limiting examples of such modifications are the insertion, deletion, inversion, and / or substitution of one or more amino acids compared to the original antibody. Preferably, the amino acid substitution, insertion, deletion, or addition is outside the CDR of the variable domain. Preferably, the amino acid substitution, insertion, deletion, or addition is located within the frame region and / or constant region of the variable region of the antibody. HVEM binding of the variant can be tested as described herein.
[0082] In some embodiments, the constant region of the antibody of the present invention is the constant region of an IgG, IgA, IgD, IgE, or IgM antibody (such as an IgG1, IgG2, IgG3, or IgG4 antibody). The constant region may contain modifications (such as amino acid substitutions) to impart specific properties to the constant region. For example, a mutation in the IgG4 hinge region makes the antibody more stable for half-molecule exchange. Other modifications affect the half-life of the antibody, add or remove glycosylation sites, increase yield, improve the uniformity of antibody products produced in large-scale fermenters, etc.
[0083] The antibody of the present invention is preferably mouse IgG1, human IgG1 mutated in the constant region to reduce or prevent complement activation or Fc receptor interaction, or human IgG4, or human IgG4 mutated to prevent half-molecules from exchanging with other IgG4 molecules.
[0084] As disclosed in this paper, some variations in the antibody's CDRs (CDR1-CDR2-CDR3) are permitted. Typically, approximately 0-2 amino acid substitutions, insertions, deletions, or additions are allowed within a single CDR. More than 2 amino acid variations are generally permitted.
[0085] The antibody of the present invention may have a heavy chain CDR1, CDR2 or CDR3, which has 0-5, preferably 0-2, more preferably 2, 1 or 0 amino acid substitutions, insertions, deletions or additions relative to naturally occurring heavy chain CDR1, CDR2 or CDR3.
[0086] This antibody may have light chains CDR1, CDR2 or CDR3, which have 0-5, preferably 0-2, more preferably 0-1, more preferably 0 amino acid substitutions, insertions, deletions or additions relative to naturally occurring light chains CDR1, CDR2 or CDR3.
[0087] As disclosed herein, some variations in the variable region of the antibody are permitted. Typically, approximately 0-10 amino acid substitutions are allowed in the variable chain. Variations of more than 10 amino acids are generally permitted.
[0088] The antibody of the present invention may have a heavy chain variable region, which, relative to the naturally occurring variable heavy chain, has 0-15, preferably 0-10, more preferably 0-5, more preferably 5, 4, 3, 2, 1 or 0 amino acid substitutions, insertions, deletions or additions.
[0089] This antibody may have a light chain variable region, which, relative to the naturally occurring light chain variable region, has 0-15, preferably 0-10, more preferably 0-5, more preferably 5, 4, 3, 2, 1 or 0 amino acid substitutions, insertions, deletions or additions.
[0090] Some variations in the constant region of the antibodies disclosed herein are permitted. Typically, about 0-10 amino acid substitutions are permitted in the constant region. Variations of more than 10 amino acids are typically permitted. The antibodies of the present invention may have a heavy chain constant region (CH1-CH2-CH3) having 0-15, preferably 0-10, more preferably 0-5, more preferably 5, 4, 3, 2, 1, or 0 amino acid substitutions relative to the naturally occurring heavy chain constant region (H1-CH2-CH3). Such antibodies may have a light chain constant region having 0-5, preferably 5, 4, 3, 2, 1, or 0 amino acid substitutions relative to the naturally occurring light chain constant region.
[0091] Some variations in IgG4 occur in nature and / or are permitted without altering the immunological properties of the resulting antibody. Antibodies possessing an IgG4 constant region or a mutated IgG1 constant region retain at least most of the pharmacological properties of an antibody but do not bind complement and therefore will not induce depletion of the cells to which they bind in vivo. Preferably, the constant region is the constant region of a human antibody (chimeric).
[0092] Preferably, the constant region is a region defective in complement activation, preferably the human IgG4 constant region or the mutated human IgG1 constant region.
[0093] The HVEM binding of the antibodies and their antigen-binding fragments disclosed herein can be confirmed in many suitable assays known to those skilled in the art. Such assays include, for example, affinity assays such as Western blotting, radioimmunoassay, FACS, and ELISA (enzyme-linked immunosorbent assay). Examples (e.g., Examples 2c and 6a) describe in detail some of the many assays that can be used to measure HVEM binding, and methods for determining the relative binding affinity of antibodies to human HVEM.
[0094] On the other hand, this disclosure provides one or more nucleic acid molecules encoding antibodies or antigen-binding fragments as disclosed herein. A nucleic acid molecule encoding a variable region as disclosed herein is also provided. The nucleic acids used in this disclosure are generally, but not exclusively, ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). Based on the genetic code, those skilled in the art can determine the nucleic acid sequence encoding antibody variants as disclosed herein. Based on the degeneracy of the genetic code, 64 codons can be used to encode 20 amino acids and translation terminal signals. As is known to those skilled in the art, codon usage preferences in different organisms can affect gene expression levels. Those skilled in the art can utilize various computational tools to optimize codon usage, depending on the organism in which the desired nucleic acid will be expressed.
[0095] In another aspect, this disclosure provides a vector comprising a nucleic acid sequence molecule as described herein. As used herein, the term "vector" refers to a nucleic acid molecule capable of introducing a heterologous nucleic acid sequence into a host cell, such as a plasmid, bacteriophage, or animal virus. Vectors according to the invention allow the expression or production of antibodies of the invention encoded by a heterologous nucleic acid sequence in a host cell. Vectors used according to the invention are derived, for example, from animal viruses, including but not limited to vaccinia virus (including attenuated derivatives such as modified vaccinia virus Ankara, MVA), Newcastle disease virus (NDV), adenovirus, or retrovirus. Vectors according to the invention preferably comprise an expression cassette containing a promoter suitable for initiating transcription of antibodies according to the invention in a selected host cell. Examples of suitable promoters for expressing polypeptides according to the invention in eukaryotic host cells include, but are not limited to, β-actin promoters, immunoglobulin promoters, 5S RNA promoters, or virus-derived promoters, such as cytomegalovirus (CMV), Rous sarcoma virus (RSV), and simian virus 40 (SV40) promoters for mammalian hosts.
[0096] When one or more nucleic acid molecules as disclosed herein are expressed in a cell, the cell can produce an antibody according to the present disclosure. Therefore, in one embodiment, a cell comprising an antibody, one or more nucleic acid molecules, and / or a vector according to the present disclosure is provided. The host cell may be a mammalian, insect, plant, bacterial, or yeast cell. The cell is preferably an animal cell, more preferably a mammalian cell, and most preferably a human cell. Examples of suitable mammalian cell lines as host cells include hybridoma cells, Chinese hamster ovary (CHO) cells, NSO cells, or PER-C6. TM Cells. For the purposes of this disclosure, suitable cells are any cells capable of containing, and preferably producing, the antibodies and / or nucleic acids. This disclosure also includes cell cultures containing the cells.
[0097] The term "host cell" refers to a cell into which the expression vector has been introduced. This term includes not only the specific subject cell but also its progeny. Because progeny cells may undergo modifications due to environmental influences or mutations, they may differ from the parent cells but are still included within the scope of the term "host cell."
[0098] The antibodies disclosed herein can be produced by any method known to those skilled in the art. In a preferred embodiment, the antibodies are produced using cells, preferably hybridoma cells, CHO cells, NSO cells, or PER-C6 cells. TM Cells. In a particularly preferred embodiment, the cells are CHO cells, preferably cultured in a serum-free medium. This includes harvesting the antibody from the culture. The antibody is preferably purified from the culture medium, and preferably is affinity-purified. Alternatively, the antibody can be synthesized.
[0099] Various institutions and companies have developed cell lines for the large-scale production of antibodies, for example, for clinical use. These cells are also used for other purposes, such as protein production. Cell lines developed for the industrial-scale production of proteins and antibodies are further referred to herein as industrial cell lines. Therefore, preferred embodiments of this disclosure provide the use of cell lines developed for the large-scale production of said antibodies.
[0100] The antibodies according to the invention exhibit a variety of activities that can be advantageously used for both therapeutic and non-therapeutic purposes. In particular, the antibodies according to the invention can be used for the treatment of individuals. Preferably, the antibodies according to the invention can be used to treat or prevent immune-related diseases. In a preferred embodiment, the antibodies according to the invention can be used to treat cancer. In some embodiments, the antibodies according to the invention are preferably used in therapeutics, preferably in human therapy. In some embodiments, the antibodies disclosed herein can be used for research purposes, for example, in in vitro experiments, cell cultures, organoid cultures, and in vivo models.
[0101] It also describes methods for treating cancer. Examples of cancers include, for example, melanoma, esophageal squamous cell carcinoma, hepatocellular carcinoma, and colorectal cancer.
[0102] This invention provides a method for treating a subject with cancer, the method comprising administering to the subject a therapeutically effective amount of an antibody as disclosed herein. A method for preparing a medicament for treating a subject with cancer is also provided. This disclosure describes a method for preventing the activation of inhibitory T cells by blocking the binding of BTLA to HVEM and CD160 to HVEM.
[0103] This invention provides a method for treating a subject suffering from an inflammatory disease, the method comprising administering to the subject a therapeutically effective amount of an antibody as disclosed herein. A method for preparing a medicament for treating a subject suffering from an inflammatory disease is also provided. This disclosure describes a method for preventing the activation of inhibitory T cells by blocking the binding of BTLA to HVEM and CD160 to HVEM.
[0104] This disclosure also includes a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof as disclosed herein, or a nucleic acid encoding such antibody or antigen-binding fragment thereof, or a cell comprising an antibody or antigen-binding fragment thereof as disclosed herein, or a nucleic acid encoding such nucleic acid. Pharmaceutical compositions are provided comprising a polypeptide or a pharmaceutically acceptable salt thereof according to the invention, and at least one pharmaceutically acceptable carrier, diluent, and / or excipient. Such compositions are particularly suitable for use as pharmaceuticals. The compositions may be in any suitable form, such as liquid, semi-solid, and solid dosage forms. The dosage and schedule of the selected formulation can be determined by standard procedures well known to those skilled in the art. Such procedures involve extrapolating and estimating the dosing schedule from animal models, and then determining the optimal dosage in human clinical dose range studies. The dosage in the pharmaceutical composition will vary depending on many factors, such as the desired release and pharmacodynamic characteristics.
[0105] One embodiment of this disclosure provides a pharmaceutical composition as described herein for the prevention or treatment of cancer and / or immune-related conditions.
[0106] A method for modulating HVEM signaling activity is also provided. The term "modulation" refers to the activity of adjusting the system's output signal. The output signal, or output, can be modulated in such a way that inhibiting the output signal becomes stimulating the output signal, and vice versa. This invention provides a method for modulating HVEM signaling, the method comprising administering a therapeutically effective amount of an antibody as disclosed herein to the subject. Without being bound by theory, it is believed that HVEM delivers a co-inhibitory signal to T cells expressing BTLA or CD160. On the other hand, when LIGHT and TNFβ interact with HVEM expressed on T cells, they deliver a co-stimulatory signal to the T cells. When LIGHT and / or TNFβ, BTLA and / or CD160 simultaneously interact with HVEM, the net result is an inhibitory signal against T cell activation. This interaction is bidirectional: HVEM induces an inhibitory signal in T cells after interacting with BTLA and CD160 on T cells, while both BTLA and CD160 act as activating ligands for HVEM, leading to NFκB activation. Furthermore, LIGHT delivers co-stimulatory signals to T cells when interacting with HVEM expressed on T cells, and HVEM is also thought to transmit co-stimulatory signals to T cells when interacting with LIGHT expressed on T cells. However, LIGHT does not contain a prominent signaling motif, and its mechanism of signal transduction is not fully understood.
[0107] Co-stimulatory and co-inhibitory signaling transmitted by HVEM and BTLA in T cells can be measured by the levels of NFκB or NFAT, as well as the release of IL-2, TNFα, and IFNγ. Methods for measuring NFAT levels are known in the art. For example, an exemplary method is described in Example 3c, the results of which are... Figure 4A -B is depicted. Methods for measuring NFκB levels are known in the art. For example, an exemplary method is described in Example 6f, the results of which are... Figure 8A Depicted in -C. Methods for measuring IL-2, TNFα, and IFNγ levels are known in the art. For example, an exemplary method is described in Example 6k, the results of which are... Figure 11A -C is described.
[0108] In one aspect, this disclosure provides a method for modulating HVEM signaling activity, the method comprising contacting HVEM-expressing cells with an antibody or antigen-binding fragment thereof as disclosed herein, a nucleic acid molecule, or a carrier. In another aspect, this disclosure provides a method for enhancing an immune response in a subject, the method comprising administering to a subject in need a therapeutically effective amount of a composition comprising an antibody or antigen-binding fragment thereof as disclosed herein, a nucleic acid molecule, or a carrier.
[0109] In one aspect, this disclosure provides a method for reducing tumor growth in a subject, the method comprising administering a therapeutically effective amount of a composition to a subject in need, the composition comprising an antibody or an antigen-binding fragment thereof as disclosed herein, a nucleic acid molecule or a carrier.
[0110] As used herein, "subject" refers to a person or animal. Subjects include, but are not limited to, mammals such as humans, pigs, ferrets, seals, rabbits, cats, dogs, cattle, and horses, as well as birds such as chickens, ducks, geese, and turkeys. In a preferred embodiment of the invention, the subject is a mammal. In a particularly preferred embodiment, the subject is a human.
[0111] The term “antigen-binding fragment” in the term antibody refers to one or more portions of a full-length antibody that retain the ability to bind to the same antigen (i.e., human HVEM) to which the antibody binds. The term “antigen-binding fragment” also includes portions of an antibody that are part of a larger molecule formed through non-covalent or covalent association, or portions of an antibody with one or more other molecular entities. Examples of other molecular entities include amino acids, peptides, or proteins, such as the streptavidin core region, which can be used to prepare tetrameric scFv molecules (Kipriyanov et al., Hum Antibodies Hybridomas 1995; 6(3):93-101). Exemplary antigen-binding fragments are the VH and / or VL of an antibody. Antigen-binding fragments include Fab, F(ab'), F(ab')2, complementarity-determining region (CDR) fragments, single-chain antibodies (scFv), bivalent single-chain antibodies, and other antigen-recognizing immunoglobulin fragments. In some cases, the term “antibody” as used herein may also be understood to include its antigen-binding fragment.
[0112] The term "human antibody" refers to an antibody composed solely of the amino acid sequence of human immunoglobulins. If produced in mice, mouse cells, or hybridomas derived from mouse cells, human antibodies may contain mouse sugar chains. Human antibodies can be prepared in a variety of ways known in the art.
[0113] The term "epitope" refers to an antigenic motif that is capable of specifically binding to an antibody or T-cell receptor or otherwise interacting with a molecule. "Epitope" is also referred to in the art as an "antigenic determinant." Epitopes are typically composed of groups of chemically active surfaces of a molecule, such as amino acids or carbohydrate or sugar side chains. Epitopes can be "linear" or "non-linear / conformal." Once the desired epitope is identified (e.g., through epitope mapping), an antibody targeting that epitope can be generated. The generation and characterization of antibodies can also provide information about the desired epitope. From this information, antibodies that bind to the same epitope can then be screened, for example, by performing cross-competition studies to discover antibodies that compete for binding—that is, antibodies competing to bind to the antigen.
[0114] As used herein, the word “comprising” and its variations are used in a non-limiting sense to mean including the items following the word, but not excluding items not specifically mentioned. Additionally, the verb “consisting of” may be replaced by “consisting substantially of”, meaning that a compound or accessory compound as defined herein may contain one or more additional components besides those specifically identified, without altering the distinctive features of the invention.
[0115] As used herein, the articles “a” and “a kind” refer to the grammatical object of one or more (i.e., at least one) of the articles. By way of example, “element” means one or more elements.
[0116] When the word “approximately” or “about” is used in conjunction with a numerical value (approximately 10, about 10), it preferably means that the value may be ±1% of the given value of 10.
[0117] As used herein, the terms “treatment,” “treat,” and “treating” refer to reversing, reducing, delaying the onset of a disease or disorder or inhibiting its progression, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have appeared. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be given to a susceptible individual before the onset of symptoms (e.g., based on a history of symptoms and / or based on genetic factors or other susceptibility factors). Treatment may also continue after symptoms have subsided, for example, to prevent or delay their recurrence.
[0118] For the purposes of clarity and concise description, the features described herein are part of the same or separate embodiments. However, it will be understood that the scope of the invention may include embodiments having all or some of the described features.
[0119] All patents and references cited in this application are incorporated herein by reference in their entirety.
[0120] The invention is further explained in the following embodiments. These embodiments are not intended to limit the scope of the invention, but are merely illustrative. Attached Figure Description
[0121] Figure 1 Flow cytometry binding characteristics of mouse anti-human HVEM antibody to membrane-bound full-length human HVEM, membrane-bound human HVEM lacking CRD1, or membrane-bound full-length cynomolgus monkey HVEM on HEK293F cells. Dashed lines represent background (i.e., no binding of mouse anti-human HVEM antibody).
[0122] Figure 2. Effects of mouse anti-human HVEM antibody on the binding of (A) soluble human BTLA and (B) soluble human LIGHT to the membrane-bound full-length human HVEM on HEK293F cells. Dashed lines represent negative controls (i.e., ligand / receptor binding without mouse anti-human antibody or with mouse IgG1 negative isotype control = 100% binding of ligand to HVEM receptor).
[0123] Figure 3. (A) Effect of mouse anti-human HVEM antibody on NFκB signaling in cells expressing membrane-bound human HVEM. Soluble human LIGHT ligand is included as a reference. (B) Effect of mouse anti-human HVEM antibody on NFκB signaling induced by soluble human LIGHT (≈EC80) in cells expressing membrane-bound human HVEM. Mean ± SD (n = 2) is shown.
[0124] Figure 4. (A) Principle of the NFAT response element-luciferase (RE-luc) human BTLA / HVEM blocking bioassay: A combination of (1) CHO-K1 activated cells expressing membrane human HVEM and a proprietary membrane human T cell receptor (TCR) activator (i.e., artificial antigen-presenting cells (aAPCs)) and (2) NFAT-RE-luc Jurkat effector T cells expressing membrane human BTLA and membrane human TCR complexes was used to examine the ability of mouse anti-human HVEM antibody to block BTLA / HVEM-mediated inhibition of TCR-induced NFAT signaling. (B) Effect of mouse anti-human HVEM antibody on the inhibition of membrane-bound human BTLA / human HVEM-mediated TCR-induced NFAT signaling in Jurkat effector T cells expressing membrane-bound human BTLA / human TCR. Mean ± SD (n = 2) is shown.
[0125] Figure 5 Flow cytometry binding characteristics of purified BTLA / HVEM-blocking mouse antibody to membrane-bound (full-length) human HVEM on HEK293F cells compared to chimeric mouse / human anti-human HVEM antibody. Mean ± SD (n = 2) are shown.
[0126] Figure 6 The effect of purified BTLA / HVEM blocking mice on the binding of (A) soluble human BTLA, (B) soluble human CD160, (C) soluble human LIGHT, and (D) soluble human TNFβ to the membrane of HEK293F cells on full-length human HVEM binding. Dashed lines represent negative controls (i.e., ligand / receptor binding of mice with added mouse IgG1 or human IgG4 negative isotype controls = ligand binding to HVEM receptor 100%). The mean ± SD (n = 2–3) shown are from one (D), two (A and B), or three (C) independently performed experiments.
[0127] Figure 7 The effect of purified BTLA / HVEM chimeric mouse / human anti-human HVEM antibody on the membrane-bound full-length human HVEM replacement of pre-bound (A) soluble human BTLA, (B) soluble human CD160, (C) soluble human LIGHT, and (D) soluble human TNFβ on HEK293F cells. Dashed lines represent negative controls (i.e., ligand / receptor binding with the addition of human IgG4 negative isotype control = ligand 100% binding to the HVEM receptor). Mean ± SD (n = 2) is shown.
[0128] Figure 8. (A) Effect of purified BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on NFκB signaling in cells expressing membrane-bound human HVEM. Soluble human LIGHT ligand is included as a reference. (B) Effect of uncrosslinked vs. crosslinked purified BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on NFκB signaling in cells expressing membrane-bound human HVEM. Soluble human LIGHT ligand is included as a reference. (C) Effect of purified BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on NFκB signaling induced by soluble human LIGHT (≈EC80) in cells expressing membrane-bound human HVEM. Mean ± SD (n = 2) shown are from one (B) or both (A and C) independently performed experiments.
[0129] Figure 9 (A) Effect of soluble human TNFβ ligand on NFκB signaling in cells expressing membrane-bound human HVEM. (B) Effect of purified BTLA / HVEM-blocking chimeric mouse / human anti-human HVEM antibody on NFκB signaling induced by soluble human TNFβ (≈EC80) in cells expressing membrane-bound human HVEM. Mean ± SD (n = 3) is shown.
[0130] Figure 10 The effect of purified BTLA / HVEM-blocking chimeric mouse / human anti-human HVEM antibody on the inhibition of TCR-induced NFAT signaling mediated by membrane-bound human BTLA / human HVEM in Jurkat effector T cells expressing membrane-bound human BTLA / human TCR. Mean ± SD (n = 2) shown are from two independently conducted experiments.
[0131] Figure 11. Effect of purified BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on the inhibition of TCR-induced (top row) and TCR / CD28-induced (bottom row) inhibition of membrane-bound human BTLA / human HVEM-mediated release of IL-2 (A), TNFα (B), or IFNγ (C) from membrane-bound human BTLA / human HVEM-expressing primary naive human T cells enriched from six healthy donors (donors A, C, D, G, H, and K). Dashed lines represent basal cytokine release (i.e., exposure to human IgG4 / κ negative isotype controls). Mean ± SD (n = 5) is shown.
[0132] Example
[0133] Example 1. Generation of mouse anti-human HVEM monoclonal antibody
[0134] (a) Production of Sf9 insect cells and HEK293F cells expressing human HVEM surface antigen
[0135] The cDNA encoding the human HVEM protein (Swiss-Prot No. Q92956.3; see SEQ ID NO.1) was optimized for mammalian expression and synthesized by GENEART in Regensburg, Germany (see SEQ ID NO.2). This cDNA was subcloned into the baculovirus transfer plasmid pVL1393 (BD Transfection Kit Catalog No. 560129; BD Biosciences). Subsequently, Sf9 insect cells (Spodoptera frugiperda) were transfected with the transfer plasmid pVL1393 containing the cDNA encoding human HVEM using the baculoCOMPLETE all-in-one kit (Oxford Expression Technologies), and then incubated at 27°C for 4–5 days. After this transfection step, the supernatant was collected and stored at 4°C and used to infect more Sf9 insect cells for virus amplification. For this purpose, Sf9 insect cells were transfected with amplified recombinant baculovirus and then incubated at 27°C for 3–5 days. These Sf9 insect cells were harvested, washed with sterile PBS, and then incubated in PBS at a concentration of 20.0 x 10⁻⁶. 6 Cells were aliquoted at 1:10 / mL and stored at -80°C to obtain cell lysates. Prior to storage, human HVEM surface expression on transfected Sf9 insect cells was confirmed using a 1:20 dilution of phycoerythrin (PE)-conjugated mouse anti-human HVEM antibody (clone eBioHVEM-122; eBioscience) and flow cytometry.
[0136] The cDNA encoding the human HVEM protein (Swiss-Prot no. Q92956.3; see SEQ ID NO.1) was optimized for mammalian expression and synthesized by GENEART in Regensburg, Germany (see SEQ ID NO.2). This cDNA was subcloned into a pcDNA3.1-derived expression plasmid. FreeStyle was used for expression. TM The 293 expression system (Life Technologies) was used to transfect this full-length human HVEM plasmid into FreeStyle. TM HEK293F cells (Life Technologies) were selected using 125 μg / mL G418 (Gibco) to select stable human full-length HVEM-transfected HEK293F cells (clone 128). These HEK293F cells were harvested, washed with sterile PBS, and incubated in PBS at 19.0 x 10⁻⁶ cells / mL. 6 Cells were aliquoted at 1:10 / mL and stored at -80°C to obtain cell lysates. Prior to storage, human HVEM surface expression on transfected HEK293F cells was confirmed using a 1:20 dilution of phycoerythrin (PE)-conjugated mouse anti-human HVEM antibody (clone eBioHVEM-122; eBioscience) and flow cytometry.
[0137] (b) Immunization and production of mouse anti-human HVEM monoclonal antibodies
[0138] Two immunization regimens were used:
[0139] During the first immunization regimen, on day 0, BALB / c mice (female, 6–8 weeks old; Charles River Laboratory) were subcutaneously injected with approximately 500 μL of either water-in-oil emulsion with complete Freund's adjuvant (CFA; Sigma) or water-in-oil emulsion with Sigma. Soluble recombinant C-terminal multihistidine-labeled human extracellular HVEM domain (NCBI reference SEQ NP_003811.2; Sino Biological) in SAS (Sigma-Aldrich); 25 μg of recombinant human HVEM was injected into each mouse in 250 μL of PBS mixed with 250 μL of CFA or SAS. On day 21, antibody response was enhanced by subcutaneous injection of recombinant human HVEM in incomplete Freund's adjuvant (IFA; Sigma-Aldrich) or SAS; 25 μg of recombinant human HVEM was injected into each mouse in 250 μL of PBS mixed with 250 μL of IFA or SAS. On days 42 and 87, mice were further enhanced by subcutaneous injection of recombinant human HVEM and human HVEM-transfected Sf9 insect cell lysate in IFA or SAS; each mouse was injected with 25 μg of recombinant human HVEM and human HVEM-transfected Sf9 insect cell lysate (1.8 x 10⁻⁶) in 250 μL PBS mixed with 250 μL IFA or SAS. 6 (Preparation of live cells and cells expressing membrane-bound HVEM). Finally, on days 98 and 99, mice were intraperitoneally injected with adjuvant-free recombinant human HVEM and human HVEM-transfected Sf9 insect cell lysates; each mouse was injected with 25 μg of recombinant human HVEM and human HVEM-transfected Sf9 insect cell lysates (1.8 x 10⁻⁶ cells) in 250 μL PBS. 6 (Preparation of live cells expressing membrane-bound HVEM). On day 102, cells were initially prepared using the method described below. The standard hybridoma technique described by Milstein (Nature 1975, 256:495) fuses spleen cells from immunized mice with SP2 / 0-Ag14 myeloma cells (DSMZ).
[0140] During the second immunization regimen, on day 0, BALB / c mice (female, 6–8 weeks old; Charles River Laboratories) were subcutaneously injected with approximately 500 μL of soluble recombinant C-terminal multihistidine-labeled human extracellular HVEM domain (NCBI reference SEQ NP_003811.2; Sino Biological) and human HVEM-transfected Sf9 insect cell lysates or human HVEM-transfected HEK293F cell lysates; recombinant human HVEM and human HVEM-transfected Sf9 insect cell or HEK293F cell lysates were injected into each mouse in 250 μL of PBS mixed with or without 250 μL of CFA or SAS. (Both were 5.0 x 10⁻⁶ g) 6(Preparation of live cells expressing membrane-bound HVEM). On days 21 and 42, antibody responses were enhanced by subcutaneous injection of recombinant human HVEM and human HVEM-transfected Sf9 insect cell lysates or human HVEM-transfected HEK293F cell lysates in or without adjuvanted IFA or SAS; each mouse was injected with 10–20 μg of recombinant human HVEM and human HVEM-transfected Sf9 insect cells or HEK293F cell lysates (both 5.0 x 10⁻⁶) in 250 μL PBS with or without IFA or SAS. 6 (Preparation of live cells expressing membrane-bound HVEM). Finally, on days 59 and 64, mice were intraperitoneally injected with adjuvant-free recombinant human HVEM and human HVEM-transfected Sf9 insect cell lysates or human HVEM-transfected HEK293F cell lysates; each mouse was also injected with 10–20 μg of recombinant human HVEM and human HVEM-transfected Sf9 insect cells or HEK293F cell lysates (both 5.0 x 10⁻⁶) in 250 μL PBS. 6 (Preparation of live cells expressing membrane-bound HVEM). On day 67, using cells initially prepared by... Using the standard hybridoma technique described by Milstein (Nature 1975, 256:495), spleen cells from immunized mice were fused with SP2 / 0-Ag14 myeloma cells (DSMZ). In short, the immunized mice were sacrificed. Spleen cells were picked from the spleen and fused in serum-free medium containing GlutaMax (SF medium; Invitrogen). Washing in SF medium. Logarithmically grown SP2 / 0-Ag14 myeloma cells were washed in SF medium and added to spleen cells to produce a 5:1 spleen-to-myeloma cell ratio. Cells were then pelleted and the supernatant was removed. 1 ml of 37% (v / v) polyethylene glycol 4000 (Merck) solution was then added dropwise over 60 seconds, followed by incubation at 37°C for another 60 seconds. Then, 8 ml of SF medium was slowly added with gentle stirring, followed by 5 ml of... I and GlutaMax / 10% (v / v) fetal bovine serum (FCS; Bodinco). After 30 minutes at room temperature (RT), the cells were pelleted in a solution containing GlutaMax / 10% FCS. Washing in section I to remove residual polyethylene glycol, and finally with 0.1x10 6 A concentration of 200 μL / well was seeded on aminopterin selective medium (i.e., 1 cell / 200 μL / well). I, which contains 50x Hybri-Max TMThe medium was prepared with aminopterin (a de novo DNA synthesis inhibitor; Sigma-Aldrich) in GlutaMax / 10% FCS. Starting from day 7, the aminopterin selection medium was refilled every 2-3 days, and on days 13-14, the aminopterin selection medium was replaced with opti-MEM I containing GlutaMax / 10% FCS.
[0141] (c) Screening for mouse anti-human HVEM monoclonal antibodies
[0142] Starting on day 13 post-fusion, ELISA was used to screen for mouse anti-human HVEM antibodies (i.e., "high affinity" IgG, as opposed to "low affinity" IgM) in the supernatant of growing hybridomas using soluble recombinant C-terminal polyhistidine-labeled human HVEM (rhuHVEM; Sino Biological) as the target protein. For this purpose, rhuHVEM was coated onto PBS (50 ng / 50 μL / well) at 1 μg / mL using a half-area flat-bottom 96-well EIA plate (Corning) over a period of 16–24 hours at 4–8°C. After thorough washing with PBS / 0.05% w / v, Tween 20, the plate was blocked at RT for 1 hour with PBS / 0.05% Tween 20 / 1% w / v, bovine serum albumin (BSA; Roche). Subsequently, the plate was incubated with 50 μL of undiluted hybridoma supernatant / well at RT for 1 hour. After thorough washing in PBS / 0.05% Tween 20, antibody binding was measured at RT for 1 hour with a 1:5000 dilution of horseradish peroxidase-conjugated goat anti-mouse IgG Fcγ specific antibody (Jackson Immuno Research), followed by colorimetric detection using a ready-to-use solution of TMB substrate (Ingenium Biotech). After the addition of 1M H2SO4, antibody binding was measured at 450 nm (reference wavelength 655 nm) using a microplate reader (iMark model; BioRad).
[0143] Starting on day 13 post-fusion, cell-based ELISA targeting membrane-bound human HVEM was used to screen for and confirm the production of mouse anti-human HVEM antibodies (i.e., "high-affinity" IgG, as opposed to "low-affinity" IgM) from the supernatant of growing hybridomas. For this purpose, half-area flat-bottom 96-well EIA plates (Corning) were used at 4–8°C over a period of 16–24 hours, at 2 x 10⁻⁶ ppm. 6 Stable human full-length HVEM-transfected HEK293F cells (clone 128; see Example 1a above) were coated in PBS (0.1 x 10⁻⁶ live cells / mL). 650 μL / well (live cells / well). Parallel runs of untransfected (i.e., negative for membrane-bound human HVEM expression) wild-type (WT) HEK293F-coated cells served as negative controls. After thorough washing with PBS / 0.05% w / v, Tween 20, plates were blocked at RT for 1 h with PBS / 0.05% Tween 20 / 1% w / v, BSA (Roche). Subsequently, plates were incubated with 50 μL / well of undiluted hybridoma supernatant at RT for 1 h. After thorough washing with PBS / 0.05% Tween 20, antibody binding was measured at RT for 1 h with 1:5000 diluted horseradish peroxidase-conjugated goat anti-mouse IgG Fcγ specific antibody (Jackson Immuno Research), followed by colorimetric detection with a ready-to-use solution of TMB substrate (Ingenium). After adding 1M H2SO4, antibody binding was measured at a wavelength of 450nm (reference wavelength 655nm) using a microplate reader (iMark model; BioRad).
[0144] Starting from day 13 post-fusion, FACS, targeting membrane-bound human HVEM, was used to screen for and confirm the production of mouse anti-human HVEM antibodies (i.e., "high-affinity" IgG, as opposed to "low-affinity" IgM) from the supernatant of growing hybridomas. For this purpose, 10 x 10⁻⁶ antibodies were developed at 4°C. 6 Stable full-length human HVEM-transfected HEK293F cells (clone 128; see Example 1a above) were placed in ice-cold phosphate-buffered saline containing 0.1% BSA (Sigma) / 0.05% NaN3 (PBS / BSA / NaN3) supplemented with 50 μg / mL human IgG (blocking potential Fcγ receptor; Sigma). Then, 10 μL / tube (i.e., 0.1 x 10⁻⁶ cells / mL) was transferred to each tube. 6 These cells (number of cells) were incubated with 100 μL of undiluted hybridoma supernatant / tube at 4°C for 30 min. Parallel runs of untransfected (i.e., membrane-bound human HVEM expression negative) WT HEK293F cells were used as a negative control to determine antibody specificity. After thorough washing in PBS / BSA / NaN3, cells were then incubated at 4°C for 30 min with 1:200 diluted PE-conjugated goat anti-mouse IgG Fcγ specific antibody (Jackson Immuno Research). After thorough washing in PBS / BSA / NaN3, cells were fixed in 2% formaldehyde in PBS / BSA / NaN3 at 4°C for 30 min. Antibody binding was measured using a flow cytometer (model FACSCalibur; BD Biosciences).
[0145] Triple HVEM-positive (i.e., rhuHVEM+ in ELISA, membrane HVEM+ HEK293F cells in ELISA, and membrane HVEM+ HEK293F cells in FACS) hybridomas were expanded and cryopreserved. Supernatants from these triple HVEM-positive hybridomas showed no reactivity with untransfected (i.e., membrane-bound human HVEM expression negative) WT HEK293F cells. This method generated 18 hybridomas producing anti-human HVEM-specific antibodies. Mouse antibodies were purified from the supernatants of these anti-human HVEM-specific antibodies using a Protein G column (GE Healthcare). IsoStrip was used. TM Mouse monoclonal antibody isotyping kits (Roche) were used to classify heavy and light chains into isotypes. Subsequently, as described in Example 2, the supernatants and / or purified antibodies from these hybridomas producing anti-human HVEM-specific antibodies were tested for their effects on human HVEM ligands (i.e., human BTLA and human LIGHT) binding to membrane-bound human HVEM, their binding to membrane-bound human HVEM lacking the cysteine-rich domain 1 (CRD1), and their cross-reactivity with membrane-bound cynomolgus monkey HVEM. Additionally, as described in Example 3, the purified antibodies selected from these hybridomas producing anti-human HVEM-specific antibodies were tested for their inhibitory effects on NFκB signaling in cells expressing membrane-bound human HVEM, NFκB signaling induced by soluble human LIGHT in cells expressing membrane-bound human HVEM, and TCR-induced NFAT signaling in cells expressing membrane-bound human BTLA / human HVEM.
[0146] Example 2. Flow cytometry characterization of mouse anti-human HVEM monoclonal antibody
[0147] (a) Binding of mouse anti-human HVEM antibody to membrane-bound full-length human HVEM and membrane-bound human HVEM lacking CRD1.
[0148] To analyze the good specificity of mouse anti-human HVEM antibodies, the locations of one or more epitopes recognized by the generated mouse anti-human HVEM antibodies were determined by domain mapping. The ability of mouse anti-human HVEM antibodies to bind to truncated human HVEM expressed on the surface of (HEK-derived) 293F cells was determined by FACS analysis.
[0149] Based on the literature (Swiss-Prot Q92956.3; Montgomery et al., Cell 1996; 87:427-436; Hsu et al., J Biochem Chem 1997; 272:13471-13474; Naismith et al., Trends Biochem Sci 1998; 23:74-79; Carfi et al., Molecul Cell 2001; 8:169-179; Bodmer et al., Trends Biochem Sci 2002; 27:19-26; Compaan et al., J Biochem Chem 2005; 280:39553-39561), cysteine-rich domains (CRDs) in the extracellular region of human HVEM were identified and encoded as CRD1, CRD2, CRD3, and (truncated) CRD4. The CRDs contain topologically different modules, referred to as modules A and B. Module A is a C-type structure, and module B is an S-type structure. A typical CRD is usually composed of an A1-B2 module or an A2-B1 module (or, less commonly, a different pair of modules, such as A1-B1) with 6 conserved cysteine residues, where the numbers indicate the number of disulfide bonds within each module. Human HVEM-CRD1 contains A1-B2-modules (42-75, see SEQ ID NO.1), human HVEM-CRD2 contains A1-B2-modules (78-119, see SEQ ID NO.1), human HVEM-CRD3 contains an A2-module and an atypical (reminiscent of the B1-module) B0-module (121-162, see SEQ ID NO.1), and the truncated human HVEM-CRD4 contains only the A1-module (165-179, see SEQ ID NO.1). Two distinct human HVEM constructs were generated and expressed: (1) a full-length human HVEM construct that begins at the N-terminus CRD1 (i.e., the CRD1 A1-B2 module covers amino acids 42-75, see SEQ ID NO.1), and is therefore referred to as “full-length,” containing amino acids 1-283 (see SEQ ID NO.1), and (2) a “CRD1 truncated” construct that begins at the N-terminus CRD2 (i.e., the CRD2 A1-B2 module covers amino acids 22-63, see SEQ ID NO.3), and containing amino acids 20-227 linked to mouse Ig signal peptide amino acids 1-19 (see SEQ ID NO.3). The cDNA encoding the truncated human HVEM protein (Swiss-Prot Q92956.3) was optimized for mammalian expression and synthesized by GENEART in Regensburg, Germany (see SEQ ID NO.4). This cDNA was subcloned into a pcDNA3.1-derived expression plasmid.
[0150] Example 1a describes the generation of HEK293F cells (clone 128) transfected with human “full-length” HVEM. FreeStyle™ 293F cells (Ingenieur) were transiently transfected with a “CRD1 truncated” variant of human HVEM using the FreeStyle™ 293 expression system (Ingenieur). Surface human HVEM expression on transfected cells was analyzed by FACS analysis after 72 hours. For this purpose, the expression was measured at 10 x 10⁻⁶ cells / cell at 4°C. 6 Stable HEK293F cells transfected with full-length human HVEM and transient HEK293F cells transfected with truncated human “CRD1” HVEM were placed in ice-cold phosphate-buffered saline containing 0.1% BSA (Sigma) / 0.05% NaN3 (PBS / BSA / NaN3) supplemented with 50 μg / mL human IgG (blocking potential Fcγ receptor; Sigma). Then, 10 μL / tube (i.e., 0.1 x 10⁻⁶ cells / mL) was transferred to each tube. 6 These cells (number of cells) were incubated with 100 μL of undiluted hybridoma supernatant per tube at 4°C for 30 min. A 1:20 dilution of phycoerythrin (PE)-conjugated mouse anti-human HVEM antibody (clone eBioHVEM-122; eBioscience) was used as a positive control antibody. After thorough washing in PBS / BSA / NaN3, the cells were then incubated at 4°C for 30 min with a 1:200 dilution of PE-conjugated goat anti-mouse IgG Fcγ-specific antibody (Jackson Immuno Research). After thorough washing in PBS / BSA / NaN3, the cells were fixed in 2% formaldehyde in PBS / BSA / NaN3 at 4°C for 30 min. Antibody binding was measured using a flow cytometer (model FACSCalibur; BD Biosciences).
[0151] like Figure 1 As shown, all 18 examined mouse anti-human HVEM antibodies recognized full-length human HVEM on transfected HEK293F cells, while the majority (15 / 18) of these mouse anti-human HVEM antibodies did not show binding to “CRD1-truncated” human HVEM on transfected HEK293F cells. In contrast, mouse anti-human HVEM antibodies numbered 38G10, 39B9, and 47E10 recognized “CRD1-truncated” human HVEM on transfected HEK293F cells.
[0152] These results indicate that mouse anti-human HVEM antibodies numbered 38G10, 39B9, and 47E10 appear to recognize linear and / or nonlinear / conformal epitopes in the CRD2, CRD3, CRD4, and / or “connector” fragments (aa sequences 124-146, see SEQ ID NO.3) of the human HVEM extracellular domain, while all other generated mouse anti-human HVEM antibodies (15 / 18) appear to recognize linear and / or nonlinear / conformal epitopes in the CRD1 of the human HVEM extracellular domain.
[0153] (b) Binding of mouse anti-human HVEM antibody to membrane-bound cynomolgus monkey HVEM
[0154] To analyze the multi-species cross-reactivity of mouse anti-human HVEM antibodies, the ability of mouse anti-human HVEM antibodies to bind to cynomolgus monkey HVEM expressed on the surface of (HEK-derived) 293F cells was determined by FACS analysis.
[0155] The cDNA encoding the cynomolgus monkey HVEM protein (see SEQ ID NO. 5; NCBI reference sequence XP_005545061.1) was optimized for mammalian expression and synthesized by GENEART in Regensburg, Germany (see SEQ ID NO. 6). This cDNA was subcloned into a pcDNA3.1-derived expression plasmid.
[0156] Example 1a describes the generation of HEK293F cells (clone 128) transfected with human "full-length" HVEM. FreeStyle was used. TM 293 Expression System (Ingenie), using cynomolgus monkey (full-length) HVEM transiently transfected FreeStyle TM 293F cells (Ingenie Biotech). Surface HVEM expression on transfected cells was analyzed by FACS analysis after 72 hours. For this purpose, the expression was measured at 10 x 10⁻⁶ cells / cell at 4°C. 6 Stable HEK293F cells transfected with full-length human HVEM and transiently transfected HEK293F cells transfected with full-length cynomolgus monkey HVEM were placed in ice-cold phosphate-buffered saline containing 0.1% BSA (Sigma) / 0.05% NaN3 (PBS / BSA / NaN3) supplemented with 50 μg / mL human IgG (blocking potential Fcγ receptor; Sigma). Then, 10 μL / tube (i.e., 0.1 x 10⁻⁶ cells / mL) was transferred to each tube. 6These cells (number of cells) were incubated with 100 μL of undiluted hybridoma supernatant per tube at 4°C for 30 min. A 1:20 dilution of phycoerythrin (PE)-conjugated mouse anti-human HVEM antibody (clone eBioHVEM-122; eBioscience) was used as a positive control antibody. After thorough washing in PBS / BSA / NaN3, the cells were then incubated at 4°C for 30 min with a 1:200 dilution of PE-conjugated goat anti-mouse IgG Fcγ-specific antibody (Jackson Immuno Research). After thorough washing in PBS / BSA / NaN3, the cells were fixed in 2% formaldehyde in PBS / BSA / NaN3 at 4°C for 30 min. Antibody binding was measured using a flow cytometer (model FACSCalibur; BD Biosciences).
[0157] like Figure 1 As shown, all 18 mouse anti-human HVEM antibodies examined recognized full-length human HVEM on transfected HEK293F cells, and most (14 / 18) of these mouse anti-human HVEM antibodies showed cross-reactivity (to varying degrees) with full-length cynomolgus monkey HVEM on transfected HEK293F cells. In contrast, mouse anti-human HVEM antibodies numbered 36H12, 37D11, 41F11, and 49A11 did not recognize full-length cynomolgus monkey HVEM on transfected HEK293F cells.
[0158] These results indicate that most (14 / 18) of the generated mouse anti-human HVEM antibodies appear to recognize linear and / or nonlinear / conformal epitopes in the CRD1, CRD2, CRD3, CRD4 and / or “connector” fragments (aa sequences 180-203, see SEQ ID NO. 5) of the full-length HVEM extracellular domain of cynomolgus monkeys.
[0159] The predicted amino acid sequence of the full-length cynomolgus monkey HVEM protein (Met1–Ser280; NCBI reference sequence: XP_005545061.1) showed 82% homology with the human HVEM protein (Met1–His283; Swiss-Prot No. Q92956.3), and the predicted amino acid sequence of the extracellular region of the cynomolgus monkey HVEM (i.e., Leu39–Val203; NCBI reference sequence: XP_005545061.1) showed 87% homology with the extracellular region of the human HVEM protein (i.e., Leu39–Val202; Swiss-Prot No. Q92956.3). These results indicate that most (14 / 18) of the generated mouse anti-human HVEM monoclonal antibodies cross-react with homologous cynomolgus monkey HVEM on transfected HEK293F cells.
[0160] (c) Effects of mouse anti-human HVEM antibody on membrane-bound human BTLA and human light binding to human HVEM
[0161] Extracellular HVEMs possess two spatial ligand-binding regions (Cai et al. Immunol Rev 2009; 229:244-258; Steinberg et al. Immunol Rev 2011; 244:169-187; Pasero et al. Curr Opin Pharmacol 2012; 12:478-485). One region is used for typical ligands belonging to the TNF superfamily (i.e., LIGHT and TNFβ), and the other region is used for atypical ligands belonging to the Ig superfamily (i.e., BTLA and CD160). Mutational analysis and molecular modeling revealed that BTLA and CD160 interact with CRD1, while LIGHT and TNFβ binding is located in CRD2 and CRD3 opposite the HVEM.
[0162] To analyze the effect of mouse anti-human HVEM antibody on the binding of human BTLA and human LIGHT to membrane-bound human HVEM, FACS analysis was used to determine the ability of mouse anti-human HVEM antibody to spatially inhibit the interaction of human BTLA and human LIGHT on the full-length human HVEM expressed on the surface of (HEK-derived) 293F cells.
[0163] Example 1a describes the generation of HEK293F cells (clone 128) transfected with human "full-length" HVEM. The binding of soluble human BTLA, soluble human CD160, and soluble human LIGHT to the surface of the human HVEM-transfected cells was analyzed by FACS. For this purpose, the binding was measured at 10 x 10⁻⁶ at 4°C. 6 Stable, full-length human HVEM-transfected HEK293F cells were placed in ice-cold phosphate-buffered saline (PBS / BSA / NaN3) for 10 min, supplemented with 50 μg / mL human IgG (blocking potential Fcγ receptor; Sigma). Then, 10 μL / tube (i.e., 0.1 x 10⁻⁶ cells / mL) was transferred to each tube. 6These cells (number of cells) were incubated with or without 100 μL of purified mouse anti-HVEM antibody (10 μg / mL / tube) or negative control mouse IgG1 (BD Biosciences) at 4°C for 30 min. After this (i.e., without washing), the cells were then incubated at 4°C with 1 μg / mL soluble human BTLA-human Fcγ fusion protein (Sino Biological) or 0.1 μg / mL soluble his-labeled human LIGHT (R&D Systems) in PBS / BSA / NaN3 for 30 min. After thorough washing in PBS / BSA / NaN3, the cells were incubated at 4°C with 10 μg / mL biotinylated mouse anti-human IgG Fcγ-specific antibody (detecting BTLA; Southern Biotech) or 5 μg / mL biotinylated mouse anti-his antibody (detecting LIGHT; R&D Systems) for 30 min. After thorough washing in PBS / BSA / NaN3, cells were incubated at 4°C for 30 min with PE-conjugated streptavidin (Jackson ImmunoResearch). After further washing in PBS / BSA / NaN3, cells were fixed at 4°C in 2% formaldehyde in PBS / BSA / NaN3 for 30 min. The binding of ligands BTLA and LIGHT to human HVEM membranes was measured using a flow cytometer (FACSCalibur; BD Biosciences).
[0164] As shown in Figure 2 and Table 1, four types of mouse anti-human HVEM antibodies were identified: (Type 1 antibody; 6 / 18) does not block BTLA / HVEM and LIGHT / HVEM interactions, (Type 2 antibody; 3 / 18) blocks BTLA / HVEM interactions and does not block LIGHT / HVEM interactions, (Type 3 antibody; 4 / 18) does not block BTLA / HVEM interactions and blocks LIGHT / HVEM interactions, and (Type 4 antibody; 5 / 18) blocks BTLA / HVEM and LIGHT / HVEM interactions.
[0165] Table 1. Summary of the blocking effects of mouse anti-human HVEM antibodies on soluble human BTLA (sBTLA) ligand, soluble human CD160 (sCD160) and soluble human LIGHT (sLIGHT) ligand that bind to human HVEM membrane receptor (mHVEM).
[0166]
[0167]
[0168] - = No blocking of ligand-receptor interaction (-* = Enhanced binding of ligand to human HVEM), + = Weak blocking of ligand-receptor interaction, ++ = Moderate blocking of ligand-receptor interaction, +++ = Strong blocking of ligand-receptor interaction; the last column binds to CRD1 truncated human HVEM. All antibodies bind to full-length human HVEM.
[0169] These results demonstrate the production of a diverse group of mouse anti-human HVEM antibodies with both human ligand blocking and ligand non-blocking characteristics (i.e., mouse anti-human HVEM antibodies of types 1–4 (see above)). Notably, antibodies binding to CRD1-like ligands (36H12, 45H6) may or may not (52D3) block the binding of sBTLA or sCD160. The CRD1 antibody 52D3 does indeed appear to enhance the binding of one or more ligands. Furthermore, it clearly demonstrates the distinct functional activities of CRD1-targeting antibodies.
[0170] Example 3. Biological characterization of mouse anti-human HVEM monoclonal antibody
[0171] (a) Effect of mouse anti-human HVEM antibody on NFκB signaling in cells expressing human HVEM membranes
[0172] HVEM signaling can induce NFκB activation in various HVEM-expressing cells of the immune system, such as T and B lymphocytes and dendritic cells, thereby activating several genes important for their cellular function. Linking HVEM to T lymphocytes via LIGHT provides a positive co-stimulatory signal, leading to T lymphocyte survival, proliferation, differentiation, and IFNγ secretion (Del Rio et al., Journal of Leukocyte Biology 2010; 87:223-235). Linking HVEM to B lymphocytes via LIGHT co-stimulates CD40L-mediated proliferation and antibody secretion, thereby enhancing humoral responses (Del Rio et al., Journal of Leukocyte Biology 2010; 87:223-235). By linking HVEM to immature dendritic cells with LIGHT, co-stimulation was achieved to induce CD40L-mediated maturation, cytokine secretion (IL-12, IL-6, and TNF-α), and the initiation of specific antitumor CTLs and the production of IFN-γ (Del Rio et al., Journal Leukocyte Biology 2010; 87:223-235).
[0173] To analyze the effect of mouse anti-human HVEM antibody on membrane-bound human HVEM-mediated NFκB signaling, NFκB response element-luciferase (RE-luc) human HVEM bioassay reporter cells (HEK293; Promega) were used to examine the ability of mouse anti-human HVEM antibody to activate HVEM-mediated NFκB signaling.
[0174] In summary, NFκB-RE-luc cells expressing human HVEM were seeded at 35,000 cells / well in flat-bottomed TC-treated white solid 96-well plates (Corning Electron) and incubated overnight at 37°C / 5% CO2. The next day, these cells were washed and subsequently incubated with or without 0.0015–10 μg / mL (3-fold dilution) of mouse anti-human HVEM antibody. Parallel titrations (i.e., 0, 0.0015–10 μg / mL (3-fold dilution)) of soluble his-labeled human LIGHT (R&D Systems) were run for reference purposes. After 6 hours of incubation at 37°C / 5% CO2, the cells were analyzed using a Bio-Globe spectrophotometer. TM The luciferase assay system (Promega) measures luciferase production in NFκB-NFκB-RE-luc cells expressing human HVEM.
[0175] like Figure 3A As shown in Table 2, several examined (7 / 12) mouse anti-human HVEM antibodies induced dose-dependent NFκB activation (i.e., compared to NFκB induction mediated by soluble LIGHT) to varying degrees (ranked in order; 48H6>36H12>29C2>8H5=45H6=49G4>52D3) in NFκB-RE-luc cells expressing human HVEM, demonstrating their agonistic activity. In these NFκB-RE-luc cells expressing human HVEM, the control soluble human LIGHT also showed dose-dependent NFκB activation. In contrast, mouse anti-human HVEM antibodies 11H7, 41F11, 43E10, 47E10, and 49A11 did not show agonistic activity (i.e., compared to NFκB induction mediated by soluble LIGHT) in NFκB-RE-luc cells expressing human HVEM. Interestingly, there appears to be a relationship between the ability of these examined mouse anti-human HVEM antibodies to spatially block the interaction of soluble human LIGHT / human HVEM (see Example 2c) and their agonistic activity (i.e., NFκB induction) on cells expressing membrane human HVEM (see Table 2).
[0176] Table 2. The blocking effect of mouse anti-human HVEM antibodies on soluble human LIGHT (sLIGHT) ligands that bind to the human HVEM membrane receptor (mHVEM; see Example 2c) and their relationship to their agonistic activity on cells expressing membrane human HVEM (i.e., compared to sLIGHT-mediated NFκB induction).
[0177]
[0178] - = No blockage of LIGHT / HVEM interaction or agonist activity; + = Weak blockage of LIGHT / HVEM interaction or agonist activity; ++ = Moderate blockage of LIGHT / HVEM interaction or agonist activity; +++ = Strong blockage of LIGHT / HVEM interaction or agonist activity.
[0179] These results demonstrate that mouse anti-human HVEM antibodies that block the human LIGHT / human HVEM interaction (see Example 2c) can mimic soluble human LIGHT / human HVEM-mediated NKκB signaling. Notably, soluble human LIGHT has been shown to be far less effective than cells expressing membrane-bound LIGHT for activating human HVEM expressed on cells (Cheung et al., PNAS 2009; 106:6244-6249).
[0180] (b) Effect of mouse anti-human HVEM antibody on soluble human light-induced NFκB signaling in cells expressing membrane-bound human HVEM.
[0181] To analyze the effect of mouse anti-human HVEM antibody on soluble human LIGHT-induced NFκB signaling in cells expressing membrane human HVEM, NFκB-RE-luc human HVEM bioassay reporter cells (HEK293; Promega) were used to examine the ability of mouse anti-human HVEM antibody to interfere with (e.g., blockade, additive, or co-effect) soluble LIGHT / membrane HVEM-mediated NFκB signaling.
[0182] In short, NFκB-RE-luc cells expressing human HVEM were seeded at 35,000 cells / well in flat-bottomed TC-treated white solid 96-well plates (Corning) and incubated overnight at 37°C / 5% CO2. The next day, these cells were washed and subsequently incubated with or without 0.0015–10 μg / mL (3-fold dilution) mouse anti-human HVEM antibody and 0.3 μg / mL soluble his-labeled human LIGHT (R&D Systems, Inc.) (EC80; see Example 2a and 2b). Figure 3A After incubation at 37°C / 5% CO2 for 6 hours, the sample was analyzed using a Bio-Globe spectrophotometer. TMThe luciferase assay system (Promega) measures luciferase production in NFκB-NFκB-RE-luc cells expressing human HVEM.
[0183] like Figure 3B As shown in Table 3, the very weak agonist but moderate LIGHT / HVEM interaction blocker (see Table 2), mouse anti-human HVEM antibody number 52D3, weakly but dose-dependently inhibited soluble human LIGHT-mediated NFκB activation in NFκB-RE-luc cells expressing human HVEM. Surprisingly, the non-agonist and non-blocker of LIGHT / HVEM interaction (see Table 2), mouse anti-human HVEM antibody number 49A11, also weakly but dose-dependently inhibited soluble human LIGHT-mediated NFκB activation in NFκB-RE-luc cells expressing human HVEM. In addition, non-agonist and LIGHT / HVEM interaction non-blocker mouse anti-human HVEM antibodies numbered 11H7, 41F11, 43E10, and 47E10 showed no effect on soluble human LIGHT-mediated NFκB activation in human HVEM-expressing NFκB-RE-luc cells, while weak / moderate / strong agonist and weak / moderate / strong LIGHT / HVEM interaction blocker mouse anti-human HVEM antibodies numbered 8H5, 29C2, 36H12, 45H6, 48H6, and 49G4 showed possible additive effects but no synergistic effects on soluble human LIGHT-mediated NFκB activation in human HVEM-expressing NFκB-RE-luc cells.
[0184] Table 3. Summary of the effects of mouse anti-human HVEM antibodies on soluble human LIGHT (sLIGHT) ligands that bind to the human HVEM membrane receptor (mHVEM; see Example 2c) and their effects on soluble human LIGHT-induced agonistic activity (i.e., NFκB-induced activity) on cells expressing membrane human HVEM.
[0185]
[0186] - = No blockage of LIGHT / HVEM interaction or LIGHT-induced agonistic activity; + = Weak blockage of LIGHT / HVEM interaction or LIGHT-induced agonistic activity; ++ = Moderate blockage of LIGHT / HVEM interaction or LIGHT-induced agonistic activity; ++++ = Strong blockage of LIGHT / HVEM interaction or LIGHT-induced agonistic activity; * = Agonistaltic effect of LIGHT and / or mouse anti-human HVEM antibody.
[0187] These results indicate that mouse anti-human HVEM antibodies that block human LIGHT / human HVEM interaction (except for LIGHT / HVEM interaction non-blocking mouse anti-human HVEM antibody number 49A11; see also Example 2c) can block or mimic soluble human LIGHT / human HVEM-mediated NKκB signaling.
[0188] (c) Effect of mouse anti-human HVEM antibody on the inhibition of TCR-induced NFAT signaling mediated by human BTLA / human HVEM in T cells expressing human BTLA / human TCR.
[0189] As described above, HVEM is attached to T lymphocytes via LIGHT to deliver positive co-stimulatory signals, while BTLA is attached to T lymphocytes via HVEM to provide negative co-inhibitory signals (DelRio et al., Journal of Leukocyte Biology 2010; 87:223-235). This BTLA / HVEM pathway downregulates TCR-mediated signaling in both CD4 and CD8 T lymphocytes, leading to reduced T lymphocyte proliferation and cytokine production. Attaching BTLA to B lymphocytes via HVEM reduces the activation of downstream signaling molecules of the BCR and attenuates B cell proliferation (Vendel et al., Journal of Immunology 2009; 182:1509-1517). Unlike PD-1 and CTLA4, BTLA is not expressed on regulatory T (Treg) lymphocytes (Del Rio et al., Journal of Leukocyte Biology 2010; 87:223-235).
[0190] To analyze the inhibitory effect of mouse anti-human HVEM antibody on membrane-human TCR-induced NFAT signaling mediated by membrane-human BTLA / membrane-human HVEM, the NFAT response element-luciferase (RE-luc) human BTLA / HVEM blocking bioassay (a combination of (1) CHO-K1 activated cells (artificial antigen-presenting cells) expressing membrane-human HVEM and proprietary membrane-human TCR activators, and (2) NFAT-RE-luc Jurkat effector T cells (Promega) expressing membrane-human BTLA and membrane-human TCR) was used to examine the ability of mouse anti-human HVEM antibody to block the inhibition of TCR-induced NFAT signaling mediated by BTLA / HVEM.
[0191] In this BTLA / HVEM blocking bioassay, NFAT-RE-lucJurkat effector T cells expressing human membrane BTLA and human membrane TCR were used as effector cells, and CHO-K1 activated cells expressing human membrane HVEM and a proprietary human membrane TCR activator were used as artificial antigen-presenting cells. When these two cell types were co-cultured, the TCR complex on the effector cells was activated by the artificial antigen-presenting cells expressing the TCR activator, leading to the expression of the NFAT luciferase reporter. However, the BTLA and HVEM linkage prevented TCR activation and inhibited NFAT-reactive luciferase activity. This inhibition could be specifically reversed by exposure to a blocking anti-HVEM antibody. Neutralizing the anti-HVEM antibody blocked the BTLA / HVEM interaction and promoted T cell activation (i.e., “releasing the brakes”), leading to the reactivation of the NFAT-reactive luciferase reporter (see [link to relevant documentation]). Figure 4A ).
[0192] In summary, CHO-K1 activated cells expressing human HVEM and the proprietary TCR activator were seeded at 40,000 cells / well in flat-bottomed, TC-treated white solid 96-well plates (Corning) and incubated overnight at 37°C / 5% CO2. The next day, these cells were washed and subsequently incubated with or without 0.0015–10 μg / mL (3-fold dilution) mouse anti-human HVEM antibody. Then, NFAT-RE-luc Jurkat effector T cells expressing human BTLA and human TCR were added at 50,000 cells / well. After incubation at 37°C / 5% CO2 for 6 hours, the cells were analyzed using a Bio-Globe spectrophotometer. TM The luciferase assay system (Promega) measures luciferase production in NFAT-RE-luc Jurkat effector T cells expressing human BTLA and human TCR.
[0193] like Figure 4BAs shown in Table 4, several examined (8 / 12) mouse anti-human HVEM antibodies dose-dependently blocked the BTLA / HVEM-mediated inhibition of TCR-induced NFAT signaling in NFAT-RE-luc Jurkat effector T cells expressing human BTLA and human TCR to varying degrees (ranked in order; number 45H6>49G4>36H12>11H7>8H5=41F11=48H6=49A11). In contrast, mouse anti-human HVEM antibodies numbered 29C2, 43E10, 47E10, and 52D3 showed no effect on the BTLA / HVEM-mediated inhibition of TCR-induced NFAT signaling in NFAT-RE-luc Jurkat effector T cells expressing human BTLA and human TCR. Interestingly, in the NFAT-RE-luc human BTLA / HVEM blocking bioassay, there appears to be a relationship between the ability of these examined mouse anti-human HVEM antibodies to spatially block soluble human BTLA / human HVEM interactions (see Example 2c) and their blocking ability (i.e., the cancellation of TCR-induced BTLA / HVEM-mediated inhibition of NFAT signaling) (see Table 4).
[0194] Table 4. Relationship between the blocking effect of mouse anti-human HVEM antibodies on soluble human BTLA (sBTLA) ligands that bind to human HVEM membrane receptor (mHVEM; see Example 2c) and their blocking effect on the inhibition of membrane-human BTLA / membrane-human HVEM-induced (mBTLA / mHVEM) of TCR-induced NFAT signaling in effector T cells expressing membrane-human BTLA / TCR.
[0195]
[0196] - = No blockage of BTLA / HVEM interaction or BTLA / HVEM-induced TCR-NFAT inhibition; + = Weak blockage of BTLA / HVEM interaction or BTLA / HVEM-induced TCR-NFAT inhibition; ++ = Moderate blockage of BTLA / HVEM interaction or BTLA / HVEM-induced TCR-NFAT inhibition; +++ = Strong blockage of BTLA / HVEM interaction or BTLA / HVEM-induced TCR-NFAT inhibition; * = Enhances the binding of BTLA to human HVEM.
[0197] These results indicate that mouse anti-human HVEM antibodies that block human BTLA / human HVEM interaction (see Example 2c) can block human BTLA / human HVEM-mediated inhibition of TCR-induced NFAT signaling.
[0198] Example 4: Molecular genetic characteristics of BTLA / HVEM blocking mouse anti-human HVEM monoclonal antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4
[0199] Hybridoma cells that produced BTLA / HVEM blocking mouse anti-human HVEM antibodies (numbered 36H12, 45H6, 48H6, 11H7, and 49G4) were washed with PBS and aliquoted into 5 x 10⁻⁶ cells / mL. 6 Cells were collected in microtubules and stored as a precipitate at -80°C. These cell precipitates were used to isolate RNA using the RNeasy Mini Isolation Kit (QIAGEN). RNA concentration was measured (A260 nm), and the RNA was stored at -80°C. RNA was then isolated using RevertAid reverse transcriptase. TM The H MinusFirst Strand cDNA Synthesis Kit (Fermentas) synthesized cDNA from 1 μg of RNA and stored it at -80°C. Primers, as shown in Table 5, were designed based on isotype mouse IgG1 / κ to amplify the variable (V) regions of BTLA / HVEM-blocking mouse anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4.
[0200] Table 5. PCR primers for amplifying the cDNA of BTLA / HVEM blocking mouse anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4.
[0201]
[0202]
[0203] s = meaningful; as = antisense; VL = variable light chain region; VH = variable heavy chain region; Ck = constant mouse kappa (κ) light chain region; CH = constant mouse IgG1 heavy chain region; *numbered according to the Bioceros BV internal coding system; degenerate primers: K = G or T, S = G or C, R = A or G, M = A or C, W = A or T, Y = C or T, H = A or C or T, and N = any base.
[0204] Primers 383, 387, and 389 are sense primers designed for annealing to the signal peptide of the mouse antibody light chain; primer 394 is an antisense primer designed for annealing to the constant region of the mouse κ light chain. Primers 404, 407, 408, and 409 are sense primers designed for annealing to the signal peptide of the mouse antibody heavy chain; primer 416 is an antisense primer designed for annealing to the constant region of the mouse IgG1 heavy chain. Various PCRs were performed using the primer combinations shown in Table 5. The resulting PCR products were subcloned into pCR.TM -Blunt The cloned insert was then sequenced.
[0205] From heavy chain and light chain sequence reactions, a total of 8 and 4 informative amino acid sequences of mouse anti-human HVEM antibody 36H12 were obtained, respectively. Based on this information, the common amino acid sequences of the VH and VL regions of mouse anti-human HVEM antibody 36H12 were determined and are listed in SEQ ID NO. 16 and 17, respectively. The amino acid sequences of the CDRs of the VH and VL regions of mouse anti-human HVEM antibody 36H12 are listed in SEQ ID NO. 18-20 and 21-23, respectively.
[0206] By analyzing the heavy and light chain sequences, a total of four informative sequences of mouse anti-human HVEM antibody 45H6 were obtained. Based on this information, the common amino acid sequences of the VH and VL regions of mouse anti-human HVEM antibody 45H6 were determined and are listed in SEQ ID NO. 24 and 25, respectively. The amino acid sequences of the CDRs of the VH and VL regions of mouse anti-human HVEM antibody 45H6 are listed in SEQ ID NO. 26-28 and 29-31, respectively.
[0207] Five and four informative sequences of mouse anti-human HVEM antibody 48H6 were obtained from heavy chain and light chain sequence reactions, respectively. Based on this information, the common amino acid sequences of the VH and VL regions of mouse anti-human HVEM antibody 48H6 were determined and are listed in SEQ ID NO. 32 and 33, respectively. The amino acid sequences of the CDRs of the VH and VL regions of mouse anti-human HVEM antibody 48H6 are listed in SEQ ID NO. 34-36 and 37-39, respectively.
[0208] From heavy chain and light chain sequence reactions, a total of 9 and 3 informative sequences of mouse anti-human HVEM antibody 11H7 were obtained, respectively. Based on this information, the common amino acid sequences of the VH and VL regions of mouse anti-human HVEM antibody 11H7 were determined and are listed in SEQ ID NO. 40 and 41, respectively. The amino acid sequences of the CDRs of the VH and VL regions of mouse anti-human HVEM antibody 11H7 are listed in SEQ ID NO. 42-44 and 45-47, respectively.
[0209] Five and three informative sequences of mouse anti-human HVEM antibody 49G4 were obtained from heavy chain and light chain sequence reactions, respectively. Based on this information, the common amino acid sequences of the VH and VL regions of mouse anti-human HVEM antibody 49G4 were determined and are listed in SEQ ID NO. 48 and 49, respectively. The amino acid sequences of the CDRs of the VH and VL regions of mouse anti-human HVEM antibody 49G4 are listed in SEQ ID NO. 50-52 and 53-55, respectively.
[0210] Example 5. Generation of BTLA / HVEM blocking chimeric mouse / human IgG4 / κ (i.e., exchanging the mouse constant IgG1 / κ region for the human constant IgG4 / κ region) anti-human HVEM monoclonal antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4.
[0211] Based on the assayed BTLA / HVEM blocking of mouse anti-human HVEM antibody in the mouse V region (see Example 4 above), a chimeric mouse / human anti-human HVEM antibody version was designed and generated. For this purpose, for mammalian expression-optimized cDNA sequences, SEQ ID NO. 56 (encoding chimeric mouse / human heavy IgG4 chain 36H12), NO. 57 (encoding chimeric mouse / human heavy IgG4 chain 45H6), NO. 58 (encoding chimeric mouse / human heavy IgG4 chain 48H6), NO. 59 (encoding chimeric mouse / human heavy IgG4 chain 11H7), and NO. 60 (encoding chimeric mouse / human heavy IgG4 chain 49G4) and SEQ ID NO. 60 were ordered from GENEART (Regensburg, Germany). NO.61 (encoding chimeric mouse / human light κ chain 36H12), NO.62 (encoding chimeric mouse / human light κ chain 45H6), NO.63 (encoding chimeric mouse / human light κ chain 48H6), NO.64 (encoding chimeric mouse / human light κ chain 11H7), and NO.65 (encoding chimeric mouse / human light κ chain 49G4) encode a human signal peptide, followed by a mouse VH chain linked to the stable human IgG4 constant region (i.e., S239P; according to Angal et al. in Mol. Immunol., Vol. 30, No. 1, pp. 105-108, 1993), or subsequently a mouse VL chain linked to the human κ constant region. Using a suitable restriction enzyme, the resulting cDNA was subcloned into a pcDNA3.1-derived expression plasmid. Subsequently, FreeStyle was used... TM The chimeric antibodies were transiently expressed in 293-F cells (Ingenieur Biotech) using the 293 expression system. The expressed chimeric anti-human HVEM antibodies were purified from the supernatant using a standard affinity chromatography protein A column. LPS levels were then measured using a LAL colorimetric endpoint assay (Hycult Biotech), and all our purified chimeric mouse / human anti-human HVEM antibodies (i.e., 36H12, 45H6, 48H6, 11H7, and 49G4) contained <0.0005 EULPS / μg chimeric IgG.
[0212] For chimeric amino acid sequences, see SEQ ID NO. 66 (chimeric mouse / human heavy IgG4 chain 36H12), NO. 67 (chimeric mouse / human heavy IgG4 chain 45H6), NO. 68 (chimeric mouse / human heavy IgG4 chain 48H6), NO. 69 (chimeric mouse / human heavy IgG4 chain 11H7), and NO. 70 (chimeric mouse / human heavy IgG4 chain 49G4), and SEQ ID NO. 71 (chimeric mouse / human light κ chain 36H12), NO. 72 (chimeric mouse / human light κ chain 45H6), NO. 73 (chimeric mouse / human light κ chain 48H6), NO. 74 (chimeric mouse / human light κ chain 11H7), and NO. 75 (chimeric mouse / human light κ chain 49G4).
[0213] Example 6. Binding and biological characteristics of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4
[0214] (a) Relative binding affinity of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody to membrane-bound human HVEM.
[0215] To determine the relative binding affinity of purified BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 for human HVEM, FACS analysis was used.
[0216] Therefore, at 4℃ with 10x10 6 HEK293F cells (clone 128; see Example 1(a) above) were transfected with stable full-length human HVEM and placed in ice-cold PBS for 10 minutes. The PBS contained 0.1% BSA (Sigma) / 0.05% NaN3 (PBS / BSA / NaN3) supplemented with 50 μg / mL human IgG (blocking potential Fcγ receptor; Sigma). Then, 10 μL / tube (i.e., 0.1 x 10⁻⁶ cells / mL) was transferred to each tube. 6These cells (number of cells) were incubated with or without 100 μL of purified BTLA / HVEM-blocking chimeric mouse / human anti-human HVEM antibody (in PBS / BSA / NaN3) at 4°C for 30 min. After thorough washing in PBS / BSA / NaN3, the cells were then incubated at 4°C for 30 min with 1:200 diluted PE-conjugated goat anti-human IgG Fcγ specific antibody (Jackson Immuno Research). After thorough washing in PBS / BSA / NaN3, the cells were fixed at 4°C in 4% formaldehyde in PBS / BSA / NaN3 for 30 min. The binding (geometric mean fluorescence intensity) of chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 to human HVEM membranes was measured using flow cytometry (FACSCalibur; BD Biosciences). For comparison, purified BTLA / HVEM blocking mouse anti-human HVEM antibody counterparts numbered 36H12, 45H6, 48H6, 11H7, and 49G4 were run in parallel, and their binding was monitored as described in Example 2(a).
[0217] like Figure 5 As shown, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 bind to membrane-bound human HVEM in a dose-dependent manner. Based on their binding profile, the following relative affinity ranking (from highest to lowest affinity) was found: 45H6 = 49G4 > 36H12 = 48H6 > 11H7. For comparison, their BTLA / HVEM blocking mouse anti-human HVEM antibody counterparts, numbered 36H12, 45H6, 48H6, 11H7, and 49G4, also showed dose-dependent binding to membrane-bound human HVEM and exhibited a very similar relative affinity ranking, i.e., 45H6 = 49G4 > 36H12 = 48H6 > 11H7. More specifically, chimeric mouse / human anti-human HVEM antibodies numbered 45H6, 49G4, 36H12, 48H6, and 11H7 resulted in relative affinities (i.e., half-maximal binding EC50) of 306, 312, 433, 472, and 630 ng / mL, respectively, while the corresponding mouse anti-human HVEM antibodies numbered 45H6, 49G4, 36H12, 48H6, and 11H7 resulted in relative affinities of 260, 266, 430, 356, and 532 ng / mL, respectively. This suggests that the binding affinity of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 for membrane-bound HVEM appears to remain unchanged during chimerism.
[0218] b) The effect of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on the binding of human BTLA, human CD160, human LIGHT, and human TNFβ to membrane-bound human HVEM.
[0219] Extracellular HVEMs possess two spatial ligand-binding regions (Cai et al. Immunol Rev 2009; 229:244-258; Steinberg et al. Immunol Rev 2011; 244:169-187; Pasero et al. Curr Opin Pharmacol 2012; 12:478-485). One region is used for typical ligands belonging to the TNF superfamily (i.e., LIGHT and TNFβ), and the other region is used for atypical ligands belonging to the Ig superfamily (i.e., BTLA and CD160). Mutational analysis and molecular modeling revealed that BTLA and CD160 interact with CRD1, while LIGHT and TNFβ binding is located in CRD2 and CRD3 opposite the HVEM.
[0220] To analyze the effects of purified BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 on the binding of human BTLA, human CD160, human LIGHT, and human TNFβ to membrane-bound human HVEM, FACS analysis was used to determine the ability of chimeric mouse / human anti-human HVEM antibodies to spatially block the interaction of human BTLA, human CD160, human LIGHT, and human TNFβ (or LTα) on full-length human HVEM expressed on the surface of (HEK-derived) 293F cells.
[0221] Example 1a describes the generation of HEK293F cells (clone 128) transfected with human "full-length" HVEM. The binding of soluble human BTLA, soluble human CD160, soluble human LIGHT, and soluble human TNFβ to the surface of the human HVEM-transfected cells was analyzed by FACS. For this purpose, the binding was measured at 10 x 10⁻⁶ cells / cell at 4°C. 6 Stable, full-length human HVEM-transfected HEK293F cells were placed in ice-cold phosphate-buffered saline containing 0.1% BSA (Sigma) / 0.05% NaN3 (PBS / BSA / NaN3) supplemented with 50 μg / mL human IgG (blocking potential Fcγ receptor; Sigma). Then, 10 μL / tube (i.e., 0.1 x 10⁻⁶ cells / mL) was transferred to each tube. 6These cells (number of cells) were incubated with or without 100 μL of purified chimeric mouse / human anti-HVEM antibody (10 μg / mL / tube) or human IgG4 / κ (Sigma) negative isotype control at 4°C for 30 min. Following this (i.e., without washing), the cells were then incubated at 4°C for 30 min with 1 μg / mL soluble biotinylated human BTLA (Sino Biological), 10 μg / mL soluble his-labeled human CD160 (Sino Biological), 1 μg / mL soluble his-labeled human LIGHT (Sino Biological), or 0.1 μg / mL soluble biotinylated human TNFβ (Sino Biological) in PBS / BSA / NaN3. After thorough washing in PBS / BSA / NaN3, cells were incubated at 4°C for 30 min at 10 μg / mL with PE-conjugated streptavidin (detecting BTLA and TNFβ; Jackson Immuno Research) or biotinylated mouse anti-his antibody (detecting CD160 and LIGHT; R&D Systems). After further washing in PBS / BSA / NaN3, cells were incubated at 4°C for 30 min at 4°C with PE-conjugated streptavidin (detecting CD160 and LIGHT; Jackson Immuno Research). After further washing in PBS / BSA / NaN3, cells were fixed at 4°C in 4% formaldehyde in PBS / BSA / NaN3 for 30 min. The binding of ligands BTLA, CD160, LIGHT, and TNFβ to human HVEM membranes was measured using flow cytometry (FACSCalibur; BD Biosciences). For comparison, parallel runs were performed of purified BTLA / HVEM blocking mouse anti-human HVEM antibody correspondents numbered 36H12, 45H6, 48H6, 11H7 and 49G4 at 10 μg / mL / tube and mouse IgG1 (BD Biosciences) negative isotype control at 10 μg / mL / tube.
[0222] like Figure 6 As shown in A, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody numbers 36H12, 45H6, 48H6, 11H7, and 49G4 block (i.e., >95% block) human BTLA binding to membrane-bound human HVEM, which is comparable to their BTLA / HVEM blocking mouse anti-human HVEM antibody counterparts numbers 36H12, 45H6, 48H6, 11H7, and 49G4 (i.e., >95% block).
[0223] like Figure 6B shows that BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody numbers 36H12, 45H6, 48H6, 11H7, and 49G4 partially block (i.e., ≈60-65% block) human CD160 binding to membrane-bound human HVEM, which is comparable to their BTLA / HVEM blocking mouse anti-human HVEM antibody counterparts numbered 36H12, 45H6, 48H6, 11H7, and 49G4 (i.e., ≈45-55% block).
[0224] like Figure 6 As shown in C, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, and 49G4 partially blocked (i.e., ≈30-50% block) human LIGHT binding to membrane-bound human HVEM, which is comparable to their BTLA / HVEM blocking mouse anti-human HVEM antibody counterparts numbered 36H12, 45H6, 48H6, and 49G4 (i.e., ≈40-50% block). In contrast, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody numbered 11H7 did not block, but surprisingly appeared to enhance or stabilize (i.e., enhance ≈20%) human LIGHT binding to membrane-bound human HVEM, which is comparable to their BTLA / HVEM blocking mouse anti-human HVEM antibody counterpart numbered 11H7 (i.e., enhance ≈10%).
[0225] like Figure 6 As shown in D, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 (partially) blocked human TNFβ bound to membrane-bound human HVEM to varying degrees (in order; numbered 36H12 = 45H6 = 48H6 (i.e., >94% blocking) > 49G4 (i.e., >80% blocking) > 11H7 (i.e., >55% blocking)), which is comparable to their BTLA / HVEM blocking mouse anti-human HVEM antibody counterparts numbered 36H12, 45H6, 48H6, 11H7, and 49G4 (in order; numbered 36H12 = 45H6 = 48H6 (i.e., >95% blocking) > 49G4 (i.e., >85% blocking) > 11H7 (i.e., >60% blocking)).
[0226] c) Effects of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on the replacement of pre-bound human BTLA, human CD160, human LIGHT, and human TNFβ from membrane-bound human HVEM.
[0227] To analyze whether purified BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 could displace pre-bound human BTLA, human CD160, human LIGHT, and human TNFβ from membrane-bound human HVEM, the effects of chimeric mouse / human anti-human HVEM antibodies on the displacement of human BTLA, human CD160, human LIGHT, and human TNFβ (or LTα) from full-length human HVEM expressed on the surface of (HEK-derived) 293F cells were determined by FACS analysis.
[0228] Example 1a describes the generation of HEK293F cells (clone 128) transfected with human “full-length” HVEM. The replacement of cells transfected with human HVEM with pre-bound soluble human BTLA, soluble human CD160, soluble human LIGHT, and soluble human TNFβ was analyzed by FACS. For this purpose, the cells were subjected to a 10 x 10⁻⁶ HVEM solution at 4°C. 6 Stable, full-length human HVEM-transfected HEK293F cells were placed in ice-cold phosphate-buffered saline containing 0.1% BSA (Sigma) / 0.05% NaN3 (PBS / BSA / NaN3) supplemented with 50 μg / mL human IgG (blocking potential Fcγ receptor; Sigma). Then, 10 μL / tube (i.e., 0.1 x 10⁻⁶ cells / mL) was transferred to each tube. 6These cells (number of cells) were incubated at 4°C for 30 minutes with 50 μL of soluble biotinylated human BTLA-human Fcγ fusion protein (Sino Biological), 20 μg / mL / tube of soluble his-labeled human CD160 (Sino Biological), 2 μg / mL / tube of soluble his-labeled human LIGHT (Sino Biological), or 0.2 μg / mL / tube of soluble biotinylated human TNFβ (Sino Biological) in PBS / BSA / NaN3, with or without washing. Following this (i.e., without washing), the cells were then incubated at 4°C for 30 minutes with 50 μL of purified chimeric mouse / human anti-HVEM antibody (20 μg / mL / tube) or 20 μg / mL / tube of human IgG4 / κ (Sigma) negative isotype control. After thorough washing in PBS / BSA / NaN3, cells were incubated at 4°C for 30 minutes at a concentration of 10 μg / mL with either PE-conjugated streptavidin (for detecting BTLA and TNFβ; Jackson Immuno Research) or biotinylated mouse anti-his antibody (for detecting CD160 and LIGHT; R&D Systems). After thorough washing in PBS / BSA / NaN3, cells were incubated at 4°C for 30 min with PE-conjugated streptavidin (detecting CD160 and LIGHT; Jackson Immuno Research). After thorough washing in PBS / BSA / NaN3, cells were fixed at 4°C in 4% formaldehyde in PBS / BSA / NaN3 for 30 min. Residual binding of ligands BTLA, CD160, LIGHT, and TNFβ to human HVEM membranes was measured using flow cytometry (model FACSCalibur; BD Biosciences). For comparison, parallel runs of purified BTLA / HVEM blocking mouse anti-human HVEM antibody counterparts numbered 36H12, 45H6, 48H6, 11H7, and 49G4 (10 μg / mL / tube) and mouse IgG1 (BD Biosciences) negative isotype control (10 μg / mL / tube) were performed.
[0229] like Figure 7As shown in A, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 replaced (i.e., >95% replacement) pre-bound human BTLA from membrane human HVEM.
[0230] like Figure 7 As shown in B, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 partially replaced (i.e., ≈50-60% replacement) pre-bound human CD160 from the membrane human HVEM.
[0231] like Figure 7 As shown in Figure C, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, and 49G4 did not displace pre-bound human light from membrane human HVEM (i.e., <20% displacement). In contrast, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody numbered 11H7 did not displace pre-bound human light from membrane human HVEM, but surprisingly appeared to enhance or stabilize human light pre-bound to membrane human HVEM (i.e., enhance ≈30%).
[0232] like Figure 7 As shown in D, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, and 49G4 partially replaced pre-bound human TNFβ from membrane human HVEM to varying degrees (ranked in order; numbered 36H12 = 45H6 = 48H6 (i.e., >90% replacement) > 49G4 (i.e., >55% replacement)). In contrast, BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody numbered 11H7 appeared not to have replaced pre-bound human TNFβ from membrane human HVEM (i.e., <20% replacement).
[0233] (d) Effect of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on NFκB signaling in cells expressing membrane-bound human HVEM.
[0234] To analyze the effects of chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 on membrane-bound human HVEM-mediated NFκB signaling, NFκB response element-luciferase (RE-luc) human HVEM bioassay reporter cells (HEK293; Promega) were used to examine the ability of mouse anti-human HVEM antibodies to activate HVEM-mediated NFκB signaling.
[0235] In summary, NFκB-RE-luc cells expressing human HVEM were seeded at 35,000 cells / well in flat-bottomed TC-treated white solid 96-well plates (Corning Instruments) and incubated overnight at 37°C / 5% CO2. The next day, these cells were washed and subsequently incubated with or without 0.0015–10 μg / mL (3-fold dilution) of chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4. Parallel runs of titration (i.e., 0, 0.0015–10 μg / mL (3-fold dilution)) of soluble his-labeled human LIGHT (R&D Systems) were performed for reference purposes. After 6 hours of incubation at 37°C / 5% CO2, the cells were analyzed using a Bio-Globe spectrophotometer. TM The luciferase assay system (Promega) measures luciferase production in NFκB-NFκB-RE-luc cells expressing human HVEM.
[0236] like Figure 8A As shown, only chimeric mouse / human mouse anti-human HVEM antibody number 48H6 induced weak dose-dependent NFκB activation in NFκB-RE-luc cells expressing human HVEM (i.e., compared to NFκB induction mediated by soluble LIGHT), while chimeric mouse / human mouse anti-human HVEM antibodies numbered 36H12, 45H6, 11H7, and 49G4 showed no or very weak agonistic activity in NFκB-RE-luc cells expressing human HVEM (i.e., compared to NFκB induction mediated by soluble LIGHT). In these NFκB-RE-luc cells expressing human HVEM, control soluble human LIGHT also showed dose-dependent NFκB activation. Notably, for activating human HVEM expressed on cells, soluble human LIGHT has been shown to be far less effective than cells expressing membrane-bound LIGHT (Cheung et al., PNAS 2009; 106:6244-6249).
[0237] Although the binding affinity of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 to membrane-bound HVEM appears to remain unchanged during chimerism (see Example 6a), it is surprising that BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, and 49G4 and their human constant IgG 4Fc-tail cannot or only weakly mimic soluble human LIGHT / human HVEM-mediated NKκB signaling, in contrast to their mouse anti-human HVEM antibody IgG1 counterparts, which clearly exhibit NFκB signaling activity (see Example 3a).
[0238] (e) Effect of cross-linked BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on NFκB signaling in cells expressing membrane-bound human HVEM.
[0239] It is well known that cross-linking of antibodies against human CD40 and OX40 / CD134 (both members of the TNF receptor superfamily, such as human HVEM / CD270) can enhance their agonistic activity when bound to cells expressing membrane-bound CD40 and OX40 (i.e., mimicking the effects mediated by CO40L and OX40L, respectively) (Xu et al., Cancer Cell 2018; 33:664-675; Zhang et al., J Biol Chem 2016; 291:27134-27146). Due to the aforementioned surprising results of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, and 49G4 (i.e., failing to or weakly mimicking soluble human LIGHT / human HVEM-mediated NKκB signaling, as opposed to their mouse anti-human HVEM antibody counterparts which clearly exhibit NFκB signaling activity (see Examples 6b and 3a, respectively)), size exclusion chromatography was used to identify the (1) chimeric mouse / human and (2) fully mouse versions of the anti-human HVEM antibody numbers. The aggregation levels of antibodies 36H12, 45H6, 48H6, 11H7, and 49G4 were investigated, confirming the following: (1) the aggregation rates of chimeric mouse / human anti-human HVEM antibodies 36H12, 45H6, 48H6, 11H7, and 49G4 were 2.3%, 0.7%, 1.2%, 1.6%, and 9.4%, respectively; and (2) the aggregation rates of completely mouse anti-human HVEM antibodies 36H12, 45H6, 48H6, 11H7, and 49G4 were 36.3%, 25.8%, 19.9%, 12.4%, and 14.8%, respectively. The relatively high degree of antibody aggregation in the preparations of mouse anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, and 49G4 strongly suggests that the agonistic activity of mouse anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, and 49G4 in NFκB response element-luciferase (RE-luc) human HVEM bioassay reporter cells is an artificial effect induced by antibody aggregation (i.e., a mimicking antibody crosslinking effect). To confirm this hypothesis, non-crosslinked and crosslinked BTLA / HVEM blocking chimeric mouse / human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 (with a relatively low degree of antibody aggregation) were examined using NFκB response element-luciferase (RE-luc) human HVEM bioassay reporter cells.
[0240] In summary, NFκB-RE-luc cells expressing human HVEM were seeded at 35,000 cells / well in flat-bottomed, TC-treated white solid 96-well plates (Corning Electron) and incubated overnight at 37°C / 5% CO2. The next day, these cells were washed and subsequently incubated with, or without, 0.016–10 μg / mL (5-fold dilution) chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 (pretreated at RT with or without 10 μg / mL cross-linked goat anti-human IgG Fcγ specific antibody (Jackson Immuno Research) for 15–30 min. Parallel titrations (i.e., 0, 0.016–10 μg / mL (5-fold dilution)) of soluble his-labeled human LIGHT (Sino Biological) were run for reference purposes. After incubation at 37°C / 5% CO2 for 6 hours, the sample was analyzed using a Bio-Glo photometer. TM The luciferase assay system (Promega) measures luciferase production in NFκB-NFκB-RE-luc cells expressing human HVEM.
[0241] like Figure 8B As shown, only the non-crosslinked chimeric mouse / human anti-human HVEM antibody number 48H6 induced weak dose-dependent NFκB activation in human HVEM-expressing NFκB-RE-luc cells (i.e., compared to NFκB induction mediated by soluble LIGHT), while the non-crosslinked chimeric mouse / human anti-human HVEM antibodies numbers 36H12, 45H6, 11H7, and 49G4 showed no or very weak agonistic activity in human HVEM-expressing NFκB-RE-luc cells (i.e., compared to NFκB induction mediated by soluble LIGHT). In contrast, all examined crosslinked chimeric mouse / human anti-human HVEM antibodies induced dose-dependent NFκB activation in human HVEM-expressing NFκB-RE-luc cells (i.e., compared to NFκB induction mediated by soluble LIGHT). In these human HVEM-expressing NFκB-RE-luc cells, the control soluble human LIGHT also showed dose-dependent NFκB activation. It is worth noting that soluble human light has been shown to be far less effective than cells expressing membrane-bound light for activating human HVEM expressed on cells (Cheung et al., PNAS 2009; 106:6244-6249).
[0242] These results indicate that non-crosslinked chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 (with relatively low levels of antibody aggregation) cannot or only weakly mimic soluble human LIGHT / human HVEM-mediated NKκB signaling, while after crosslinking, these chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 can mimic soluble human LIGHT / human HVEM-mediated NKκB signaling. Notably, soluble human LIGHT has been shown to be far less effective than cells expressing membrane-bound LIGHT for activating human HVEM expressed on cells (Cheung et al., PNAS 2009; 106:6244-6249).
[0243] (f). Effect of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on soluble human light-induced NFκB signaling in cells expressing membrane-bound human HVEM.
[0244] To analyze the effects of chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 on soluble human LIGHT-induced NFκB signaling in cells expressing membrane human HVEM, NFκB-RE-luc human HVEM bioassay reporter cells (HEK293; Promega) were used to examine the ability of mouse anti-human HVEM antibodies to interfere with (e.g., blockade, additive, or co-effect) soluble LIGHT / membrane HVEM-mediated NFκB signaling.
[0245] In short, NFκB-RE-luc cells expressing human HVEM were seeded at 35,000 cells / well in flat-bottomed TC-treated white solid 96-well plates (Corning) and incubated overnight at 37°C / 5% CO2. The next day, these cells were washed and subsequently incubated with or without 0.0015–10 μg / mL (3-fold dilution) chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 and 0.3 μg / mL soluble his-labeled human LIGHT (Sino Biological) (EC80; see Example 2a and 2000). Figure 3A After incubation at 37°C / 5% CO2 for 6 hours, the sample was analyzed using a Bio-Globe spectrophotometer. TM The luciferase assay system (Promega) measures luciferase production in NFκB-NFκB-RE-luc cells expressing human HVEM.
[0246] like Figure 8CAs shown, chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 had no effect on soluble human LIGHT-mediated NFκB activation in NFκB-RE-luc cells expressing human HVEM.
[0247] These results indicate that chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 do not affect soluble human LIGHT / human HVEM-mediated NKκB signaling.
[0248] (g) Effect of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on soluble human TNFβ-induced NFκB signaling in cells expressing membrane-bound human HVEM.
[0249] It has been reported that TNFβ / LTα binds weakly to HVEM, and its exact functional role in the HVEM pathway remains unclear (Cai et al. Immunol Rev 2009; 229:244-258), although the prevailing view is that the TNFβ / HVEM pathway (like the LIGHT / HVEM pathway) provides a co-stimulatory signal, leading to an enhanced immune response (Cai et al. Immunol Rev 2009; 229:244-258; Steinberg et al. Immunol Rev 2011; 244:169-187; Pasero et al. CurrOpin Pharmacol 2012; 12:478-485; Del Rio et al. Am J Transplant 2013; 13:541-551; Schaer et al. J Immunother Cancer 2014; 2:7).
[0250] To analyze the effects of chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 on soluble human TNFβ-induced NFκB signaling in cells expressing membrane human HVEM, NFκB-RE-luc human HVEM bioassay reporter cells (HEK293; Promega) were used to examine the ability of mouse anti-human HVEM antibodies to interfere with (e.g., blockade, additive, or co-effect) soluble TNFβ / membrane HVEM-mediated NFκB signaling.
[0251] In short, NFκB-RE-luc cells expressing human HVEM were seeded at 32,000 cells / well in flat-bottomed, TC-treated white solid 96-well plates (Corning) and incubated overnight at 37°C / 5% CO2. The next day, these cells were washed and subsequently incubated with or without 0.0015–10 μg / mL (3-fold dilution) chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 and 0.05 μg / mL soluble recombinant human TNFβ (Sino Biological) (EC80, see [link]). Figure 9 A). ≈ Parallel titrations (i.e., 0, 0.000026-2 μg / mL (5-fold dilution)) of soluble recombinant human TNFβ were used for reference purposes. After incubation at 37°C / 5% CO2 for 6 hours, the titrations were measured using a Bio-Globe spectrophotometer. TM The luciferase assay system (Promega) measures luciferase production in NFκB-NFκB-RE-luc cells expressing human HVEM.
[0252] like Figure 9 As shown in B, chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 showed no effect on soluble human TNFβ-mediated NFκB activation in NFκB-RE-luc cells expressing relatively low levels of membrane-bound human HVEM (i.e., signal with a signal-to-noise ratio <5 when using PE-conjugated mouse anti-human HVEM antibody (clone eBioHVEM-122; eBioscience) at a 1:20 ratio). This observation is surprising because chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 prevented soluble human TNFβ from binding to and / or replacing pre-bound soluble human TNFβ from HEK293F cell clone number 128 (see Examples 5(b) and 5(c) respectively), which expresses relatively high levels of membrane-bound human HVEM (i.e., overexpression; using PE-conjugated mouse anti-human HVEM antibody (clone eBioHVEM-122; eBioscience) at a 1:20 signal-to-noise ratio of 1000; see Figure 1However, it has been reported that human TNFβ binds with high affinity to human TNFR1 / CD120a and human TNFR2 / CD120b (Medvedev et al. J Biol Chem 1996; 16:9778-9784). Interestingly, HEK293 cells endogenously express low levels of human TNFR1 / CD120a (Murphy et al. Cell Death Differ. 1998; 5:497-505; McFarlane et al. FEBS Letters 2002; 515:119-126; Razonable et al. Antimicrob Agents Chemother 2005; 49:1617-1621). Most likely, human TNFβ preferentially binds to these "high-affinity" human TNFR1s (as opposed to "low / weak-affinity" human HVEMs) on cells that co-express HVEM+ / TNFR1+ at low affinity, thereby preferentially triggering soluble human TNFβ / human TNFR1-mediated (as opposed to soluble human TNFβ / human HVEM-mediated) NFκB activation. In this scenario, chimeric mouse / human anti-human HVEM antibodies will be ineffective.
[0253] These results indicate that chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 do not affect soluble human TNFβ-mediated NKκB signaling when membrane-bound human HVEM and membrane-bound human TNFR1 are co-expressed at relatively low levels on cells.
[0254] (h). Effect of BTLA / HVEM-blocking chimeric mouse / human anti-human HVEM antibody on the inhibition of TCR-induced NFAT signaling in T cells expressing membrane human BTLA / membrane human TCR mediated by membrane human BTLA / membrane human HVEM.
[0255] To analyze the inhibitory effect of chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 on membrane-mediated human BTLA / human HVEM-induced NFAT signaling induced by human TCR, the NFAT response element-luciferase (RE-luc) human BTLA / HVEM blocking bioassay (see Example 3(c) above) was used to examine the ability of mouse anti-human HVEM antibodies to block the BTLA / HVEM-mediated inhibition of TCR-induced NFAT signaling.
[0256] In summary, CHO-K1 activated cells expressing human HVEM and proprietary TCR activators were seeded at 40,000 cells / well in flat-bottomed, TC-treated white solid 96-well plates (Corning) and incubated overnight at 37°C / 5% CO2. The next day, these cells were washed and subsequently incubated with or without 0.0015–10 μg / mL (3-fold dilution) chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4. Then, NFAT-RE-luc Jurkat effector T cells expressing human BTLA and human TCR were added at 50,000 cells / well. After incubation at 37°C / 5% CO2 for 6 hours, the cells were analyzed using a Bio-Globe spectrophotometer. TM The luciferase assay system (Promega) measures luciferase production in NFAT-RE-luc Jurkat effector T cells expressing human BTLA and human TCR.
[0257] like Figure 10 As shown, all examined chimeric mouse / human anti-human HVEM antibodies dose-dependently blocked BTLA / HVEM-mediated inhibition of TCR-induced NFAT signaling in NFAT-RE-luc Jurkat effector T cells expressing human BTLA and human TCR to varying degrees (in this order; numbered 45H6>49G4>11H7>36H12>>48H6).
[0258] These results indicate that chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 can block TCR-induced NFAT signaling in human BTLA / human HVEM-mediated inhibition.
[0259] (k) Effect of BTLA / HVEM blocking chimeric mouse / human anti-human HVEM antibody on the inhibition of TCR-induced cytokine release from primary naive human T cells expressing membrane-human BTLA / membrane-human TCR mediated by membrane-human BTLA / membrane-human HVEM.
[0260] As described above, HVEM is attached to T lymphocytes via LIGHT to deliver positive co-stimulatory signals, while BTLA is attached to T lymphocytes via HVEM to provide negative co-inhibitory signals (DelRio et al., Journal of Leukocyte Biology 2010; 87:223-235). This BTLA / HVEM pathway downregulates TCR-mediated signaling in both CD4 and CD8 T lymphocytes, leading to reduced T lymphocyte proliferation and cytokine production.
[0261] To analyze the inhibitory effects of chimeric mouse / human anti-human HVEM antibodies (numbers 36H12, 45H6, 48H6, 11H7, and 49G4) on membrane-human TCR-induced cytokine release mediated by membrane-human BTLA / membrane-human HVEM, (1) stable full-length human HVEM-transfected HEK293F cells (clone number 128; see Example 1a above) were transiently transfected with a membrane-bound anti-human CD3 (OKT3) single-chain variable fragment (scFv) TCR activator as previously described with slight modifications (Chen et al., Front Immunol 2017; 8:793; artificial antigen-presenting cells) and (2) primary human naive T cells (reactive cells) expressing membrane-human BTLA and membrane-human TCR complexes were co-cultured to examine the ability of mouse anti-human HVEM antibodies to attenuate / reverse the inhibition of TCR-induced cytokine release mediated by BTLA / HVEM (see also for the assay principle). Figure 4A Except that CHO-K1 artificial antigen-presenting cells expressing human HVEM and Jurkat effector T cells expressing human BTLA were exchanged for HEK293F artificial antigen-presenting cells expressing human HVEM and primary human naive T cells expressing human BTLA, respectively.
[0262] In summary, a cDNA encoding a membrane-binding anti-human CD3(OKT3)scFv TCR activator protein (SEQ ID NO.76) was optimized for mammalian expression and synthesized by GENEART in Regensburg, Germany (see SEQ ID NO.77). This cDNA was subcloned into a pcDNA3.1-derived expression plasmid. FreeStyle was used for expression. TM The anti-human CD3(OKT3) scFv TCR-activating protein particle was transfected into stable human full-length HVEM-transfected HEK293F cells (clone number 128; see Example 1a above) using the 293 expression system (Life Technologies). Two days later, these HEK293F cells were harvested and expressed at 1.0 x 10⁻⁶ cells per cell line. 6 Cells / mL were resuspended in RPMI-1640 medium (Gibco) containing 10% fetal bovine serum (Capricorn) and 50 μg / mL gentamicin (Gibco). Prior to co-culture, the expression of anti-human CD3 (OKT3) scFv TCR activator protein on transiently transfected HEK293F cells expressing human HVEM (i.e., used as artificial antigen-presenting cells) was confirmed by flow cytometry using PE-conjugated goat anti-human IgG fcγ specific antibody (Jackson Immuno Research) at a concentration of 1:200.
[0263] via LymphoprepTM Peripheral blood mononuclear cells (PBMCs) from healthy donors (informed consent) were separated by density centrifugation at 1.077 g / mL (Nycomed). Subsequently, Dynabeads were used to separate the PBMCs. TM Untouched TM Human T-cell kit (Ingenie) enriches human T lymphocytes (i.e., CD4 and CD8) from PBMC grade and at a concentration of 1.0 x 10⁻⁶. 6 Cells / mL were resuspended in RPMI-1640 medium (Gibco) containing 10% fetal bovine serum (Capricorn) and 50 μg / mL gentamicin (Gibco). Prior to co-culture, human BTLA surface expression on enriched human naive T lymphocytes (i.e., used as responder cells) was confirmed by flow cytometry using a 1:20 dilution of PE-conjugated mouse anti-human BTLA-specific antibody (BD Biosciences).
[0264] Under RT, chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, 48H6, 11H7, and 49G4 were administered at a concentration of 1.0 x 10⁻⁶. 6 HEK293F cells / mL were pretreated with an artificial antigen expressing human HVEM for 15–30 min. In parallel, 40 μg / mL human IgG4 / κ (Sigma) was run as a negative isotype control. Following this (i.e., without washing), at a 1:1 ratio (i.e., 50,000 T cells / 50,000 artificial antigen-presenting cells / 200 μL / well), artificial antigen-presenting HEK293F cells pretreated with chimeric mouse / human anti-human HVEM antibodies (numbers 36H12, 45H6, 48H6, 11H7, and 49G4) and 20 μg / mL human IgG4 / κ (Sigma) negative isotype controls, and enriched human naive T lymphocytes, were co-cultured for 2 days in flat-bottomed TC-treated clear 96-well plates (Corning) at 37°C / 5% CO2, with and without 0.5 μg / mL co-stimulated mouse anti-human CD28 antibody (clone CD28; BDBiosciences). After 2 days of culture, the supernatant was harvested and frozen at -80°C until use.
[0265] The conventional sandwich ELISA developed internally was used (i.e., (I) for IL-2 ELISA, a combination of rat anti-human IL-2 monoclonal coated antibody (clone MQ1-17H12; eBioscience), titrated rhuIL-2 standard (PeproTech), and biotinylated rabbit anti-human IL-2 polyclonal detection antibody (eBioscience); (II) for TNFα ELISA, a combination of mouse anti-human TNFα monoclonal coated antibody (clone MAb11; Biolegend), titrated rhuTNFα standard (PeproTech), and biotinylated rabbit anti-human IL-2 polyclonal detection antibody (eBioscience) was used). (III) For IFNγ ELISA, a combination of mouse anti-human IFNγ monoclonal antibody (clone MAb11; Biolegend) and biotinylated mouse anti-human IFNγ monoclonal antibody (clone NIB42; eBioscience), titrated rhuIFNγ standard (Peptec) and biotinylated mouse anti-human IFNγ monoclonal antibody (clone 4S.B3; eBioscience) was used to measure human IL-2, human TNFα and human IFNγ released from primary human naive T lymphocytes in these supernatants.
[0266] Supernatants from artificial antigen-presenting HEK293F cells or enriched human naive T lymphocytes (not co-cultured, but cultured alone for 2 days (i.e., 50,000 artificial antigen-presenting cells / 200 μL / well or 50,000 T cells / 200 μL / well)) did not show measurable levels of human IL-2, human TNFα, or human IFNγ.
[0267] like Figure 11A As shown, all examined chimeric mouse / human anti-human HVEM antibodies attenuated / reversed to varying degrees the BTLA / HVEM-mediated inhibition of TCR / CD28-induced IL-2 release from primary human naive T lymphocytes expressing co-cultured human BTLA enriched from all 6 healthy donors (ranked in order; 45H6>11H7>36H12>49G4>>48H6). Additionally, chimeric mouse / human anti-human HVEM antibodies 36H12, 45H6, 11H7, and 49G4 attenuated / reversed to varying degrees the BTLA / HVEM-mediated inhibition of TCR-induced IL-2 (if any) release from primary human naive T lymphocytes expressing co-cultured human BTLA enriched from 2 / 6 healthy donors (i.e., donors A and H) (ranked in order; 45H6>11H7>36H12>49G4).
[0268] like Figure 11BAs shown, chimeric mouse / human anti-human HVEM antibodies 36H12, 45H6, and 11H7 attenuated / reversed, to varying degrees, the inhibition of TCR / CD28-induced TNFα release from primary human naive T lymphocytes co-cultured with co-expressing human BTLA enriched from all six healthy donors by BTLA / HVEM-mediated inhibition (in order of importance; 45H6 > 11H7 > 36H12). Furthermore, chimeric mouse / human anti-human HVEM antibodies 36H12, 45H6, and 11H7 attenuated / reversed, to varying degrees, the inhibition of TCR-induced TNFα (if any) release from primary human naive T lymphocytes co-expressing human BTLA enriched from four / six healthy donors (i.e., donors A, D, H, and K) by BTLA / HVEM-mediated inhibition (in order of importance; 45H6 > 11H7 = 36H12).
[0269] like Figure 11C As shown, chimeric mouse / human anti-human HVEM antibodies 36H12, 45H6, and 11H7 attenuated / reversed, to varying degrees, the inhibition of TCR / CD28-induced IFNγ release from primary human naive T lymphocytes co-cultured with co-expressing human BTLA enriched from all six healthy donors by BTLA / HVEM-mediated inhibition (in order of importance; 45H6 > 11H7 > 36H12). Furthermore, chimeric mouse / human anti-human HVEM antibodies 36H12, 45H6, and 11H7 attenuated / reversed, to varying degrees, the inhibition of TCR-induced IFNγ (if any) release from primary human naive T lymphocytes co-cultured with co-expressing human BTLA enriched from four / six healthy donors (i.e., donors A, D, H, and K) by BTLA / HVEM-mediated inhibition (in order of importance; 45H6 = 11H7 > 36H12).
[0270] These results indicate that chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, and 11H7 attenuate / reverse the inhibition of human BTLA / human HVEM-mediated release of TCR / CD28-induced IL-2, TNFα, and IFNγ from primary naive human T cells expressing human BTLA. Furthermore, these results demonstrate that chimeric mouse / human anti-human HVEM antibodies numbered 36H12, 45H6, and 11H7 attenuate / reverse the inhibition of human BTLA / human HVEM-mediated release of TCR-induced IL-2, TNFα, and IFNγ (if present) from primary naive human T cells expressing human BTLA.
[0271] Sequence Description
[0272] SEQ ID NO.1
[0273] Amino acid sequence of human HVEM (Swiss-Prot Q92956.3; aa 1-283)
[0274]
[0275] The signal peptide (aa sequence 1-38), extracellular domains (aa sequence 39-202, including CRD1 (aa sequence 42-75), CRD2 (aa sequence 78-119), CRD3 (aa sequence 121-162) and truncated CRD4 (aa sequence 165-179), "connector" (aa sequence 180-202)), transmembrane domains (aa sequence 203-223), and cytoplasmic domains (aa sequence 224-283) are included.
[0276] SEQ ID NO.2
[0277] cDNA sequence encoding human HVEM protein (optimized for mammalian expression)
[0278]
[0279] SEQ ID NO.3
[0280] Human HVEM with truncated CRD1 amino acid sequence
[0281]
[0282] The mouse Ig signal peptide (aa sequence 1-19), extracellular domains (aa sequence 20-146, including CRD2 (aa sequence 22-63), CRD3 (aa sequence 65-106) and truncated CRD4 (aa sequence 109-123), "connector" fragment (aa sequence 124-146)), transmembrane domains (aa sequence 147-167), and cytoplasmic domains (aa sequence 168-227) are included.
[0283] SEQ ID NO.4
[0284] cDNA sequence encoding a truncated human HVEM protein of CRD1 (optimized for mammalian expression)
[0285]
[0286]
[0287] SEQ ID NO.5
[0288] Amino acid sequence of cynomolgus monkey HVEM (NCBI reference sequence: XP_005545061.1; aa 1-280)
[0289]
[0290] SEQ ID NO.6
[0291] cDNA sequence encoding the cynomolgus monkey HVEM protein (optimized for mammalian expression)
[0292]
[0293]
[0294] SEQ ID NO.7
[0295] PCR primers
[0296] ATGAAGTTGCCTGTTAGGCTGTTGGTGCTG
[0297] SEQ ID NO.8
[0298] PCR primers
[0299] ATGGATTTWCAGGGTGCAGATTWTCAGCTTC
[0300] SEQ ID NO.9
[0301] PCR primers
[0302] ATGGGCWTCAAAGATGGAGTCACA
[0303] SEQ ID NO.10
[0304] PCR primers
[0305] ACTGGATGGTGGGAAGATGG
[0306] SEQ ID NO.11
[0307] PCR primers
[0308] ATGAAATGCAGCTGGGGCATSTTCTTC
[0309] SEQ ID NO.12
[0310] PCR primers
[0311] ATGRACTTTGGGYTCAGCTTGRTTT
[0312] SEQ ID NO.13
[0313] PCR primers
[0314] ATGGGACTCCAGGCTCAATTTAGTTTTCCTT
[0315] SEQ ID NO.14
[0316] PCR primers
[0317] ATGGCTTGTCYTTRGSGCTRCTCTTCTGC
[0318] SEQ ID NO.15
[0319] PCR primers
[0320] CAGTGGATAGACAGATGGGGG
[0321] SEQ ID NO.16
[0322] The common amino acid sequence of the heavy chain variable region of mouse anti-human HVEM antibody 36H12
[0323]
[0324] SEQ ID NO.17
[0325] The common amino acid sequence of the light chain variable region of mouse anti-human HVEM antibody 36H12
[0326]
[0327] Complementarity-determining region (CDR) of mouse anti-human HVEM antibody 36H12: SEQ ID NO.18-23
[0328] SEQ ID NO.18
[0329] The amino acid sequence of 36H12 heavy chain CDR1
[0330] DTYMH
[0331] SEQ ID NO.19
[0332] The amino acid sequence of 36H12 heavy chain CDR2
[0333] RIDPATANTKYDPKFQG
[0334] SEQ ID NO.20
[0335] The amino acid sequence of 36H12 heavy chain CDR3
[0336] YGYDVSWFAY
[0337] SEQ ID NO.21
[0338] The amino acid sequence of 36H12, light chain CDR1
[0339] RSSQSIVHSNGITYLE
[0340] SEQ ID NO.22
[0341] The amino acid sequence of 36H12, light chain CDR2
[0342] KVSNRFS
[0343] SEQ ID NO.23
[0344] The amino acid sequence of 36H12, light chain CDR3
[0345] FQGSHVPLT
[0346] SEQ ID NO.24
[0347] The common amino acid sequence of the heavy chain variable region of mouse anti-human HVEM antibody 45H6
[0348]
[0349] SEQ ID NO.25
[0350] The common amino acid sequence of the light chain variable region of mouse anti-human HVEM antibody 45H6
[0351]
[0352]
[0353] Complementarity-determining region (CDR) of mouse anti-human HVEM antibody 45H6:
[0354] SEQ ID NO.26-31
[0355] SEQ ID NO.26
[0356] The amino acid sequence of the 45H6 heavy chain CDR1
[0357] SFGMH
[0358] SEQ ID NO.27
[0359] The amino acid sequence of 45H6 heavy chain CDR2
[0360] YISSGNSNIYYVDTVKG
[0361] SEQ ID NO.28
[0362] The amino acid sequence of 45H6 heavy chain CDR3
[0363] KRAYGDYSGFSMDY
[0364] SEQ ID NO.29
[0365] The amino acid sequence of 45H6, light chain CDR1
[0366] KASQNVDTNVA
[0367] SEQ ID NO.30
[0368] The amino acid sequence of 45H6, light chain CDR2
[0369] SASYRYS
[0370] SEQ ID NO.31
[0371] The amino acid sequence of 45H6, light chain CDR3
[0372] QQYNKFPLT
[0373] SEQ ID NO.32
[0374] The common amino acid sequence of the heavy chain variable region of mouse anti-human HVEM antibody 48H6
[0375]
[0376]
[0377] SEQ ID NO.33
[0378] The common amino acid sequence of the light chain variable region of mouse anti-human HVEM antibody 48H6
[0379]
[0380] Complementarity-determining region (CDR) of mouse anti-human HVEM antibody 48H6:
[0381] SEQ ID NO.34-39
[0382] SEQ ID NO.34
[0383] The amino acid sequence of 48H6 heavy chain CDR1
[0384] GYAMS
[0385] SEQ ID NO.35
[0386] The amino acid sequence of 48H6 heavy chain CDR2
[0387] SISSGGSTYYPDSVKG
[0388] SEQ ID NO.36
[0389] The amino acid sequence of 48H6 heavy chain CDR3
[0390] GGHGSSYVY
[0391] SEQ ID NO.37
[0392] The amino acid sequence of 48H6, light chain CDR1
[0393] KSSQSLLYSSNQKNYLA
[0394] SEQ ID NO.38
[0395] The amino acid sequence of 48H6, light chain CDR2
[0396] WASTRES
[0397] SEQ ID NO.39
[0398] The amino acid sequence of 48H6, light chain CDR3
[0399] HQYYSYPLT
[0400] SEQ ID NO.40
[0401] The common amino acid sequence of the heavy chain variable region of mouse anti-human HVEM antibody 11H7
[0402]
[0403] SEQ ID NO:41
[0404] The common amino acid sequence of the light chain variable region of mouse anti-human HVEM antibody 11H7
[0405]
[0406] Complementarity-determining region (CDR) of mouse anti-human HVEM antibody 11H7:
[0407] SEQ ID NO.42-47
[0408] SEQ ID NO.42
[0409] The amino acid sequence of 11H7 heavy chain CDR1
[0410] IYGVH
[0411] SEQ ID NO.43
[0412] The amino acid sequence of 11H7 heavy chain CDR2
[0413] VIWSGGSTDYNAAFIS
[0414] SEQ ID NO.44
[0415] The amino acid sequence of 11H7 heavy chain CDR3
[0416] RDYGSRSFYYAMDY
[0417] SEQ ID NO.45
[0418] The amino acid sequence of 11H7, light chain CDR1
[0419] SVSSSISSSNLH
[0420] SEQ ID NO.46
[0421] The amino acid sequence of 11H7, light chain CDR2
[0422] GTSNLAS
[0423] SEQ ID NO.47
[0424] The amino acid sequence of 11H7, light chain CDR3
[0425] QQWSSYPLT
[0426] SEQ ID NO.48
[0427] The common amino acid sequence of the heavy chain variable region of mouse anti-human HVEM antibody 49G4
[0428]
[0429] SEQ ID NO.49
[0430] The common amino acid sequence of the light chain variable region of mouse anti-human HVEM antibody 49G4
[0431]
[0432] Complementarity-determining region (CDR) of mouse anti-human HVEM antibody 49G4:
[0433] SEQ ID NO.50-55
[0434] SEQ ID NO.50
[0435] The amino acid sequence of 49G4 heavy chain CDR1
[0436] DTYMH
[0437] SEQ ID NO.51
[0438] The amino acid sequence of 49G4 heavy chain CDR2
[0439] RIDPARGNTKYDPKFQG
[0440] SEQ ID NO.52
[0441] The amino acid sequence of 49G4 heavy chain CDR3
[0442] AMDY
[0443] SEQ ID NO.53
[0444] The amino acid sequence of 49G4, light chain CDR1
[0445] RSSQSIVHSNGNTYLE
[0446] SEQ ID NO.54
[0447] The amino acid sequence of 49G4, light chain CDR2
[0448] KVSNRFS
[0449] SEQ ID NO.55
[0450] The amino acid sequence of 49G4 includes the light chain CDR3.
[0451] FQGSHVPLT
[0452] SEQ ID NO.56
[0453] cDNA sequences encoding chimeric mouse VH 36H12 and human constant-weight IgG4 chains
[0454]
[0455]
[0456] SEQ ID NO.57
[0457] cDNA sequences encoding chimeric mouse VH 45H6 and human constant-weight IgG4 chains
[0458]
[0459]
[0460]
[0461] SEQ ID NO.58
[0462] cDNA sequences encoding chimeric mouse VH 48H6 and human constant-weight IgG4 chains
[0463]
[0464]
[0465] SEQ ID NO.59
[0466] cDNA sequences encoding chimeric mouse VH 11H7 and human constant-weight IgG4 chains
[0467]
[0468]
[0469]
[0470] SEQ ID NO.60
[0471] cDNA sequences encoding chimeric mouse VH 49G4 and human constant-weight IgG4 chains
[0472]
[0473]
[0474] SEQ ID NO.61
[0475] cDNA sequences encoding chimeric mouse VL 36H12 and human constant light κ chain
[0476]
[0477]
[0478] SEQ ID NO.62
[0479] cDNA sequences encoding chimeric mouse VL 45H6 and human constant light κ chain
[0480]
[0481]
[0482] SEQ ID NO.63
[0483] cDNA sequences encoding chimeric mouse VL 48H6 and human constant light κ chain
[0484]
[0485]
[0486] SEQ ID NO.64
[0487] cDNA sequences encoding chimeric mouse VL 11H7 and human constant light κ chain
[0488]
[0489] SEQ ID NO.65
[0490] cDNA sequences encoding chimeric mouse VL and 49G4 human constant light κ chains
[0491]
[0492] SEQ ID NO.66
[0493] Amino acid sequences of chimeric mouse VH 36H12 and human constant-weight IgG4 chains
[0494]
[0495]
[0496] SEQ ID NO.67
[0497] Amino acid sequences of chimeric mouse VH 45H6 and human constant-weight IgG4 chains
[0498]
[0499] SEQ ID NO.68
[0500] Amino acid sequences of chimeric mouse VH 48H6 and human constant-weight IgG4 chains
[0501]
[0502] SEQ ID NO.69
[0503] Amino acid sequences of chimeric mouse VH 11H7 and human constant-weight IgG4 chains
[0504]
[0505] SEQ ID NO.70
[0506] Amino acid sequences of chimeric mouse VH 49G4 and human constant-weight IgG4 chains
[0507]
[0508] SEQ ID NO.71
[0509] Amino acid sequences of chimeric mouse VL 36H12 and human constant light κ chain
[0510]
[0511] SEQ ID NO.72
[0512] Amino acid sequences of chimeric mouse VL 45H6 and human constant light κ chain
[0513]
[0514]
[0515] SEQ ID NO.73
[0516] Amino acid sequences of chimeric mouse VL 48H6 and human constant light κ chain
[0517]
[0518] SEQ ID NO.74
[0519] Amino acid sequences of chimeric mouse VL 11H7 and human constant light κ chain
[0520]
[0521] SEQ ID NO.75
[0522] Amino acid sequences of chimeric mouse VL 49G4 and human constant light κ chain
[0523]
[0524]
[0525] SEQ ID NO.76
[0526] The amino acid sequence of membrane-bound anti-human CD3 scFv (signal peptide, followed by OKT3 scFv linked to the CH2-CH3 domain of human IgG1 and the cytoplasmic tail of human CD80)
[0527]
[0528] SEQ ID NO.77
[0529] cDNA sequence encoding membrane-binding anti-human CD3 scFv
[0530]
[0531]
[0532]
Claims
1. An antibody that binds to the extracellular cysteine-rich domain-1 (CRD1) of HVEM on HVEM-expressing cells, and, when said antibody binds to said extracellular portion of HVEM, prevents the binding of B- and T-lymphocyte attenuating factors (BTLA) to HVEM, and displaces BTLA bound to said extracellular portion of HVEM, wherein said antibody comprises: (a) A heavy chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 18-20 and a light chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 21-23. (b) A heavy chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 26-28 and a light chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 29-31. (c) A heavy chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 34-36 and a light chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 37-39. (d) A heavy chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 42-44 and a light chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 45-47, or (e) A heavy chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 50-52 and a light chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 53-55. The CDR sequence mentioned therein is assigned according to Kabat.
2. The antibody according to claim 1, wherein the antibody comprises: (a) A heavy chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 18-20 and a light chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 21-23. (b) A heavy chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 26-28 and a light chain variable region having CDR1, CDR2, and CDR3 sequences consisting of SEQ ID NO: 29-31, or (c) A heavy chain variable region having CDR1, CDR2 and CDR3 sequences consisting of SEQ ID NO: 42-44 and a light chain variable region having CDR1, CDR2 and CDR3 sequences consisting of SEQ ID NO: 45-47.
3. The antibody according to claim 1, wherein the antibody comprises: a heavy chain variable region having CDR1, CDR2 and CDR3 sequences consisting of SEQ ID NO: 26-28 and a light chain variable region having CDR1, CDR2 and CDR3 sequences consisting of SEQ ID NO: 29-31.
4. The antibody according to claim 1, wherein when the antibody binds to the extracellular portion of the HVEM, the antibody replaces less than 30% of the light bound to the extracellular portion of the HVEM, compared to the presence of the ligand in the absence of the antibody.
5. The antibody of claim 1, wherein when the antibody binds to the extracellular portion of the HVEM, the antibody partially prevents CD160 from binding to the HVEM and partially displaces CD160 bound to the extracellular portion of the HVEM.
6. The antibody of claim 1, wherein the antibody comprises: (a) The heavy chain variable region consisting of the sequence of SEQ ID NO: 16 and the light chain variable region consisting of the sequence of SEQ ID NO:
17. (b) The heavy chain variable region consisting of the sequence of SEQ ID NO: 24 and the light chain variable region consisting of the sequence of SEQ ID NO:
25. (c) The heavy chain variable region consisting of the sequence of SEQ ID NO: 32 and the light chain variable region consisting of the sequence of SEQ ID NO:
33. (d) The heavy chain variable region consisting of the sequence of SEQ ID NO: 40 and the light chain variable region consisting of the sequence of SEQ ID NO: 41, or (e) The heavy chain variable region consisting of the sequence of SEQ ID NO: 48 and the light chain variable region consisting of the sequence of SEQ ID NO:
49.
7. The antibody according to claim 1, comprising: (a) The heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 24 and the light chain variable region consisting of the amino acid sequence of SEQ ID NO: 25; or (b) The heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 40 and the light chain variable region consisting of the amino acid sequence of SEQ ID NO:
41.
8. The antibody according to any one of claims 1-2, 4-7, wherein when the antibody binds to the extracellular portion of the HVEM, the antibody does not prevent LIGHT from binding to the extracellular portion of the HVEM.
9. The antibody according to any one of claims 1-7, wherein the antibody is selected from monoclonal antibodies and humanized antibodies.
10. One or more nucleic acid molecules comprising a nucleotide sequence encoding the antibody according to claim 1.
11. A cell comprising one or more nucleic acid molecules according to claim 10, wherein the one or more nucleic acid molecules are capable of assembling into an antibody according to any one of claims 1-7.
12. A pharmaceutical composition comprising the antibody of claim 1 or the nucleic acid molecule of claim 10, and a pharmaceutically acceptable carrier and / or diluent.
Citation Information
Patent Citations
Chimeric receptor genes and cells transformed therewith
US20120093842A1
Method for tapping the immunological repertoire
US6291158B1
Production of anti-self bodies from antibody segment repertories and displayed on phage
US6582915B1
Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6593081B1
Immunoglobulins devoid of light chains
US6765087B1