Synthesis of rig-i-like receptor agonists

By packaging synthetic RNA molecules with specific sequences into virus-like particles, the problem of insufficient immune regulation in existing technologies is addressed, enabling strong and sustained immune responses suitable for the treatment of cancer and chronic infections.

CN115279905BActive Publication Date: 2026-03-17REGENERON PHARMACEUTICALS INC
View PDF 64 Cites 0 Cited by

Patent Information

Application Number
CN202080089370.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-10-23
Filing Date
2020-10-23
Publication Date
2026-03-17
Estimated Expiration
2040-10-23

AI Technical Summary

Technical Problem

There is a lack of effective compositions and methods in the prior art to modulate the activity of immunomodulatory proteins, especially in cancer immunotherapy and the treatment of chronic infections. Improved RIG-I-like receptor ligands and delivery methods are needed to elicit strong and sustained immune responses.

Method used

Synthetic RNA molecules are used as RIG-I-like receptor agonists. By packaging them into virus-like particles, especially those of RNA phage Qβ, synthetic RNA agonists that specifically bind to RIG-I-like receptors are utilized. These agonists contain specific nucleotide sequences and structures, such as 5' diphosphate or triphosphate moieties, forming double-stranded or blunt-ended hairpin RNAs, which enhance binding to RIG-I-like receptors and biological activity.

Benefits of technology

It enhances the strength and duration of the immune response, strengthens cytokine production, interferon-stimulated gene expression and intracellular signal transduction, and increases the binding affinity to RIG-I-like receptors, making it suitable for the treatment of tumors and chronic infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115279905B_ABST
    Figure CN115279905B_ABST
Patent Text Reader

Abstract

This disclosure relates in particular to RNA molecules (e.g., RNA hairpin agonists) that bind to and activate RIG-I-like receptors (RLRs), and the use of said molecules, including RLR agonists packaged in virus-like particles (VLPs), in methods for treating a condition (e.g., cancer) or improving one or more symptoms of said condition.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-references to related applications

[0002] This application claims the benefit of U.S. Provisional Patent Application Serial No. 62 / 925,120, filed October 23, 2019. The entire contents of that application are incorporated herein by reference. Technical Field

[0003] This application relates to the field of immune regulation, and more specifically, to the synthesis of RIG-I-like receptor (RLR) agonists and their uses. Background Technology

[0004] Introducing exogenous nucleic acids, especially viral nucleic acids, into cells induces an innate immune response, leading to events such as interferon (IFN) production and cell death. Upon sensing viral RNA, RIG-I-like receptors induce type I interferon (IFN) secretion, resulting in upregulation of antiviral IFN-induced proteins in infected and neighboring cells, thereby inhibiting viral replication. Further downstream events attract immune cells and trigger adaptive immune responses. Additionally, RIG-I ligands have been reported to induce apoptosis in many different types of tumor cells, but not in normal cells.

[0005] Virus-like particles (VLPs) are supramolecular structures composed of one or more types of protein molecules arranged in a symmetrical manner. They lack a viral genome and are therefore non-infectious. VLPs can usually be produced in large quantities through heterologous expression and are easily purified.

[0006] Due to their structural properties and non-infectious nature, VLPs are used in vaccinology, immunology, and medicine. VLPs have been shown to be efficiently represented on MHC class I molecules because they can be efficiently processed and cross-initiated onto MHC class I molecules after being taken up by endocytosis or other cellular uptake pathways.

[0007] Further and improved compositions and methods are still needed to modulate the activity of immunomodulatory proteins. These agents could be used in cancer immunotherapy and the treatment of other conditions such as chronic infections. Improved RIG-I-like receptor ligands, including improved delivery methods, need to be developed for a variety of therapeutic immunomodulatory applications. Summary of the Invention

[0008] This disclosure is based, at least in part, on the discovery of synthetic RNA molecules that act as RIG-I-like receptor (RLR) agonists. This disclosure also provides compositions and methods for enhancing biological activity by packaging immunostimulatory nucleic acids, particularly RLR agonists, into VLPs (RIG-VLPs). The compositions described herein can be used to induce strong and sustained immune responses, and are particularly useful for the treatment of tumors.

[0009] Therefore, in some aspects, this disclosure provides a composition comprising:

[0010] (a) virus-like particles; and

[0011] (b) At least one synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the RLR agonist comprises ribonucleic acid (RNA) of 10-100 nucleotides in length, wherein the 5'most nucleotide of the RNA comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analog thereof, wherein at least one RLR agonist is packaged in a virus-like particle.

[0012] In some aspects, this disclosure provides a composition comprising:

[0013] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0014] (b) At least one synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the RLR agonist comprises ribonucleic acid (RNA) of 10-100 nucleotides in length, wherein the 5'most nucleotide of the RNA comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analog thereof, wherein at least one RLR agonist is packaged in a virus-like particle.

[0015] In any of the foregoing or related respects, RNA is single-stranded. In other respects, some or all of RNA is double-stranded.

[0016] In any of the foregoing or related aspects, the length of the RNA of the RLR agonist is 10-15, 15-20, 20-25, 25-30, or 30-35 nucleotides.

[0017] In any of the foregoing or related aspects, an RLR agonist comprises a first polynucleotide and a second polynucleotide, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a double strand. In some aspects, the double strand comprises a hairpin. In some aspects, the double strand comprises 10–15, 15–20, 20–25, 25–30, or 30–35 base pairs. In some aspects, the double strand comprises fewer than 19 base pairs. In some aspects, the first polynucleotide is linked to the second polynucleotide via a linker.

[0018] In any of the foregoing or related aspects, an RLR agonist comprises a sequence motif that, relative to an agonist not containing the sequence motif, provides at least one biological activity mediated by the RLR.

[0019] In some aspects, this disclosure provides a composition comprising:

[0020] (a) virus-like particles; and

[0021] (b) At least one synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analog thereof, and wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR, relative to an agonist not comprising the sequence motif. In some aspects, the first polynucleotide comprises a sequence motif, wherein at least one RLR agonist is packaged in a virus-like particle.

[0022] In some aspects, this disclosure provides a composition comprising:

[0023] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0024] (b) At least one synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analog thereof, and wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR, relative to an agonist not comprising the sequence motif. In some aspects, the first polynucleotide comprises a sequence motif, wherein at least one RLR agonist is packaged in a virus-like particle.

[0025] In any of the foregoing or related respects, RLR agonists contain sequence motifs selected from the group consisting of:

[0026] (i)GT repeating motif;

[0027] (ii) GA repeating motifs;

[0028] (iii) AUCG repeating motif;

[0029] (iv) AU repeating motif;

[0030] (v) Dipyrimidine motif;

[0031] (vi) Dipurine motif;

[0032] (vii) Pyrimidine triplet motif;

[0033] (viii) Purine triple motif;

[0034] (ix) Palindromic sequence base order; and

[0035] A combination of any one of (x)(i)-(ix).

[0036] In some aspects, this disclosure provides a composition comprising:

[0037] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0038] (b) At least one synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, and wherein the agonist comprises a sequence motif selected from:

[0039] (i)GT repeating motif;

[0040] (ii) GA repeating motifs;

[0041] (iii) AUCG repeating motif;

[0042] (iv) AU repeating motif;

[0043] (v) Dipyrimidine motif;

[0044] (vi) Dipurine motif;

[0045] (vii) Pyrimidine triplet motif;

[0046] (viii) Purine triple motif;

[0047] (ix) Palindromic sequence base order; and

[0048] A combination of any one of (x)(i)-(ix), wherein at least one RLR agonist is packaged in a virus-like particle.

[0049] In some aspects, the RLR agonists disclosed herein comprise combinations of sequence motifs. In some aspects, the combination of sequence motifs is a GT repeat motif and a purine triplet motif. In some aspects, the combination of sequence motifs is an AUCG repeat motif and a dipyrimidine motif. In some aspects, the combination of sequence motifs is an AUCG repeat motif and a dipurine motif.

[0050] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise a sequence motif that, relative to agonists not containing said sequence motif, provides at least one improved RLR-mediated biological activity, wherein the at least one improved biological activity is selected from:

[0051] (i) Increased RLR-mediated cytokine production;

[0052] (ii) RLR-mediated increase in the expression of interferon-stimulated genes;

[0053] (iii) Increased intracellular signaling mediated by RLR;

[0054] (iv) Increased binding affinity to RLR; and

[0055] Combinations of any one of (v)(i)-(iv).

[0056] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise a sequence motif that, relative to agonists not containing said sequence motif, increases RLR-mediated production of type I interferons (e.g., IFN-α, IFN-β). In some aspects, the RLR agonists of this disclosure comprise a sequence motif that, relative to agonists not containing said sequence motif, increases RLR-mediated production of IL-1β. In some aspects, the RLR agonists of this disclosure comprise a sequence motif that, relative to agonists not containing said sequence motif, increases RLR-mediated production of IP-10. In some aspects, the RLR agonists of this disclosure comprise a sequence motif that, relative to agonists not containing said sequence motif, increases RLR-mediated production of IL-6, IL-12p70, MCP-1, and / or MIP-1β.

[0057] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a sequence motif, wherein the sequence motif is a GT repeat motif (e.g., GTGTGT) containing <19, about 15-18, about 15, about 10-15, about 10, about 5-10, about 5, about 4, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif containing <19 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif containing about 15-18 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif containing about 15 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif containing about 10-15 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif containing about 10 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif containing about 5-10 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif containing about 5 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif containing about 4 guanine and thymine nucleotides or their derivatives or analogs. In some respects, GT repeat motifs provide improved biological activity in RLR agonists, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0058] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a sequence motif, wherein the sequence motif is a GT repeat motif comprising 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif comprising 18 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif comprising 16 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif comprising 14 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif comprising 12 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif comprising a sequence of 10 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif comprising a sequence of 8 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif comprising a sequence of 6 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GT repeat motif comprising a sequence of 4 guanine and thymine nucleotides or their derivatives or analogs. In some aspects, the RLR agonist of this disclosure comprises a sequence motif wherein the sequence motif is a GT repeat motif, wherein the GT repeat motif is [GT]. n Where n = 2 to 9, 3-7, or 4-8. In some respects, the GT repeat motif provides improved biological activity in RLR agonists, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0059] In some aspects, this disclosure provides a composition comprising:

[0060] (a) virus-like particles; and

[0061] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked (operably linked) to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR relative to an agonist that does not contain the sequence motif, wherein the first polynucleotide contains the sequence motif, and wherein the sequence motif is a GT repeat motif comprising a sequence of about 14 guanine and thymine nucleotides, wherein the at least one RLR agonist is packaged in the virus-like particle.

[0062] In some aspects, this disclosure provides a composition comprising:

[0063] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0064] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked (operably linked) to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR relative to an agonist that does not contain the sequence motif, wherein the first polynucleotide contains the sequence motif, and wherein the sequence motif is a GT repeat motif comprising a sequence of about 14 guanine and thymine nucleotides, wherein the at least one RLR agonist is packaged in the virus-like particle.

[0065] In some respects, the sequence motif is a GT repeat motif, wherein the GT repeat motif is [GT]7. In some respects, the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity for RLR; and a combination of any of the above.

[0066] In some aspects, this disclosure provides a composition comprising:

[0067] (a) virus-like particles; and

[0068] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR relative to an agonist that does not contain the sequence motif, wherein the first polynucleotide contains the sequence motif, and wherein the sequence motif is a GT repeat motif comprising a sequence of 6 guanine and thymine nucleotides, wherein the at least one RLR agonist is packaged in the virus-like particle.

[0069] In some aspects, this disclosure provides a composition comprising:

[0070] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0071] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR relative to an agonist that does not contain the sequence motif, wherein the first polynucleotide contains the sequence motif, and wherein the sequence motif is a GT repeat motif comprising a sequence of 6 guanine and thymine nucleotides, wherein the at least one RLR agonist is packaged in the virus-like particle.

[0072] In some aspects, the sequence motif is a GT repeat motif, wherein the GT repeat motif is [GT]3. In some aspects, the sequence motif is a GT repeat motif, wherein the GT repeat motif is [GT]3, and wherein the GT repeat is followed by a purine triplet and UCG. In some aspects, the purine triplet is GGA. In some aspects, the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and any combination of the above.

[0073] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a sequence motif, wherein the sequence motif is a GA repeat motif (e.g., GAGAGA) comprising <19, about 15-18, about 15, about 10-15, about 10, about 5-10, about 5, about 4, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif comprising <19 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif comprising about 15-18 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif comprising about 15 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing about 10-15 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing about 10 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing about 5-10 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing about 5 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing about 4 guanine and adenine nucleotides or their derivatives or analogs. In some respects, GA repeat motifs provide improved biological activity in RLR agonists, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0074] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a sequence motif that is a GA repeat motif containing 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing 18 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing 16 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing 14 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing 12 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing a sequence of 8 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing a sequence of 6 guanine and adenine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is a GA repeat motif containing a sequence of 4 guanine and adenine nucleotides or their derivatives or analogs.

[0075] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a sequence motif, wherein said sequence motif is a GA repeat motif, and the GA repeat motif is [GA]. n Where n = 2 to 9, 3 to 7, or 4 to 8. In some respects, GA repeat motifs provide improved biological activity in RLR agonists, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0076] In some aspects, this disclosure provides a composition comprising:

[0077] (a) virus-like particles; and

[0078] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR relative to an agonist that does not contain the sequence motif, wherein the first polynucleotide contains the sequence motif, and wherein the sequence motif is a GA repeat motif comprising a sequence of about 14 guanine and adenine nucleotides, wherein the at least one RLR agonist is packaged in the virus-like particle.

[0079] In some aspects, this disclosure provides a composition comprising:

[0080] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0081] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR relative to an agonist that does not contain the sequence motif, wherein the first polynucleotide contains the sequence motif, and wherein the sequence motif is a GA repeat motif comprising a sequence of about 14 guanine and adenine nucleotides, wherein the at least one RLR agonist is packaged in the virus-like particle.

[0082] In some respects, the sequence motif is a GA repeat motif, wherein the GA repeat motif is [GA]7. In some respects, the GA repeat motif provides improved biological activity in RLR agonists, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity for RLR; and any combination of the above.

[0083] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a sequence motif, wherein the sequence motif is an AUCG repeat motif (e.g., AUCGAUCG) containing <19, about 16, about 12-16, about 12, about 8-12, about 6, 16, 12, or 8 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is an AUCG repeat motif containing <19 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is an AUCG repeat motif containing about 16 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is an AUCG repeat motif containing about 12-16 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is an AUCG repeat motif containing about 12 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is an AUCG repeat motif containing about 8-12 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is an AUCG repeat motif containing about 6 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is an AUCG repeat motif containing 16 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some aspects, the sequence motif is an AUCG repeat motif containing 12 adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some respects, the sequence motif is an AUCG repeat motif comprising the sequence of eight adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs. In some respects, the AUCG repeat motif provides improved biological activity in RLR agonists, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity for RLR; and any combination thereof.

[0084] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a sequence motif, wherein said sequence motif is an AUCG repeat motif, and the AUCG repeat motif is [AUCG]. nWhere n = 2 to 4 or 2, 3 or 4. In some respects, the AUCG repeat motif provides improved biological activity in RLR agonists, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0085] In some aspects, this disclosure provides a composition comprising:

[0086] (a) virus-like particles; and

[0087] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR relative to an agonist not comprising the sequence motif, wherein the first polynucleotide comprises the sequence motif, and wherein the sequence motif is an AUCG repeat motif comprising a sequence of about 12 guanine and adenine nucleotides. In some aspects, the AUCG repeat motif is [AUCG]3, wherein at least one RLR agonist is packaged in a virus-like particle.

[0088] In some aspects, this disclosure provides a composition comprising:

[0089] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0090] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR relative to an agonist not comprising the sequence motif, wherein the first polynucleotide comprises the sequence motif, and wherein the sequence motif is an AUCG repeat motif comprising a sequence of about 12 guanine and adenine nucleotides. In some aspects, the AUCG repeat motif is [AUCG]3, wherein at least one RLR agonist is packaged in a virus-like particle.

[0091] In some respects, the AUCG repeat motif provides improved biological activity in RLR agonists, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0092] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise an AUCG repeat motif, wherein the motif is preceded by a CG or a pyrimidine motif. In some aspects, the AUCG repeat motif is preceded by a CG. In some aspects, the AUCG repeat motif is [AUCG]3 and preceded by a CG. In some aspects, the AUCG repeat motif is [AUCG]3 and preceded by a CC.

[0093] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise an AUCG repeat motif preceded by a dipurine motif. In some aspects, the dipurine motif is GA. In some aspects, the AUCG repeat motif is [AUCG]3 and preceded by the dipurine motif GA. In some aspects, the AUCG repeat motif is preceded by the dipurine motif II.

[0094] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise an AUCG repeat motif, wherein one or more uridine nucleosides (U) are substituted with a modified nucleoside. In some aspects, the modified nucleoside is ribothymidine (T). In some aspects, the AUCG repeat motif is [AUCG]3, wherein one or more uridine nucleosides (U) constituting the AUCG repeat motif are substituted with a modified nucleoside, wherein the modified nucleoside is ribothymidine (T). In some aspects, the AUCG repeat motif is [AUCG]3, wherein one or more uridine nucleosides (U) constituting the AUCG repeat motif are substituted with a modified nucleoside, wherein the modified nucleoside is ribothymidine (T), and wherein the AUCG repeat motif is preceded by GG.

[0095] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise an AUCG repeat motif, wherein one or more guanosine nucleosides (G) are substituted with a modified nucleoside. In some aspects, the modified nucleoside is inosine (I). In some aspects, the AUCG repeat motif is [AUCG]3, wherein one or more guanosine nucleosides (G) constituting the AUCG repeat motif are substituted with a modified nucleoside, wherein the modified nucleoside is ribothymidine (T), and wherein the AUCG repeat motif is preceded by GG.

[0096] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise an AUCG repeat motif, wherein the motif is preceded by IG. In some aspects, the AUCG repeat motif is [AUCG]3 and is preceded by IG.

[0097] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise an AUCG repeat wherein one or more guanosine nucleosides (G) are substituted with inosine (I), wherein the AUCG repeat is preceded by inosine (I). In some aspects, the guanosine nucleosides (G) constituting the AUCG repeat are substituted with inosine (I), wherein the AUCG repeat is preceded by inosine (I), wherein the 5' nucleotide of the first polynucleotide comprises inosine (I).

[0098] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises an AUCG repeat motif, wherein the AUCG repeat motif is [AUCG]2. In some aspects, the sequence motif is an AUCG repeat motif, wherein the AUCG repeat motif is [AUCG]2, and wherein the AUCG repeat motif is preceded by a dipurine motif. In some aspects, the sequence motif is an AUCG repeat motif, wherein the AUCG repeat motif is [AUCG]2, wherein the AUCG repeat motif is preceded by a dipurine motif, and wherein the dipurine motif is GG.

[0099] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises an AUCG repeat motif, wherein the AUCG repeat motif is [AUCG]2, and wherein the AUCG repeat motif is preceded by a purine triple motif. In some aspects, the purine triple motif is GGG. In some aspects, the sequence motif is an AUCG repeat motif, wherein the AUCG repeat motif is [AUCG]2, and wherein the AUCG repeat motif is preceded by a purine triple motif, and wherein the purine triple motif is GGG. In some aspects, the sequence motif is an AUCG repeat motif, wherein the AUCG repeat motif is [AUCG]2, and wherein the AUCG repeat motif is preceded by CCCCCG. In some aspects, the sequence motif is an AUCG repeat motif, wherein the AUCG repeat motif is [AUCG]2, and wherein the AUCG repeat motif is preceded by TCGUCG.

[0100] In some aspects, this disclosure provides a composition comprising:

[0101] (a) virus-like particles; and

[0102] (b) At least one synthetic RLR agonist specifically binding to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first and second polynucleotides are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analog thereof, wherein the agonist comprises an [AUCG]n repeat motif, wherein n = 2-4; wherein the 5'most AUGG repeat motif is preceded by GG, CG, or IG, and wherein at least one RLR agonist is packaged in a virus-like particle. In some aspects, n = 3. In some aspects, each G in the AUGG motif is replaced by inosine.

[0103] In some aspects, this disclosure provides a composition comprising:

[0104] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0105] (b) At least one synthetic RLR agonist specifically binding to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first and second polynucleotides are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analog thereof, wherein the agonist comprises an [AUCG]n repeat motif, wherein n = 2-4; wherein the 5'most AUGG repeat motif is preceded by GG, CG, or IG, and wherein at least one RLR agonist is packaged in a virus-like particle. In some aspects, n = 3. In some aspects, each G in the AUGG motif is replaced by inosine.

[0106] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a sequence motif that is a palindromic sequence comprising <19, about 15-18, about 15, about 10-15, about 10, about 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 nucleotides or their derivatives or analogs linked in any palindromic sequence. In some aspects, the sequence motif is a palindromic sequence comprising <19 nucleotides or their derivatives or analogs linked in any palindromic sequence. In some aspects, the sequence motif is a palindromic sequence comprising about 15-18 nucleotides or their derivatives or analogs linked in any palindromic sequence. In some aspects, the sequence motif is a palindromic sequence comprising about 15 nucleotides or their derivatives or analogs linked in any palindromic sequence. In some aspects, the sequence motif is a palindromic sequence comprising about 10-15 nucleotides or their derivatives or similar sequences linked in any palindrome-producing order. In some aspects, the sequence motif is a palindromic sequence comprising about 10 nucleotides or their derivatives or similar sequences linked in any palindrome-producing order. In some aspects, the sequence motif is a palindromic sequence comprising 18 nucleotides or their derivatives or similar sequences linked in any palindrome-producing order. In some aspects, the sequence motif is a palindromic sequence comprising 17 nucleotides or their derivatives or similar sequences linked in any palindrome-producing order. In some aspects, the sequence motif is a palindromic sequence comprising 16 nucleotides or their derivatives or similar sequences linked in any palindrome-producing order. In some aspects, the sequence motif is a palindromic sequence comprising 15 nucleotides or their derivatives or similar sequences linked in any palindrome-producing order. In some aspects, the sequence motif is a palindromic sequence comprising 14 nucleotides or their derivatives or similar sequences linked in any palindrome-producing order. In some aspects, the sequence motif is a palindromic sequence comprising a sequence of 13 nucleotides or their derivatives or analogs linked in any order that produces a palindrome. In some aspects, the sequence motif is a palindromic sequence comprising a sequence of 12 nucleotides or their derivatives or analogs linked in any order that produces a palindrome. In some aspects, the sequence motif is a palindromic sequence comprising a sequence of 11 nucleotides or their derivatives or analogs linked in any order that produces a palindrome. In some aspects, the sequence motif is a palindromic sequence comprising a sequence of 10 nucleotides or their derivatives or analogs linked in any order that produces a palindrome. In some aspects, the sequence motif is a palindromic sequence comprising a sequence of 9 nucleotides or their derivatives or analogs linked in any order that produces a palindrome. In some aspects, the sequence motif is a palindromic sequence comprising a sequence of 8 nucleotides or their derivatives or analogs linked in any order that produces a palindrome.In some aspects, a sequence motif is a palindromic sequence comprising a sequence of 7 nucleotides, or their derivatives or analogs, linked in any order that produces a palindrome. In some aspects, a sequence motif is a palindromic sequence comprising a sequence of 6 nucleotides, or their derivatives or analogs, linked in any order that produces a palindrome. In some aspects, a sequence motif is a palindromic sequence comprising a sequence of 5 nucleotides, or their derivatives or analogs, linked in any order that produces a palindrome. In some aspects, a sequence motif is a palindromic sequence comprising a sequence of 4 nucleotides, or their derivatives or analogs, linked in any order that produces a palindrome.

[0107] In any of the foregoing or related aspects, the RLR agonist of this disclosure comprises a linker, wherein the linker is side-mounted with an AU repeat motif. In some aspects, the linker is side-mounted with an AU repeat motif, wherein the AU repeat motif is [AU]. n , where n = 2 to 3. In some respects, the repeating motif of AU is [AU]2.

[0108] In some aspects, this disclosure provides a composition comprising:

[0109] (a) virus-like particles; and

[0110] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0111] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0112] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0113] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0114] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0115] (iv) Base pairing between N1 and N4;

[0116] (v) N2 and N3 base pairing;

[0117] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0118] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0119] (viii) X1 and X2 are complementary;

[0120] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0121] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0122] At least one of N1, N2, N3, and N4 is inosine and / or at least one of X1 and / or X2 contains at least one inosine nucleotide, wherein the inosine nucleotide pairs with a cytidine base in the hairpin RNA.

[0123] The at least one RLR agonist is packaged in the virus-like particle.

[0124] In some aspects, this disclosure provides a composition comprising:

[0125] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0126] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0127] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0128] (iv) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0129] (v)(X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3, and N4;

[0130] (vi) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0131] (iv) Base pairing between N1 and N4;

[0132] (v) N2 and N3 base pairing;

[0133] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0134] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0135] (viii) X1 and X2 are complementary;

[0136] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0137] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0138] At least one of N1, N2, N3, and N4 is inosine and / or at least one of X1 and / or X2 contains at least one inosine nucleotide, wherein the inosine nucleotide pairs with a cytidine base in the hairpin RNA.

[0139] The at least one RLR agonist is packaged in the virus-like particle.

[0140] In some respects, the RLR agonists of this disclosure have improved biological activity, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity for RLR; and a combination of any of the above.

[0141] In some aspects, this disclosure provides a composition comprising:

[0142] (a) virus-like particles; and

[0143] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA containing a non-nucleotide linker, and wherein the agonist comprises the following formula:

[0144] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0145] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0146] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0147] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0148] (iv) Base pairing between N1 and N4;

[0149] (v) N2 and N3 base pairing;

[0150] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0151] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0152] (viii) X1 and X2 are complementary;

[0153] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0154] (x)L is the non-nucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0155] If present, inosine pairs with cytidine bases.

[0156] The at least one RLR agonist is packaged in the virus-like particle.

[0157] In some aspects, this disclosure provides a composition comprising:

[0158] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0159] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA containing a non-nucleotide linker, and wherein the agonist comprises the following formula:

[0160] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0161] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0162] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0163] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0164] (iv) Base pairing between N1 and N4;

[0165] (v) N2 and N3 base pairing;

[0166] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0167] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0168] (viii) X1 and X2 are complementary;

[0169] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0170] (x)L is the non-nucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0171] If present, inosine pairs with cytidine bases.

[0172] The at least one RLR agonist is packaged in the virus-like particle.

[0173] In some respects, the RLR agonists of this disclosure have improved biological activity, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity for RLR; and a combination of any of the above.

[0174] In some aspects, N1 contains inosine and N4 contains cytidine. In some aspects, N1 contains inosine and N4 contains cytidine, and X1 and X2 are each 12 nucleotides in length. In some aspects, N1 contains cytidine and N4 contains inosine. In some aspects, N2 contains inosine and N3 contains cytidine. In some aspects, N2 contains cytidine and N3 contains inosine. In some aspects, N1 contains guanosine. In some aspects, N2 contains guanosine. In some aspects, N1 contains cytidine. In some aspects, N2 contains cytidine. In some aspects, N1 and N2 contain guanosine and N3 and N4 contain cytidine. In some aspects, N1 and N2 contain cytidine and N3 and N4 contain guanosine. In some aspects, N1 and N2 contain inosine and N3 and N4 contain cytidine. In some aspects, N1 and N2 contain cytidine and N3 and N4 contain inosine.

[0175] In any of the foregoing or related aspects, the RLR agonists disclosed herein comprise the following formula:

[0176] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0177] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0178] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0179] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0180] (iv) Base pairing between N1 and N4;

[0181] (v) N2 and N3 base pairing;

[0182] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0183] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0184] (viii) X1 and X2 are complementary;

[0185] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0186] (x)L is the non-nucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0187] If present, inosine is paired with cytidine, wherein N1 contains inosine and N4 contains cytidine, and X1 and / or X2 each contains at least one inosine. In some aspects, N2 contains inosine and N3 contains cytidine, and X1 and / or X2 each contains at least one inosine. In some aspects, N1 and N2 contain guanosine, N3 and N4 contain cytidine, and X1 and / or X2 each contain at least one inosine. In some aspects, N1 and N2 contain guanosine and N3 and N4 contain cytidine, and X1 and X2 each contain at least one inosine. In some aspects, N1 and N2 contain guanosine and N3 and N4 contain cytidine, X1 and X2 each contain at least one inosine, and X1 and X2 are each 12 nucleotides in length. In some aspects, N1 and N2 contain cytidine and N3 and N4 contain guanosine, and X1 and X2 each contain at least one inosine. In some aspects, N1 and N2 contain guanosine and N3 and N4 contain cytidine, and X1 and X2 each contain inosine and do not contain guanosine nucleoside. In some aspects, N1 and N2 contain guanosine and N3 and N4 contain cytidine, X1 and X2 each contain at least one inosine, and X1 and X2 are each 12 nucleotides in length. In some aspects, N1 and N2 contain cytidine and N3 and N4 contain guanosine, and X1 and X2 each contain inosine and do not contain guanosine nucleoside. In some aspects, the RLR agonists of this disclosure have improved biological activity, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0188] In any of the foregoing or related aspects, the RLR agonists disclosed herein comprise the following formula:

[0189] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0190] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0191] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0192] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0193] (iv) Base pairing between N1 and N4;

[0194] (v) N2 and N3 base pairing;

[0195] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0196] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0197] (viii) X1 and X2 are complementary;

[0198] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0199] (x)L is the non-nucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0200] If present, inosine is paired with cytidine, and N1 and N2 contain inosine and N3 and N4 contain cytidine, and X1 and / or X2 each contain at least one inosine. In some aspects, N1 and N2 contain inosine and N3 and N4 contain cytidine, X1 and X2 each contain at least one inosine, and X1 and X2 are each 12 nucleotides in length. In some aspects, N1 and N2 contain inosine and N3 and N4 contain cytidine, and X1 and X2 each contain at least one inosine. In some aspects, N1 and N2 contain inosine and N3 and N4 contain cytidine, X1 and X2 each contain at least one inosine, and X1 and X2 are each 12 nucleotides in length. In some aspects, N1 and N2 contain cytidine and N3 and N4 contain inosine, and X1 and / or X2 each contain at least one inosine. In some aspects, N1 and N2 contain inosine and N3 and N4 contain cytidine, and X1 and X2 contain inosine but not guanosine. In some aspects, N1 and N2 contain cytidine and N3 and N4 contain inosine, and X1 and X2 contain inosine but not guanosine. In some aspects, the RLR agonists of this disclosure have improved biological activity, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0201] In any of the foregoing or related aspects, the RLR agonists disclosed herein comprise the following formula:

[0202] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', wherein X1 and X2 are each 12 nucleotides and contain 1, 2, 3, or 4 inosine nucleosides. In some aspects, X1 and X2 are each 13 nucleotides and contain 1, 2, 3, 4, or 5 inosine nucleosides. In some aspects, X1 and X2 are each 14 nucleotides and contain 1, 2, 3, 4, 5, or 6 inosine nucleosides. In some aspects, X1 and X2 are each 15 nucleotides and contain 1, 2, 3, 4, 5, 6, or 7 inosine nucleosides. In some aspects, X1 and X2 are each 16 nucleotides and each contains 1, 2, 3, 4, 5, 6, 7, or 8 inosine nucleosides. In some aspects, X1 and X2 are each 12 nucleotides and contain at least 10%, 20%, 30%, or 40% inosine nucleosides. In some respects, the RLR agonists of this disclosure have improved biological activity, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity for RLR; and a combination of any of the above.

[0203] In some aspects, this disclosure provides a composition comprising:

[0204] (a) virus-like particles; and

[0205] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0206] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0207] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0208] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0209] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0210] (iv) Base pairing between N1 and N4;

[0211] (v) N2 and N3 base pairing;

[0212] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0213] (vii)X1 contains the sequence motif [AUCN5]. x N5 contains guanosine or inosine, where x is an integer whose value represents the number of sequence motifs, and where x = 2-4;

[0214] (viii)X2 contains the sequence motif [CN6AU]. y , where N6 contains guanosine or inosine, where y is an integer whose value represents the number of sequence motifs, and where y = 2-4;

[0215] (ix)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0216] Optionally, at least one of N1, N2, N3, and N4 is inosine, and wherein the inosine nucleotide pairs with a cytidine base in the hairpin RNA.

[0217] The at least one RLR agonist is packaged in the virus-like particle.

[0218] In some aspects, this disclosure provides a composition comprising:

[0219] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0220] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0221] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0222] (iv) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0223] (v)(X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3, and N4;

[0224] (vi) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0225] (iv) Base pairing between N1 and N4;

[0226] (v) N2 and N3 base pairing;

[0227] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0228] (vii)X1 contains the sequence motif [AUCN5].x N5 contains guanosine or inosine, where x is an integer whose value represents the number of sequence motifs, and where x = 2-4;

[0229] (viii)X2 contains the sequence motif [CN6AU]. y , where N6 contains guanosine or inosine, where y is an integer whose value represents the number of sequence motifs, and where y = 2-4;

[0230] (ix)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0231] Optionally, at least one of N1, N2, N3, and N4 is inosine, and wherein the inosine nucleotide pairs with a cytidine base in the hairpin RNA.

[0232] The at least one RLR agonist is packaged in the virus-like particle.

[0233] In some aspects, N5 contains inosine and N6 contains inosine. In some aspects, N5 contains guanosine and N6 contains inosine. In some aspects, N5 contains inosine and N6 contains guanosine. In some aspects, N5 contains guanosine (G) and N6 contains guanosine (G). In some aspects, x = 2 and y = 2. In some aspects, x = 3 and y = 3. In some aspects, x = 4 and y = 4. In some aspects, N1 contains inosine (I) and N4 contains cytidine (C). In some aspects, N2 contains inosine (I) and N3 contains cytidine (C). In some aspects, N3 contains inosine (I) and N2 contains cytidine (C). In some aspects, N4 contains inosine (I) and N1 contains cytidine (C). In some aspects, N1 contains guanosine (G). In some aspects, N2 contains guanosine (G). In some aspects, N1 contains cytidine (C). In some aspects, N2 contains cytidine (C). In some aspects, N1 and N2 contain guanosine (G) and N3 and N4 contain cytidine (C). In some aspects, N1 and N2 contain cytidine (C) and N3 and N4 contain guanosine (G). In some aspects, N1 and N2 contain inosine (I) and N3 and N4 contain cytidine (C). In some aspects, N1 and N2 contain cytidine (C) and N3 and N4 contain inosine (I). In some aspects, the RLR agonists of this disclosure have improved biological activity, wherein the improved biological activity is an increase in RLR-mediated cytokine production; an increase in RLR-mediated expression of interferon-stimulated genes; an increase in RLR-mediated intracellular signaling; an increase in binding affinity to RLR; and a combination of any of the above.

[0234] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise a linker, wherein the linker is a nucleotide linker or a non-nucleotide linker. In some aspects, the linker is a non-nucleotide linker. In some aspects, the linker is a nucleotide linker. In some aspects, the nucleotide linker comprises a tetracycle, wherein the nucleotide sequence of the tetracycle is selected from the group consisting of:

[0235] (a) UNCG, where N = A, C, G or U;

[0236] (b) GNRA, where N = A, C, G or U, and where R = A or G;

[0237] (c) ANYA, where N = A, C, G or U, and where Y = C or T;

[0238] (d)CUYG, where Y = C or T;

[0239] (e) UMAC, where M = A or C; and

[0240] (f)CUUG.

[0241] In some respects, the sequence of the four-ring is UUCG. In other respects, the sequence of the four-ring is GAUC.

[0242] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise a nucleotide linker, wherein the nucleotide linker comprises the nucleotide sequence UUUGAU or UGUUU. In some aspects, the nucleotide linker comprises the nucleotide sequence UUUGAU. In some aspects, the nucleotide linker comprises the nucleotide sequence UGUUU.

[0243] In any of the foregoing or related aspects, the RLR agonists disclosed herein comprise nonnucleotide linkers, wherein the nonnucleotide linkers are selected from the group consisting of:

[0244] (a) Ethylene glycol connector; and

[0245] (b) Alkyl connector.

[0246] In some respects, the non-nucleotide linker is a hexaethylene glycol linker. In other respects, the non-nucleotide linker is a C9 alkyl linker.

[0247] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise a 5' diphosphate moiety or a derivative or analogue thereof. In some aspects, the agonist comprises a 5' triphosphate moiety or a derivative or analogue thereof. In some aspects, the derivative or analogue of the 5' diphosphate or triphosphate moiety comprises a phosphate ester bioisostere selected from: phosphonates, thiophosphonates, thiophosphates, sulfates, sulfonates, aminosulfonates, thiazolidinones, carboxylates, malonic esters, boric acid, benzoxadiborone pentane, borophosphates, and squaramide.

[0248] In any of the foregoing or related aspects, the RLR agonists of this disclosure comprise modified nucleotides, modified nucleosides, or modified nucleobases, or combinations thereof. In some aspects, the agonists comprise modifications to internucleotide linkages or to the polynucleotide backbone.

[0249] In any of the foregoing or related aspects, the RLR agonists of this disclosure exhibit one or more of the following properties:

[0250] (a) Specifically binds to one or more RLRs (e.g., RIG-1, MDA5 and / or LGP2);

[0251] (b) Increased RLR-mediated cytokine production;

[0252] (c) Increase the expression of RLR-mediated interferon-stimulated gene (ISG);

[0253] (d) Increases RLR-dependent intracellular signaling;

[0254] (e) Increase the stability of the double strand;

[0255] (f) Increases binding affinity to RLR;

[0256] (g) Reduce off-target binding;

[0257] (h) Prolonging the biological half-life;

[0258] (i) Increase biological distribution and bioavailability;

[0259] (j) Increase and / or enhance uptake into cells and / or tissues;

[0260] (k) Reduced immunogenicity; and

[0261] A combination of any term in (l)(a)-(k).

[0262] In some aspects, this disclosure provides a composition comprising:

[0263] (a) virus-like particles; and

[0264] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0265] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0266] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0267] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0268] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0269] (iv) Base pairing between N1 and N4;

[0270] (v) N2 and N3 base pairing;

[0271] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0272] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0273] (viii) X1 and X2 are complementary;

[0274] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0275] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0276] N1 and N2 each contain guanosine, N3 and N4 each contain cytidine, X1 and X2 are each 12 nucleotides in length, X1 and X2 each contain at least one inosine nucleotide, the inosine nucleotide pairs with the cytidine base in the hairpin RNA, and L contains a four-loop nucleotide linker with the sequence UUCG.

[0277] The at least one RLR agonist is packaged in the virus-like particle.

[0278] In some aspects, this disclosure provides a composition comprising:

[0279] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0280] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0281] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0282] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0283] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0284] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0285] (iv) Base pairing between N1 and N4;

[0286] (v) N2 and N3 base pairing;

[0287] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0288] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0289] (viii) X1 and X2 are complementary;

[0290] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0291] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0292] N1 and N2 each contain guanosine, N3 and N4 each contain cytidine, X1 and X2 are each 12 nucleotides in length, X1 and X2 each contain at least one inosine nucleotide, the inosine nucleotide pairs with the cytidine base in the hairpin RNA, and L contains a four-loop nucleotide linker with the sequence UUCG.

[0293] The at least one RLR agonist is packaged in the virus-like particle.

[0294] In some aspects, this disclosure provides a composition comprising:

[0295] (a) virus-like particles; and

[0296] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0297] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0298] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0299] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0300] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0301] (iv) Base pairing between N1 and N4;

[0302] (v) N2 and N3 base pairing;

[0303] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0304] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0305] (viii) X1 and X2 are complementary;

[0306] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0307] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0308] N1 contains inosine and N2 contains guanosine, N3 and N4 each contain cytidine, X1 and X2 are each 12 nucleotides in length, X1 and X2 each contain at least one inosine nucleotide, the inosine nucleotide pairs with the cytidine bases in the hairpin RNA, and L contains a four-loop nucleotide linker with the nucleotide sequence UUCG.

[0309] The at least one RLR agonist is packaged in the virus-like particle.

[0310] In some aspects, this disclosure provides a composition comprising:

[0311] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0312] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0313] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0314] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0315] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0316] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0317] (iv) Base pairing between N1 and N4;

[0318] (v) N2 and N3 base pairing;

[0319] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0320] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0321] (viii) X1 and X2 are complementary;

[0322] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0323] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0324] N1 contains inosine and N2 contains guanosine, N3 and N4 each contain cytidine, X1 and X2 are each 12 nucleotides in length, X1 and X2 each contain at least one inosine nucleotide, the inosine nucleotide pairs with the cytidine bases in the hairpin RNA, and L contains a four-loop nucleotide linker with the nucleotide sequence UUCG.

[0325] The at least one RLR agonist is packaged in the virus-like particle.

[0326] In some aspects, this disclosure provides a composition comprising:

[0327] (a) virus-like particles; and

[0328] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0329] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0330] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0331] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0332] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0333] (iv) Base pairing between N1 and N4;

[0334] (v) N2 and N3 base pairing;

[0335] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0336] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0337] (viii) X1 and X2 are complementary;

[0338] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0339] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0340] N1 and N2 contain inosine, and N3 and N4 contain cytidine. X1 and X2 are each 12 nucleotides in length, and each X1 and X2 contains at least one inosine nucleotide. The inosine nucleotide pairs with the cytidine bases in the hairpin RNA. L contains a four-loop nucleotide linker with the nucleotide sequence UUCG.

[0341] The at least one RLR agonist is packaged in the virus-like particle.

[0342] In some aspects, this disclosure provides a composition comprising:

[0343] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0344] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0345] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0346] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0347] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0348] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0349] (iv) Base pairing between N1 and N4;

[0350] (v) N2 and N3 base pairing;

[0351] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0352] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0353] (viii) X1 and X2 are complementary;

[0354] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0355] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0356] N1 and N2 contain inosine, and N3 and N4 contain cytidine. X1 and X2 are each 12 nucleotides in length, and each X1 and X2 contains at least one inosine nucleotide. The inosine nucleotide pairs with the cytidine bases in the hairpin RNA. L contains a four-loop nucleotide linker with the nucleotide sequence UUCG.

[0357] The at least one RLR agonist is packaged in the virus-like particle.

[0358] In some aspects, this disclosure provides a composition comprising:

[0359] (a) virus-like particles; and

[0360] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA containing a non-nucleotide linker, and wherein the agonist comprises the following formula:

[0361] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0362] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0363] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0364] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0365] (iv) Base pairing between N1 and N4;

[0366] (v) N2 and N3 base pairing;

[0367] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0368] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0369] (viii) X1 and X2 are complementary;

[0370] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0371] (x)L is the non-nucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0372] N1 and N2 contain guanosine, N3 and N4 contain cytidine, X1 and X2 are each 12 nucleotides in length, and the non-nucleotide linkers are C9 alkyl linkers.

[0373] The at least one RLR agonist is packaged in the virus-like particle.

[0374] In some aspects, this disclosure provides a composition comprising:

[0375] (a) virus-like particles; and

[0376] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA containing a non-nucleotide linker, and wherein the agonist comprises the following formula:

[0377] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0378] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0379] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0380] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0381] (iv) Base pairing between N1 and N4;

[0382] (v) N2 and N3 base pairing;

[0383] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0384] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0385] (viii) X1 and X2 are complementary;

[0386] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0387] (x)L is the non-nucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0388] N1 and N2 contain guanosine, N3 and N4 contain cytidine, X1 and X2 are each 12 nucleotides in length, and the non-nucleotide linkers are hexaethylene glycol linkers.

[0389] The at least one RLR agonist is packaged in the virus-like particle.

[0390] In some aspects, this disclosure provides a composition comprising:

[0391] (a) virus-like particles; and

[0392] (b) At least one RLR agonist that specifically binds to the RLR, wherein the 5'most nucleotide of the agonist comprises a 5' diphosphate or triphosphate moiety or a derivative thereof or analogue, and wherein the agonist comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 and 36.

[0393] The at least one RLR agonist is packaged in the virus-like particle.

[0394] In some aspects, this disclosure provides a composition comprising:

[0395] (a) virus-like particles; and

[0396] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analog thereof, wherein the agonist comprises a sequence motif that, relative to an agonist not comprising the sequence motif, provides at least one improved biological activity mediated by the RLR, and wherein the first polynucleotide and the second polynucleotide comprise nucleotide sequences selected from the group consisting of:

[0397] (i) are SEQ ID NO:37 and 68, respectively;

[0398] (ii) are SEQ ID NO:38 and 69, respectively;

[0399] (iii) are SEQ ID NO:39 and 70, respectively;

[0400] (iv) are SEQ ID NO:40 and 71, respectively;

[0401] (v) are SEQ ID NO:41 and 72, respectively;

[0402] (vi) are SEQ ID NO:42 and 73 respectively;

[0403] (vii) are SEQ ID NO:43 and 74, respectively;

[0404] (viii) are SEQ ID NO:44 and 75, respectively;

[0405] (ix) are SEQ ID NO:45 and 76, respectively;

[0406] (x) are SEQ ID NO:46 and 77, respectively;

[0407] (xi) are SEQ ID NO:47 and 78, respectively;

[0408] (xii) are SEQ ID NO:48 and 79, respectively;

[0409] (xiii) are SEQ ID NO:49 and 80, respectively;

[0410] (xiv) are SEQ ID NO:50 and 81, respectively;

[0411] (xv) are SEQ ID NO:51 and 82, respectively;

[0412] (xvi) are SEQ ID NO:52 and 83, respectively;

[0413] (xvii) are SEQ ID NO:53 and 84, respectively;

[0414] (xviii) are SEQ ID NO:54 and 85, respectively;

[0415] (xix) are SEQ ID NO:55 and 86, respectively;

[0416] (xx) are SEQ ID NO:56 and 87 respectively;

[0417] (xxi) are SEQ ID NO:57 and 88, respectively;

[0418] (xxii) are SEQ ID NO:58 and 89, respectively;

[0419] (xxiii) are SEQ ID NO:59 and 89, respectively;

[0420] (xxiv) are SEQ ID NO:60 and 90, respectively;

[0421] (xxv) are SEQ ID NO:61 and 91, respectively;

[0422] (xxvi) are SEQ ID NO:62 and 92, respectively;

[0423] (xxvii) are SEQ ID NO:63 and 91, respectively;

[0424] (xxviii) are SEQ ID NO:64 and 93, respectively;

[0425] (xxix) are SEQ ID NO:65 and 94, respectively;

[0426] (xxx) are SEQ ID NO: 66 and 95 respectively;

[0427] (xxxi) are SEQ ID NO: 67 and 96 respectively; and

[0428] (xxxii) are SEQ ID NO:63 and 97, respectively.

[0429] The at least one RLR agonist is packaged in the virus-like particle.

[0430] In some aspects, this disclosure provides a composition comprising:

[0431] (a) virus-like particles; and

[0432] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising at least one or more nucleotides containing inosine that pair with cytidine bases, and wherein the agonist comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 22, 23 and 25.

[0433] The at least one RLR agonist is packaged in the virus-like particle.

[0434] In some aspects, this disclosure provides a composition comprising:

[0435] (a) virus-like particles; and

[0436] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising at least one or more nucleotides containing inosine that pair with cytidine bases, wherein the agonist comprises the formula 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', wherein (N1-N2-X1) comprises a first polynucleotide and (X2-N3-N4) comprises a second polynucleotide, and wherein the first polynucleotide and the second polynucleotide comprise nucleotide sequences selected from the group consisting of:

[0437] (i) are SEQ ID NO:58 and 89, respectively;

[0438] (ii) are SEQ ID NO:59 and 89 respectively; and

[0439] (iii) are SEQ ID NO:61 and 91, respectively.

[0440] The at least one RLR agonist is packaged in the virus-like particle.

[0441] In some aspects, this disclosure provides a composition comprising:

[0442] (a) virus-like particles; and

[0443] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a non-nucleotide linker, wherein the agonist comprises the formula 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', wherein (N1-N2-X1) comprises a first polynucleotide and (X2-N3-N4) comprises a second polynucleotide, and wherein the first polynucleotide and the second polynucleotide comprise nucleotide sequences selected from the group consisting of:

[0444] (i) are SEQ ID NO:37 and 68, respectively;

[0445] (ii) are SEQ ID NO:38 and 69, respectively;

[0446] (iii) are SEQ ID NO:39 and 70, respectively;

[0447] (iv) are SEQ ID NO:40 and 71, respectively;

[0448] (v) are SEQ ID NO:41 and 72, respectively;

[0449] (vi) are SEQ ID NO:42 and 73 respectively;

[0450] (vii) are SEQ ID NO:43 and 74, respectively;

[0451] (viii) are SEQ ID NO:44 and 75, respectively;

[0452] (ix) are SEQ ID NO:45 and 76, respectively;

[0453] (x) are SEQ ID NO:46 and 77, respectively;

[0454] (xi) are SEQ ID NO:47 and 78, respectively;

[0455] (xii) are SEQ ID NO:48 and 79, respectively;

[0456] (xiii) are SEQ ID NO:49 and 80, respectively;

[0457] (xiv) are SEQ ID NO:50 and 81, respectively;

[0458] (xv) are SEQ ID NO:51 and 82, respectively;

[0459] (xvi) are SEQ ID NO:52 and 83, respectively;

[0460] (xvii) are SEQ ID NO:53 and 84, respectively;

[0461] (xviii) are SEQ ID NO:54 and 85, respectively;

[0462] (xix) are SEQ ID NO:55 and 86, respectively;

[0463] (xx) are SEQ ID NO:56 and 87 respectively;

[0464] (xxi) are SEQ ID NO:57 and 88, respectively;

[0465] (xxii) are SEQ ID NO:58 and 89, respectively;

[0466] (xxiii) are SEQ ID NO:59 and 89, respectively;

[0467] (xxiv) are SEQ ID NO:60 and 90, respectively;

[0468] (xxv) are SEQ ID NO:61 and 91, respectively;

[0469] (xxvi) are SEQ ID NO:62 and 92, respectively;

[0470] (xxvii) are SEQ ID NO:63 and 91, respectively;

[0471] (xxviii) are SEQ ID NO:64 and 93, respectively;

[0472] (xxix) are SEQ ID NO:65 and 94, respectively;

[0473] (xxx) are SEQ ID NO: 66 and 95 respectively;

[0474] (xxxi) are SEQ ID NO: 67 and 96 respectively; and

[0475] (xxxii) are SEQ ID NO:63 and 97, respectively.

[0476] The at least one RLR agonist is packaged in the virus-like particle.

[0477] In some aspects, this disclosure provides a composition comprising:

[0478] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0479] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA containing a non-nucleotide linker, and wherein the agonist comprises the following formula:

[0480] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0481] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0482] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0483] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0484] (iv) Base pairing between N1 and N4;

[0485] (v) N2 and N3 base pairing;

[0486] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0487] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0488] (viii) X1 and X2 are complementary;

[0489] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0490] (x)L is the non-nucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0491] N1 and N2 contain guanosine, N3 and N4 contain cytidine, X1 and X2 are each 12 nucleotides in length, and the non-nucleotide linkers are C9 alkyl linkers.

[0492] The at least one RLR agonist is packaged in the virus-like particle.

[0493] In some aspects, this disclosure provides a composition comprising:

[0494] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0495] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA containing a non-nucleotide linker, and wherein the agonist comprises the following formula:

[0496] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0497] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0498] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0499] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0500] (iv) Base pairing between N1 and N4;

[0501] (v) N2 and N3 base pairing;

[0502] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0503] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0504] (viii) X1 and X2 are complementary;

[0505] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0506] (x)L is the non-nucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0507] N1 and N2 contain guanosine, N3 and N4 contain cytidine, X1 and X2 are each 12 nucleotides in length, and the non-nucleotide linkers are hexaethylene glycol linkers.

[0508] The at least one RLR agonist is packaged in the virus-like particle.

[0509] In some aspects, this disclosure provides a composition comprising:

[0510] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0511] (b) At least one RLR agonist that specifically binds to the RLR, wherein the 5'most nucleotide of the agonist comprises a 5' diphosphate or triphosphate moiety or a derivative thereof or analogue, and wherein the agonist comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 and 36.

[0512] The at least one RLR agonist is packaged in the virus-like particle.

[0513] In some aspects, this disclosure provides a composition comprising:

[0514] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0515] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first oligonucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analog thereof, wherein the agonist comprises a sequence motif that, relative to an agonist not comprising the sequence motif, provides at least one improved biological activity mediated by the RLR, and wherein the first polynucleotide and the second polynucleotide comprise nucleotide sequences selected from the group consisting of:

[0516] (i) are SEQ ID NO:37 and 68, respectively;

[0517] (ii) are SEQ ID NO:38 and 69, respectively;

[0518] (iii) are SEQ ID NO:39 and 70, respectively;

[0519] (iv) are SEQ ID NO:40 and 71, respectively;

[0520] (v) are SEQ ID NO:41 and 72, respectively;

[0521] (vi) are SEQ ID NO:42 and 73 respectively;

[0522] (vii) are SEQ ID NO:43 and 74, respectively;

[0523] (viii) are SEQ ID NO:44 and 75, respectively;

[0524] (ix) are SEQ ID NO:45 and 76, respectively;

[0525] (x) are SEQ ID NO:46 and 77, respectively;

[0526] (xi) are SEQ ID NO:47 and 78, respectively;

[0527] (xii) are SEQ ID NO:48 and 79, respectively;

[0528] (xiii) are SEQ ID NO:49 and 80, respectively;

[0529] (xiv) are SEQ ID NO:50 and 81, respectively;

[0530] (xv) are SEQ ID NO:51 and 82, respectively;

[0531] (xvi) are SEQ ID NO:52 and 83, respectively;

[0532] (xvii) are SEQ ID NO:53 and 84, respectively;

[0533] (xviii) are SEQ ID NO:54 and 85, respectively;

[0534] (xix) are SEQ ID NO:55 and 86, respectively;

[0535] (xx) are SEQ ID NO:56 and 87 respectively;

[0536] (xxi) are SEQ ID NO:57 and 88, respectively;

[0537] (xxii) are SEQ ID NO:58 and 89, respectively;

[0538] (xxiii) are SEQ ID NO:59 and 89, respectively;

[0539] (xxiv) are SEQ ID NO:60 and 90, respectively;

[0540] (xxv) are SEQ ID NO:61 and 91, respectively;

[0541] (xxvi) are SEQ ID NO:62 and 92, respectively;

[0542] (xxvii) are SEQ ID NO:63 and 91, respectively;

[0543] (xxviii) are SEQ ID NO:64 and 93, respectively;

[0544] (xxix) are SEQ ID NO:65 and 94, respectively;

[0545] (xxx) are SEQ ID NO: 66 and 95 respectively;

[0546] (xxxi) are SEQ ID NO: 67 and 96 respectively; and

[0547] (xxxii) are SEQ ID NO:63 and 97, respectively.

[0548] The at least one RLR agonist is packaged in the virus-like particle.

[0549] In some aspects, this disclosure provides a composition comprising:

[0550] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0551] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising at least one or more nucleotides containing inosine that pair with cytidine bases, and wherein the agonist comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 22, 23, and 25.

[0552] The at least one RLR agonist is packaged in the virus-like particle.

[0553] In some aspects, this disclosure provides a composition comprising:

[0554] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0555] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising at least one or more nucleotides containing inosine that pair with cytidine bases, wherein the agonist comprises the formula 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', wherein (N1-N2-X1) comprises a first polynucleotide and (X2-N3-N4) comprises a second polynucleotide, and wherein the first polynucleotide and the second polynucleotide comprise nucleotide sequences selected from the group consisting of:

[0556] (i) are SEQ ID NO:58 and 89, respectively;

[0557] (ii) are SEQ ID NO:59 and 89 respectively; and

[0558] (iii) are SEQ ID NO:61 and 91, respectively.

[0559] The at least one RLR agonist is packaged in the virus-like particle.

[0560] In some aspects, this disclosure provides a composition comprising:

[0561] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0562] (b) At least one RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising a non-nucleotide linker, wherein the agonist comprises the formula 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', wherein (N1-N2-X1) comprises a first polynucleotide and (X2-N3-N4) comprises a second polynucleotide, and wherein the first polynucleotide and the second polynucleotide comprise nucleotide sequences selected from the group consisting of:

[0563] (i) are SEQ ID NO:37 and 68, respectively;

[0564] (ii) are SEQ ID NO:38 and 69, respectively;

[0565] (iii) are SEQ ID NO:39 and 70, respectively;

[0566] (iv) are SEQ ID NO:40 and 71, respectively;

[0567] (v) are SEQ ID NO:41 and 72, respectively;

[0568] (vi) are SEQ ID NO:42 and 73 respectively;

[0569] (vii) are SEQ ID NO:43 and 74, respectively;

[0570] (viii) are SEQ ID NO:44 and 75, respectively;

[0571] (ix) are SEQ ID NO:45 and 76, respectively;

[0572] (x) are SEQ ID NO:46 and 77, respectively;

[0573] (xi) are SEQ ID NO:47 and 78, respectively;

[0574] (xii) are SEQ ID NO:48 and 79, respectively;

[0575] (xiii) are SEQ ID NO:49 and 80, respectively;

[0576] (xiv) are SEQ ID NO:50 and 81, respectively;

[0577] (xv) are SEQ ID NO:51 and 82, respectively;

[0578] (xvi) are SEQ ID NO:52 and 83, respectively;

[0579] (xvii) are SEQ ID NO:53 and 84, respectively;

[0580] (xviii) are SEQ ID NO:54 and 85, respectively;

[0581] (xix) are SEQ ID NO:55 and 86, respectively;

[0582] (xx) are SEQ ID NO:56 and 87 respectively;

[0583] (xxi) are SEQ ID NO:57 and 88, respectively;

[0584] (xxii) are SEQ ID NO:58 and 89, respectively;

[0585] (xxiii) are SEQ ID NO:59 and 89, respectively;

[0586] (xxiv) are SEQ ID NO:60 and 90, respectively;

[0587] (xxv) are SEQ ID NO:61 and 91, respectively;

[0588] (xxvi) are SEQ ID NO:62 and 92, respectively;

[0589] (xxvii) are SEQ ID NO:63 and 91, respectively;

[0590] (xxviii) are SEQ ID NO:64 and 93, respectively;

[0591] (xxix) are SEQ ID NO:65 and 94, respectively;

[0592] (xxx) are SEQ ID NO: 66 and 95 respectively;

[0593] (xxxi) are SEQ ID NO: 67 and 96 respectively; and

[0594] (xxxii) are SEQ ID NO:63 and 97, respectively.

[0595] The at least one RLR agonist is packaged in the virus-like particle. In any of the foregoing or related aspects, the nucleotide sequence containing the RLR agonist is not complementary to the genomic DNA sequence or mRNA sequence, the RLR agonist does not participate in RNA interference, and the RLR agonist does not silence gene expression.

[0596] In any of the foregoing or related respects, the virus-like particles described herein lack a lipoprotein-containing envelope.

[0597] In any of the foregoing or related respects, the virus-like particles described herein are recombinant virus-like particles. In some respects, recombinant virus-like particles are selected from the group consisting of:

[0598] (a) Recombinant protein of hepatitis B virus;

[0599] (b) Recombinant proteins of measles virus;

[0600] (c) Recombinant proteins of Sinbis virus;

[0601] (d) Recombinant proteins of rotavirus;

[0602] (e) Recombinant proteins of foot-and-mouth disease virus;

[0603] (f) Recombinant proteins of retroviruses;

[0604] (g) Recombinant proteins of Norwalk virus;

[0605] (h) Recombinant proteins of human papillomavirus;

[0606] (i) Recombinant proteins of BK virus;

[0607] (j) Recombinant proteins of bacteriophages;

[0608] (k) Recombinant proteins from RNA bacteriophages;

[0609] (l) Recombinant proteins of Qβ phage;

[0610] (m)Recombinant protein of GA phage;

[0611] (n)fr recombinant proteins of bacteriophages;

[0612] (o)Recombinant protein of AP 205 phage;

[0613] (p)Ty recombinant protein; and

[0614] Fragments of any recombinant protein from (q)(a) to (p).

[0615] In any of the foregoing or related aspects, the virus-like particles described herein comprise recombinant proteins of RNA phages selected from the group consisting of: (a) phage Qβ; (b) phage R17; (c) phage fr; (d) phage GA; (e) phage SP; (f) phage MS2; (g) phage M11; (h) phage MX1; (i) phage NL95; (j) phage f2; (k) phage PP7; and (l) phage AP205.

[0616] In any of the foregoing or related aspects, the virus-like particles described herein comprise recombinant proteins of phage Qβ. In some aspects, the recombinant proteins of phage Qβ comprise a capsid protein having the amino acid sequence SEQ ID NO:112. In some aspects, the recombinant proteins of phage Qβ comprise a capsid protein having an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:112.

[0617] In some aspects, this disclosure provides a composition comprising:

[0618] (a) A virus-like particle of RNA bacteriophage Qβ, comprising a capsid protein having the amino acid sequence SEQ ID NO:112; and

[0619] (b) At least one synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the RLR agonist comprises ribonucleic acid (RNA) of 10-100 nucleotides in length, wherein the 5'most nucleotide of the RNA comprises a 5' diphosphate or triphosphate portion or a derivative thereof or analogue.

[0620] The at least one RLR agonist is packaged in the virus-like particle.

[0621] In some aspects, this disclosure provides a composition comprising:

[0622] (a) Virus-like particles of RNA bacteriophage Qβ; and

[0623] (b) At least one synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises the nucleotide sequence SEQ ID NO:23, and wherein the 5'most nucleotide of the agonist comprises a 5' diphosphate or triphosphate moiety or a derivative thereof or analog thereof.

[0624] The at least one RLR agonist is packaged in the virus-like particle.

[0625] In any of the foregoing or related aspects, the RLR agonist binds non-covalently to the viral particle.

[0626] In any of the foregoing or related aspects, the RLR agonist binds to a virus-like particle site selected from the group consisting of oligonucleotide binding sites, DNA binding sites, and RNA binding sites. In some aspects, the virus-like particle contains arginine-rich repeats.

[0627] In any of the foregoing or related aspects, the compositions described herein comprise at least one antigen or antigenic determinant that binds to virus-like particles. In some aspects, at least one antigen or antigenic determinant binds to virus-like particles via at least one covalent bond. In some aspects, at least one antigen or antigenic determinant binds to virus-like particles via a non-peptide bond. In other aspects, the antigen or antigenic determinant is fused to the virus-like particles. In some aspects, the virus-like particles comprise at least one first attachment site, and wherein the antigen or antigenic determinant comprises at least one second attachment site, the second attachment site being selected from the group consisting of: (a) attachment sites not naturally present within the antigen or antigenic determinant; and (b) attachment sites naturally present within the antigen or antigenic determinant.

[0628] The binding of the antigen or antigenic determinant to the virus-like particle is achieved through association between the first attachment site and the second attachment site, optionally wherein the association is via at least one non-peptide bond. In some aspects, the first attachment site comprises an amino or lysine residue, and the second attachment site comprises a thiol or cysteine ​​residue.

[0629] In some aspects, this disclosure provides a pharmaceutical composition for stimulating an immune response in a subject of need, treating their cancer, delaying the progression of their cancer, or reducing or inhibiting tumor growth, comprising the composition provided in this disclosure and a pharmaceutically acceptable carrier. In some aspects, the composition is formulated in a polyethyleneimine (PEI) carrier. In some aspects, the PEI carrier is...

[0630] In some aspects, this disclosure provides a method for increasing the production of one or more RLR-mediated cytokines in cells, the method comprising contacting cells with a composition provided in this disclosure, wherein the composition increases the production of RLR-mediated cytokines in cells. In some aspects, the composition increases the production of RLR-mediated type I interferons (e.g., IFN-α, IFN-β) in cells. In some aspects, the composition increases the production of RLR-mediated IL-1β in cells. In some aspects, the composition increases the production of RLR-mediated IP-10 in cells. In some aspects, the composition increases the production of RLR-mediated IL-6, IL-12p70, MCP-1, and / or MIP-1β in cells.

[0631] In some aspects, this disclosure provides a method for increasing the expression of one or more interferon-stimulated genes mediated by RLR in cells, the method comprising contacting cells with a composition provided in this disclosure, wherein the composition increases the expression of one or more interferon-stimulated genes mediated by RLR in cells.

[0632] In some aspects, this disclosure provides a method for increasing RLR-dependent intracellular signaling in cells, the method comprising contacting cells with a composition provided in this disclosure, wherein the composition increases RLR-dependent intracellular signaling.

[0633] In some aspects, this disclosure provides a method for stimulating an immune response in a subject, the method comprising administering to the subject an effective amount of the composition provided in this disclosure.

[0634] In some aspects, this disclosure provides a method for treating a subject's cancer or delaying the progression of the cancer, the method comprising administering to the subject an effective amount of the composition provided in this disclosure.

[0635] In some aspects, this disclosure provides a method for reducing or inhibiting tumor growth in a subject in need, the method comprising administering to the subject an effective amount of the composition provided in this disclosure.

[0636] In some aspects, this disclosure provides a method for stimulating an immune response in a subject in need, treating their cancer, delaying the progression of their cancer, or inhibiting the growth of their tumor, the method comprising administering to the subject an effective amount of a composition provided in this disclosure, wherein the composition increases the production of one or more RLR-mediated cytokines in cells, increases the expression of one or more RLR-mediated interferon-stimulated genes in cells, and / or increases RLR-dependent intracellular signaling in cells, thereby stimulating an immune response, treating cancer, delaying the progression of cancer, or inhibiting the growth of tumors.

[0637] In some aspects, the compositions provided in this disclosure are administered in combination with one or more additional therapeutic agents selected from the group consisting of: chemotherapy, targeted anticancer therapy, oncolytic drugs, cell death inducers, opsonizers (e.g., opsonizing antibodies), cytotoxic agents, immune-based therapies, cytokines, activators or agonists of co-stimulatory molecules, inhibitors of inhibitory molecules, vaccines, cellular immunotherapy, or combinations thereof.

[0638] In some respects, the compositions provided in this disclosure are administered before or after the administration of one or more other therapeutic agents, or one or more other therapeutic agents are administered simultaneously with, before or after the administration of an agonist or pharmaceutical composition.

[0639] In some respects, one or more additional therapeutic agents are PD-1 / PD-L1 antagonists, TIM-3 antagonists, VISTA antagonists, adenosine A2AR antagonists, B7-H3 antagonists, B7-H4 antagonists, BTLA antagonists, CTLA-4 antagonists, IDO antagonists, KIR antagonists, LAG-3 antagonists, Toll-like receptor 3 (TLR3) agonists, Toll-like receptor 7 (TLR7) agonists, and Toll-like receptor 9 (TLR9) agonists.

[0640] In some respects, one or more other therapeutic agents are agonists comprising a polypeptide (e.g., an antibody or its antigen-binding moiety) that specifically binds to CD137 (4-1BB).

[0641] In some respects, one or more other therapeutic agents are agonists comprising a polypeptide (e.g., an antibody or its antigen-binding portion) that specifically binds to CD134 (OX40).

[0642] In some respects, one or more additional therapeutic agents are PD-1 / PD-L1 antagonists. In some respects, PD-1 / PD-L1 antagonists are selected from the group consisting of: PDR001, (pembrolizumab) (nivolumab), pidilizumab, MEDI0680, REGN2810, TSR-042, PF-06801591, and AMP-224. In some respects, PD-1 / PD-L1 antagonists are selected from the group consisting of: FAZ053, (atezolizumab) (avelumab) (durvalumab) and BMS-936559.

[0643] In some respects, one or more other therapeutic agents are TIM-3 antagonists.

[0644] In some respects, one or more other therapeutic agents are VISTA antagonists.

[0645] In some respects, one or more other therapeutic agents are adenosine A2AR antagonists.

[0646] In some respects, one or more other therapeutic agents are B7-H3 antagonists.

[0647] In some respects, one or more other therapeutic agents are B7-H4 antagonists.

[0648] In some respects, one or more other therapeutic agents are BTLA antagonists.

[0649] In some respects, one or more additional treatments are CTLA-4 antagonists.

[0650] In some respects, one or more other therapeutic agents are IDO antagonists.

[0651] In some respects, one or more additional therapeutic agents are KIR antagonists.

[0652] In some respects, one or more other treatment agents are LAG-3 antagonists.

[0653] In some respects, one or more additional therapeutic agents are Toll-like receptor 3 (TLR3) agonists. In some respects, TLR3 agonists are polyinosine:polycytidylic acid (poly I:C). In some respects, TLR3 agonists are... (poly ICLC). In some respects, TLR3 agonists are polyadenosine-polyuridine (poly A:U). In some respects, TLR3 agonists are... ( 100). In some respects, TLR3 agonists are ( 50 biological conjugates). In some respects, TLR3 agonists are ( 50).

[0654] In some respects, one or more additional therapeutic agents are Toll-like receptor 7 (TLR7) agonists. In some respects, the TLR7 agonist is GS-9620 (Vesatolimod). In some respects, the TLR7 agonist is imiquimod (ALDARA). TM In some respects, the TLR7 agonist is resiquimod (R-848).

[0655] In some respects, one or more additional therapeutic agents are Toll-like receptor 9 (TLR9) agonists. In some respects, TLR9 agonists are CpG oligodeoxynucleotides (CpG ODNs). In some respects, CpG ODNs are class A CpG ODNs (CpG-AODNs). In some respects, CpG ODNs are class B CpG ODNs (CpG-B ODNs). In some respects, CpG ODNs are class C CpG ODNs (CpG-C ODNs).

[0656] In some aspects, this disclosure provides the use of the compositions provided herein for stimulating an immune response in a subject in need, treating their cancer or delaying the progression of their cancer or inhibiting the growth of their tumor, optionally in combination with one or more other therapeutic agents.

[0657] In some aspects, this disclosure provides the use of the compositions provided herein in the manufacture of a medicament for stimulating an immune response in a subject in need, treating their cancer, delaying the progression of their cancer, or inhibiting the growth of their tumor, optionally in combination with one or more additional therapeutic agents. In some aspects, the composition is administered in combination with one or more additional therapeutic agents selected from the group consisting of: chemotherapy, targeted anticancer therapies, oncolytic drugs, cell death inducers, opsonizers (e.g., opsonizing antibodies), cytotoxic agents, immunotherapy-based therapies, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, vaccines, cellular immunotherapy, or combinations thereof. In some aspects, the composition is administered before or after administration of one or more additional therapeutic agents, or one or more additional therapeutic agents are administered simultaneously with, before, or after administration of the composition.

[0658] In some aspects, this disclosure provides a kit comprising the composition provided herein and instructions for use in stimulating an immune response in a subject, or treating a subject's cancer or delaying the progression of the cancer, or inhibiting tumor growth, optionally including instructions for use in combination with one or more additional therapeutic agents. In some aspects, the kit includes instructions for administering the composition in combination with one or more additional therapeutic agents selected from the group consisting of: chemotherapy, targeted anticancer therapy, oncolytic drugs, cell death inducers, opsonizers (e.g., opsonizing antibodies), cytotoxic agents, immunotherapy, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, vaccines, cellular immunotherapy, or combinations thereof. In some aspects, the composition is administered before or after administration of one or more additional therapeutic agents, or one or more additional therapeutic agents are administered simultaneously with, before, or after administration of the composition.

[0659] In any of the foregoing or related aspects, one or more additional therapeutic agents are PD-1 / PD-L1 antagonists, TIM-3 antagonists, VISTA antagonists, adenosine A2AR antagonists, B7-H3 antagonists, B7-H4 antagonists, BTLA antagonists, CTLA-4 antagonists, IDO antagonists, KIR antagonists, LAG-3 antagonists, Toll-like receptor 3 (TLR3) agonists, Toll-like receptor 7 (TLR7) agonists, and Toll-like receptor 9 (TLR9) agonists.

[0660] In any of the foregoing or related aspects, one or more additional therapeutic agents are agonists comprising a polypeptide (e.g., an antibody or its antigen-binding portion) that specifically binds to CD137 (4-1BB).

[0661] In any of the foregoing or related aspects, one or more additional therapeutic agents are agonists comprising a polypeptide (e.g., an antibody or its antigen-binding portion) that specifically binds to CD134 (OX40).

[0662] In some aspects, this disclosure provides a method for producing a composition as described herein, the method comprising:

[0663] (a) Disassembling virus-like particles;

[0664] (b) Addition of an RLR agonist; and

[0665] (c) Reassemble virus-like particles.

[0666] In some aspects, the method includes removing nucleic acids from the disassembled virus-like particles. In some aspects, the method includes purifying the composition after reassembly. In some aspects, the method includes (d) binding an antigen or antigenic determinant to the virus-like particles. In some aspects, the antigen or antigenic determinant is bound to the virus-like particles before disassembly. In other aspects, the antigen or antigenic determinant is bound to the virus-like particles after reassembly. Attached Figure Description

[0667] Figure 1 Bar graphs depicting the quantification of cytokine secretion are provided: IFN-α2a from human PBMCs treated with 0.4 nM, 2 nM, and 10 nM RLR agonists containing various modifications.

[0668] Figure 2 Bar graphs are provided depicting the quantitative secretion of IFN-α in human PBMCs treated with RIG 50c (X24907) and inosine-substituted RIG 27c (X24935) at concentrations of 0.2 nM, 2 nM, 20 nM, and 200 nM.

[0669] Figure 3 Bar graphs are provided depicting the quantitative secretion of IFN-α from human PBMCs treated with Qβ-RIG27 (RIG27c packaged in a VLP with an RNA phage Qβ coat protein) at concentrations of 2 nM, 20 nM, 200 nM, and 600 nM. Detailed Implementation

[0670] Overview

[0671] RIG-I-like receptors (RLRs) are a family of cytosol pattern recognition receptors crucial for detecting viral RNA and triggering innate immune responses. The RLR family comprises three members: retinoic acid-inducible gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA5), and Laboratory of Genetics and Physiology 2 (LGP2). These receptors are expressed in both immune and non-immune cell types and regulate signaling pathways that promote IRF3 and IRF7-dependent expression of type I and type III interferon (IFN) and NF-κB-dependent expression of pro-inflammatory cytokines.

[0672] All three RLR family receptors possess a DExD / H box RNA helicase domain with ATPase activity. This domain, along with the adjacent C-terminal domain, is required for RNA binding. Additionally, the C-terminal domains of RIG-I and LGP2 have been shown to act as repressive domains, ensuring the receptor remains in an inactive conformation before binding to activating RNA.

[0673] This disclosure provides an RLR agonist comprising a synthetic RNA molecule folded to form a double-stranded dsRNA and containing one or more sequence motifs providing one or more improved biological activities. This disclosure also provides a composition comprising at least one RLR agonist packaged in a VLP, exhibiting improved immunostimulatory potency, such as induction of cytokine expression, compared to a VLP alone. RIG-VLP provides an improved immunostimulatory composition for use in prophylactic or therapeutic regimens targeting, for example, tumors.

[0674] RIG-I-like receptors and their ligands

[0675] This disclosure provides synthetic RNA ligands that specifically bind to and activate the RIG-I-like receptor (RLR) (RLR agonists). In some aspects, this disclosure provides RLR agonists that can be used to treat cancer. In some aspects, this disclosure provides RLR agonists that can be used to treat infectious diseases. In some embodiments, the RLR agonist induces cytokine production. In some embodiments, the RLR agonist increases the number of CD8+ T cells in the tumor microenvironment. In some embodiments, the RLR agonist induces protective antitumor immunity.

[0676] RIG-I-like receptors (RLRs) comprise the DExD / H-box RNA helicase family, which act as cytosolic pattern recognition receptors (PRRs) to sense the presence of pathogenic agents via recognition of pathogen-associated molecular patterns (PAMPs). Specifically, the intracellular presence of non-self (e.g., viral) RNA is sensed by infected cells via RNA binding to the RLR, leading to the initiation and regulation of antiviral immunity. Like most viral RNAs, endogenous mRNA and RNA polymerase III transcripts are 5'-triphosphorylated, but eukaryotic mRNAs possess a 5' cap structure linked to guanosine methylated at N7, which prevents RIG-I activation. These structural differences between viral and self RNAs, along with differences in intracellular localization, are thought to enable RIG-I to function effectively as a defense against viral infection by preferentially detecting viral RNA. The molecular recognition and binding of non-self RNA ligands to the RLR propagates specific intracellular signaling events, ultimately activating transcription factors that drive type 1 interferon (IFN) production and antiviral gene expression. RLR-mediated production of IFN and inflammatory cytokines, as well as the induction of antiviral gene expression, have led to immune responses that control viral infection (Yoneyama et al., (2015) Curr Opin Immunol 32:48-53).

[0677] Three members of the RLR family have been identified: RIG-I (retinoic acid-inducible gene I) – the founding member and most distinctive of the RLR family; MDA5 (melanoma differentiation-associated factor 5); and LGP2 (a homolog of the genetics and physiology laboratory 2 and mouse D11lgp2). RIG-I is an important component of the innate immune system and plays a key role in the defense against RNA virus infection. Unlike Toll-like receptors TLR3, TLR7, TLR8, and TLR9, which detect nucleic acids in the endosomes of a small subset of immune cells, RIG-I is a cytosolic innate immune receptor expressed in all cell types (Kato et al., (2006) Nature 441(7089):101-105; Loo et al., (2008) J Virol 82(1):335-345). Two earlier studies independently identified that RIG-I specifically detects and is activated by viral RNA (Hornung et al., (2006) Science 314(5801):994-997; Pichlmair et al., (2006) Science 314(5801):997-1001).

[0678] High-resolution structures of RIG-I / ligand complexes provide molecular details of RIG-I binding to RNA ligands, particularly to activating ligand-bound 5'-triphosphorylated RNA (ppp-dsRNA) (Civril et al., (2011) EMBO Reports 12(11):1127-1134; Jiang et al., (2011) Nature 479(7373):423-427; Kowalinski et al., (2011) Cell147(2):423-435; Lu et al., (2010) Structure 18(8):1032-1043; Luo et al., (2011) Cell147(2):409-422; Wang et al., (2010) Nature Structural & Molecular Biology). 17(7):781-787; Hornung et al., (2006) Science 314(5801):994-997; Pichlmair et al., (2006) Science 314(5801):997-1001; Schlee et al., (2009) Immunity 31(1):25-34). The crystal structure of the RIG-I / RNA complex shows that the protein binds to the backbone rather than the bases, suggesting that the RNA sequence may not affect RIG-I binding, or that the RNA sequence may exhibit a role or activity that has not yet been characterized. To date, there is no evidence in the art of sequence-dependent differential interactions or affinities with RIG-I-like receptors or of RIG-I-like receptor activation (Schlee and Hartmann (2010) Molecular Therapy 18(7):1254-1262).

[0679] Therefore, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist comprising a non-naturally occurring, synthetic, and / or engineered RLR RNA ligand. In some embodiments, the RLR agonist comprises ribonucleic acid (RNA) of 10-100 nucleotides in length. In some aspects, the RNA is 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, 90-95, or 95-100 nucleotides in length.

[0680] In some implementations, the RLR agonist can be a single-stranded, single-stranded (containing a self-complementary sequence that can form a double-stranded, stem-loop, or hairpin structure), double-stranded, or partially double-stranded oligonucleotide.

[0681] In some implementations, the double-stranded oligonucleotide is fully double-stranded. In this case, the oligonucleotide consists of two single-stranded oligonucleotides of the same length and having sequences that are 100% complementary to each other.

[0682] In some implementations, the double-stranded oligonucleotide is partially double-stranded. In this case, the two strands forming the oligonucleotide are sequences of different lengths, not 100% complementary to each other, or both. In other words, at least one fully double-stranded segment of the oligonucleotide is attached to a single-stranded structure at one or both ends.

[0683] In some implementations, the double strand, hairpin, or stem-loop structure comprises 10-15, 15-20, 20-25, 25-30, 30-35, 30-35, 35-40, 40-45, 45-50, or 50-55 base pairs.

[0684] In some embodiments, the oligonucleotide forms a double helix containing fewer than 19 base pairs. In some embodiments, the complementary bases of the double helix are linked by nucleotide or non-nucleotide linkers.

[0685] In some implementations, the oligonucleotide is single-stranded, single-stranded (containing its own complementary sequence), or double-stranded, and the length of the oligonucleotide is the length of a single strand.

[0686] In some respects, the oligonucleotide is partially double-stranded, and the length of the oligonucleotide is the length of the longer chain. Therefore, the oligonucleotides of the present invention comprise partially double-stranded oligonucleotides, wherein at least one chain has a length of 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, or 85-90 nucleotides.

[0687] In some aspects, an oligonucleotide is a double-stranded or partially double-stranded oligonucleotide, wherein at least one strand contains at least one 5' diphosphate or triphosphate group. When both strands contain 5' diphosphate or triphosphate groups, the number of phosphate groups on the two strands may be the same or different. In some aspects, an oligonucleotide is a partially double-stranded oligonucleotide, wherein at least one ribonucleotide at the 5' end containing at least one 5' diphosphate or triphosphate may be on a long chain or a short chain, wherein the length of at least the long chain is 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, or 85-90 nucleotides.

[0688] In some aspects, the degree of complementarity is preferably at least 50%, 60%, or 70%, more preferably at least 75%, 80%, 85%, or 90%, even more preferably at least 95%, 96%, 97%, 98%, or 99%, and most preferably 100%. As used in the art, the term "degree of complementarity" between two oligonucleotides / polynucleotides refers to the percentage of complementary bases in the overlapping regions of the two oligonucleotides. Two bases are complementary to each other if they can form a base pair via hydrogen bonding. Base pairs include Watson-Crick base pairs and wobbling base pairs. Watson-Crick base pairs include AT, CG, and AU; wobbling base pairs include GU, IU, IA, and IC. The degree of complementarity can be determined manually or automatically by a person skilled in the art using any method known in the art through various engines such as BLAST. For example, ATCG has 100% complementarity with CGAT and CGATGG, and 75% complementarity with CGTT and CGTTGG.

[0689] In some aspects, this disclosure provides an RLR agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises blunt-ended hairpin RNA containing a first polynucleotide linked to a second polynucleotide via a linker, wherein the agonist comprises blunt-ended hairpin RNA containing the first polynucleotide linked to the second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a double strand, wherein the double strand contains fewer than 19 base pairs, wherein the 5'most nucleotide of the first polynucleotide contains a 5' diphosphate or triphosphate portion or a derivative or analog thereof, and wherein the agonist comprises a sequence motif that provides at least one improved biological activity mediated by the RLR, relative to an agonist that does not contain the sequence motif.

[0690] In some embodiments, the RLR agonist of this disclosure comprises a sequence motif, wherein the sequence motif is selected from the group consisting of:

[0691] (i)GT repeating motif;

[0692] (ii) GA repeating motifs;

[0693] (iii) AUCG repeating motif;

[0694] (iv) AU repeating motif;

[0695] (v) Dipyrimidine motif;

[0696] (vi) Dipurine motif;

[0697] (vii) Pyrimidine triplet motif;

[0698] (viii) Purine triple motif;

[0699] (ix) Palindromic sequence base order; and

[0700] A combination of any one of (x)(i)-(ix).

[0701] In some embodiments, the RLR agonist of this disclosure comprises at least one improved biological activity, wherein the improved biological activity is selected from:

[0702] (i) Increased RLR-mediated cytokine production;

[0703] (ii) RLR-mediated increase in the expression of interferon-stimulated genes;

[0704] (iii) Increased intracellular signaling mediated by RLR;

[0705] (iv) Increased binding affinity to RLR; and

[0706] Combinations of any one of (v)(i)-(iv).

[0707] In some embodiments, the RLR agonist of this disclosure comprises a sequence motif, wherein the sequence motif is a GT repeat motif comprising <19, about 15-18, about 15, about 10-15, about 10, about 5-10, about 5, about 4, about 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 sequences of guanine and thymine nucleotides or their derivatives or analogs. In some embodiments, the GT repeat motif is [GT]. n Where n = 2 to 9. In some embodiments, the GT repeat motif is [GT]7. In some embodiments, the GT repeat motif is [GT]3, and where the GT repeat motif is followed by a purine triplet and UCG, respectively. In some embodiments, the purine triplet is GGA.

[0708] In some embodiments, the sequence motif is a GA repeat motif comprising <19, about 15-18, about 15, about 10-15, about 10, about 5-10, about 5, about 4, about 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 guanine and adenine nucleotides or their derivatives or analogs. In some embodiments, the GA repeat motif is [GA]. n , where n = 2 to 9. In some implementations, the GA repeating motif is [GA]7.

[0709] In some embodiments, the RLR agonist of this disclosure comprises a sequence motif, wherein the sequence motif is an AUCG repeat motif comprising <19, about 16, about 12-16, about 12, about 8-12, about 6, about 16, 12, or 8 sequences of adenine, uracil, cytosine, and guanine nucleotides or their derivatives or analogs.

[0710] In some implementations, the AUCG repeat motif is [AUCG]. n , where n = 2 to 4. In some implementations, the AUCG repeating motif is [AUCG]3.

[0711] In some embodiments, the AUCG repeat motif is preceded by a CG or a dipyrimidine motif. In some embodiments, the AUCG repeat motif is preceded by a CG. In some embodiments, the dipyrimidine motif is CC. In some embodiments, the AUCG repeat motif is preceded by a dipurine motif. In some embodiments, the dipurine motif is GA. In some embodiments, the dipurine motif is GG.

[0712] In some embodiments, the RLR agonist of this disclosure comprises an AUCG repeat motif, wherein one or more uridine nucleosides (U) are substituted with a modified nucleoside. In some embodiments, the modified nucleoside is ribothymidine (T). In some embodiments, the AUCG repeat motif is [AUCG]3, wherein one or more uridine nucleosides (U) constituting the AUCG repeat motif are substituted with a modified nucleoside, wherein the modified nucleoside is ribothymidine (T). In some embodiments, the AUCG repeat motif is [AUCG]3, wherein one or more uridine nucleosides (U) constituting the AUCG repeat motif are substituted with a modified nucleoside, wherein the modified nucleoside is ribothymidine (T), and wherein the AUCG repeat motif is preceded by GG.

[0713] In some embodiments, the RLR agonist of this disclosure comprises an AUCG repeat motif, wherein one or more guanosine nucleosides (G) are substituted with a modified nucleoside. In some embodiments, the modified nucleoside is inosine (I). In some embodiments, the AUCG repeat motif is [AUCG]3, wherein one or more guanosine nucleosides (G) constituting the AUCG repeat motif are substituted with a modified nucleoside, wherein the modified nucleoside is ribothymidine (T), and wherein the AUCG repeat motif is preceded by GG.

[0714] In some embodiments, the RLR agonist of this disclosure comprises an AUCG repeat motif, wherein the motif is preceded by IG. In some embodiments, the AUCG repeat motif is [AUCG]3 and is preceded by IG.

[0715] In some embodiments, the RLR agonist of this disclosure comprises an AUCG repeat, wherein one or more guanosine nucleosides (G) are replaced by inosine (I), wherein the AUCG repeat is preceded by inosine (I). In some embodiments, the guanosine nucleoside (G) constituting the AUCG repeat is replaced by inosine (I), wherein the AUCG repeat is preceded by inosine (I), wherein the 5' nucleotide of the first polynucleotide comprises inosine (I).

[0716] In some implementations, the 5' nucleotide of the first polynucleotide comprises inosine (I).

[0717] In some embodiments, the RLR agonist of this disclosure comprises an AUCG repeat sequence motif, wherein the AUCG repeat motif is [AUCG]2. In some embodiments, the AUCG repeat motif is preceded by a dipurine motif. In some embodiments, the dipurine motif is GG. In some embodiments, the AUCG repeat motif is preceded by a purine triplet. In some embodiments, the purine triplet is GGG. In some embodiments, the AUCG repeat motif is preceded by CCCCCG. In some embodiments, the AUCG repeat motif is preceded by TCGUCG.

[0718] In some embodiments, the RLR agonist of this disclosure comprises a palindromic sequence comprising a sequence of <19, about 15-18, about 15, about 10-15, about 10, about 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 nucleotides or their derivatives or analogs linked in any order that produces a palindrome.

[0719] In some embodiments, the connector side is equipped with an AU repeating motif. In some embodiments, the connector side is equipped with an AU repeating motif, wherein the AU repeating motif is [AU]. n , where n = 2 to 3. In some implementations, the AU repeating motif is [AU]2.

[0720] In some aspects, this disclosure provides an RLR agonist that specifically binds to the RLR, wherein the agonist comprises a blunt-ended hairpin RNA comprising at least one or more nucleotides containing inosine that pair with cytidine bases, and wherein the agonist comprises the following formula:

[0721] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0722] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0723] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0724] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0725] (iv) Base pairing between N1 and N4;

[0726] (v) N2 and N3 base pairing;

[0727] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0728] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0729] (viii) X1 and X2 are complementary;

[0730] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0731] (x)L is a linker that covalently connects the first polynucleotide and the second polynucleotide.

[0732] In other respects, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises blunt-ended hairpin RNA containing a non-nucleotide linker, and wherein the agonist comprises the following formula:

[0733] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0734] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0735] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0736] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0737] (iv) Base pairing between N1 and N4;

[0738] (v) N2 and N3 base pairing;

[0739] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0740] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0741] (viii) X1 and X2 are complementary;

[0742] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0743] (x)L is the nonnucleotide linker that covalently connects the first polynucleotide and the second polynucleotide.

[0744] In some implementations, when present in an RLR agonist, inosine pairs with cytidine bases.

[0745] In some implementations, the linker (L) is a nucleotide linker or a non-nucleotide linker.

[0746] In some respects, this disclosure provides an RLR agonist that specifically binds to the RLR, wherein the agonist comprises blunt-ended hairpin RNA containing a nucleotide or non-nucleotide linker. RNA hairpins are among the most common secondary structural elements of RNA, in which the hybrid portion or “stem” of the hairpin is often capped by an RNA tetraloop. RNA tetraloops are composed of characteristic tetracyclic nucleotides, forming a compact and stable structure. While they can be formed from many different nucleotide sequences, the most common are UNCG (N = A, C, G, or U), GNRA (R = A or G), and CUUG tetraloops. Tetraloops generally facilitate the initiation of RNA folding processes and provide sites for tertiary contacts and protein binding within or between RNA, thereby promoting the assembly of ribonucleoprotein particles. Further description of tetraloops can be found in Cheong, H., Kim, N., and Cheong, C. (2015). RNA Structure: Tetraloops. In eLS, John Wiley & Sons, Ltd (eds.), which is incorporated herein by reference in its entirety.

[0747] Therefore, in some embodiments, the RLR agonist of this disclosure comprises a tetracyclic nucleotide linker. In some embodiments, the tetracyclic nucleotide sequence is selected from the group consisting of:

[0748] (a) UNCG, where N = A, C, G or U;

[0749] (b) GNRA, where N = A, C, G or U, and where R = A or G;

[0750] (c) ANYA, where N = A, C, G or U, and where Y = C or T;

[0751] (d)CUYG, where Y = C or T;

[0752] (e) UMAC, where M = A or C; and

[0753] (f)CUUG.

[0754] In some embodiments, the nucleotide linker comprises the nucleotide sequence UUUGAU or UGUUU. In some embodiments, the tetracyclic sequence is UUCG. In some embodiments, the tetracyclic sequence is GAUC. In some embodiments, the nucleotide linker comprises the nucleotide sequence UUUGAU. In some embodiments, the nucleotide linker comprises the nucleotide sequence UGUUU.

[0755] In other respects, the RLR agonists disclosed herein contain nonnucleotide linkers. As described herein, nucleic acid loops (e.g., tetracycles) are common elements found in the secondary structure of nucleic acids. Nucleotide loops appear in folded structural domains present in intrastranded duplexes. Synthetic nucleic acids designed to contain hairpin loops comprising nonnucleotide linkers (e.g., nonnucleotide linkers) can replace several nucleotides bridging the folded duplex structure. Nonnucleotide groups are also used as linkers in unfolded structures. Such linkers can be useful replacements for native nucleotide linkers (e.g., tetracycles). For example, they can shorten the synthesis of nucleic acids with the desired secondary structure in several steps because a relatively long nonnucleotide linker replaces several individual nucleotides that would normally form a loop. Such non-natured loops or linkers (e.g., nonnucleotide linkers) can confer resistance to degradation by nucleases that typically act on native loop structures in the biological environment (e.g., in cells or in the circulation of a subject at the time of administration). Nonnucleotide linkers also have the potential to provide more stable folded structures than nucleotide loops and / or linkers. Further description of the nonnucleotide linker can be found in Rumney and Kool (1995) J Am Chem Soc 117:5635-5646, which is incorporated herein by reference in its entirety.

[0756] Therefore, in some embodiments, the RLR agonist of this disclosure comprises a nonnucleotide linker selected from the group consisting of:

[0757] (a) Ethylene glycol connector; and

[0758] (b) Alkyl connector.

[0759] In some embodiments, the non-nucleotide linker is a hexaethylene glycol linker. In some embodiments, the non-nucleotide linker is a C9 alkyl linker.

[0760] In some embodiments, the RLR agonist comprises a 5' diphosphate moiety or a derivative or analog thereof. In some embodiments, the agonist comprises a 5' triphosphate moiety or a derivative or analog thereof. In some embodiments, the derivative or analog of the 5' diphosphate or triphosphate moiety comprises a phosphate ester bioisostere selected from: phosphonates, thiophosphonates, thiophosphates, sulfates, sulfonates, aminosulfonates, thiazolidinones, carboxylates, malonic esters, boric acid, benzoxadiborone, borophosphates, and squaramides.

[0761] In some embodiments, the agonist comprises a modified nucleotide, a modified nucleoside, or a modified nucleobase, or a combination thereof. In some embodiments, the agonist comprises modifications to internucleotide linkages or to the polynucleotide backbone.

[0762] In some respects, the RLR agonists of this disclosure exhibit at least one or more of the following properties:

[0763] (a) Specifically binds to one or more RLRs (e.g., RIG-1, MDA5 and / or LGP2);

[0764] (b) Increased RLR-mediated cytokine production;

[0765] (c) Increase the expression of RLR-mediated interferon-stimulated gene (ISG);

[0766] (d) Increases RLR-dependent intracellular signaling;

[0767] (e) Increase the stability of the double strand;

[0768] (f) Increases binding affinity to RLR;

[0769] (g) Reduce off-target binding;

[0770] (h) Prolonging the biological half-life;

[0771] (i) Increase biological distribution and bioavailability;

[0772] (j) Increase and / or enhance uptake into cells and / or tissues;

[0773] (k) Reduced immunogenicity; and

[0774] A combination of any term in (l)(a)-(k).

[0775] In some aspects, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist that specifically binds to the RIG-I-like receptor (RLR), wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0776] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0777] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0778] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0779] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0780] (iv) Base pairing between N1 and N4;

[0781] (v) N2 and N3 base pairing;

[0782] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0783] (vii) X1 and X2 are each oligonucleotides containing nucleosides selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine, and inosine;

[0784] (viii) X1 and X2 are complementary;

[0785] (ix) X1 and X2 are each between 12 and 16 nucleotides in length and are of the same length;

[0786] (x)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0787] At least one of N1, N2, N3 and N4 is inosine and / or at least one of X1 and / or X2 contains at least one inosine nucleoside, wherein the inosine nucleoside is paired with a cytidine base in the hairpin RNA.

[0788] In some embodiments, N1 contains inosine and N4 contains cytidine. In some embodiments, N1 contains cytidine and N4 contains inosine. In some embodiments, N2 contains inosine and N3 contains cytidine. In some embodiments, N2 contains cytidine and N3 contains inosine. In some embodiments, N1 contains guanosine. In some embodiments, N2 contains guanosine. In some embodiments, N1 contains cytidine. In some embodiments, N2 contains cytidine. In some embodiments, N1 and N2 contain guanosine and N3 and N4 contain cytidine. In some embodiments, N1 and N2 contain cytidine and N3 and N4 contain guanosine. In some embodiments, N1 and N2 contain inosine and N3 and N4 contain cytidine. In some embodiments, N1 and N2 contain cytidine and N3 and N4 contain inosine. In some embodiments, N1 contains inosine and N4 contains cytidine, and X1 and / or X2 each contain at least one inosine. In some embodiments, N2 comprises inosine and N3 comprises cytidine, and X1 and / or X2 each comprises at least one inosine. In some embodiments, N1 and N2 comprise guanosine, N3 and N4 comprise cytidine, and X1 and / or X2 each comprise at least one inosine. In some embodiments, N1 and N2 comprise guanosine and N3 and N4 comprise cytidine, and X1 and X2 each comprise at least one inosine. In some embodiments, N1 and N2 comprise cytidine and N3 and N4 comprise guanosine, and X1 and X2 each comprise at least one inosine. In some embodiments, N1 and N2 comprise guanosine and N3 and N4 comprise cytidine, and X1 and X2 each comprise inosine and do not comprise guanosine nucleoside. In some embodiments, N1 and N2 comprise cytidine and N3 and N4 comprise guanosine, and X1 and X2 each comprise inosine and do not comprise guanosine nucleoside. In some embodiments, N1 and N2 contain inosine and N3 and N4 contain cytidine, and X1 and / or X2 each contain at least one inosine. In some embodiments, N1 and N2 contain inosine and N3 and N4 contain cytidine, and X1 and X2 each contain at least one inosine. In some embodiments, N1 and N2 contain cytidine and N3 and N4 contain inosine, and X1 and / or X2 each contain at least one inosine. In some embodiments, N1 and N2 contain inosine and N3 and N4 contain cytidine, and X1 and X2 contain inosine but not guanosine. In some embodiments, N1 and N2 contain cytidine and N3 and N4 contain inosine, and X1 and X2 contain inosine but not guanosine. In some embodiments, X1 and X2 are each 12 nucleotides and contain 1, 2, 3, or 4 inosine nucleosides. In some embodiments, X1 and X2 are each 13 nucleotides and contain 1, 2, 3, 4, or 5 inosine nucleosides. In some implementations, X1 and X2 are each 14 nucleotides and contain 1, 2, 3, 4, 5 or 6 inosine nucleosides.In some embodiments, X1 and X2 are each 15 nucleotides and contain 1, 2, 3, 4, 5, 6, or 7 inosine nucleosides. In some embodiments, X1 and X2 are each 16 nucleotides and contain 1, 2, 3, 4, 5, 6, 7, or 8 inosine nucleosides. In some embodiments, X1 and X2 are each 12 nucleotides and contain at least 10%, 20%, 30%, or 40% inosine nucleosides.

[0789] In some aspects, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist that specifically binds to the RIG-I-like receptor (RLR), wherein the agonist comprises blunt-ended hairpin RNA comprising the following formula:

[0790] 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', where

[0791] (i) (N1-N2-X1) contains a first polynucleotide comprising the linked nucleotides N1, N2 and X1;

[0792] (ii) (X2-N3-N4) contains a second polynucleotide comprising the linked nucleotides X2, N3 and N4;

[0793] (iii) N1, N2, N3 and N4 each contain a single nucleotide, which contains a nucleoside selected from the group consisting of: adenosine, guanosine, cytidine, 5-methyluridine, uridine and inosine;

[0794] (iv) Base pairing between N1 and N4;

[0795] (v) N2 and N3 base pairing;

[0796] (vi)N1 contains a 5' diphosphate or triphosphate moiety or its derivatives or analogs;

[0797] (vii)X1 contains the sequence motif [AUCN5]. x N5 contains guanosine or inosine, where x is an integer whose value represents the number of sequence motifs, and where x = 3 or 4;

[0798] (viii)X2 contains the sequence motif [CN6AU]. y , where N6 contains guanosine or inosine, where y is an integer whose value represents the number of sequence motifs, and where y = 3 or 4;

[0799] (ix)L is a linker that operatively connects the first polynucleotide and the second polynucleotide.

[0800] Optionally, at least one of N1, N2, N3, and N4 is inosine, and wherein the inosine nucleoside pairs with a cytidine base in the hairpin RNA. In some embodiments, N5 comprises inosine and N6 comprises inosine. In some embodiments, N5 comprises guanosine and N6 comprises inosine. In some embodiments, N5 comprises inosine and N6 comprises guanosine. In some embodiments, N5 comprises guanosine (G) and N6 comprises guanosine (G). In some embodiments, x = 3 and y = 3. In some embodiments, x = 4 and y = 4. In some embodiments, N1 comprises inosine (I) and N4 comprises cytidine (C). In some embodiments, N2 comprises inosine (I) and N3 comprises cytidine (C). In some embodiments, N3 comprises inosine (I) and N2 comprises cytidine (C). In some embodiments, N4 comprises inosine (I) and N1 comprises cytidine (C). In some embodiments, N1 comprises guanosine (G). In some embodiments, N2 comprises guanosine (G). In some embodiments, N1 comprises cytidine (C). In some embodiments, N2 comprises cytidine (C). In some embodiments, N1 and N2 comprise guanosine (G) and N3 and N4 comprise cytidine (C). In some embodiments, N1 and N2 comprise cytidine (C) and N3 and N4 comprise guanosine (G). In some embodiments, N1 and N2 comprise inosine (I) and N3 and N4 comprise cytidine (C). In some embodiments, N1 and N2 comprise cytidine (C) and N3 and N4 comprise inosine (I).

[0801] In some embodiments, the linker (L) is a nucleotide linker or a non-nucleotide linker. In some embodiments, the linker (L) is a tetracyclic nucleotide linker, wherein the tetracyclic nucleotide sequence is selected from the group consisting of:

[0802] (a) UNCG, where N = A, C, G or U;

[0803] (b) GNRA, where N = A, C, G or U, and where R = A or G;

[0804] (c) ANYA, where N = A, C, G or U, and where Y = C or T;

[0805] (d)CUYG, where Y = C or T;

[0806] (e) UMAC, where M = A or C; and

[0807] (f)CUUG.

[0808] In some embodiments, the linker (L) is a nucleotide linker containing the nucleotide sequence UUUGAU or UGUUU. In some embodiments, the nucleotide linker contains the nucleotide sequence UUUGAU. In some embodiments, the nucleotide linker contains the nucleotide sequence UGUUU.

[0809] In some embodiments, the linker (L) is a tetracyclic nucleotide linker, wherein the sequence of the tetracyclic ring is UUCG. In some embodiments, the sequence of the tetracyclic ring is GAUC.

[0810] In some implementations, the linker (L) is a non-nucleotide linker selected from the group consisting of:

[0811] (a) Ethylene glycol connector; and

[0812] (b) Alkyl connector.

[0813] In some embodiments, the non-nucleotide linker is a hexaethylene glycol linker. In some embodiments, the non-nucleotide linker is a C9 alkyl linker.

[0814] In some embodiments, the RLR agonist comprises a 5' diphosphate moiety or a derivative or analog thereof. In some embodiments, the agonist comprises a 5' triphosphate moiety or a derivative or analog thereof. In some embodiments, the derivative or analog of the 5' diphosphate or triphosphate moiety comprises a phosphate ester bioisostere selected from: phosphonates, thiophosphonates, thiophosphates, sulfates, sulfonates, aminosulfonates, thiazolidinones, carboxylates, malonic esters, boric acid, benzoxadiborone, borophosphates, and squaramides.

[0815] In some embodiments, the RLR agonist comprises a modified nucleotide, a modified nucleoside, or a modified nucleobase, or a combination thereof. In some embodiments, the agonist comprises modifications to internucleotide linkages or to the polynucleotide backbone.

[0816] In some implementations, the RLR agonist exhibits at least one or more of the following properties:

[0817] (a) Specifically binds to one or more RLRs (e.g., RIG-1, MDA5 and / or LGP2);

[0818] (b) Increased RLR-mediated cytokine production;

[0819] (c) Increase the expression of RLR-mediated interferon-stimulated gene (ISG);

[0820] (d) Increases RLR-dependent intracellular signaling;

[0821] (e) Increase the stability of the double strand;

[0822] (f) Increases binding affinity to RLR;

[0823] (g) Reduce off-target binding;

[0824] (h) Prolonging the biological half-life;

[0825] (i) Increase biological distribution and bioavailability;

[0826] (j) Increase and / or enhance uptake into cells and / or tissues;

[0827] (k) Reduced immunogenicity; and

[0828] A combination of any term in (l)(a)-(k).

[0829] In some aspects, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first polynucleotide and the second polynucleotide are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first polynucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that, relative to an agonist not comprising said sequence motif, provides at least one improved biological activity mediated by said RLR, and wherein said agonist comprises selected from SEQ ID NO. The nucleotide sequences of group NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 and 36.

[0830] In some aspects, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises a blunt-ended hairpin RNA comprising a first polynucleotide linked to a second polynucleotide via a linker, wherein the first and second polynucleotides are sufficiently complementary to form a duplex, wherein the duplex comprises fewer than 19 base pairs, wherein the 5'most nucleotide of the first polynucleotide comprises a 5' diphosphate or triphosphate portion or a derivative thereof or the like, wherein the agonist comprises a sequence motif that, relative to an agonist not comprising said sequence motif, provides at least one improved biological activity mediated by said RLR, and wherein said first and second polynucleotides comprise nucleotide sequences selected from the group consisting of:

[0831] (i) are SEQ ID NO:37 and 68, respectively;

[0832] (ii) are SEQ ID NO:38 and 69, respectively;

[0833] (iii) are SEQ ID NO:39 and 70, respectively;

[0834] (iv) are SEQ ID NO:40 and 71, respectively;

[0835] (v) are SEQ ID NO:41 and 72, respectively;

[0836] (vi) are SEQ ID NO:42 and 73 respectively;

[0837] (vii) are SEQ ID NO:43 and 74, respectively;

[0838] (viii) are SEQ ID NO:44 and 75, respectively;

[0839] (ix) are SEQ ID NO:45 and 76, respectively;

[0840] (x) are SEQ ID NO:46 and 77, respectively;

[0841] (xi) are SEQ ID NO:47 and 78, respectively;

[0842] (xii) are SEQ ID NO:48 and 79, respectively;

[0843] (xiii) are SEQ ID NO:49 and 80, respectively;

[0844] (xiv) are SEQ ID NO:50 and 81, respectively;

[0845] (xv) are SEQ ID NO:51 and 82, respectively;

[0846] (xvi) are SEQ ID NO:52 and 83, respectively;

[0847] (xvii) are SEQ ID NO:53 and 84, respectively;

[0848] (xviii) are SEQ ID NO:54 and 85, respectively;

[0849] (xix) are SEQ ID NO:55 and 86, respectively;

[0850] (xx) are SEQ ID NO:56 and 87 respectively;

[0851] (xxi) are SEQ ID NO:57 and 88, respectively;

[0852] (xxii) are SEQ ID NO:58 and 89, respectively;

[0853] (xxiii) are SEQ ID NO:59 and 89, respectively;

[0854] (xxiv) are SEQ ID NO:60 and 90, respectively;

[0855] (xxv) are SEQ ID NO:61 and 91, respectively;

[0856] (xxvi) are SEQ ID NO:62 and 92, respectively;

[0857] (xxvii) are SEQ ID NO:63 and 91, respectively;

[0858] (xxviii) are SEQ ID NO:64 and 93, respectively;

[0859] (xxix) are SEQ ID NO:65 and 94, respectively;

[0860] (xxx) are SEQ ID NO: 66 and 95 respectively;

[0861] (xxxi) are SEQ ID NO: 67 and 96 respectively; and

[0862] (xxxii) are SEQ ID NO:63 and 97, respectively.

[0863] In some aspects, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises a blunt-ended hairpin RNA comprising at least one or more nucleotides containing inosine that pair with cytidine bases, and wherein the agonist comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 22, 23 and 25.

[0864] In some aspects, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises a blunt-ended hairpin RNA comprising at least one or more nucleotides containing inosine that pair with cytidine bases, wherein the agonist comprises the formula 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', wherein (N1-N2-X1) comprises a first polynucleotide and (X2-N3-N4) comprises a second polynucleotide, and wherein the first polynucleotide and the second polynucleotide comprise nucleotide sequences selected from the group consisting of:

[0865] (i) are SEQ ID NO:58 and 89, respectively;

[0866] (ii) are SEQ ID NO:59 and 89 respectively; and

[0867] (iii) are SEQ ID NO:61 and 91, respectively.

[0868] In some aspects, this disclosure provides a synthetic RIG-I-like receptor (RLR) agonist that specifically binds to a RIG-I-like receptor (RLR), wherein the agonist comprises blunt-ended hairpin RNA containing a non-nucleotide linker, wherein the agonist comprises the formula 5'-(N1-N2-X1)-L-(X2-N3-N4)-3', wherein (N1-N2-X1) comprises a first polynucleotide and (X2-N3-N4) comprises a second polynucleotide, and wherein the first and second polynucleotides comprise nucleotide sequences selected from the group consisting of:

[0869] (i) are SEQ ID NO:37 and 68, respectively;

[0870] (ii) are SEQ ID NO:38 and 69, respectively;

[0871] (iii) are SEQ ID NO:39 and 70, respectively;

[0872] (iv) are SEQ ID NO:40 and 71, respectively;

[0873] (v) are SEQ ID NO:41 and 72, respectively;

[0874] (vi) are SEQ ID NO:42 and 73 respectively;

[0875] (vii) are SEQ ID NO:43 and 74, respectively;

[0876] (viii) are SEQ ID NO:44 and 75, respectively;

[0877] (ix) are SEQ ID NO:45 and 76, respectively;

[0878] (x) are SEQ ID NO:46 and 77, respectively;

[0879] (xi) are SEQ ID NO:47 and 78, respectively;

[0880] (xii) are SEQ ID NO:48 and 79, respectively;

[0881] (xiii) are SEQ ID NO:49 and 80, respectively;

[0882] (xiv) are SEQ ID NO:50 and 81, respectively;

[0883] (xv) are SEQ ID NO:51 and 82, respectively;

[0884] (xvi) are SEQ ID NO:52 and 83, respectively;

[0885] (xvii) are SEQ ID NO:53 and 84, respectively;

[0886] (xviii) are SEQ ID NO:54 and 85, respectively;

[0887] (xix) are SEQ ID NO:55 and 86, respectively;

[0888] (xx) are SEQ ID NO:56 and 87 respectively;

[0889] (xxi) are SEQ ID NO:57 and 88, respectively;

[0890] (xxii) are SEQ ID NO:58 and 89, respectively;

[0891] (xxiii) are SEQ ID NO:59 and 89, respectively;

[0892] (xxiv) are SEQ ID NO:60 and 90, respectively;

[0893] (xxv) are SEQ ID NO:61 and 91, respectively;

[0894] (xxvi) are SEQ ID NO:62 and 92, respectively;

[0895] (xxvii) are SEQ ID NO:63 and 91, respectively;

[0896] (xxviii) are SEQ ID NO:64 and 93, respectively;

[0897] (xxix) are SEQ ID NO:65 and 94, respectively;

[0898] (xxx) are SEQ ID NO: 66 and 95 respectively;

[0899] (xxxi) are SEQ ID NO: 67 and 96 respectively; and

[0900] (xxxii) are SEQ ID NO:63 and 97, respectively.

[0901] In some aspects, this disclosure provides an RLR agonist comprising a nucleotide sequence that is not complementary to a genomic DNA sequence or mRNA sequence, wherein the RLR agonist does not participate in RNA interference, and wherein the RLR agonist does not silence gene expression.

[0902] RLR agonists containing modified nucleobases, nucleosides, or nucleotides

[0903] In some embodiments, the RLR agonists of this disclosure comprise one or more modified nucleobases, nucleosides, or nucleotides. In some embodiments, the modified RLR agonists may have useful properties compared to a reference unmodified RLR agonist, including enhanced stability, intracellular retention, enhanced target binding, and / or increased induction of innate immune responses in cells incorporating the RLR agonist. Thus, the use of modified RLR agonists can improve the efficiency of target binding, intracellular retention of nucleic acids, and have reduced immunogenicity. In one embodiment, the agonist provided by this disclosure comprises one or more oligonucleotides comprising at least one region modified to increase target binding affinity. The affinity of the oligonucleotide for its target polypeptide (e.g., the RLR receptor) can be determined, for example, by measuring the fluorescence polarization (FP) of the fluorescently labeled oligonucleotide when it binds to its target (Moerke (2009) Curr Protoc Chem Biol 1(1):1-15).

[0904] In another embodiment, the RLR agonist provided in this disclosure comprises at least one oligonucleotide containing at least one region comprising at least one modified nucleobase, nucleoside, or nucleotide that increases the stability of the duplex. The stability of the duplex can be routinely determined by measuring the Tm of the duplex, which is the temperature at which the two oligonucleotide chains constituting the duplex dissociate; dissociation is detected spectrophotometrically. A higher Tm indicates higher duplex stability.

[0905] In one embodiment, the oligonucleotide region modified to increase duplex stability comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a nucleotide modified with 2'-O-alkyl, 2'-O-alkyl-O-alkyl, or 2'-fluoroalkyl. In another embodiment, the oligonucleotide containing an RLR agonist is also modified to enhance nuclease resistance. Cells contain a variety of exonucleases and endonucleases that degrade nucleic acids. Many nucleotide and nucleoside modifications have been shown to make the incorporated oligonucleotides more resistant to nuclease digestion than unmodified oligonucleotides. Nuclease resistance is conventionally measured by incubating the oligonucleotide with cell extracts or isolated nuclease solutions and typically by measuring the extent to which intact oligonucleotides are retained over time using gel electrophoresis. Oligonucleotides modified to enhance nuclease resistance retain their integrity for a longer time than unmodified oligonucleotides. Various oligonucleotide modifications have been shown to enhance or confer nuclease resistance. In one embodiment, an oligonucleotide containing at least one phosphate thioester modification is used. In some cases, oligonucleotide modifications that enhance target binding affinity can also independently enhance nuclease resistance (De Mesmaeker et al., 1995, Acc. Chem. Res. 28: 366-374).

[0906] Specific examples of oligonucleotides contemplated in this invention include those containing a modified backbone, such as thiophosphate, phosphate triester, methyl phosphonate, short-chain alkyl or cycloalkyl sugar linkages, or short-chain heteroatom or heterocyclic sugar linkages. In some embodiments, oligonucleotides having a thiophosphate backbone (including those synthesized in a stereospecific manner) and those having a heteroatom backbone (particularly CH2-NH-O-CH2, CH2-N(CH3)-O-CH2 [referred to as a methylene (methylimino) or MMI backbone], CH2-ON(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2, and ON(CH3)-CH2-CH2 backbone, wherein the native phosphodiester backbone is represented as OPO-CH2) are used. The amide backbone disclosed by DeMesmaeker et al. (1995, Acc. Chem. Res. 28:366-374) is also used in some embodiments. Oligonucleotides may also contain one or more substituted sugar moieties. In some embodiments, the oligonucleotide comprises one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3OCH3, OCH3O(CH2)nCH3, O(CH2)nNH2, or O(CH2)nCH3, wherein n is 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy (also known in the art as O-alkyl-O-alkyl), substituted lower alkyl, alkylaryl, or arylalkyl; Cl; Br; CN; CF3; OCF3; O-alkyl, S-alkyl, or N-alkyl; O-alkenyl, S-alkenyl, or N-alkenyl; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocyclic alkyl; heterocyclic alkylaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleavage group; reporter group; intercalator; group for improving the pharmacokinetic properties of the oligonucleotide; or group for improving the pharmacodynamic properties of the oligonucleotide and other substituents having similar properties. In one embodiment, the modification includes 2'-methoxyethoxy [2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE] (Martin et al., Helv. Chim. Acta, 1995, 78, 486). In some embodiments, the modification includes 2'-methoxy (2'-O-CH3), 2'-propoxy (2'-OCH2CH2CH3), and 2'-fluorine (2'-F). Similar modifications can also be made at other positions on the oligonucleotide, particularly at the 3' position of the sugar on the 3' terminal nucleotide and at the 5' position of the 5' terminal nucleotide. The oligonucleotide may also have a sugar mimic (such as cyclobutyl) instead of a pentofuranose.

[0907] Oligonucleotides may also additionally or alternatively include nucleobase (generally referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include those occasionally or transiently found only in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-mepyridine, especially 5-methylcytosine (also known as 5-methyl-2'-deoxycytosine and commonly referred to in the art as 5-me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, and gentiobiose HMC; as well as synthetic nucleobases, such as 2-aminoadenine, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-nitroguanine, 7-denitroguanine, N6(6-aminohexyl)adenine, and 2,6-diaminopurine. (Kornberg, A., DNA Replication, WH Freeman & Co., San Francisco, 1980, pp. 75-77; Gebeyehu, G., et al., 1987, Nucl. Acids Res. 15:4513). It may include “universal” bases known in the art, such as inosine. 5-me-C substitution has been shown to improve the stability of nucleic acid duplexes by 0.6 °C–1.2 °C. (Sanghvi, YS, Crooke, ST, and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276–278) and is currently used as a base substitution in some embodiments.

[0908] Another modification of the oligonucleotide of the present invention involves chemically linking the oligonucleotide to one or more portions or conjugates that enhance the activity or cellular uptake of the oligonucleotide. Such moieties include, but are not limited to, lipid moieties, such as cholesterol moieties, cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553), bile acids (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053), thioethers (e.g., hexyl-S-triphenylmethanethiol) (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765), mercaptocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533), and fatty acid chains (e.g., dodecyl glycol or undecyl residues) (Saison-Behmoaras et al., EMBO J., 1991, 10, 111; Kabanov et al., FEBS). Lett., 1990, 259, 327; Svinarchuk et al., Biochimie, 1993, 75, 49), phospholipids, polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969) or adamantaneacetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651). Oligonucleotides containing lipophilic moieties and methods for preparing such oligonucleotides are known in the art, for example, by U.S. Patent Nos. 5,138,045, 5,218,105 and 5,459,255.

[0909] The oligonucleotides of the present invention can be provided as prodrugs, comprising one or more moieties that are normally cleaved in vivo to produce an active oligonucleotide. An example of a prodrug method is described by Imbach et al. in WO Publication No. 94 / 26764.

[0910] It is not necessary to uniformly modify all positions of a given oligonucleotide, and in fact, more than one of the above modifications can be incorporated into a single oligonucleotide or even into a single nucleoside within the oligonucleotide.

[0911] The oligonucleotides according to the invention are preferably about 8 to about 50 nucleotides in length. In the context of this invention, it should be understood that this includes non-naturally occurring oligomers having 8 to 50 monomers as described above.

[0912] The oligonucleotides used according to the present invention can be conveniently and routinely prepared using well-known solid-phase synthesis techniques. Equipment for such synthesis is available from several suppliers, including Applied Biosystems. Any other method for such synthesis may also be used; the actual synthesis of the oligonucleotides is entirely within the knowledge and capabilities of those skilled in the art. The preparation of other oligonucleotides, such as phosphate thioides and alkylated derivatives, using similar techniques is also well known. It is equally well known that fluorescently labeled, biotinylated, or otherwise modified oligonucleotides, such as cholesterol-modified oligonucleotides, can be synthesized using similar techniques and commercially available modified amide esters and controlled-pore glass (CPG) products such as biotin, fluorescein, acridine, or psoralen-modified amide esters and / or CPG (available from Glen Research, Sterling Va.).

[0913] In some embodiments, the RLR agonist comprises one or more (e.g., 1, 2, 3, or 4) different modified nucleosides, nucleosides, or nucleotides. In some embodiments, the RLR agonist comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more) different modified nucleosides, nucleosides, or nucleotides. In some embodiments, the modified RLR agonist may experience reduced degradation in cells incorporating the RLR agonist compared to its unmodified counterpart.

[0914] In some embodiments, the modified nucleobase is a modification of uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-ketoribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, and 2-thio-uridine (s). 2 U), 4-thiouridine (s) 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho) 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine (m 3 U), 5-methoxyuridine (mo) 5 U), uridine 5-oxyacetic acid (cmo) 5 U), uridine 5-hydroxyacetic acid methyl ester (mcmo) 5 U), 5-carboxymethyluridine (cm) 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm) 5 U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm) 5 U), 5-methoxycarbonylmethyl-uridine (mcm)5 U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm) 5 s 2 U), 5-aminomethyl-2-thio-uridine (nm) 5 s 2 U), 5-methylaminomethyluridine (mnm) 5 U), 5-methylaminomethyl-2-thio-uridine (mnm) 5 s 2 U), 5-methylaminomethyl-2-seleno-uridine (mnm) 5 se 2 U), 5-carbamoylmethyluridine (ncm) 5 U), 5-carbohydrate hydroxymethylaminomethyl-uridine (cmnm) 5 U), 5-Carboxymethylaminomethyl-2-thio-uridine (cmnm) 5 s 2 U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-tauric acid methyl-uridine (τm) 5 U), 1-taurine methyl-pseuuridine, 5-taurine methyl-2-thio-uridine (τm) 5 s 2 U), 1-Tauratemethyl-4-thio-pseuuridine, 5-methyl-uridine (m 5 U, i.e., having nucleobase deoxythymidine), 1-methyl-pseudouridine (m 1 ψ), 5-methyl-2-thiouridine (m) 5 s 2 U), 1-methyl-4-thio-pseuuridine (m 1 s 4 ψ), 4-thio-1-methyl-pseuuridine, 3-methyl-pseuuridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-denitro-pseudouridine, 2-thio-1-methyl-1-denitro-pseudouridine, dihydrouridine (D), dihydrouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m) 5 D) 2-Thio-dihydrouridine, 2-Thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp) 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp) 3 ψ), 5-(isopentenylaminomethyl)uridine (inm) 5 U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5 s 2 U), α-thiouridine, 2'-O-methyluridine (Um), 5,2'-O-dimethyluridine (m) 5 Um), 2'-O-methyl-pseudouridine (ψm), 2-thio-2'-O-methyluridine (s) 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm) 5 Um), 5-carbamoylmethyl-2'-O-methyluridine (ncm) 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm) 5 Um), 3,2'-O-dimethyluridine (m) 3 Um) and 5-(isopentenaminomethyl)-2'-O-methyl-uridine (inm) 5 Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-methoxycarbonylvinyl)uridine and 5-[3-(1-E-propenylamino)]uridine.

[0915] In some embodiments, the modified nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, and 3-methylcytidine (m 3 C), N4-acetyl-cytidine (ac) 4 C), 5-formyl-cytidine (f) 5 C), N4-methyl-cytidine (m) 4 C), 5-methyl-cytidine (m) 5 C) 5-Halo-cytidine (e.g., 5-iodocytidine), 5-hydroxymethylcytidine (hm) 5 C), 1-methyl-pseudocytidine, pyrrolo-cytidine, pyrrolo-pseudocytidine, 2-thio-cytidine (s 2 C) 2-Thio-5-methyl-cytidine, 4-thio-pseudo-cytidine, 4-thio-1-methyl-pseudo-cytidine, 4-thio-1-methyl-1-deazo-pseudo-cytidine, 1-methyl-1-deazo-pseudo-cytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudo-cytidine, 4-methoxy-1-methyl-pseudo-cytidine, lysoxidine (k2C), α-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5,2'-O-dimethyl-cytidine (m) 5 Cm), N4-acetyl-2'-O-methyl-cytidine (ac)4 Cm), N4,2'-O-dimethyl-cytidine (m) 4 Cm), 5-formyl-2'-O-methyl-cytidine (f) 5 Cm), N4,N4,2'-O-trimethyl-cytidine (m) 4 2Cm), 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine and 2'-OH-ara-cytidine.

[0916] In some embodiments, the modified nucleobase is an adenine modification. Exemplary nucleobases and nucleosides having adenine modifications include α-thio-adenosine, 2-amino-purine, 2,6-diamino-purine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deadenine, 7-deadenine-8-aza-adenosine, 7-deadenine-2-amino-purine, 7-deadenine-8-aza-2-amino-purine, 7-deadenine-2,6-diamino-purine, 7-deadenine-8-aza-2,6-diamino-purine, 1-methyl-adenosine (m 1 A) 2-Methyl-adenine (m 2 A), N6-methyl-adenosine (m) 6 A) 2-Methylthio-N6-methyl-adenosine (ms) 2 m 6 A), N6-isopentenyl-adenosine (i 6 A) 2-Methylthio-N6-isopentenyl-adenosine (ms) 2 i 6 A) N6-(cis-hydroxyisopentenyl)adenosine (io 6 A) 2-Methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms) 2 io 6 A) N6-glycylcarbamoyl-adenosine (g) 6 A) N6-threonylcarbamoyl-adenosine (t) 6 A) N6-methyl-N6-threonylcarbamoyl-adenosine (m 6 t 6 A) 2-Methylthio-N6-threonylcarbamoyl-adenosine (ms) 2 g 6 A), N6,N6-dimethyl-adenosine (m) 6 2A), N6-hydroxyn-valinecarbamoyl-adenosine (hn) 6 A) 2-Methylthio-N6-hydroxyn-valinecarbamoyl-adenosine (ms) 2 hn 6A) N6-acetyl-adenosine (ac) 6 A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenine, 2'-O-methyl-adenine (Am), N6,2'-O-dimethyl-adenine (m) 6 Am), N6,N6,2'-O-trimethyl-adenosine (m) 6 2Am), 1,2'-O-dimethyl-adenosine (m 1 Am), 2'-O-ribosyl adenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaenoyl)-adenosine.

[0917] In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine include α-thioguanine, inosine (I), and 1-methyl-inosine (m). 1 I), wyosine (imG), methyl wyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wyosine (yW), wyobutosine (o2yW), hydroxywyosine (OhyW), undermodified hydroxywyosine (OhyW*), 7-deazoguanosine, queuosine (Q), epoxyqueuosine (oQ), galactosylqueuosine (galQ), mannosylqueuosine (manQ), 7-cyano-7-deazoguanosine (preQ0), 7-aminomethyl-7-deazoguanosine (preQ1), archaeosine (G) + ), 7-deazo-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deazo-guanosine, 6-thio-7-deazo-8-aza-guanosine, 7-methyl-guanosine (m 7 G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m 1 G), N2-methyl-guanosine (m) 2 G), N2,N2-dimethyl-guanosine (m) 2 2G), N2,7-dimethyl-guanosine (m 2,7 G), N2,N2,7-dimethyl-guanosine (m) 2,2,7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m) 2 Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m) 2 2Gm), 1-methyl-2'-O-methyl-guanosine (m) 1 Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m) 2,7 Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m) 1 Im), 2'-O-ribosylguanosine (phosphate) (Gr(p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-ara-guanosine and 2'-F-guanosine.

[0918] In some embodiments, the RLR agonist of this disclosure comprises a combination of one or more of the modified nucleobases described above (e.g., a combination of two, three, or four of the modified nucleobases described above).

[0919] In some embodiments, the RLR agonists of this disclosure are uniformly modified (i.e., completely modified, modified throughout the entire sequence) for specific modifications. For example, the RLR agonist can be 5-methylcytidine (m 5 C) Uniform modification, which means that all cytosine residues in the mRNA sequence are modified by 5-methyl-cytidine (m 5 C) Substitution. Similarly, the RLR agonists of this disclosure can be uniformly modified for any type of nucleoside residue present in the sequence by substitution with modifying residues (such as those described above).

[0920] Examples of nucleoside modifications and combinations thereof that may exist in the RLR agonists disclosed herein include, but are not limited to, those described in the following PCT patent applications: WO2012045075, WO2014081507, WO2014093924, WO2014164253 and WO2014159813.

[0921] The RLR agonists disclosed herein may comprise a combination of modifications to the inter-glucose, nucleobase, and / or nucleoside linkages. These combinations may include any one or more modifications described herein.

[0922] Examples of modified nucleosides and combinations of modified nucleosides are provided in Tables 1 and 2 below. These combinations of modified nucleotides can be used to form the RLR agonists of this disclosure. In some embodiments, the modified nucleosides may partially or completely replace the native nucleotides of the RLR agonists of this disclosure. As a non-limiting example, the native nucleotide uridine may be replaced by the modified nucleosides described herein. In another non-limiting example, the native nucleoside uridine may be partially replaced by at least one of the modified nucleosides disclosed herein (e.g., about 0.1%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99.9% of native uridine).

[0923] Table 1. Combinations of nucleoside modifications

[0924]

[0925]

[0926] Table 2. Modified nucleosides and their combinations

[0927]

[0928]

[0929]

[0930]

[0931] According to this disclosure, the polynucleotides disclosed herein can be synthesized to include combinations or single modifications of Table 1 or Table 2.

[0932] When a single modification is listed, the listed nucleoside or nucleotide represents 100% of the A, U, G, or C nucleotide or nucleoside that has been modified. When percentages are listed, these percentages represent the percentage of a specific A, U, G, or C nucleotide triphosphate in the total amount of A, U, G, or C triphosphate present. For example, the combination: 25% 5-aminoallyl-CTP + 75% CTP / 25% 5-methoxy-UTP + 75% UTP refers to the following polynucleotide in which 25% of the cytosine triphosphate is 5-aminoallyl-CTP and 75% of the cytosine is CTP; and 25% of the uracil is 5-methoxy-UTP and 75% of the uracil is UTP. When modified UTPs are not listed, naturally occurring ATP, UTP, GTP, and / or CTP are used at 100% of the sites of those nucleotides found in the polynucleotide. In this example, all GTP and ATP nucleotides are unmodified.

[0933] Methods for preparing RLR agonists

[0934] The RLR agonists disclosed herein can be produced by means available in the art, including but not limited to in vitro transcription (IVT) and synthetic methods. Enzymatic (IVT), solid-phase, liquid-phase, combinatorial synthesis, small-region synthesis, and ligation methods can be used. In one embodiment, the RLR agonist is prepared using an IVT enzymatic synthesis method. Methods for preparing polynucleotides via IVT are known in the art and described in International Application PCT / US2013 / 30062, the contents of which are incorporated herein by reference in their entirety. Therefore, this disclosure also includes polynucleotides such as DNA, constructs, and vectors that can be used for in vitro transcription of the RLR agonists described herein.

[0935] Non-naturally modified nucleobases can be introduced into polynucleotides, such as RNA, during or after synthesis. In some embodiments, the modification can be on internucleotide bonds, purine or pyrimidine bases, or sugars. In certain embodiments, the modification can be introduced at the end of the polynucleotide chain or at any other position in the polynucleotide chain; using chemical synthesis or polymerases. Examples of modified nucleic acids and their synthesis are disclosed in PCT application number PCT / US2012 / 058519. The synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, Vol. 76, 99-134 (1998).

[0936] Enzymatic or chemical linking methods can be used to conjugate polynucleotides or regions thereof with different functional parts, such as targeting or delivery agents, fluorescent labels, liquids, nanoparticles, etc. Goodchild, Bioconjugate Chemistry, Vol. 1(3), 165-187 (1990) reviewed polynucleotide conjugates and modified polynucleotides.

[0937] Taskova et al., (2017) Chembiochem 18(17):1671-1682; Gooding et al., (2016) EurJ Pharm Biopharm 107:321-40; Menzi et al., (2015) Future Med Chem 7(13):1733-49; Winkler J., (2013) Ther Deliv.(7):791-809; Singh et al., (2010) Chem Soc Rev 39(6):2054-70; and Lu et al., (2010) Bioconjug Chem 21(2):187-202 further describe the synthesis, conjugation, and linkage of oligonucleotides and polynucleotides.

[0938] Virus-like particles (VLPs)

[0939] In some embodiments, this disclosure provides a composition comprising at least one of the said RLR agonists and a virus-like particle (VLP). In some embodiments, the RLR agonist is bound to the VLP. In some embodiments, the RLR agonist is packaged within the VLP.

[0940] In the context of this application, virus-like particles refer to structures that resemble virus particles but are not pathogenic. Generally, virus-like particles lack a viral genome and are therefore non-infectious. Furthermore, virus-like particles can be produced in large quantities through heterologous expression and can be easily purified.

[0941] Exemplary virus-like particles suitable for the compositions described herein are provided in PCT Publications WO 2003 / 024481 and WO2004 / 084940, each of which is incorporated herein by reference in its entirety.

[0942] In some implementations, the virus-like particles (VLPs) are recombinant virus-like particles. Technicians can generate VLPs using recombinant DNA techniques and publicly available viral coding sequences described herein. For example, the coding sequence for a viral envelope or core protein can be engineered using a commercially available baculovirus vector under the regulatory control of a viral promoter for expression in a baculovirus expression vector, with appropriate modifications to allow functional linkage between the coding sequence and the regulatory sequence. For example, the coding sequence for a viral envelope or core protein can also be engineered for expression in a bacterial expression vector.

[0943] Examples of VLPs include, but are not limited to, the capsid protein of hepatitis B virus (Ulrich et al., Virus Res. 50:141-182 (1998)), measles virus (Warnes et al., Gene 160:173-178 (1995)), Sindbis virus, rotavirus (US Patent Nos. 5,071,651 and 5,374,426), foot-and-mouth disease virus (Twomey et al., Vaccine 13:1603-1610 (1995)), norovirus (Jiang, X. et al., Science 250:1580-1583 (1990); Matsui, SM et al., J. Clin. Invest. 87:1456-1461 (1991)), and retroviral GAG protein (PCT patent application No. WO). 96 / 30523), retrotransposon Ty protein p1, hepatitis B virus surface protein (WO 92 / 11291), human papillomavirus (WO 98 / 15631), human polyomavirus (Sasnauskas K. et al., Biol. Chem. 380(3):381-386 (1999); Sasnauskas K. et al., Generation of recombinant virus-like particles of different polyomaviruses in yeast 3 rd International Workshop “Virus-like particles as vaccines.” Berlin, September 26-29, 2001), RNA phage, Ty, fr phage, GA phage, AP 205 phage, and in particular, Qβ phage.

[0944] As will be apparent to those skilled in the art, the VLPs disclosed herein are not limited to any particular form. The particles may be chemically synthesized or synthesized through biological processes, and may be natural or non-natural. For example, embodiments of this type include virus-like particles or recombinant forms thereof. In some embodiments, the VLP comprises a recombinant polypeptide of rotavirus; a recombinant polypeptide of norovirus; a recombinant polypeptide of alphavirus; a recombinant protein forming bacterial pili or pili-like structures; a recombinant polypeptide of foot-and-mouth disease virus; a recombinant polypeptide of measles virus, a recombinant polypeptide of Sindbis virus, a recombinant polypeptide of retrovirus; a recombinant polypeptide of hepatitis B virus (e.g., HBcAg); a recombinant polypeptide of tobacco mosaic virus; a recombinant polypeptide of Flock House Virus; a recombinant polypeptide of human papillomavirus; a recombinant polypeptide of polyomavirus, and particularly, a recombinant polypeptide of human polyomavirus, and particularly, a recombinant polypeptide of BK virus; a recombinant polypeptide of bacteriophage, a recombinant polypeptide of RNA bacteriophage; a recombinant polypeptide of Ty; a recombinant polypeptide of fr bacteriophage, a recombinant polypeptide of GA bacteriophage, a recombinant polypeptide of AP 205 bacteriophage, and particularly, a recombinant polypeptide of Qβ bacteriophage. The virus-like particle may also comprise one or more fragments of such polypeptides and variants of such polypeptides, or alternatively consist of them. Variants of peptides may share, for example, at least 80%, 85%, 90%, 95%, 97%, or 99% identity with their wild-type counterparts at the amino acid level.

[0945] In some embodiments, the virus-like particles contain recombinant proteins of an RNA phage or fragments thereof. In some embodiments, the RNA phage is selected from the group consisting of: a) phage Qβ; b) phage R17; c) phage fr; d) phage GA; e) phage SP; f) phage MS2; g) phage M11; h) phage MX1; i) phage NL95; k) phage f2; and l) phage PP7.

[0946] In some embodiments, the virus-like particles contain a recombinant protein of RNA phage Qβ or RNA phage fr, or a fragment thereof.

[0947] In some implementations, the recombinant protein comprises the coat protein of an RNA bacteriophage.

[0948] Therefore, RNA phage capsid proteins that form capsids or VLPs, or fragments of phage capsid proteins compatible with self-assembling into capsids or VLPs, are other embodiments of this disclosure. For example, phage Qβ capsid proteins can be recombinantly expressed in *Escherichia coli* (E. coli). Furthermore, following such expression, these proteins spontaneously form capsids. Additionally, these capsids form structures with inherent repeating organization.

[0949] Examples of phage coat proteins that can be used to prepare the compositions of this disclosure include coat proteins of RNA phages, such as phage Qβ (SEQ ID NO: 112; PIR database accession number VCBPQb, referring to QβCP and SEQ ID NO: 113; accession number AAA16663, referring to QβA1 protein), phage R17 (SEQ ID NO: 114; PIR accession number VCBPR7), phage fr (SEQ ID NO: 115; PIR accession number VCBPFR), phage GA (SEQ ID NO: 116; GenBank accession number NP-040754), phage SP (SEQ ID NO: 117; GenBank accession number CAA30374, referring to SPCP and SEQ ID NO: 118; accession number, referring to SP A1 protein), phage MS2 (SEQ ID NO: 119; PIR accession number VCBPM2), phage M11 (SEQ ID NO: 112; PIR database accession number VCBPQb, referring to QβCP and SEQ ID NO: 113; accession number AAA16663, referring to QβA1 protein), phage MS2 (SEQ ID NO: 119; PIR accession number VCBPM2), phage M11 (SEQ ID NO: 112; PIR database ... database accession number AAA16663, referring to QβA1 protein), phage MS2 (SEQ ID NO: 119; PIR database accession number AAA16663, referring to QβA Phages MX1 (SEQ ID NO: 120; GenBank accession number AAC06250), NL95 (SEQ ID NO: 122; GenBank accession number AAC14704), f2 (SEQ ID NO: 123; GenBank accession number P03611), and PP7 (SEQ ID NO: 124) can be incorporated into the capsid assembly of the Qβ coat protein, either the A1 protein of phage Qβ or a truncated form with up to 100, 150, or 180 amino acids removed from its C-terminus. Typically, the percentage of QβA1 protein relative to QβCP in capsid assembly is limited to ensure capsid formation.

[0950] It was also found that the Qβ coat protein self-assembles into a capsid when expressed in *E. coli* (Kozlovska T M. et al., GENE 137:133-137 (1993)). The resulting capsids or virus-like particles exhibit an icosahedral phage-like capsid structure with a diameter of 25 nm and quasi-symmetric T=3. Furthermore, the crystal structure of phage Qβ has been resolved. The capsid contains 180 copies of the coat protein, which are covalently linked by disulfide bonds in pentamer and hexamer forms (Golmohammadi, R. et al., Structure 4:543-5554 (1996)), resulting in the excellent stability of the Qβ coat protein capsid. However, capsids or VLPs made from recombinant Qβ coat protein may contain subunits that are not or are incompletely linked to other subunits within the capsid by disulfide bonds. Therefore, after loading the recombinant Qβ capsid onto non-reducing SDS-PAGE, bands corresponding to the monomeric Qβ capsid protein and bands corresponding to the hexamer or pentamer of the Qβ capsid protein can be observed. Incompletely disulfide-linked subunits may exhibit dimer, trimer, or even tetramer bands in non-reducing SDS-PAGE. The Qβ capsid protein also shows unusual tolerance to organic solvents and denaturants. Concentrations of up to 30% DMSO and acetonitrile, and up to 1 M guanidine, have been observed to have no effect on capsid stability. The high stability of the Qβ capsid protein capsid is an advantageous feature, particularly for its use in mammalian and human immunization and vaccination according to the present invention.

[0951] Following expression in *E. coli*, the N-terminal methionine of the Qβ coat protein is typically removed, as observed by N-terminal Edman sequencing as described in Stoll, E. et al., J. Biol. Chem. 252:990-993 (1977). VLPs consisting of Qβ coat proteins with the N-terminal methionine not removed, or VLPs comprising a mixture of Qβ coat proteins in which the N-terminal methionine is cleaved or present, are also within the scope of this disclosure.

[0952] Other RNA phage capsid proteins have also been shown to self-assemble after expression in the bacterial host (Kastelein, RA. et al., Gene 23:245-254 (1983); Kozlovskaya, T M. et al., Dokl. Akad. Nauk SSSR 287:452-455 (1986); Adhin, M R. et al., Virology 170:238-242 (1989); Ni, C Z. et al., Protein Sci. 5:2485-2493 (1996); Priano, C. et al., J. Mol. Biol. 249:283-297 (1995)). In addition to the capsid proteins, the Qβ phage capsid also contains the so-called readthrough protein A1 and the mature protein A2. A1 is generated by a repression at the UGA stop codon and is 329a in length. In some embodiments, the capsid of the phage Qβ recombinant capsid protein used in this disclosure does not contain the A2 cleavage protein and contains RNA from the host. The capsid protein of RNA phages is an RNA-binding protein and acts as a translation repressor by interacting with the stem-loop at the ribosome binding site of the replicase gene during the viral life cycle. The sequences and structural elements of the interaction are known (Witherell, G W. & Uhlenbeck, O C. Biochemistry 28:71-76 (1989); Lim F. et al., J. Biol. Chem. 271:31839-31845 (1996)). The stem-loop and RNA are generally known to be involved in viral assembly (Golmohammadi, R. et al., Structure 4:543-5554 (1996)).

[0953] In some embodiments, the virus-like particles comprise a recombinant protein of an RNA phage or a fragment thereof, wherein the recombinant protein comprises a mutant capsid protein of the RNA phage, preferably the aforementioned mutant capsid protein of the RNA phage. In some embodiments, the mutant capsid protein of the RNA phage has been modified by substitution to remove at least one lysine residue, or by substitution to add at least one lysine residue; alternatively, the mutant capsid protein of the RNA phage has been modified by deletion of at least one lysine residue or by insertion to add at least one lysine residue.

[0954] In some embodiments, the virus-like particle comprises a recombinant protein of RNA phage Qβ or a fragment thereof, wherein the recombinant protein comprises a capsid protein having the amino acid sequence SEQ ID NO:112 or a mixture of capsid proteins having amino acid sequences SEQ ID NO:112 and SEQ ID NO:113 or a mutant of SEQ ID NO:113, and wherein the N-terminal methionine is preferably cleaved.

[0955] In some embodiments, the virus-like particles comprise a recombinant protein of Qβ or a fragment thereof, wherein the recombinant protein comprises a mutant Qβ capsid protein. In some embodiments, these mutant capsid proteins have been modified by substitution to remove at least one lysine residue, or by substitution to add at least one lysine residue. Alternatively, these mutant capsid proteins have been modified by deletion of at least one lysine residue, or by insertion to add at least one lysine residue.

[0956] Four lysine residues are exposed on the capsid surface of the Qβ coat protein. Qβ mutants in which the exposed lysine residues are replaced with arginine can also be used in this invention. Therefore, the following Qβ coat protein mutants and mutant QβVLP can be used in the practice of this invention: “Qβ240” (Lys13-Arg; SEQ ID NO:125), “Qβ-243” (Asn 10-Lys; SEQ ID NO:126), “Qβ-250” (Lys 2-Arg, Lys13-Arg; SEQ ID NO:127), “Qβ-251” (SEQ ID NO:128), and “Qβ-259” (Lys 2-Arg, Lys16-Arg; SEQ ID NO:129). Therefore, in some embodiments, the virus-like particle comprises a recombinant protein of a mutant Qβ coat protein, which comprises a protein having an amino acid sequence selected from the group consisting of: a) amino acid sequence SEQ ID NO:125; b) amino acid sequence SEQ ID NO:126; c) amino acid sequence SEQ ID NO:127; d) amino acid sequence SEQ ID NO:128; and e) amino acid sequence SEQ ID NO:129. The construction, expression, and purification of the Qβ coat protein, the mutant Qβ coat protein VLP, and the capsid indicated above are disclosed in U.S. Publication No. US2003-0175290, which is incorporated herein by reference in its entirety. Particular reference is made herein to Example 18 of the aforementioned application.

[0957] In some embodiments, the virus-like particles contain a recombinant protein of Qβ or a fragment thereof, wherein the recombinant protein comprises a mixture of any of the aforementioned Qβ mutants and the corresponding A1 protein.

[0958] In some implementations, the virus-like particles contain a recombinant protein of RNA phage AP205 or a fragment thereof.

[0959] The AP205 genome consists of a mature protein, a capsid protein, a replicase, and two open reading frames not present in the associated phage; the cleavage gene and the open reading frames play a role in the translation of the mature gene (Klovins, J., et al., J. Gen. Virol. 83:1523-33 (2002)). The AP205 capsid protein can be expressed by plasmid pAP283-58 (SEQ ID NO:79), a derivative of pQb10 (Kozlovska, TM, et al., Gene 137:133-37 (1993)), which contains the AP205 ribosome binding site. Alternatively, the AP205 capsid protein can be cloned into pQb185, downstream of the ribosome binding site present in the vector. Both methods result in protein expression and capsid formation, as described in U.S. Patent No. 7,138,252, which is incorporated herein by reference in its entirety. Vectors pQb10 and pQb185 are derived from pGEM vectors, in which the expression of cloned genes is controlled by the trp promoter (Kozlovska, TM et al., Gene 137:133-37 (1993)). Plasmid pAP283-58 (SEQ ID NO:130) contains the putative AP205 ribosome binding site in the following sequence, which is located downstream of the XbaI site and immediately upstream of the ATG start codon of the AP205 capsid protein: tctagaATTTTCTGCGCACCCATCC CGGGTGGCGCCCAAAGTGAGGAAAATCAC atg (SEQ ID NO:131). Vector pQb185 contains a Shine Delagarnosequence (tctagaTTAACCCAACGCGTA GGAGTCAGGCCatg, Shine Delagarnosequence with underline, SEQ ID NO:132) downstream of the XbaI site and upstream of the start codon.

[0960] In some implementations, the virus-like particles contain a recombinant coat protein of RNA bacteriophage AP205 or a fragment thereof.

[0961] In some embodiments, the AP205 capsid protein forms a capsid. Such proteins are recombinantly expressed or prepared from natural sources. As demonstrated by electron microscopy (EM) and immunodiffusion, AP205 capsid proteins produced in bacteria spontaneously form capsids. The structural characteristics of capsids formed by AP205 capsid proteins (SEQ ID NO: 133) and those formed by AP205 RNA phage capsid proteins are virtually indistinguishable under EM. AP205 VLPs are highly immunogenic and can be linked to antigens and / or antigenic determinants to produce vaccine constructs exhibiting antigens and / or antigenic determinants oriented in a repetitive manner. High titers are elicited against such antigens, indicating that the bound antigens and / or antigenic determinants readily interact with antibody molecules and are immunogenic.

[0962] In some implementations, the virus-like particles contain a recombinant mutant coat protein of RNA phage AP205 or a fragment thereof.

[0963] In some embodiments, assembly-capacity mutant forms of the AP205 VLP, including the AP205 capsid protein (SEQ ID NO: 134) with proline replaced by threonine at amino acid 5, are used in the practice of this disclosure. These VLPs, AP205 VLPs derived from natural sources, or AP205 viral particles can bind to antigens to generate ordered repeat arrays of antigens according to the invention.

[0964] The AP205 P5-T mutant capsid protein can be expressed by plasmid pAP281-32 (SEQ ID No. 135), which is directly derived from pQb185 and contains the mutant AP205 capsid protein gene instead of the Qβ capsid protein gene. The vector for expressing the AP205 capsid protein was transfected into *E. coli* to express the AP205 capsid protein.

[0965] In some embodiments, this disclosure provides compositions comprising proteins having an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97%, or 99% identical to wild-type proteins that form an ordered array and have an inherent repeating structure.

[0966] In some embodiments, this disclosure provides nucleic acid molecules that encode proteins used to prepare the compositions of the present invention.

[0967] In some embodiments, the compositions described herein comprise proteins having an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, or 99% identity with any one of the amino acid sequences shown in SEQ ID NO:112-129.

[0968] The proteins applicable to this disclosure also include C-terminal truncated mutants or VLPs of proteins that form capsids or capsid-like structures. Specific examples of such truncated mutants include proteins having the amino acid sequence shown in any one of SEQ ID NO:112-129, wherein amino acids 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 have been removed from the C-terminus. Typically, these C-terminal truncated mutants will retain the ability to form capsids or capsid-like structures.

[0969] Other proteins applicable to this disclosure include N-terminal truncated mutants of proteins that form capsids or capsid-like structures. Specific examples of such truncated mutants include proteins having the amino acid sequence shown in any one of SEQ ID NO:112-129, wherein amino acids 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 have been removed from the N-terminus. Typically, these N-terminal truncated mutants will retain the ability to form capsids or capsid-like structures.

[0970] Additional proteins suitable for this disclosure include N- and C-terminal truncated mutants that form capsids or capsid-like structures. Suitable truncated mutants include proteins having the amino acid sequences shown in any one of SEQ ID NO:112-129, wherein amino acids 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 have been removed from the N-terminus, and amino acids 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 have been removed from the C-terminus. Typically, these N-terminal and C-terminal truncated mutants will retain the ability to form capsids or capsid-like structures.

[0971] VLP fragments that retain the ability to induce an immune response may comprise, or alternatively consist of, the following peptides, the length of which is about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, or 500 amino acids, but will obviously depend on the sequence length of the subunits constituting the VLP. Examples of such fragments include the protein fragments discussed herein suitable for preparing immune-enhancing compositions.

[0972] In some embodiments, the VLP is free of a lipoprotein coating or a lipoprotein-containing coating. In some embodiments, the VLP is completely free of a coating.

[0973] The absence of a lipoprotein envelope or a lipoprotein-containing envelope, and especially the complete absence of an envelope, results in a more defined structure and composition of virus-like particles. Therefore, such more defined virus-like particles can minimize side effects. Furthermore, the absence of a lipoprotein-containing envelope, or especially the complete absence of an envelope, avoids or minimizes the incorporation of potentially toxic molecules and pyrogens into the virus-like particles.

[0974] In some embodiments, the particles used in the compositions of this disclosure consist of hepatitis B capsid (core) protein (HBcAg) or fragments of HBcAg that have been modified to eliminate or reduce the number of free cysteine ​​residues. Zhou et al. (J.Virol. 66:5393-5398 (1992)) demonstrated that HBcAg modified to remove naturally occurring cysteine ​​residues retains its ability to associate and form multimeric structures. Therefore, core particles suitable for the compositions of this disclosure include those containing modified HBcAg or fragments thereof, wherein one or more of the naturally occurring cysteine ​​residues have been deleted or replaced by another amino acid residue (e.g., a serine residue).

[0975] HBcAg is a protein produced by processing hepatitis B core antigen precursor protein. Many isotypes of HBcAg have been identified, and their amino acid sequences are readily available to those skilled in the art. For example, the HBcAg protein having the amino acid sequence shown in SEQ ID NO:136 is 185 amino acids long and is produced by processing a 212-amino acid hepatitis B core antigen precursor protein. This processing results in the removal of 29 amino acids from the N-terminus of the hepatitis B core antigen precursor protein. Similarly, the 185-amino acid HBcAg protein is produced by processing a 214-amino acid hepatitis B core antigen precursor protein.

[0976] In some embodiments, the compositions of this disclosure will be prepared using a processed form of HBcAg (i.e., HBcAg with the N-terminal leader sequence of the hepatitis B core antigen precursor protein removed).

[0977] Furthermore, when HBcAg is produced under conditions where no processing occurs, it is typically expressed in a "processed" form. For example, bacterial systems, such as *E. coli*, generally do not remove the leader sequence, also known as the "signal peptide," of proteins normally expressed in eukaryotic cells. Therefore, when the HBcAg of this disclosure is produced using an *E. coli* expression system that directs protein expression to the cytoplasm, the expression of these proteins typically results in the absence of the N-terminal leader sequence of the hepatitis B core antigen precursor protein.

[0978] The preparation of hepatitis B virus-like particles that can be used in this disclosure is disclosed, for example, in WO 00 / 32227, and particularly in Examples 17 to 19 and 21 to 24 herein, and in WO 01 / 85208, and particularly in Examples 17 to 19, 21 to 24, 31 and 41 herein, and in pending U.S. Publication No. US2003-0175290. For the latter application, specific references are made to Examples 23, 24, 31 and 51. All three documents are expressly incorporated herein by reference.

[0979] This disclosure also includes HBcAg variants that have been modified to delete or substitute one or more additional cysteine ​​residues. Therefore, the vaccine compositions of the present invention comprise compositions containing HBcAg, wherein cysteine ​​residues not present in the amino acid sequence shown in SEQ ID NO:136 have been deleted.

[0980] It is well known in the art that free cysteine ​​residues can participate in a number of chemical side reactions. These side reactions include disulfide bond exchange, reactions with chemicals or metabolites (e.g., chemicals or metabolites injected or formed in combination therapies with other substances), direct oxidation upon exposure to ultraviolet light, and reactions with nucleotides. Toxic adducts may thus be generated, especially considering the strong tendency of HBcAg to bind to nucleic acids. Consequently, toxic adducts will be distributed among multiple species, which may exist independently in low concentrations but together reach toxic levels.

[0981] In view of the above, one advantage of using HBcAg in compositions that have been modified to remove naturally occurring cysteine ​​residues is that the number of binding sites for toxic species will be reduced or completely eliminated when the antigen or antigenic determinant is attached.

[0982] Many naturally occurring HBcAg variants suitable for the practice of this disclosure have been identified. For example, Yuan et al. (J.Virol.73:10122-10128(1999)) described a variant in which the isoleucine residue corresponding to position 97 in SEQ ID NO:137 is replaced by a leucine residue or a phenylalanine residue. The amino acid sequences of many HBcAg variants and several hepatitis B core antigen precursor variants are disclosed in the following GenBank reports: AAF121240 (SEQ ID NO:138), AF121239 (SEQ ID NO:139), X85297 (SEQ ID NO:140), X02496 (SEQ ID NO:141), X85305 (SEQ ID NO:142), X85303 (SEQ ID NO:143), AF151735 (SEQ ID NO:144), X85259 (SEQ ID NO:145), X85286 (SEQ ID NO:146), X85260 (SEQ ID NO:147), X85317 (SEQ ID NO:148), X85298 (SEQ ID NO:149), AF043593 (SEQ ID NO:150), M20706 (SEQ ID NO:149), AAF121240 (SEQ ID NO:138 ...85286 (SEQ ID NO:146), X85260 (SEQ ID NO:1 NO:151), X85295 (SEQ ID NO:152), X80925 (SEQ ID NO:153), NO:157), X65258 (SEQ ID NO:158), X85302 (SEQ ID NO:159), M32138 (SEQ ID NO:160), ID NO:164), X85316 (SEQ ID NO:165), X85296 (SEQ ID NO:166), AB033559 (SEQ ID NO:167), X59795 (SEQ ID NO:168), X85299 (SEQ ID NO:169), NO:173), X85314(SEQ IDThe following reports are cited in this document: NO:174), X85287 (SEQ ID NO:175), X85272 (SEQ ID NO:176), X85319 (SEQ ID NO:177), AB010289 (SEQ ID NO:178), X85285 (SEQ ID NO:179), AB010289 (SEQ ID NO:180), AF121242 (SEQ ID NO:181), M90520 (SEQ ID NO:182), P03153 (SEQ ID NO:183), AF110999 (SEQ ID NO:184), and M95589 (SEQ ID NO:185), the contents of which are hereby incorporated by reference. These HBcAg variants differ in amino acid sequences at multiple positions, including amino acid residues corresponding to the following positions in SEQ ID NO:77: 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182, and 183. Other HBcAg variants suitable for the compositions of the present invention and which may be further modified according to the disclosure of this specification are described in WO 00 / 198333, WO00 / 177158 and WO 00 / 214478.

[0983] The HBcAg applicable to this disclosure can be derived from any organism, as long as they are able to encapsulate, conjugate, or otherwise attach (in particular, as long as they are able to package) an RLR agonist and induce an immune response.

[0984] In some embodiments, the composition comprises an HBcAg variant capable of associating to form a dimer or multimer structure. In some embodiments, the composition comprises an HBcAg polypeptide comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, or 99% identity with any wild-type amino acid sequence, and in a form where such proteins are processed to remove the N-terminal leader sequence, where appropriate.

[0985] Whether a polypeptide's amino acid sequence has at least 80%, 85%, 90%, 95%, 97%, or 99% identity with one of the wild-type amino acid sequences or its sub-regions can be routinely determined using known computer programs (such as the Bestfit program). When using Bestfit or any other sequence alignment program to determine whether a particular sequence has, for example, 95% identity with a reference amino acid sequence, parameters are set such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that the homology interval of the total number of amino acid residues in the reference sequence is allowed to be at most 5%.

[0986] HBcAg variants and precursors having the amino acid sequences shown in SEQ ID NO:138-181 and 182-185 are relatively similar to each other. Therefore, references to amino acid residues of HBcAg variants located at positions corresponding to specific locations in SEQ ID NO:186 refer to amino acid residues present at those positions in the amino acid sequence shown in SEQ ID NO:186. The homology among these HBcAg variants is sufficiently high in most cases in hepatitis B viruses infecting mammals, so those skilled in the art have little difficulty in examining the amino acid sequences shown in SEQ ID NO:186 and SEQ ID NO:136 and the amino acid sequences of specific HBcAg variants, and in identifying the “corresponding” amino acid residues. Furthermore, the HBcAg amino acid sequence shown in SEQ ID NO:182 (which shows the amino acid sequence of HBcAg derived from a virus infecting a marmot) has sufficient homology with the HBcAg having the amino acid sequence shown in SEQ ID NO:186, and it is clear that there is a three-amino acid residue insertion between amino acid residues 155 and 156 of SEQ ID NO:182 and SEQ ID NO:186.

[0987] As discussed above, the removal of free cysteine ​​residues reduces the number of sites where toxic components can bind to HBcAg, and also eliminates sites where lysine and cysteine ​​residues of the same or adjacent HBcAg molecules might crosslink. Therefore, in some embodiments, one or more cysteine ​​residues of the hepatitis B virus capsid protein have been deleted or replaced by another amino acid residue.

[0988] In some embodiments, the compositions described herein comprise HBcAg with the C-terminal region removed (e.g., amino acid residues 145-185 or 150-185 of SEQ ID NO: 186). Therefore, additional modified HBcAg suitable for the practice of this disclosure includes C-terminal truncated mutants. Suitable truncated mutants include HBcAg with 1, 5, 10, 15, 20, 25, 30, 34, or 35 amino acids removed from the C-terminus.

[0989] HBcAg applicable to the practice of this disclosure also includes N-terminal truncated mutants. Suitable truncated mutants include modified HBcAg with 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids removed from the N-terminus.

[0990] Other modifications of HBcAg suitable for practice with this disclosure include N- and C-terminal truncated mutants. Suitable truncated mutants include HBcAg with 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids removed from the N-terminus and 1, 5, 10, 15, 20, 25, 30, or 34 amino acids removed from the C-terminus.

[0991] In some embodiments, the composition containing the HBcAg polypeptide comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, or 99% identity with the truncated mutant described above.

[0992] In some embodiments, lysine residues are introduced into the HBcAg polypeptide to mediate the binding of the antigen or antigenic determinant to the VLP of HBcAg. In some embodiments, the compositions described herein are prepared using HBcAg comprising amino acids 1-144 or 1-149, 1-185 of SEQ ID NO:186, said HBcAg being modified such that amino acids corresponding to positions 79 and 80 are replaced by a peptide having the amino acid sequence Gly-Gly-Lys-Gly-Gly (SEQ ID NO:187). These compositions are particularly useful in those embodiments where the antigenic determinant is coupled to the VLP of HBcAg. In some embodiments, cysteine ​​residues at positions 48 and 107 of SEQ ID NO:186 are mutated to serine. In some embodiments, the compositions described herein comprise the corresponding polypeptide having the amino acid sequence shown in any one of SEQ ID NO:138-183, and also having the above-described amino acid changes. Further HBcAg variants capable of associating to form a capsid or VLP and having the above-described amino acid changes are also included within the scope of this disclosure. Therefore, this disclosure also includes compositions comprising HBcAg polypeptides comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, or 99% identity with any wild-type amino acid sequence, and in a form where such proteins are processed, where appropriate, to remove the N-terminal leader sequence and modified with the aforementioned alterations.

[0993] In some embodiments, the compositions described herein comprise a mixture of different HBcAgs. Therefore, these compositions can be composed of HBcAgs with different amino acid sequences. For example, compositions comprising "wild-type" HBcAg and modified HBcAgs in which one or more amino acid residues have been altered (e.g., deleted, inserted, or substituted) can be prepared.

[0994] Several crystal structures of RNA phages have been determined (Golmohammadi, R. et al., Structure 4:543-554 (1996)). Using this information, surface-exposed residues can be identified, and thus RNA phage coat proteins can be modified such that one or more reactive amino acid residues can be inserted by insertion or substitution. Therefore, those modified forms of phage coat proteins can also be used in this disclosure. Consequently, protein variants that form capsids or capsid-like structures (e.g., coat proteins of phages Qβ, R17, fr, GA, SP, MS2, and AP 205) can also be used to prepare the compositions described herein.

[0995] Although the sequences of the variant proteins discussed above differ from their wild-type counterparts, these variant proteins generally retain the ability to form capsids or capsid-like structures. Therefore, the present invention also includes compositions further comprising protein variants that form capsids or capsid-like structures, methods for preparing such compositions, individual protein subunits for preparing such compositions, and nucleic acid molecules encoding these protein subunits. Thus, the scope of this disclosure includes variant forms of wild-type proteins that form capsids or capsid-like structures and retain the ability to associate and form capsids or capsid-like structures.

[0996] Antigens and antigenic determinants

[0997] In some embodiments, the compositions described herein comprise an antigen or antigenic determinant that binds to virus-like particles. This disclosure provides compositions that vary depending on the antigen or antigenic determinant selected with consideration of desired therapeutic effects. Exemplary antigens or antigenic determinants suitable for use in this invention are disclosed in U.S. Patent Nos. 7,229,624, 6,964,769, and 7,264,810, the disclosures of which are incorporated herein by reference in their entirety.

[0998] An antigen can be of any known or still unknown origin. It can be isolated from bacteria, viruses, or other pathogens, or it can be a recombinant antigen obtained from the expression of a suitable nucleic acid encoding this. It can also be isolated from prions, tumors, automolecules, non-peptide haptens, allergens, and hormones. In some embodiments, the antigen is a recombinant antigen. Of course, the choice of antigen depends on the desired immune response and the host.

[0999] In some implementations, an immune response is induced against the VLP itself. In some implementations, the virus-like particles are coupled, fused, or otherwise attached to an antigen / immunogen that requires an enhanced immune response.

[1000] In some embodiments, at least one antigen or antigenic determinant is fused to a virus-like particle. As described above, a VLP is typically composed of at least one subunit that assembles into a VLP. Therefore, in some embodiments, an antigen or antigenic determinant is fused to at least one subunit of a virus-like particle or a protein capable of being incorporated into a VLP to produce a chimeric VLP-subunit-antigen fusion.

[1001] Fusion of antigens or antigenic determinants can be achieved by insertion into the VLP subunit sequence or by fusion with the N or C terminus of a VLP-subunit or a protein capable of incorporating into the VLP. In the following text, when referring to a fusion protein of a peptide with a VLP subunit, it encompasses fusion with either end of the subunit sequence or internal insertion of the peptide within the subunit sequence.

[1002] Fusion can also be achieved by inserting an antigen or antigenic determinant sequence into a variant of the VLP subunit in which a portion of the subunit sequence has been deleted (which is further referred to as a truncated mutant). The truncated mutant may have an N- or C-terminus, or an internal deletion of a portion of the VLP subunit sequence. For example, a particular VLP HBcAg with a deletion of, for example, amino acid residues 79 to 81 is a truncated mutant with an internal deletion. In some embodiments, the antigen or antigenic determinant is fused to the N- or C-terminus of the truncated mutant VLP subunit. Similarly, fusion of epitopes into the sequence of the VLP subunit can also be achieved by substitution, for example, for a particular VLP HBcAg, amino acids 79-81 are replaced by a foreign epitope. Therefore, the fusions mentioned below can be achieved by inserting an antigen or antigenic determinant sequence into the sequence of the VLP subunit, by replacing a portion of the VLP subunit sequence with an antigen or antigenic determinant, or by a combination of deletion, substitution, or insertion.

[1003] Chimeric antigens or antigenic determinants—VLP subunits—are typically capable of self-assembling into VLPs. VLPs exhibiting epitopes fused to their subunits are also referred to herein as chimeric VLPs. As noted, virus-like particles contain at least one VLP subunit or are alternatively composed of it. In some embodiments, virus-like particles contain a mixture of chimeric and non-chimeric VLP subunits (i.e., VLP subunits without an antigen fused to them) or are alternatively composed of them, thereby producing so-called mosaic particles. This may be advantageous in ensuring the formation and assembly of VLPs. In those embodiments, the proportion of chimeric VLP subunits can be 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or higher.

[1004] Flanking amino acid residues can be added to either end of the sequence of a peptide or epitope to fuse with either end of the sequence of a VLP subunit, or to insert such peptide sequences internally into the sequence of a VLP subunit. Glycine and serine residues are particularly advantageous amino acids for use in flanking sequences of the peptide to be fused. Glycine residues provide additional flexibility, which reduces the potential instability of fusing foreign sequences into the VLP subunit sequence.

[1005] In some embodiments, at least one antigen or antigenic determinant is fused to the Qβ coat protein. Fusion protein constructs have been described involving the C-terminus fusion of the epitope with a truncated form of the A1 protein of Qβ or insertion into the A1 protein (Kozlovska, TM, et al., Intervirology, 39:9-15 (1996)). The A1 protein is generated by a stop codon at the UGA stop codon and is 329 aa or 328 aa in length (if the cleavage of the N-terminal methionine is taken into account). The N-terminal methionine cleavage before alanine (the second amino acid encoded by the QβCP gene) typically occurs in *E. coli*, and this is the case at the N-terminus of the Qβ coat protein. The A1 gene portion (3' of the UGA amber codon) encodes a CP extension of 195 amino acids. Insertion of at least one antigen or antigenic determinant between positions 72 and 73 of the CP extension results in other embodiments of the invention (Kozlovska, TM, et al., Intervirology 39:9-15 (1996)). Fusion of the antigen or antigenic determinant at the C-terminus of a truncated QβA1 protein leads to other embodiments of the invention. For example, Kozlovska et al. (Intervirology, 39:9-15 (1996)) described a QβA1 protein fusion in which the epitope is fused to the C-terminus of a truncated QβCP extension at position 19.

[1006] As described by Kozlovska et al. (Intervirology, 39:9-15 (1996)), the assembly of particles exhibiting fusion epitopes typically requires the presence of both the A1 protein-antigen fusion and the wild-type CP to form a mosaic particle. However, embodiments comprising virus-like particles, and in particular, VLPs comprising the RNA phage Qβ coat protein, which consist solely of a VLP subunit having at least one antigen or antigenic determinant fused thereto, are also within the scope of this disclosure.

[1007] The generation of mosaic particles can be achieved in several ways. Kozlovska et al., Intervirology, 39:9-15 (1996) describe three methods, all of which can be used in the practice of this disclosure. In the first method, efficient display of the fusion epitope on the VLP is mediated by the expression of a plasmid encoding a QβA1 protein fusion having a UGA stop codon between the CP and CP extension of an E. coli strain containing a plasmid encoding a clonal UGA repressive tRNA that causes the UGA codon to be translated into Trp (pISM3001 plasmid (Smiley BK et al., Gene 134:33-40 (1993))). In another method, the CP gene stop codon is modified to UAA, and a second plasmid expressing the A1 protein-antigen fusion is co-transformed. The second plasmid encodes different antibiotic resistance and has an origin of replication compatible with the first plasmid (Kozlovska, TM et al., Intervirology 39:9-15 (1996)). In the third approach, the CP and A1 protein-antigen fusions are encoded in a bicistronic manner and are operatively linked to promoters such as the Trp promoter, as described in Kozlovska et al., Intervirology, 39:9-15 (1996). Figure 1 As stated above.

[1008] In some embodiments, recombinant DNA technology can be used to fuse heterologous proteins with VLP proteins (Kratz, PA, et al., Proc. Natl. Acad. Sci. USA 96:1915 (1999)). For example, this disclosure covers VLPs that are recombinantly fused or chemically conjugated (including both covalent and non-covalent conjugations) with an antigen (or a portion thereof, preferably at least 10, 20, or 50 amino acids) to produce a fusion protein or conjugate. Fusion does not necessarily need to be direct but can be performed via a linker sequence. More generally, in cases where an epitope fused, conjugated, or otherwise attached to a virus-like particle is used as an antigen according to the invention, spacer or linker sequences are typically added to one or both ends of the epitope. Such linker sequences preferably contain sequences recognized by proteases, endosome proteases, or other vesicular compartments of the cell.

[1009] One coupling method is via peptide bonds, where the conjugate can be an adjacent polypeptide, i.e., a fusion protein. In some embodiments, different peptides or polypeptides are linked together within a framework to form an adjacent polypeptide. Thus, the first portion of the fusion protein contains an antigen or immunogen, and the second portion of the fusion protein (at the N-terminus or C-terminus of the first portion) contains a VLP. Alternatively, according to the invention, internal insertion into the VLP may be used, with optional linker sequences at both ends of the antigen.

[1010] Flexible adapter sequences (e.g., sequences containing polyglycine / polyserine, such as [Gly4 Ser]2 (Huston et al., Meth. Enzymol 203:46-88 (1991))) can be inserted into fusion proteins between antigens and ligands. Additionally, fusion proteins can be constructed to contain "epitope tags" that allow the fusion protein to bind antibodies (e.g., monoclonal antibodies), for example, for labeling or purification purposes. One example of an epitope tag is the Glu-Glu-Phe tripeptide recognized by the monoclonal antibody YL1 / 2.

[1011] This disclosure also relates to chimeric DNA containing sequences encoding VLPs and sequences encoding antigens / immunogens. For example, the DNA can be expressed in insect cells transformed with baculoviruses, in yeast, or in bacteria. There are no limitations on the expression system, with a large number of options available for conventional use. Preferably, systems that allow for large-scale protein expression are used. Generally, bacterial expression systems are used because of their efficiency. An example of a suitable bacterial expression system for use within the scope of this invention is the bacterial expression system described by Clarke et al., J. Gen. Virol. 71:1109-1117 (1990); Borisova et al., J. Virol. 67:3696-3701 (1993); and Studier et al., Methods Enzymol. 185:60-89 (1990). An example of a suitable yeast expression system is the yeast expression system described by Emr, Methods Enzymol. 185:231-3 (1990); baculovirus systems previously used for preparing capsid proteins are also suitable. Constitutive or inducible expression systems can be used. By selecting and potentially modifying the available expression systems, it is possible to control the form of the obtained protein.

[1012] In some embodiments, at least one antigen or antigenic determinant binds to a virus-like particle via at least one covalent bond. In some embodiments, at least one antigen or antigenic determinant binds to a virus-like particle via at least one covalent bond, said covalent bond being a non-peptide bond that results in an array of antigens or antigenic determinants and an antigen or antigenic determinant-VLP conjugate, respectively. Because at least one antigen or antigenic determinant binds to the VLP in an oriented manner, such an array of antigens or antigenic determinants and conjugates generally and preferably have repeating and ordered structures. In some embodiments, equal to or more than 120, equal to or more than 180, more than 270, and equal to or more than 360 antigens bind to the VLP. The formation of repeating and ordered arrays of antigens or antigenic determinants-VLPs and conjugates is ensured by the orientation and orientation of at least one antigen or antigenic determinant with the VLP, and by defined binding and attachment, as will become apparent below. Furthermore, the typically inherently highly repetitive and organized structure of VLPs advantageously facilitates the display of antigens or antigenic determinants in a highly ordered and repetitive manner, thereby resulting in highly organized and repetitive antigen or antigenic determinant-VLP arrays and conjugates, respectively.

[1013] The VLP, or capsid, of the Qβ capsid protein exhibits a defined number of lysine residues on its surface, with a defined topological structure in which three lysine residues point inward and interact with RNA, while another four lysine residues are exposed on the outside of the capsid. These defined properties favor antigen attachment to the outside of the particle, rather than to the inside of the particle where the lysine residues interact with RNA. Other RNA phage capsid proteins also have a defined number of lysine residues on their surface and a defined topological structure for these lysine residues.

[1014] In some embodiments, the first attachment site is a lysine residue and / or the second attachment site contains a thiol or cysteine ​​residue.

[1015] In some embodiments, the antigen or antigenic determinant binds to the lysine residue of the VLP of the RNA phage capsid protein via a cysteine ​​residue, and particularly to the VLP of the Qβ capsid protein.

[1016] Using VLPs as carriers allows for the formation of robust antigen arrays and conjugates with variable antigen densities. Specifically, using VLPs of RNA phages, and particularly VLPs of RNA phage Qβ coat proteins, allows for very high epitope densities. Specifically, by conjugating, for example, human Aβ1-6 peptides to VLPs of Qβ coat proteins, densities of more than 1.5 epitopes per subunit have been achieved (WO 2004 / 016282). The teachings of this application can be used to prepare VLP compositions of RNA phage coat proteins with high epitope densities. In some implementations, when the antigen or antigenic determinant is coupled to the VLPQβ coat protein, the average number of antigens or antigenic determinants per subunit is used at 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 or higher.

[1017] As defined herein, a second attachment site may be naturally or non-naturally present with an antigen or antigenic determinant. In cases where a suitable naturally present second attachment site does not exist on the antigen or antigenic determinant, such non-natural second attachments must be engineered for the antigen.

[1018] As described above, four lysine residues are exposed on the VLP surface of the Qβ coat protein. Normally, these residues are derivatized upon reaction with a cross-linking agent molecule. In cases where not all exposed lysine residues are conjugated to the antigen, the lysine residues that react with the cross-linking agent remain after the derivatization step along with the cross-linking agent molecule attached to the quadrature-amino group. This results in the loss of one or more positive charges, which can be detrimental to the solubility and stability of the VLP. In the disclosed Qβ coat protein mutants described below, excessive loss of positive charges is prevented by replacing some lysine residues with arginine, since arginine residues do not react with the cross-linking agent. Furthermore, replacing lysine residues with arginine may result in a more defined antigenic array because fewer sites are available for antigen reaction.

[1019] In some embodiments, the exposed lysine residues are replaced with arginine in the following Qβ coat protein mutants and the mutant QβVLP disclosed herein: Qβ-240 (Lys13-Arg; SEQ ID NO:125), Qβ-250 (Lys 2-Arg, Lys13-Arg; SEQ ID NO:127) and Qβ-259 (Lys 2-Arg, Lys16-Arg; SEQ ID NO:129).

[1020] In some embodiments, the Qβ mutant capsid protein contains an additional lysine residue, suitable for obtaining a higher density antigen array. Cloning such a mutant Qβ capsid protein Qβ-243 (Asn 10-Lys; SEQ ID NO: 126), expressing the protein, and isolating and purifying the capsid or VLP showed that the introduction of the additional lysine residue was compatible with the subunit self-assembly into the capsid or VLP. Therefore, the VLP of the Qβ capsid protein mutant can be used to prepare antigens or antigen determinant arrays and conjugates, respectively. A particularly advantageous method for attaching antigens to VLPs, and especially to VLPs of RNA phage capsid proteins, is to link the lysine residues present on the surface of the VLP of the RNA phage capsid protein with cysteine ​​residues added to the antigen. For the cysteine ​​residue to function effectively as a second attachment site, the thiol group must be available for coupling. Therefore, the cysteine ​​residue must be in its reduced state, i.e., free cysteine ​​or cysteine ​​residues with a free thiol group must be available. If the cysteine ​​residue acting as the second attachment site is in its oxidized form, for example if it is forming a disulfide bond, this disulfide bond needs to be reduced with, for example, DTT, TCEP, or β-mercaptoethanol. The concentration of the reducing agent and the molar excess of the reducing agent relative to the antigen must be adjusted for each antigen. Titration ranges were tested, starting from concentrations as low as 10 μM or lower up to 10 to 20 mM or higher (if desired), and the coupling of the antigen with the carrier was evaluated. Although low concentrations of reducing agent are compatible with the coupling reaction as described in WO 02 / 056905, higher concentrations inhibit the coupling reaction as is known to those skilled in the art. In such cases, the reducing agent must be removed or its concentration reduced, for example by dialysis, gel filtration, or reversed-phase HPLC. Advantageously, the pH of the dialysis or equilibration buffer is below 7, preferably 6. The compatibility of the low-pH buffer with the antigen activity or stability must be tested.

[1021] Epitope density on the VLP of RNA phage coat proteins can be modulated by selecting cross-linking agents and other reaction conditions. For example, the cross-linking agents Sulfo-GMBS and SMPH typically allow for high epitope densities. Derivatization is positively influenced by high concentrations of reactants, and manipulation of reaction conditions can be used to control the number of antigens coupled to the VLP of RNA phage coat proteins, and particularly to the VLP of Qβ coat proteins.

[1022] Before designing a non-natural second attachment site, the location where it should be fused, inserted, or typically engineered must be selected. The selection of the second attachment site location can, for example, be based on the crystal structure of the antigen. Such a crystal structure of the antigen can provide information about the availability of the C or N-termini of the molecule (e.g., determined by their accessibility to solvents) or about the exposure of residues suitable for use as a second attachment site (such as cysteine ​​residues) to solvents. As with Fab fragments, exposed disulfide bonds can also be a source of second attachment sites, as they can typically be converted to a single cysteine ​​residue using mild reduction methods such as 2-mercaptoethylamine, TCEP, β-mercaptoethanol, or DTT. Mild reduction conditions that do not affect the immunogenicity of the antigen will be selected. Generally, in cases where the purpose of immunization with a self-antigen is to inhibit the interaction of this self-antigen with its natural ligand, a second attachment site will be added to allow the generation of antibodies against the site that interacts with the natural ligand. Therefore, the location of the second attachment site will be selected to avoid steric hindrance from the second attachment site or any amino acid linkers containing said site. In other embodiments, an antibody response is required targeting a site different from the interaction site between the self-antigen and its natural ligand. In such embodiments, a second attachment site may be selected such that it prevents the generation of antibodies against the interaction site between the self-antigen and its natural ligand.

[1023] Other criteria for selecting the location of the second attachment site include the oligomerization state of the antigen, the site of oligomerization, the presence of cofactors, and the availability of experimental evidence of the site in the publicly disclosed antigen structure and sequence, wherein the modification of the antigen is compatible with the function of the self-antigen or with the production of antibodies that recognize the self-antigen.

[1024] In some embodiments, the antigen or antigenic determinant comprises a single second attachment site or a single reactive attachment site capable of associating with a first attachment site on the core particle and the VLP or VLP subunit, respectively. This further ensures at least one, but typically more than one, preferably more than 10, 20, 40, 80, 120, 150, 180, 210, 240, 270, 300, 360, 400, or 450 antigens, respectively, with defined and homogeneous binding and association with the core particle and the VLP. Thus, providing a single second attachment site or a single reactive attachment site on the antigen ensures a single and homogeneous type of binding and association, resulting in a highly ordered and repetitive array. For example, if binding and association are achieved through lysine (as the first attachment site) interaction and cysteine ​​(as the second attachment site) interaction, respectively, then according to one embodiment of the invention, it is ensured that each antigen has only one cysteine ​​residue (whether this cysteine ​​residue is naturally or unnaturally present on the antigen) that can bind and associate with the first attachment sites of the VLP and the core particle, respectively.

[1025] In some embodiments, engineering the second attachment site onto the antigen requires fusing an amino acid linker containing an amino acid suitable as a second attachment site according to the disclosure of the present invention. Therefore, in some embodiments, the amino acid linker binds to the antigen or antigenic determinant via at least one covalent bond. In some embodiments, the amino acid linker comprises a second attachment site. In some embodiments, the amino acid linker comprises a thiol or cysteine ​​residue. In some embodiments, the amino acid linker is a cysteine ​​residue.

[1026] In some embodiments, the virus-like particle includes at least one first attachment site and the antigen or antigenic determinant includes at least one second attachment site. In some embodiments, the first attachment site includes an amino or lysine residue. In some embodiments, the second attachment site is selected from the group consisting of (a) attachment sites not naturally present in the antigen or antigenic determinant; and (b) attachment sites naturally present in the antigen or antigenic determinant. In some embodiments, the second attachment site includes a thiol or cysteine ​​residue. In some embodiments, the binding of the antigen or antigenic determinant to the virus-like particle is achieved through association between the first and second attachment sites, wherein the association is carried out by at least one non-peptide bond, and wherein the antigen or antigenic determinant and the virus-like particle interact through the association to form an ordered and repeating array of antigens. In some embodiments, the first attachment site is a lysine residue and the second attachment site is a cysteine ​​residue. In some embodiments, the first attachment site is an amino group and the second attachment site is a thiol group.

[1027] This disclosure applies to a variety of antigens. In some embodiments, the antigen is a protein, polypeptide, or peptide. In some embodiments, the antigen is DNA. The antigen can also be a lipid, carbohydrate, or organic molecule, particularly small organic molecules such as nicotine.

[1028] Methods for preparing VLPs and packaging RLR agonists in VLPs

[1029] Methods for expressing the capsid protein and mutant capsid protein separately, leading to self-assembly into a VLP, are described in U.S. Patent No. 7,138,252, which is incorporated herein by reference in its entirety. Suitable Escherichia coli strains include, but are not limited to, Escherichia coli K802, JM 109, and RR1. Suitable vectors and strains, and combinations thereof, can be identified by testing the expression of the capsid protein and mutant capsid protein separately by SDS-PAGE; and by testing capsid formation and assembly by optionally first purifying the capsid by gel filtration and subsequently testing them in an immunodiffusion assay (Ouchterlony test) or electron microscopy (Kozlovska, TM et al., Gene 137:133-37 (1993)).

[1030] One advantage of using VLPs derived from RNA phages is their high expression yield in bacteria, allowing for the production of large quantities of material at an affordable cost. Methods for manufacturing the virus-like particles described herein (including methods scalable to commercial scale) are described in U.S. Patent Nos. 9,518,095 and 9,657,065, which are incorporated herein by reference in their entirety.

[1031] This disclosure also provides a method for producing a composition comprising a VLP and an RLR agonist packaged into the VLP, the method comprising incubating the VLP with the RLR agonist, adding an RNase, and purifying the composition. In some embodiments, the method further comprises the step of binding an antigen or antigenic determinant to the virus-like particle. In some embodiments, the antigen or antigenic determinant is bound to the virus-like particle before incubating the virus-like particle with the RLR agonist. In some embodiments, the antigen or antigenic determinant is bound to the virus-like particle after purification of the composition. In some embodiments, the method comprises incubating the VLP with an RNase, adding an RLR agonist, and purifying the composition. In some embodiments, the method further comprises the step of binding an antigen or antigenic determinant to the virus-like particle. In some embodiments, the antigen or antigenic determinant is bound to the virus-like particle before incubating the virus-like particle with the RNase. In some embodiments, the antigen or antigenic determinant is bound to the virus-like particle after purification of the composition. In some embodiments, the VLP is produced in a bacterial expression system. In another embodiment, the RNase is RNase A.

[1032] This disclosure also provides a method for generating a composition comprising an RLR agonist packaged in a VLP, the method comprising disassembling the VLP, adding the RLR agonist, and reassembling the VLP. In some embodiments, the disassembled VLP is generated during the manufacture of the VLP. In some embodiments, the disassembled VLP comprises a segregated dimer of a capsid protein (e.g., a Qβ dimer). In some embodiments, the segregated dimer is assembled around the RLR agonist into a VLP to package the agonist into the VLP. The method may further comprise removing nucleic acids from the disassembled VLP and / or purifying the composition after reassembly. In some embodiments, the method further comprises the step of binding an antigen or antigenic determinant to the virus-like particle. In some embodiments, the antigen or antigenic determinant is bound to the virus-like particle before disassembling the virus-like particle. In some embodiments, the antigen or antigenic determinant is bound to the virus-like particle after reassembly of the virus-like particle and preferably after purification of the composition.

[1033] This disclosure provides a method for binding an antigen or antigenic determinant to a VLP. As noted, in some embodiments, at least one antigen or antigenic determinant is bound to the VLP by chemical cross-linking, typically and preferably by using a heterobifunctional cross-linking agent. Several heterobifunctional cross-linking agents are known in the art. In some embodiments, the heterobifunctional cross-linking agent contains a functional group that reacts with a first attachment site (i.e., a side-chain amino group of a lysine residue of the VLP or at least one VLP subunit) and an additional functional group that reacts with a second attachment site (i.e., a cysteine ​​residue that fuses with the antigen or antigenic determinant and optionally can also react by reduction). The first step of the process, commonly referred to as derivatization, is the reaction of the VLP with the cross-linking agent. The product of this reaction is an activated VLP, also known as an activated carrier. In the second step, unreacted cross-linking agent is removed using common methods such as gel filtration or dialysis. In the third step, the antigen or antigenic determinant reacts with the activated VLP, and this step is commonly referred to as the coupling step. Unreacted antigen or antigenic determinant may optionally be removed in a fourth step, for example, by dialysis. Several heterobifunctional crosslinking agents are known in the art. These include crosslinking agents SMPH (Pierce), Sulfo-MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB, Sulfo-SMPB, Sulfo-SMCC, SVSB, SIA, and other crosslinking agents, for example, available from Pierce Chemical Company (Rockford, Illinois, USA), having one functional group reactive to an amino group and one functional group reactive to a cysteine ​​residue. All of the above crosslinking agents result in the formation of thioether bonds. Another suitable class of crosslinking agents is characterized by introducing disulfide bonds between the antigen or antigenic determinant and the VLP during coupling. In one embodiment, crosslinking agents belonging to this class include, for example, SPDP and Sulfo-LC-SPDP (Pierce). The degree of derivatization of the VLP with the crosslinking agent can be affected by various experimental conditions, such as the concentration of each reaction partner, the excess of one reagent relative to another, pH, temperature, and ionic strength. The degree of coupling, i.e. the amount of antigen or antigenic determinant in each VLP subunit, can be adjusted by changing the experimental conditions described above to match the requirements of the vaccine.

[1034] In some embodiments, the method of binding an antigen or antigenic determinant to a VLP includes linking a lysine residue on the surface of the VLP to a cysteine ​​residue on the antigen or antigenic determinant. In some embodiments, it may be necessary to fuse an amino acid linker containing a cysteine ​​residue as a second attachment site or part thereof to the antigen or antigenic determinant to achieve coupling with the VLP.

[1035] In some implementations, flexible amino acid linkers are used. Examples of amino acid linkers are selected from the group consisting of: (a) CGG; (b) N-terminal γ1-linker; (c) N-terminal γ3-linker; (d) Ig hinge region; (e) N-terminal glycine linker; (f) (G)kC(G)n, where n = 0-12 and k = 0-5; (g) N-terminal glycine-serine linker; (h) (G)kC(G)m(S)l(GGGGS)n, where n = 0-3, k = 0-5, m = 0-10, l = 0-2 (SEQ ID NO: ... NO:188); (i)GGC; (k)GGC-NH2; (l)C-terminal γ1-linker; (m)C-terminal γ3-linker; (n)C-terminal glycine linker; (o)(G)nC(G)k, where n = 0-12 and k = 0-5; (p)C-terminal glycine-serine linker; (q)(G)m(S)l(GGGGS)n(G)oC(G)k, where n = 0-3, k = 0-5, m = 0-10, l = 0-2 and o = 0-8 (SEQ ID NO:189).

[1036] Other examples of amino acid linkers are the hinge region of immunoglobulins, the glycine-serine linker (GGGGS)n (SEQ ID NO: 190), and the glycine linker (G)n, all of which further contain cysteine ​​residues as a second attachment site and optionally additional glycine residues. Typical examples of the amino acid linkers are: N-terminal γ1: CGDKTHTSPP (SEQ ID NO: 191); C-terminal γ1: DKTHTSPPCG (SEQ ID NO: 192); N-terminal γ3: CGGPKPSTPPGSSGGAP (SEQ ID NO: 193); C-terminal γ3: PKPSTPPGSSGGAPGGCG (SEQ ID NO: 194); N-terminal glycine linker: GCGGGG (SEQ ID NO: 195); C-terminal glycine linker: GGGGCG (SEQ ID NO: 196); C-terminal glycine-lysine linker: GGKKGC (SEQ ID NO: 197); N-terminal glycine-lysine linker: CGKKGG (SEQ ID NO: 198).

[1037] In some embodiments, when the hydrophobic antigen or antigenic determinant binds to the VLP, the other amino acid linkers are CGKKGG (SEQ ID NO:199) or CGDEGG (SEQ ID NO:200) for the N-terminal linker, or GGKKGC (SEQ ID NO:201) and GGEDGC (SEQ ID NO:202) for the C-terminal linker. For the C-terminal linker, the terminal cysteine ​​is optionally C-terminally amidated.

[1038] In some embodiments, the GGCG (SEQ ID NO:203), GGC, or GGC-NH2 (“NH2” stands for amidation) linker at the C-terminus of the peptide, or the CGG at its N-terminus, is used as an amino acid linker. Generally, the glycine residue is inserted between the larger amino acid and the cysteine ​​residue to be used as a second attachment site to avoid potential steric hindrance from the larger amino acid during the coupling reaction. In some embodiments, the amino acid linker GGC-NH2 is fused to the C-terminus of the antigen or antigenic determinant.

[1039] Cysteine ​​residues present on the antigen or antigenic determinant must be in their reduced state to react with the heterobifunctional crosslinker on the activated VLP; that is, free cysteine ​​or cysteine ​​residues with free thiol groups must be available. If the cysteine ​​residue acting as the binding site is in its oxidized form, for example if it is forming a disulfide bond, this disulfide bond needs to be reduced with, for example, DTT, TCEP, or β-mercaptoethanol. Low concentrations of the reducing agent are compatible with coupling as described in WO 02 / 05690; higher concentrations inhibit the coupling reaction, as is known to those skilled in the art, and in such cases, the reducing agent must be removed or its concentration reduced prior to coupling, for example by dialysis, gel filtration, or reversed-phase BPLC.

[1040] According to the above method, by using a heterobifunctional cross-linking agent to bind an antigen or antigenic determinant to a VLP, the antigen or antigenic determinant is allowed to be coupled to the VLP in an oriented manner. Other methods for binding an antigen or antigenic determinant to a VLP include methods using carbodiimides EDC and NHS to cross-link the antigen or antigenic determinant to the VLP. In a further method, the antigen or antigenic determinant is attached to the VLP using a homobifunctional cross-linking agent such as glutaraldehyde, DSG, BM[PEO]4, BS3 (Pierce Chemical Company, Rockford, Illinois, USA), or other known homobifunctional cross-linking agents having functional groups reactive to the amino or carboxyl groups of the VLP.

[1041] Other methods for binding VLPs to antigens or antigenic determinants include biotinylation of the VLP and expression of the antigen or antigenic determinant as a streptavidin fusion protein, or biotinylation of both the antigen or antigenic determinant and the VLP, as described, for example, in WO 00 / 23955. In this case, the antigen or antigenic determinant can be first bound to streptavidin or avidin by adjusting the ratio of antigen or antigenic determinant to streptavidin, such that free binding sites remain available for binding VLPs added in the next step. Alternatively, all components can be mixed in a one-pot reaction. Other ligand-receptor pairs (when soluble forms of the receptor and ligand are available and capable of crosslinking with VLPs or antigens or antigenic determinants) can be used as binding agents for binding antigens or antigenic determinants to VLPs. Alternatively, the ligand or receptor can be fused to the antigen or antigenic determinant, and thus mediate binding to VLPs that are chemically bound to or fused to the receptor or ligand, respectively. Fusion can also be achieved by insertion or substitution.

[1042] Pharmaceutical compositions and formulations

[1043] In some embodiments, the present invention provides a pharmaceutical composition comprising an RLR agonist and a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative, and / or adjuvant.

[1044] In some embodiments, the acceptable formulation material is preferably non-toxic to the recipient at the dose and concentration used. In some embodiments, the formulation material is for subcutaneous and / or intravenous administration. In some embodiments, the pharmaceutical composition may contain formulation material for adjusting, maintaining, or preserving, for example, the composition's pH, osmolality, viscosity, clarity, color, isotropic properties, odor, sterility, stability, dissolution or release rate, absorption, or permeation. In some embodiments, suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine, or lysine); antimicrobial agents; antioxidants (such as ascorbic acid, sodium sulfite, or sodium bisulfite); buffers (such as borates, bicarbonates, Tris-HCl, citrates, phosphates, or other organic acids); build-up agents (such as mannitol or glycine); chelating agents (such as ethylenediaminetetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, β-cyclodextrin, or hydroxypropyl-β-cyclodextrin); fillers; monosaccharides; disaccharides; and other carbohydrates (such as glucose, mannose, or dextrin); proteins (such as serum albumin, gelatin, or immunoglobulins); colorants, flavoring agents, and diluents; emulsifiers; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight peptides; salt-forming counterions (such as sodium); and preservatives (such as benzyl ammonium chloride, benzyl...). Acids, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid, or hydrogen peroxide; solvents (such as glycerol, propylene glycol, or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronic, PEG, dehydrated sorbitan esters, polysorbate esters (such as polysorbate 20, polysorbate 80), triton, tromethamine, lecithin, cholesterol, tyloxapal); stability enhancers (such as sucrose or sorbitol); tension enhancers (such as alkali metal halides (preferably sodium chloride or potassium chloride), mannitol, sorbitol); delivery media; diluents; excipients and / or pharmaceutical adjuvants. (Remington's Pharmaceutical Sciences, 18th Edition, edited by ARGennaro, Mack Publishing Company (1995)). In some embodiments, the formulation comprises PBS; 20 mM NaOAC (pH 5.2), 50 mM NaCl; and / or 10 mM NaOAC (pH 5.2), 9% sucrose. In some embodiments, the optimal pharmaceutical composition will be determined by those skilled in the art based on, for example, the intended route of administration, delivery method, and required dosage.See, for example, Remington's Pharmaceutical Sciences, ibid. In some embodiments, such compositions may affect the physical state, stability, in vivo release rate, and / or in vivo clearance rate of the RLR agonist.

[1045] In some embodiments, the primary medium or carrier in the pharmaceutical composition may be aqueous or non-aqueous in nature. For example, in some embodiments, a suitable medium or carrier may be water for injection, physiological saline solution, or artificial cerebrospinal fluid, possibly supplemented with other materials common in compositions for parenteral administration. In some embodiments, the saline includes isotonic phosphate-buffered saline. In some embodiments, neutral buffered saline or saline mixed with serum albumin are other exemplary mediums. In some embodiments, the pharmaceutical composition comprises a Tris buffer with a pH of about 7.0-8.5 or an acetate buffer with a pH of about 4.0-5.5, which may also contain sorbitol or a suitable alternative thereof. In some embodiments, a composition containing an RLR agonist may be prepared for storage by mixing the selected composition having the desired purity with an optional formulation (Remington's Pharmaceutical Sciences, ibid.) in the form of a lyophilized cake or an aqueous solution. Furthermore, in some embodiments, the composition containing an RLR agonist may be formulated into a lyophilized product using a suitable excipient such as sucrose.

[1046] In some embodiments, the pharmaceutical composition may be selected for parenteral delivery. In some embodiments, the composition may be selected for inhalation or delivery via the digestive tract (such as oral administration). The preparation of such pharmaceutically acceptable compositions is within the capabilities of those skilled in the art.

[1047] In some embodiments, the formulation components are present at a concentration acceptable for the application site. In some embodiments, a buffer is used to maintain the composition at a physiological pH or slightly lower, typically in the pH range of about 5 to about 8.

[1048] In some embodiments, when considering parenteral administration, the therapeutic composition may be in the form of a pyrogen-free, parenterically acceptable aqueous solution containing an RLR agonist in a pharmaceutically acceptable medium. In some embodiments, the medium for parenteral injection is sterile distilled water in which the RLR agonist is formulated into a sterile isotonic solution and appropriately stored. In some embodiments, preparation may involve combining the desired molecule with a delivery medium or agent that provides controlled or sustained release of the product, thus enabling delivery of the product via a reservoir-type injection, such as injectable microspheres, bio-erosive particles, polymers (such as polylactic acid, polyglycolic acid, or polyethyleneimine (e.g., ...). It is formulated together with beads or liposomes. In some embodiments, hyaluronic acid may also be used, and it may have the effect of promoting the duration of circulation. In some embodiments, an implantable drug delivery device may be used to introduce the desired molecule.

[1049] In some embodiments, the pharmaceutical composition may be formulated for inhalation. In some embodiments, the RLR agonist may be formulated as a dry powder for inhalation. In some embodiments, an inhalation solution containing an RLR agonist may be formulated with a propellant for aerosol delivery. In some embodiments, the solution may be nebulized. Lung administration is further described in PCT application number PCT / US94 / 001875, which describes the pulmonary delivery of chemically modified proteins.

[1050] In some embodiments, the formulation is intended for oral administration. In some embodiments, the RLR agonist administered in this manner may be formulated with or without those carriers typically used in compounding solid dosage forms such as tablets and capsules. In some embodiments, the capsule may be designed to release the active portion of the formulation when it is in the gastrointestinal tract, where bioavailability is maximized and pre-systemic degradation is minimized. In some embodiments, at least one additional agent may be included to promote the absorption of the RLR agonist. In some embodiments, diluents, flavoring agents, low-melting-point waxes, vegetable oils, lubricants, suspending agents, tablet disintegrants, and binders may also be employed.

[1051] In some embodiments, the pharmaceutical composition may comprise an effective amount of an RLR agonist or RIG-VLP mixture with a non-toxic excipient suitable for manufacturing tablets. In some embodiments, a solution in unit dose form may be prepared by dissolving the tablet in sterile water or another suitable medium. In some embodiments, suitable excipients include, but are not limited to, inert diluents such as calcium carbonate, sodium carbonate, or sodium bicarbonate, lactose, or calcium phosphate; or binders such as starch, gelatin, or gum arabic; or lubricants such as magnesium stearate, stearic acid, or talc.

[1052] Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations involving RLR agonists or RIG-VLPs in the form of sustained or controlled delivery formulations. In some embodiments, techniques for formulating a variety of other sustained or controlled delivery methods, such as liposome carriers, bio-erectible microparticles or porous beads and reservoir-type injections, are also known to those skilled in the art. See, for example, PCT application PCT / US93 / 00829, which describes the controlled release of porous polymeric microparticles for the delivery of pharmaceutical compositions. In some embodiments, sustained-release formulations may comprise a semi-permeable polymer matrix in the form of a shaped article, such as a film or microcapsule. Sustained-release matrices may include polyesters, hydrogels, polylactide (US Patent Nos. 3,773,919 and EP 058,481), copolymers of L-glutamic acid and γ-ethyl-L-glutamic acid (Sidman et al., Biopolymers, 22:547-556 (1983)), poly(2-hydroxyethyl-methacrylate) (Langer et al., J. Biomed. Mater. Res., 15:167-277 (1981) and Langer, Chem. Tech., 12:98-105 (1982)), ethylene vinyl acetate (Langer et al., ibid.), or poly-D(-)-3-hydroxybutyric acid (EP 133,988). In some embodiments, the sustained-release composition may also comprise liposomes, which may be prepared by any of several methods known in the art. See, for example, Eppstein et al., Proc. Natl. Acad. Sci. USA, 82:3688-3692 (1985); EP 036,676; EP 088,046 and EP 143,949.

[1053] Pharmaceutical compositions intended for internal administration are typically sterile. In some embodiments, this can be accomplished by filtration through a sterile filter membrane. In some embodiments, when the composition is lyophilized, sterilization using this method can be performed before or after lyophilization and reconstitution. In some embodiments, compositions intended for parenteral administration can be stored in lyophilized or solution form. In some embodiments, parenteral compositions are typically placed in containers with sterile access ports, such as intravenous solution bags or vials with stoppers that can be punctured by a hypodermic needle.

[1054] In some embodiments, once the pharmaceutical composition has been formulated, it can be stored in sterile vials in the form of a solution, suspension, gel, emulsion, solid, or as a dehydrated or lyophilized powder. In some embodiments, such formulations can be stored in ready-to-use form or in a reconstituted form (e.g., lyophilized form) prior to application.

[1055] In some embodiments, a cartridge is provided for producing a single dose unit. In some embodiments, the cartridge may contain both a first container with dried protein and a second container with an aqueous formulation. In some embodiments, the cartridge includes a cartridge containing single-chamber and multi-chamber pre-filled syringes (e.g., liquid syringes and lyosyringes).

[1056] In some embodiments, the effective amount of the pharmaceutical composition comprising an RLR agonist or RIG-VLP to be used for treatment will depend, for example, on the treatment context and objectives. Therefore, those skilled in the art will understand that, according to certain embodiments, the appropriate dose level for treatment will depend in part on factors such as the delivered molecule, the indication for which the RLR agonist or RIG-VLP is used, the route of administration, and the patient's body size (weight, body surface area, or organ size) and / or condition (age and general health status). In some embodiments, clinicians may perform dose titration and modify the route of administration to obtain optimal therapeutic effect.

[1057] In some embodiments, the dosing frequency will take into account the pharmacokinetic parameters of the RLR agonist or RIG-VLP in the formulation used. In some embodiments, the clinician will administer the composition until a dose is reached to achieve the desired effect. In some embodiments, the composition may therefore be administered as a single dose, or as two or more doses over time (which may or may not contain the same amount of the desired molecule), or as a continuous infusion via an implantable device or catheter. Further refinement of the appropriate dose is performed routinely by those skilled in the art and is within the scope of their usual duties. In some embodiments, the appropriate dose can be determined by using appropriate dose-response data.

[1058] In some embodiments, the route of administration of the pharmaceutical composition is consistent with known methods, such as oral administration, intravenous, intraperitoneal, intracerebral (parenchymal), intraventricular, intramuscular, subcutaneous, intraocular, intraarterial, portal venous, or intralesional injection; via a sustained-release system or implantable device. In some embodiments, the composition may be administered by bolus injection, continuous infusion, or via an implantable device. In some embodiments, individual elements of the combination therapy may be administered via different routes.

[1059] In some embodiments, the composition can be administered topically via an implanted membrane, sponge, or other suitable material to which the desired molecule has been adsorbed or encapsulated. In some embodiments, when using an implantable device, the device can be implanted into any suitable tissue or organ, and delivery of the desired molecule can be achieved via diffusion, timed-release pellet delivery, or continuous administration. In some embodiments, ex vivo use of pharmaceutical compositions containing RLR agonists is desirable. In such cases, cells, tissues, and / or organs removed from the patient are exposed to a pharmaceutical composition containing an RLR agonist or RIG-VLP, and subsequently the cells, tissues, and / or organs are implanted back into the patient.

[1060] In some embodiments, RLR agonists or RIG-VLPs can be delivered via implantation into genetically engineered cells, such as those described herein, to express and secrete the agonist. In some embodiments, such cells can be animal or human cells and can be autologous, allogeneic, or xenogeneic. In some embodiments, the cells can be immortalized. In some embodiments, to reduce the chance of an immune response, the cells can be encapsulated to prevent infiltration by surrounding tissues. In some embodiments, the encapsulation material is typically a biocompatible, semi-permeable polymer shell or membrane that allows the release of protein products but prevents the patient's immune system or other harmful factors from surrounding tissues from damaging the cells.

[1061] In some aspects, this disclosure provides a pharmaceutical composition comprising an RLR agonist or RIG-VLP according to this disclosure for stimulating an immune response in a subject of need, treating their cancer or delaying its progression, or reducing or inhibiting its tumor growth, and a pharmaceutically acceptable carrier. In some embodiments, the RLR agonist is formulated in a polyethyleneimine (PEI) carrier. In some embodiments, the PEI carrier is...

[1062] application

[1063] The compositions described herein can be used for diagnostic and therapeutic applications. For example, detectable labeled RLR agonists or RIG-VLPs can be used to determine the presence or amount of a target protein in a sample (e.g., a biological sample). The compositions can be used in in vitro assays to study inhibition of target function (e.g., RLR-mediated cell signaling or responses). In some embodiments, such as where the composition binds to and activates a target (e.g., a protein or peptide), the composition can be used as a positive control in assays designed to identify additional novel compounds that also induce the activity of the target protein or peptide and / or are additionally useful for treating conditions associated with the target protein or peptide. For example, RLR-activating compositions can be used as positive controls in assays to identify additional compounds (e.g., small molecules, aptamers, or antibodies) that induce, increase, or stimulate RLR function. The compositions can also be used in therapeutic applications detailed below.

[1064] medicine box

[1065] The kit may include an RLR agonist or RIG-VLP as disclosed herein, along with instructions for use. The kit may include an RLR agonist, one or more controls, and a variety of buffers, reagents, enzymes, and other standard components well known in the art, in a suitable container.

[1066] The container may include at least one vial, orifice, test tube, flask, bottle, syringe, or other container component in which an RLR agonist or RIG-VLP can be placed and, in some cases, appropriately aliquoted. Where additional components are provided, the kit may contain additional containers for holding said components. The kit may also include components for containing the RLR agonist or RIG-VLP and any other tightly sealed reagent containers intended for commercial sale. Such containers may include injection-molded or blow-molded plastic containers in which the desired vials are held. Containers and / or kits may include markings with instructions for use and / or warnings.

[1067] In some aspects, this disclosure provides a kit comprising an RLR agonist or RIG-VLP provided herein, or comprising a pharmaceutical composition provided herein and instructions for use in stimulating an immune response in a subject, or treating a subject’s cancer or delaying the progression of his / her cancer, or inhibiting the growth of his / her tumor, optionally with instructions for use in combination with one or more other therapeutic agents.

[1068] In some embodiments, the agonist or pharmaceutical composition is administered in combination with one or more additional therapeutic agents selected from the group consisting of: chemotherapy, targeted anticancer therapy, oncolytic drugs, cell death inducers, opsonizers (e.g., opsonizing antibodies), cytotoxic agents, immune-based therapies, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, vaccines, cellular immunotherapy, or combinations thereof.

[1069] In some embodiments, the RLR agonist or pharmaceutical composition is administered before or after the administration of one or more other therapeutic agents, or one or more other therapeutic agents are administered simultaneously with, before or after the administration of the RLR agonist or pharmaceutical composition.

[1070] In some implementations, one or more additional therapeutic agents are PD-1 / PD-L1 antagonists, TIM-3 antagonists, VISTA antagonists, adenosine A2AR antagonists, B7-H3 antagonists, B7-H4 antagonists, BTLA antagonists, CTLA-4 antagonists, IDO antagonists, KIR antagonists, LAG-3 antagonists, toll-like receptor 3 (TLR3) agonists, toll-like receptor 7 (TLR7) agonists, and toll-like receptor 9 (TLR9) agonists.

[1071] In some embodiments, one or more additional therapeutic agents are agonists comprising a polypeptide (e.g., an antibody or its antigen-binding moiety) that specifically binds to CD137 (4-1BB).

[1072] In some embodiments, one or more additional therapeutic agents are agonists comprising a polypeptide (e.g., an antibody or its antigen-binding portion) that specifically binds to CD134 (OX40).

[1073] How to use

[1074] The compositions of the present invention have a variety of in vitro and in vivo effects, including detection and / or quantification of RLR and / or activation of RLR function.

[1075] The above-described compositions are particularly useful for methods of treating or preventing various cancers or infectious diseases in subjects. The compositions can be administered to subjects, such as human subjects, using various methods, depending in part on the route of administration. These routes can be, for example, intravenous injection or infusion (IV), subcutaneous injection (SC), intradermal injection (ID), intraperitoneal injection (IP), intramuscular injection (IM), intratumoral injection (IT), or intrathecal injection. Injection can be bolus-type or continuous infusion.

[1076] Administration can be achieved, for example, by local infusion, injection, or through an implant. The implant can be a porous, non-porous, or gel-like material, including membranes such as sialastic membranes, or fibers. The implant can be configured to continuously or periodically release the composition to a subject. See, for example, U.S. Patent Application Publication No. 20080241223; U.S. Patents 5,501,856; 4,863,457; and 3,710,795; EP488401; and EP 430539, the disclosures of which are incorporated herein by reference in their entirety. The composition can be delivered to a subject via implantable devices based on, for example, diffusion, erosion, or convection systems, such as osmotic pumps, biodegradable implants, electrodiffusion systems, electroosmotic systems, vapor pressure pumps, electrolytic pumps, effervescent pumps, piezoelectric pumps, erosion-based systems, or electromechanical systems.

[1077] In some embodiments, the RLR agonist is therapeutically delivered to the subject via topical application. In some embodiments, the RLR agonist is packaged in a VLP. In one embodiment, the RLR agonist is therapeutically delivered together with an antigen. In other embodiments, the VLP may be conjugated to an antigen. In other embodiments, the RLR agonist is packaged in a VLP and administered in combination with a separate VLP conjugated to an antigen.

[1078] The appropriate dose of the RLR agonist or RIG-VLP described herein (a dose that can treat or prevent cancer in the subject) may depend on a variety of factors, including, for example, the age, sex, and weight of the subject to be treated, and the specific inhibitory compound used. Other factors influencing the dose administered to a subject include, for example, the type or severity of the cancer or infectious disease. For example, a subject with metastatic melanoma may require a different dose of RLR agonist or RIG-VLP than a subject with glioblastoma. Other factors may include, for example, other medical conditions affecting the subject concurrently or previously, the subject's general health condition, the subject's genetic predisposition, diet, timing of administration, excretion rate, drug combination, and any other additional therapeutic agents administered to the subject. It should also be understood that the specific dose and treatment regimen for any particular subject will also depend on the judgment of the treating physician (e.g., a doctor or nurse). Appropriate doses are described herein.

[1079] Pharmaceutical compositions may comprise a therapeutically effective amount of the RLR agonist or its RIG-VLP described herein. Such effective amounts can be readily determined by those skilled in the art, in part based on the effect of the administered RLR agonist or RIG-VLP, or the combined effect of the RLR agonist or RIG-VLP with one or more additional active agents (if more than one agent is used). The therapeutically effective amount of the RLR agonist or RIG-VLP described herein may also vary depending on factors such as an individual's disease state, age, sex, and weight, and the ability of the agonist (and one or more additional active agents) to elicit the desired response in the individual (e.g., a reduction in tumor growth). For example, a therapeutically effective amount of the RLR agonist or RIG-VLP may inhibit (reduce its severity or eliminate its occurrence) and / or prevent a particular condition, and / or any of the symptoms of a particular condition known in the art or described herein. A therapeutically effective amount is also the amount in which any toxic or harmful effects of the composition outweigh the beneficial therapeutic effects.

[1080] Appropriate human doses of any RLR agonist or RIG-VLP described herein may be further evaluated, for example, in a phase I dose-escalation study. See, for example, van Gurp et al. (2008) Am J Transplantation 8(8):1711-1718; Hanouska et al. (2007) Clin Cancer Res 13(2, Part 1):523-531; and Hetherington et al. (2006) Antimicrobial Agents and Chemotherapy 50(10):3499-3500.

[1081] In some embodiments, the composition contains any of the RLR agonists or RIG-VLPs described herein and one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, or eleven or more) additional therapeutic agents, such that the composition as a whole is therapeutically effective. For example, the composition may contain an RLR agonist or RIG-VLP described herein and an alkylating agent, wherein the agonist and the agent are each at a concentration that is therapeutically effective for treating or preventing cancer (e.g., melanoma) in the subject when combined.

[1082] The toxicity and therapeutic efficacy of such compositions can be determined by known pharmaceutical procedures in cell cultures or laboratory animals (e.g., animal models of any of the cancers described herein). These procedures can be used, for example, to determine the LD50. 50 (Dose lethal to 50% of the population) and ED 50 (The dose that is effective in 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index and can be expressed as the ratio LD50. 50 / ED50 RLR agonists or RIG-VLPs exhibiting high therapeutic index are preferred. Although compositions exhibiting toxic side effects can be used, delivery systems that target such compounds to the affected tissue sites should be carefully designed to minimize potential damage to normal cells and thereby reduce side effects.

[1083] Data obtained from cell culture assays and animal studies can be used to formulate dose ranges for human use. For the RLR agonists or RIG-VLPs described herein, the therapeutically effective dose can be initially estimated from cell culture assays. Doses can be formulated in animal models to achieve EC50 levels as determined in cell cultures. 50 The range of circulating plasma concentrations (i.e., the concentration of the agonist that achieves half-maximal inhibition of symptoms). This information can be used to more accurately determine the effective dose in the human body. Plasma levels can be measured, for example, by high-performance liquid chromatography. In some embodiments, such as those requiring local application (e.g., to the eyes or joints), cell cultures or animal models can be used to determine the dose required to achieve therapeutically effective concentrations at the local site.

[1084] In some implementations, the method may be performed in combination with other therapies for cancer or infectious diseases. For example, the composition may be administered to a subject concurrently with, before, or after radiation, surgery, targeted or cytotoxic chemotherapy, chemoradiotherapy, hormone therapy, immunotherapy, gene therapy, cell transplantation therapy, precision medicine, genome editing therapy, or other drug therapies.

[1085] As described above, the compositions described herein (e.g., RLR agonists or RIG-VLP compositions) can be used to treat a variety of cancers, such as, but not limited to: Kaposi's sarcoma, leukemia, acute lymphoblastic leukemia, acute myeloid leukemia, myeloblastic promyelocytic granulocytic erythrocytic leukemia, chronic leukemia, chronic myeloid (granulocytic) leukemia, chronic lymphocytic leukemia, mantle cell lymphoma, primary central nervous system lymphoma, Burkitt's lymphoma, marginal zone B-cell lymphoma, polycythemia vera, and Hodgkin's disease. Diseases including: non-Hodgkin's disease, multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, solid tumors, sarcomas and carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelial sarcoma, lymphangiosarcoma, lymphangioendothelial sarcoma, synovium, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon sarcoma, colorectal cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystic adenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, hepatocellular carcinoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor. Tumors, cervical cancer, uterine cancer, testicular tumors, lung cancer, small cell lung cancer, non-small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal tumor, hemangioblastoma, acoustic neuroma, oligodendroglioma, cerebral hemangioma, melanoma, neuroblastoma, retinoblastoma, nasopharyngeal carcinoma, esophageal cancer, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, cervical cancer, choriocarcinoma, colorectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, gastric cancer. Cancers including: intraepithelial neoplasia, kidney cancer, laryngeal cancer, liver cancer, lung cancer (small cell lung cancer, large cell lung cancer), melanoma, neuroblastoma; oral cancer (e.g., lip cancer, tongue cancer, oral cavity cancer, and pharyngeal cancer), ovarian cancer, pancreatic cancer, rectal cancer; respiratory cancers, sarcomas, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, and urinary system cancers.

[1086] In some embodiments, this disclosure provides a vaccine comprising an RLR agonist packaged into a VLP and an antigen or antigenic determinant that binds to the VLP. In some embodiments, the vaccine induces an immune response against the antigen or antigenic determinant that binds to the VLP. In some embodiments, the vaccine is prophylactic. In some embodiments, the vaccine is therapeutic. In some embodiments, the antigen or antigenic determinant that binds to the VLP is a cancer or tumor antigen, and therefore the vaccine induces an anti-tumor immune response. In some embodiments, the vaccine induces protective immunity.

[1087] In some aspects, this disclosure provides a method for increasing the production of one or more RLR-mediated cytokines in cells, the method comprising contacting cells with an RLR agonist or RIG-VLP provided in this disclosure, wherein the agonist increases the production of RLR-mediated cytokines in cells.

[1088] In some aspects, this disclosure provides a method for increasing the expression of one or more interferon-stimulated genes mediated by RLR in cells, the method comprising contacting cells with an RLR agonist or RIG-VLP provided in this disclosure, wherein the agonist increases the expression of one or more interferon-stimulated genes mediated by RLR in cells.

[1089] In some aspects, this disclosure provides a method for increasing RLR-dependent intracellular signaling in cells, the method comprising contacting cells with an RLR agonist or RIG-VLP provided in this disclosure, wherein the agonist increases RLR-dependent intracellular signaling.

[1090] In some aspects, this disclosure provides a method for stimulating an immune response in a subject, the method comprising administering to the subject an effective amount of an RLR agonist or RIG-VLP provided in this disclosure, or a pharmaceutical composition provided in this disclosure.

[1091] In some aspects, this disclosure provides a method for treating a subject with cancer or delaying the progression of the cancer, the method comprising administering to the subject an effective amount of an RLR agonist or RIG-VLP provided in this disclosure, or a pharmaceutical composition provided in this disclosure.

[1092] In some aspects, this disclosure provides a method for reducing or inhibiting tumor growth in a subject in need, the method comprising administering to the subject an effective amount of an RLR agonist or RIG-VLP provided in this disclosure, or a pharmaceutical composition provided in this disclosure.

[1093] In some aspects, this disclosure provides a method for stimulating an immune response in a subject of need, treating their cancer, delaying the progression of their cancer, or inhibiting tumor growth, said method comprising administering to the subject an effective amount of an RLR agonist or RIG-VLP provided in this disclosure, or a pharmaceutical composition provided in this disclosure, wherein the agonist or pharmaceutical composition increases the production of one or more RLR-mediated cytokines in cells, increases the expression of one or more interferon-stimulated genes mediated by RLR in cells, and / or increases RLR-dependent intracellular signaling in cells, thereby stimulating an immune response, treating cancer, delaying the progression of cancer, or inhibiting tumor growth.

[1094] Combination of RLR agonists with other therapeutic agents

[1095] In some implementations, the RLR agonist or RIG-VLP described herein may be administered to a subject as a monotherapy. Alternatively, the RLR agonist or RIG-VLP may be administered to a subject as a combination therapy with another treatment (e.g., another treatment for cancer). For example, the combination therapy may include administering one or more additional agents to a subject (e.g., a human patient) that provide therapeutic benefit to a subject who has cancer or is at risk of developing cancer.

[1096] In some embodiments of the methods provided in this disclosure, an RLR agonist or RIG-VLP or pharmaceutical composition is administered in combination with one or more additional therapeutic agents selected from the group consisting of: chemotherapy, targeted anticancer therapy, oncolytic drugs, cell death inducers, opsonizers (e.g., opsonizing antibodies), cytotoxic agents, immune-based therapies, cytokines, activators or agonists of co-stimulatory molecules, inhibitors of inhibitory molecules, vaccines, cellular immunotherapy, or combinations thereof.

[1097] In some embodiments, the combination may be administered, for example, as an admixture, simultaneously, or concurrently; or sequentially. This includes demonstrations of the combination being administered together with a treatment mixture, as well as procedures for the combination being administered, for example, via a separate intravenous line to the same individual, simultaneously. "Combination" administration also includes the separate administration of one of the initially given compounds or agents, followed by the administration of a second.

[1098] In some embodiments, the RLR agonist, RIG-VLP, or pharmaceutical composition is administered before or after the administration of one or more other therapeutic agents, or one or more other therapeutic agents are administered simultaneously with, before, or after the administration of the agonist or pharmaceutical composition.

[1099] In some implementations, one or more additional therapeutic agents are PD-1 / PD-L1 antagonists, TIM-3 antagonists, VISTA antagonists, adenosine A2AR antagonists, B7-H3 antagonists, B7-H4 antagonists, BTLA antagonists, CTLA-4 antagonists, IDO antagonists, KIR antagonists, LAG-3 antagonists, toll-like receptor 3 (TLR3) agonists, toll-like receptor 7 (TLR7) agonists, and toll-like receptor 9 (TLR9) agonists.

[1100] Combined with chemotherapy

[1101] Chemotherapy agents suitable for combination with and / or co-administration with the compositions of the present invention include, for example: paclitaxel, cytochalasin B, bacitracin D, ethidium bromide, imidin, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthraquinone, mitoxantrone, photomycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and their analogues or homologues. Other agents include, for example, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., dichloromethyldiethylamine, thiotepa, chlorambucil, melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, cis-dichlorodiamineplatin(II) (DDP), procarbazine, hexamethylmelamine, cisplatin, carboplatin, oxaliplatin, nedaplatin, saplatin, or triplatinum tetranitrate), anthracycline antibiotics (e.g., daunorubicin and doxorubicin), antibiotics (e.g., dermatomycin, bleomycin, styracin, and atrazomycin (AMC)), and antimitotic agents (e.g., vincristine and vinblastine), as well as temozolomide.

[1102] Combination with PD-1 / PD-L1 antagonists

[1103] In some embodiments, the RLR agonist, RIG-VLP, or pharmaceutical composition thereof provided in this disclosure are combined with one or more PD-1 / PD-L1 antagonists (e.g., combined administration), said antagonist specifically binds to human PD-1 or PD-L1 and inhibits PD-1 / PD-L1 biological activity and / or downstream pathways and / or cellular processes mediated by human PD-1 / PD-L1 signaling or other PD-1 / PD-L1-mediated functions.

[1104] Therefore, this article provides PD-1 / PD-L1 antagonists that directly or allosterically block, antagonize, inhibit, suppress, or reduce the biological activity of PD-1 / PD-L1, including downstream pathways and / or cellular processes mediated by PD-1 / PD-L1 signaling, such as receptor binding and / or eliciting cellular responses to PD-1 / PD-L1. This article also provides PD-1 / PD-L1 antagonists that reduce the number or amount of human PD-1 or PD-L1 produced by cells or subjects.

[1105] In some embodiments, this disclosure provides a PD-1 / PD-L1 antagonist that binds to human PD-1 and prevents, inhibits, or reduces the binding of PD-L1 to PD-1. In some aspects, the PD-1 / PD-L1 antagonist binds to the mRNA encoding PD-1 or PD-L1 and prevents translation. In some embodiments, the PD-1 / PD-L1 antagonist binds to the mRNA encoding PD-1 or PD-L1 and induces degradation and / or turnover.

[1106] In some embodiments, PD-1 / PD-L1 antagonists inhibit PD-1 signaling or function. In some embodiments, PD-1 / PD-L1 antagonists block the binding of PD-1 to PD-L1, PD-L2, or both PD-L1 and PD-L2. In some embodiments, PD-1 / PD-L1 antagonists block the binding of PD-1 to PD-L1. In some embodiments, PD-1 / PD-L1 antagonists block the binding of PD-1 to PD-L2. In some embodiments, PD-1 / PD-L1 antagonists block the binding of PD-1 to both PD-L1 and PD-L2. In some embodiments, PD-1 / PD-L1 antagonists specifically bind to PD-1. In some embodiments, PD-1 / PD-L1 antagonists specifically bind to PD-L1. In some embodiments, PD-1 / PD-L1 antagonists specifically bind to PD-L2.

[1107] In some embodiments, PD-1 / PD-L1 antagonists inhibit the binding of PD-1 to its homologous ligand. In some embodiments, PD-1 / PD-L1 antagonists inhibit the binding of PD-1 to PD-L1, PD-1 to PD-L2, or PD-1 to both PD-L1 and PD-L2. In some embodiments, PD-1 / PD-L1 antagonists do not inhibit the binding of PD-1 to its homologous ligand.

[1108] In some embodiments, the PD-1 / PD-L1 antagonist is a monoclonal antibody (mAb) or antigen-binding fragment thereof that specifically binds to PD-1 or PD-L1. In some embodiments, the PD-1 / PD-L1 antagonist is an antibody or antigen-binding fragment thereof that specifically binds to human PD-1. In some embodiments, the PD-1 / PD-L1 antagonist is an antibody or antigen-binding fragment thereof that specifically binds to human PD-L1. In some embodiments, the PD-1 / PD-L1 antagonist is an antibody or antigen-binding fragment that binds to human PD-L1 and inhibits the binding of PD-L1 to PD-1. In some embodiments, the PD-1 / PD-L1 antagonist is an antibody or antigen-binding fragment that binds to human PD-1 and inhibits the binding of PD-L1 to PD-1.

[1109] Several immune checkpoint antagonists that inhibit or disrupt the interaction between PD-1 and one or both of its ligands PD-L1 and PD-L2 are in clinical development or are currently available to clinicians for the treatment of cancer.

[1110] Examples of anti-human PD-1 monoclonal antibodies or antigen-binding fragments thereof that may comprise PD-1 / PD-L1 antagonists in any compositions, methods, and uses provided in this disclosure include, but are not limited to: (pembrolizumab, MK-3475, h409A11; see US8952136, US8354509, US8900587 and EP2170959, all of which are incorporated herein by reference in their entirety; Merck) (Nivolumab, BMS-936558, MDX-1106, ONO-4538; see US7595048, US8728474, US9073994, US9067999, EP1537878, US8008449, US8779105 and EP2161336, all of which are incorporated herein by reference in their entirety; Bristol Myers Squibb), MEDI0680 (AMP-514), BGB-A317 and BGB-108 (BeiGene), 244C8 and 388D4 (see WO2016106159, which is incorporated herein by reference in its entirety; Enumeral Biomedical), PDR001 (Novartis) and REGN2810 (Regeneron). Therefore, in some implementations, the PD-1 / PD-L1 antagonist is pembrolizumab. In some implementations, the PD-1 / PD-L1 antagonist is nivolumab.

[1111] Examples of anti-human PD-L1 monoclonal antibodies or antigen-binding fragments thereof that may comprise PD-1 / PD-L1 antagonists in any composition, method, and use provided in this disclosure include, but are not limited to: (Avelumab, MSB0010718C, see WO2013 / 79174, the patent described herein is incorporated herein by reference in its entirety; Merck / Pfizer) (durvalumab, MEDI4736) (atezolizumab, MPDL3280A, RG7446; see WO2010 / 077634, which is incorporated herein by reference in its entirety; Roche), MDX-1105 (BMS-936559, 12A4; see US7943743 and WO2013 / 173223, both of which are incorporated herein by reference in their entirety; Medarex / BMS), and FAZ053 (Novartis). Therefore, in some embodiments, the PD-1 / PD-L1 antagonist is averulimab. In some embodiments, the PD-1 / PD-L1 antagonist is duvalimab. In some embodiments, the PD-1 / PD-L1 antagonist is atezolizumab.

[1112] In some embodiments, the PD-1 / PD-L1 antagonist is an immunoadhesive that specifically binds to human PD-1 or human PD-L1, for example, a fusion protein containing an extracellular or PD-1-binding portion of PD-L1 or PD-L2 fused to a constant region such as the Fc region of an immunoglobulin molecule. Examples of immunoadhesion molecules that specifically bind to PD-1 are described in WO2010 / 027827 and WO2011 / 066342, both of which are incorporated herein by reference in their entirety. In some embodiments, the PD-1 / PD-L1 antagonist is AMP-224 (also known as B7-DCIg), a PD-L2-FC fusion protein that specifically binds to human PD-1.

[1113] Those skilled in the art will understand that any PD-1 / PD-L1 antagonist that binds to PD-1 or PD-L1 and disrupts the PD-1 / PD-L1 signaling pathway is suitable for the compositions, methods and uses disclosed herein.

[1114] In some implementations, the PD-1 / PD-L1 antagonist is a small molecule, nucleic acid, peptide, peptide mimic, protein, carbohydrate, carbohydrate derivative, or glycopolymer. An exemplary small molecule PD-1 inhibitor is described in Zhan et al., (2016) Drug Discov Today 21(6):1027-1036.

[1115] In some embodiments of the methods provided in this disclosure, an RLR agonist is combined with a PD-1 / PD-L1 antagonist, wherein the PD-1 / PD-L1 antagonist is selected from the group consisting of: PDR001, (pembrolizumab) (Nivolumab), Pildizumab, MEDI0680, REGN2810, TSR-042, PF-06801591, and AMP-224. In some embodiments, the PD-1 / PD-L1 antagonist is selected from the group consisting of: FAZ053, (atelizumab) (Avelumab) (Durvarumab) and BMS-936559.

[1116] Combination with TIM-3 antagonists

[1117] In some embodiments, the RLR agonist, RIG-VLP, or pharmaceutical compositions thereof provided in this disclosure are combined with a TIM-3 antagonist (e.g., administered in combination). The TIM-3 antagonist may be an antibody, its antigen-binding fragment, an immunoadhesin, a fusion protein, or an oligopeptide. In some embodiments, the TIM-3 antagonist is selected from MGB453 (Novartis), TSR-022 (Tesaro), or LY3321367 (Eli Lilly).

[1118] Combination with LAG-3 antagonists

[1119] In some embodiments, the RLR agonist, RIG-VLP, or pharmaceutical composition thereof provided in this disclosure are combined with a LAG-3 antagonist (e.g., combined administration). The LAG-3 antagonist may be an antibody, its antigen-binding fragment, an immunoadhesin, a fusion protein, or an oligopeptide. In some embodiments, the LAG-3 inhibitor is selected from LAG525 (Novartis), BMS-986016 (Bristol-Myers Squibb), TSR-033 (Tesaro), MK-4280 (Merck & Co), or REGN3767 (Regeneron).

[1120] Combination with Toll-like receptor (TLR) agonists

[1121] In some embodiments, the RLR agonist, RIG-VLP, or pharmaceutical composition thereof provided in this disclosure are combined with a TLR agonist (e.g., combined administration).

[1122] Toll-like receptors (TLRs) are a family of germline-encoded transmembrane proteins that promote pathogen recognition and activation of the innate immune system (Hoffmann et al., (1999) Science 284:1313-1318; Rock et al., (1998) Proc Natl Acad Sci USA 95:588-593). TLRs are pattern recognition receptors (PRRs) and are expressed by cells of the innate immune system. Known examples of TLR ligands include Gram-positive bacteria (TLR-2), bacterial endotoxins (TLR-4), flagellin (TLR-5), bacterial DNA (TLR-9), double-stranded RNA and poly I:C (TLR-3), and yeast (TLR-2). In vivo activation of TLRs triggers an innate immune response involving specific cytokines, chemokines, and growth factors. While all TLRs activate certain intracellular signaling molecules, such as nuclear factor κβ (NF-κB) and mitogen-activated protein kinase (MAP kinase), the specific set of cytokines and chemokines released by each TLR appears to be unique. TLRs 7, 8, and 9 constitute a subfamily of TLRs that reside in the endosomes or lysosomal compartments of immune cells, such as dendritic cells and monocytes. TLR 8 is primarily expressed on myeloid dendritic cells (mDCs) and monocytes, compared to TLRs 7 and 9, which are highly expressed on plasmacytoid dendritic cells (pDCs). This subfamily mediates the recognition of microbial nucleic acids such as single-stranded RNA.

[1123] Small, low molecular weight (less than 400 Daltons) synthetic imidazoquinoline compounds, similar to the purine nucleotides adenosine and guanosine, were among the first TLR7 and TLR8 agonists identified. Many of these compounds have exhibited antiviral and anticancer properties. For example, the TLR7 agonist imiquimod (ALDARA) TM Imiquimod has been approved by the U.S. Food and Drug Administration as a topical agent for the treatment of skin lesions caused by certain strains of human papillomavirus. Imiquimod is also used to treat primary skin cancers and skin tumors such as basal cell carcinoma, keratoacanthoma, actinic keratosis, and Bowen's disease. The TLR7 / 8 agonist resimod (R-848) is being evaluated as a topical agent for the treatment of human genital herpes.

[1124] The TLR agonist according to this disclosure can be any TLR agonist. ...

Claims

1. A composition comprising: (a) a virus-like particle; and (b) at least one synthetic RLR agonist that specifically binds to an RLR, wherein the agonist comprises a blunt-end hairpin RNA comprising a first polynucleotide linked to a second polynucleotide by a linker, wherein the first polynucleotide is sufficiently complementary to the second polynucleotide to form a duplex, wherein the duplex comprises less than 19 base pairs, wherein the 5' most nucleotide of the first polynucleotide comprises a 5' diphosphate or triphosphate moiety or a derivative or analog thereof, wherein the derivative or analog is selected from: phosphonate, thiophosphonate, phosphorothioate, sulfate, sulfonate, sulfamate, thiazolidinone, carboxylate, malonate, boronic acid, benzoxyborolane, borophosphonate, square amide; wherein the agonist comprises [AUCG] n repeats of AUCG, where n = 3, and where the most 5' AUCG repeat motif is preceded by CG; wherein the first polynucleotide comprises SEQ ID NO: 50 and the second polynucleotide comprises SEQ ID NO: 81, wherein the linker comprises UUCG; wherein the synthetic RLR agonist comprises the nucleotide sequence of SEQ ID NO: 14; and wherein the synthetic RLR agonist is packaged in the virus-like particle.

2. A composition comprising: (a) a virus-like particle; and (b) at least one synthetic RLR agonist that specifically binds to an RLR, wherein the agonist comprises a blunt-end hairpin RNA comprising a first polynucleotide linked to a second polynucleotide by a linker, wherein the first polynucleotide is sufficiently complementary to the second polynucleotide to form a duplex, wherein the duplex comprises less than 19 base pairs, wherein the 5' most nucleotide of the first polynucleotide comprises a 5' diphosphate or triphosphate moiety or a derivative or analog thereof, wherein the derivative or analog is selected from: phosphonate, thiophosphonate, phosphorothioate, sulfate, sulfonate, sulfamate, thiazolidinone, carboxylate, malonate, boronic acid, benzoxyborolane, borophosphonate, square amide; wherein the agonist comprises [AUCG] n repeating motif, wherein n = 3, and wherein the front of the 5' most AUCG repeat motif is IG; wherein the first polynucleotide comprises SEQ ID NO: 61 and the second polynucleotide comprises SEQ ID NO: 91, wherein the linker comprises UUCG; wherein the synthetic RLR agonist comprises the nucleotide sequence of SEQ ID NO: 25; and wherein the synthetic RLR agonist is packaged in the virus-like particle.

3. A composition comprising: (a) a virus-like particle; and (b) at least one synthetic RLR agonist that specifically binds to an RLR, wherein the agonist comprises a blunt-end hairpin RNA comprising a first polynucleotide linked to a second polynucleotide by a linker, wherein the first polynucleotide is sufficiently complementary to the second polynucleotide to form a duplex, wherein the duplex comprises less than 19 base pairs, wherein the most 5' terminal nucleotide of the first polynucleotide comprises a 5' diphosphate or triphosphate moiety or a derivative or analog thereof, wherein the derivative or analog is selected from the group consisting of: phosphonate, thiophosphonate, phosphorothioate, sulfate, sulfonate, sulfamate, thiazolidinone, carboxylate, malonate, boronic acid, benzoxyborolane, borophosphonate, squaramide; wherein the agonist comprises [AUCG] n repeating motif, wherein n = 3, and wherein the most 5' terminal AUCG repeat motif is preceded by GG, and each G in the AUCG motif is replaced by inosine; wherein the first polynucleotide comprises SEQ ID NO: 59 and the second polynucleotide comprises SEQ ID NO: 89, wherein the linker comprises UUCG; wherein the synthetic RLR agonist comprises the nucleotide sequence of SEQ ID NO: 23; and wherein the synthetic RLR agonist is packaged in the virus-like particle.

4. The composition of any one of claims 1-3, wherein the virus-like particle is a recombinant virus-like particle, wherein the recombinant virus-like particle comprises a protein selected from the group consisting of: (a) a recombinant protein of a hepatitis B virus; (b) a recombinant protein of a measles virus; (c) a recombinant protein of a Sindbis virus; (d) a recombinant protein of a rotavirus; (e) a recombinant protein of a foot-and-mouth disease virus; (f) a recombinant protein of a retrovirus; (g) a recombinant protein of a norovirus; (h) a recombinant protein of a human papillomavirus; (i) a recombinant protein of a BK virus; and (j) a recombinant protein of a bacteriophage.

5. The composition of claim 4, wherein the recombinant virus-like particle comprises a protein selected from the group consisting of: (k) a recombinant protein of an RNA bacteriophage.

6. The composition of claim 4, wherein the recombinant virus-like particle comprises a protein selected from the group consisting of: (l) a recombinant protein of a Qβ bacteriophage; (m) a recombinant protein of a GA bacteriophage; (n) a recombinant protein of a fr bacteriophage; (o) a recombinant protein of an AP 205 bacteriophage; and (p) a recombinant protein of a retrotransposon Ty protein pi.

7. The composition of claim 5, wherein the virus-like particle comprises a recombinant protein of an RNA bacteriophage, wherein the RNA bacteriophage is selected from the group consisting of: (a) bacteriophage Qβ; (b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e) bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage Ml l; (h) bacteriophage MXl; (i) bacteriophage NL95; (j) bacteriophage f2; (k) bacteriophage PP7; and (1) bacteriophage AP205.

8. The composition of claim 7, wherein the virus-like particle comprises a recombinant protein of the RNA bacteriophage Qβ.

9. The composition of claim 8, wherein the virus-like particle comprises a coat protein of the RNA bacteriophage Qβ.

10. The composition of claim 1, wherein the synthetic RLR agonist is non-covalently bound to the virus-like particle.

11. The composition of any one of claims 1-10, further comprising at least one antigen or antigenic determinant bound to the virus-like particle.

12. A pharmaceutical composition comprising the composition of any one of claims 1-11 and a pharmaceutically acceptable carrier.

13. A kit comprising the composition of any one of claims 1-11 or the pharmaceutical composition of claim 12.

14. Use of the composition of any one of claims 1-11 or the pharmaceutical composition of claim 12 in the manufacture of a medicament for treating cancer in a subject in need thereof.

15. The use of claim 14, wherein the medicament is used in combination with one or more additional therapeutic agents, wherein the one or more additional therapeutic agents is a PD-1 or PD-L1 antagonist, a TIM-3 antagonist, a VISTA antagonist, an adenosine A2AR antagonist, a B7-H3 antagonist, a B7-H4 antagonist, a BTLA antagonist, a CTLA-4 antagonist, an IDO antagonist, a KIR antagonist, a LAG-3 antagonist, a Toll-like receptor 3 agonist, a Toll-like receptor 7 agonist, a Toll-like receptor 9 agonist, or an agonist comprising a polypeptide that specifically binds to CD137 or CD134.

16. The use of claim 15, wherein the one or more additional therapeutic agents is administered simultaneously with, prior to, or subsequent to administration of the composition or pharmaceutical composition.

17. A method of producing the composition of any one of claims 1-11, comprising: (a) disassembling a virus-like particle; (b) adding the synthetic RLR agonist; and (c) reassembling the virus-like particle.

18. The method of claim 17, further comprising removing nucleic acid of the disassembled virus-like particle.

19. The method of claim 18, further comprising purifying the composition after reassembling.

20. The method of any one of claims 17-19, comprising (d) binding an antigen or antigenic determinant to the virus-like particle. ​

Citation Information

Patent Citations

  • Method of making uniformly sized liposomes and liposomes so made

    EP0036676A1

  • Continuous release pharmaceutical compositions

    EP0058481A1

  • Lipids in the aqueous phase

    EP0088046A2

  • Regulating peptide-containing pharmaceutical preparations with retarded release, and process for their preparation

    EP0133988A2

  • Pharmaceutical composition containing urokinase

    EP0143949A1