A method for improving the acid tolerance of E. coli by integrating the extreme acidophilic chaperone CbpA
By integrating the encoding gene of the chaperone protein CbpA of the acidophilus thiophilus molecule into the E. coli genome, the growth and production efficiency of E. coli under acid stress was solved, and its acid tolerance and growth ability were significantly improved.
Patent Information
- Application Number
- CN202211613199.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-15
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2042-12-15
AI Technical Summary
During industrial biological treatment, microorganisms face acid stress pressure, resulting in a decrease in cell growth and production efficiency. The existing technology is difficult to effectively improve the acid tolerance of E. coli.
By integrating the encoding gene of the chaperone protein CbpA of the acidophilus thiophilus molecule into the E. coli genome, it improves its acid stress resistance.
It significantly improves the acid tolerance of E. coli, enhances its growth ability and survival rate in an acidic environment, reduces the consumption of ATP in cells, and improves cell morphology and function.
Smart Images

Figure CN115786225B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for improving the acid tolerance of E. coli by integrating the molecular chaperone CbpA of extreme acidophilic bacteria, belonging to the fields of biochemistry and molecular biology. Background Art
[0002] Microorganisms used in industrial biological treatment applications often encounter multiple stresses (e.g., heat, acid, oxidative stress, osmotic stress, and toxic substances), negatively impacting cell growth and productivity. Therefore, stress resistance is crucial for ensuring robust cell production. Acid stress is one of the most concerning, particularly in the production of organic acids and amino acids. The accumulation of acidic fermentation products or byproducts causes a decrease in the pH of the fermentation broth, leading to a lower intracellular pH, resulting in denaturation of essential enzymes and DNA damage, thus inhibiting microbial growth and production. While adding exogenous alkaline substances can neutralize the fermentation broth and prevent acid diffusion into the cells, it introduces other problems, such as increased downstream process costs and the generation of large amounts of wastewater. Therefore, the use of acid-tolerant strains is considered a more efficient and cost-effective industrial fermentation solution.
[0003] Acidophilic thiobacillus (A. caldus) plays a crucial role in bioleaching processes and is renowned for its resistance to acids and heavy metals. Its ability to grow normally under extremely acidic conditions (pH 0.5–1) is rare among most other organisms. As a perfect extremophile, the acid tolerance of bacteria to such extreme environments is attracting increasing attention.
[0004] As a representative chassis microorganism, *Escherichia coli* has advantages such as a short growth cycle, stable genetic performance, simple operation methods, and well-developed expression systems, making it a common industrial microorganism used in production. Industrial fermentation processes often produce acidic byproducts, such as acetic acid and succinic acid, which can cause acid stress in the culture environment. Therefore, improving the adaptability and tolerance of *E. coli* to such environments is of great significance for industrial production. Summary of the Invention
[0005] This invention provides a molecular chaperone protein CbpA from *Acidithiobacillus caldus* and its encoding gene; the molecular chaperone protein CbpA can enhance the acid stress resistance of *Escherichia coli*.
[0006] In one embodiment of the present invention, the amino acid sequence of the molecular chaperone protein CbpA is shown in SEQ ID NO.2.
[0007] In one embodiment of the present invention, the nucleotide sequence encoding the molecular chaperone protein CbpA is shown in SEQ ID NO. 1.
[0008] This invention provides an engineered Escherichia coli strain with enhanced acid stress resistance, wherein the engineered Escherichia coli strain integrates and expresses the molecular chaperone protein CbpA derived from Thiobacillus acidophilus into the Escherichia coli genome.
[0009] In one embodiment of the present invention, the amino acid sequence of the molecular chaperone protein CbpA is shown in SEQ ID NO.2.
[0010] In one embodiment of the present invention, the nucleotide sequence encoding the molecular chaperone protein CbpA is shown in SEQ ID NO. 1.
[0011] In one embodiment of the present invention, the engineered Escherichia coli is a molecular chaperone protein CbpA derived from Thiobacillus acidophilus, which replaces the molecular chaperone protein CbpA on the Escherichia coli genome.
[0012] This invention also provides a method for constructing the above-mentioned engineered Escherichia coli, the method comprising: using cbpA containing the nucleotide sequence shown in SEQ ID NO.1 Ec An integrative vector containing the N20 sequence of the gene guide sequence integrates the molecular chaperone protein CbpA from Thiobacillus acidophilus into the CbpA site on the Escherichia coli genome.
[0013] In one embodiment of the present invention, the N20 sequence is: CGTCGGTTTCACGCCCATGA.
[0014] The present invention also provides a method for improving the acid stress resistance of Escherichia coli, wherein the method involves integrating and expressing the molecular chaperone protein CbpA derived from Thiobacillus acidophilus into the genome of Escherichia coli.
[0015] In one embodiment of the present invention, the amino acid sequence of the molecular chaperone protein CbpA is shown in SEQ ID NO.2.
[0016] In one embodiment of the present invention, the nucleotide sequence encoding the molecular chaperone protein CbpA is shown in SEQ ID NO. 1.
[0017] In one embodiment of the present invention, the method involves replacing the molecular chaperone protein CbpA on the genome of *Escherichia coli* with a molecular chaperone protein CbpA derived from *Thiobacillus acidophilus*.
[0018] In one embodiment of the present invention, the acid stress resistance includes the ability to withstand 35 mM acetic acid.
[0019] Beneficial effects
[0020] This invention verifies the role of the molecular chaperone protein CbpA in enhancing bacterial acid tolerance by integrating the coding gene into the Escherichia coli genome.
[0021] (1) The final OD of the auxotrophic strain BL21-ΔcbpA under acidic conditions (pH 5.0) 600 The final biomass of the recombinant strain BL21-ΔcbpA / AccbpA was 4.53% higher than that of the defective strain, and was 8.68% lower than that of the wild-type BL21. The growth of BL21-ΔcbpA / AccbpA under acidic conditions indicated that cbpA... Ac The importance of bacterial acid tolerance was highlighted, as its survival rate under 35 mM acetic acid stress was 7.67 times higher than that of BL21-ΔcbpA and 2.25 times higher than that of the wild type.
[0022] (2) Cell morphology was observed using field emission scanning electron microscopy (FESEM). The results showed that the cell membrane of BL21-ΔcbpA cells was damaged, but cbpA cells were integrated. Ac The cell membrane of the BL21-ΔcbpA / AccbpA gene returned to normal. With prolonged stress, intracellular ATP levels gradually decreased in all strains. Particularly after 5 hours of stress, the recombinant strain showed a 55.99% decrease compared to the defective strain, indicating that the recombinant strain consumed a significant amount of energy to resist acid stress.
[0023] (3) The free amino acids associated with acid tolerance in the recombinant strain were significantly increased, with arginine concentration twice that of the auxotrophic strain, and aspartic acid and glutamic acid contents 14.79% and 6.23% higher than those of the wild type, respectively. This invention can provide acid-tolerant microorganisms for industrial fermentation processes to improve industrial fermentation efficiency.
[0024] (4) The molecular chaperone protein CbpA of the acidophilic thermophilic thiobacillus and its encoding gene play an important role in bacterial acid tolerance. Attached Figure Description
[0025] Figure 1 This is a flowchart illustrating the construction process of the defective and recombinant strains in Example 1.
[0026] Figure 2 The image shows the colony PCR electrophoresis diagram of the defective strain in Example 1; where M: DNA Marker 5000; +: positive transformant; -: false positive transformant.
[0027] Figure 3The image shows the colony PCR electrophoresis diagram of the recombinant strain from Example 1; where M: DNA Marker 5000; +: positive transformant; -: false positive transformant.
[0028] Figure 4 The growth curves of the recombinant genomic strain of Example 2 under different pH conditions are shown; where (A) is the growth curve at pH 7.0 and (B) is the growth curve at pH 5.0.
[0029] Figure 5 This is a colony diagram showing the tolerance of the recombinant genomic strain of Example 3 to acetic acid.
[0030] Figure 6 The image shows the morphological structure of bacteria observed by FESEM in Example 4; where (A) is BL21(WT) without acid; (B) is BL21-ΔcbpA without acid; (C) is BL21-ΔcbpA / AccbpA without acid; (D) is BL21(WT) 35mM acetic acid; (E) is BL21-ΔcbpA 35mM acetic acid; and (F) is BL21-ΔcbpA / AccbpA 35mM acetic acid.
[0031] Figure 7 The results are for intracellular ATP measurement in Example 5.
[0032] Figure 8 This is a graph showing the results of intracellular free amino acid determination in Example 6. Detailed Implementation
[0033] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.
[0034] The culture media involved in the following examples are as follows:
[0035] LB medium: yeast extract 5 g·L -1 10g / L of peptone -1 NaCl 10 g·L -1 LB solid medium can be prepared by adding 1.8% agar to the medium.
[0036] M9 liquid culture medium: Na₂HPO₄ 6.78 g·L⁻¹ -1 KH2PO4 3g·L -1 NaCl 0.5 g·L -1 NH4Cl 1g·L -1 4g / L glucose -1 MgSO4 0.24 g·L -1 CaCl2 0.011 g·L -1 .
[0037] The ATP detection methods involved in the following examples are as follows:
[0038] (1) Preparation of cells to be tested: Centrifuge the cells in a centrifuge tube, discard the supernatant, gently disperse the cells, add lysis buffer at a ratio of 200 μL per 2 mL of cells, and lyse the cells. After lysis, centrifuge at 12000g for 5 minutes at 4℃, and collect the supernatant for subsequent assays.
[0039] (2) Preparation for standard curve determination: Melt the reagents to be used on an ice bath, and dilute the ATP standard solution with ATP detection lysis buffer to a concentration gradient of 0.01, 0.03, 0.1, 0.3, 1, 3 and 10 μM.
[0040] (3) Add 100 μL of ATP detection working solution to the detection well. Let it stand at room temperature for 3-5 minutes to allow all the background ATP to be consumed, thereby reducing the background.
[0041] (4) Add 20 μL of sample to the test well and mix quickly with a pipette (micropipette). After at least 2 seconds, measure the RLU value using a chemiluminescence analyzer. Repeat each experiment three times. Calculate the intracellular ATP content based on the standard curve. The final ATP concentration is expressed as nmol mg. -1 protein.
[0042] The detection of free amino acid content involved in the following examples:
[0043] (1) Collect 50 mL of cells by centrifugation (12,000 × g, 10 min) and wash twice with ultrapure water. Resuspend the cells in 1 mL of 5% (w / v) trichloroacetic acid, then mix and sonicate at room temperature for 20 min. Let the mixture stand for 2 h. Remove cell debris by centrifugation at 12,000 × g for 15 min and filter the supernatant through a 0.22 μm filter membrane.
[0044] (2) Detection method: An Agilent Hypersil ODS column (5 μm, 4.0 mm x 250 mm) was used with gradient elution. The elution program was: 0 min, 8% B; 17 min, 50% B; 20.1 min, 100% B; 24.0 min, 0% B. The mobile phase flow rate was 1.0 mL / min, the column temperature was 40 °C, and the detection wavelength was 338 nm using a UV detector (VWD). The amino acid content was quantified using the external standard method.
[0045] Example 1: Construction of cbpA-deficient strains and recombinant Escherichia coli using the CRISPR / Cas9 system
[0046] The construction process is as follows Figure 1 As shown, the specific steps are as follows:
[0047] 1. Construction of defective strains:
[0048] (1) Transformation of pCas plasmid: E. coli BL21(DE3)-transformed competent cells were prepared according to the instructions of the supercompetent cell preparation kit. The competent cells were thawed on ice, and 2 μL of pCas plasmid was added. Then, the cells were heat-shocked in a metal bath at 42℃ for 90 s, and immediately placed on ice for 2 min. After the ice bath, 900 μL of liquid LB medium was added for recovery culture at 30℃, 200 rpm, and for 1 h. After recovery, the cells were plated, and single colonies grown on the plates were picked, cultured, and plasmids were extracted to verify successful transformation of E. coli BL21(DE3)-pCas.
[0049] (2) Construction of pTargetF-ΔcbpA plasmid used to knock out the target gene: The N20 sequence corresponding to the sgRNA of the target gene was designed, and the NGG site on the target gene was determined. The target sequence of the sgRNA is CGTCGGTTTCACGCCCATGATGG. The pTargetF was integrated into the sgRNA expression plasmid pTargetF by full plasmid mutation PCR using primers N20-cbpA-F and N20-cbpA-R.
[0050] The primer sequences are as follows:
[0051] N20-cbpA-F:
[0052] CGTCGGTTCACGCCCATGAGTTTTAGAGCTAGAAATAGCAAGTT;
[0053] N20-cbpA-R:
[0054] TCATGGGCGTGAAACCGACGACTAGTATTATACCTAGGACTGAGC.
[0055] (3) Preparation of homologous arms:
[0056] Using primers cbpA-UF and cbpA-UR, and cbpA-DF and cbpA-DR, 500 bp each of the upstream and downstream homologous arms of the cbpA gene in E. coli BL21(DE3) were amplified. After verification by nucleic acid electrophoresis, the fragments were recovered by column purification. Finally, using primers cbpA-UF and cbpA-DR, and with an equal mixture of the upstream and downstream homologous arms of the cbpA gene as a template, overlap extension PCR was performed to obtain cbpA knockout.Ec The sequence of the homologous arm fragment of the gene (repair template) is shown in SEQ ID NO.3.
[0057] The primer sequences involved are as follows:
[0058] cbpA-UF:GTTATTGCTGGTGTTAGTGGAGTGC;
[0059] cbpA-UR:GTGTTGATTTACGCGAGATAACGCTATGGCTAATGTTACGGTGACTTTTACTATTACC;
[0060] cbpA-DF: GGTAATAGTAAAAGTCACCGTAACATTAGCCATAGCGTTATCTCGCGTAAATCAACAC;
[0061] cbpA-DR:ATTATCATTCTGTATTTCCTCAAATTCTTTTTCTAGTGATTC.
[0062] (4) Construction of defective strains
[0063] Using electroporation, the plasmid pTargetF-ΔcbpA obtained in step (2) and the homologous arm fragment obtained in step (3) were respectively transformed into the E. coli BL21(DE3)-pCas strain prepared in step (1);
[0064] The defective strain was selected and identified, and named BL21-ΔcbpA;
[0065] (5) Colony PCR verification: The defective strain BL21-ΔcbpA obtained in step (4) was subjected to colony PCR, using primers such as cbpA-UF and cbpA-DR mentioned above.
[0066] Positive transformants were obtained by nucleic acid electrophoresis, and the results are as follows: Figure 2 As shown in the figure; positive transformants were selected and sent to a sequencing company for sequencing, and the results showed that the strain was successfully constructed.
[0067] 2. Construction of recombinant Escherichia coli genome (using CbpA, a molecular chaperone protein derived from Thiobacillus acidophilus, to replace the molecular chaperone protein CbpA on the Escherichia coli genome), the specific steps are as follows:
[0068] (1) The steps for transferring pCas plasmid and constructing pTargetF-ΔcbpA plasmid are the same as steps (2) and (3) in step 1.
[0069] (2) A cbpA was added between the upstream and downstream fragments to construct the homologous arm of the recombinant genomic strain. Ac sequence.
[0070] Using overlap extension PCR to obtain knock-in cbpA Ac The sequence of the homologous arm fragment of the gene (repair template) is shown in SEQ ID NO.4.
[0071] The primer sequences involved are based on the primer sequences in step (3) of step 1, with two additional primer sequences as follows:
[0072] cbpA-IF: GGTAATAGTAAAAGTCACCGTAACATTAGCCATTCAGCGACGTGGGTGAAAGT;
[0073] cbpA-IR: GTGTTGATTTACGCGAGATAACGCTTTGGAATACAAAGATTACTATCAGATTCTGGGTGTTG.
[0074] (3) Using electroporation, the plasmid pTargetF-ΔcbpA prepared in step (1) and the homologous arm fragment prepared in step (2) were transformed into E.coli BL21(DE3)-pCas respectively; the recombinant strain was selected and identified and named: BL21-ΔcbpA / AccbpA.
[0075] (4) Colony PCR verification: The aforementioned recombinant strain was subjected to colony PCR using primers cbpA-UF and cbpA-IR. Positive transformants were obtained by nucleic acid electrophoresis, and the results are as follows: Figure 3 As shown in the figure; positive transformants were selected and sent to a sequencing company for sequencing, and the results showed that the strain was successfully constructed.
[0076] Example 2: Growth of recombinant genomic strains under different pH conditions
[0077] The growth status of wild-type BL21(WT), auxotype BL21-ΔcbpA, and recombinant strain BL21-ΔcbpA / AccbpA was detected under pH 7.0 and pH 5.0 conditions, respectively. The specific steps are as follows:
[0078] (1) Wild-type E. coli BL21(DE3)(WT), defective BL21-ΔcbpA, and recombinant strain BL21-ΔcbpA / AccbpA glycerol bacteria were streaked on LB plates and activated overnight at 37°C;
[0079] Single colonies were picked from the activated LB plates and inoculated into LB medium. They were cultured at 37℃ and 200rpm for 12h to prepare seed solutions. The bacterial concentration of the seed solutions was then measured.
[0080] The results showed that the initial bacterial concentrations were as follows: the OD600 values of E. coli BL21(DE3)(WT), the auxotype BL21-ΔcbpA, and the recombinant strain BL21-ΔcbpA / AccbpA were 2.01, 1.98, and 1.99, respectively.
[0081] (2) The wild-type, defective and recombinant strain seed liquids obtained in step (1) were added to fresh M9 liquid culture medium at pH 7.0 and pH 5.0 respectively at an inoculation rate of 1% (v / v). The pH was adjusted with hydrochloric acid and their growth was observed.
[0082] Every 2 hours according to OD 600 Growth was monitored until the quiescent phase (18 h of culture), and each experiment was repeated three times. Specific growth rate (μ) was calculated using Origin 2022 software; results are shown below. Figure 4 As shown.
[0083] The results showed that at pH 7.0, the growth status of the three E. coli strains was basically the same, and their growth rates also showed similar trends. Figure 4 A).
[0084] However, when the pH dropped to 5.0, the three strains showed some differences: the final OD of the defective strain BL21-ΔcbpA was higher. 600 (OD 600 The value was 0.684% higher than that of wild-type E. coli BL21(DE3)(OD200). 600 The final biomass (OD) of recombinant BL21-ΔcbpA / AccbpA was 8.68% lower than that of 0.749. 600 The value was 0.715, which was 4.53% higher than that of the defective strain BL21-ΔcbpA. Figure 4 B).
[0085] Example 3: Analysis of the tolerance of recombinant genomic strains to acetic acid
[0086] To investigate CbpA Ac In the application of organic acid tolerance, organic acid stress was applied to each strain to verify its tolerance to organic acids, including the following steps:
[0087] (1) The preserved glycerol bacteria (wild-type E. coli BL21(DE3)(WT), defective BL21-ΔcbpA, and recombinant strain BL21-ΔcbpA / AccbpA) were taken out of the refrigerator, streaked on LB medium solid plates, and cultured in an incubator at 37°C to obtain single colonies.
[0088] Single colonies obtained from solid plates were inoculated into LB medium and cultured at 37°C and 200 rpm for 12 h on a shaker to prepare seed cultures. The bacterial concentration of the seed cultures was then measured.
[0089] The results showed that the initial bacterial concentrations were as follows: OD of E. coli BL21(DE3)(WT), auxotrophic BL21-ΔcbpA, and recombinant strain BL21-ΔcbpA / AccbpA. 600 They are 2.01, 1.98, and 1.99 respectively.
[0090] (2) Take the above seed liquid with the same OD and inoculate it into LB medium. When the OD=0.6, add 17.5mM acetic acid (pH 4.69) and 35mM acetic acid (pH 4.23) to the medium of each strain respectively; at the same time, use no organic acid as a control and stress culture for 10h to obtain fermentation broth.
[0091] After serially diluting the above fermentation broth, take 10% of each dilution. 4 , 10 5 , 10 6 , 10 7 5 μL of the diluted solution was spotted onto LB agar plates, incubated overnight at 37°C, and colony counts were performed to calculate the viability. The calculation method was as follows:
[0092]
[0093] Plate colony results as follows Figure 5 .
[0094] The results showed that, without the addition of organic acids, the cell viability of the three strains was almost identical.
[0095] Under 17.5 mM acetic acid stress, the survival rate of BL21-ΔcbpA decreased by 69.67% compared to the acid-free condition (control strain), while the survival rate of the genomic recombinant strain BL21-ΔcbpA / AccbpA was 5.67 times higher than that of the defective BL21-ΔcbpA, and slightly higher than that of the wild-type BL21.
[0096] When the acetic acid concentration was increased to 35 mM, acid stress significantly affected cell survival. Compared with the control strain (without organic acid), the survival rates of both wild-type BL21 and the defective BL21-ΔcbpA decreased by about 100-fold; the survival rate of BL21-ΔcbpA / AccbpA decreased by 83.33%.
[0097] It is evident that, under conditions where the acetic acid concentration is increased to 35 mM, the survival rate of BL21-ΔcbpA / AccbpA is 7.67 times higher than that of the defective type and 2.25 times higher than that of the wild type, showing significant differences.
[0098] Example 4: Observation of bacterial morphological changes using cold field emission scanning electron microscopy (FESEM)
[0099] To further investigate the effects of organic acid (taking 35mM acetic acid as an example) on bacterial cell stress, bacterial cells were observed using cold field emission scanning electron microscopy.
[0100] The following steps are involved:
[0101] (1) The strain was grown in LB medium to the early exponential phase (OD). 600 =0.4~0.6), followed by adding 35mM acetic acid for 10 hours (see Example 3 for specific method).
[0102] (2) Bacterial cells were collected by centrifugation, fixed with 5% glutaraldehyde at 4°C for 12 h, and then washed repeatedly with 0.1 M phosphate buffer to remove the glutaraldehyde solution. The cells were then dehydrated using a gradient of 30%, 50%, 70%, 90%, and 100% ethanol solutions. After critical point drying and ion sputtering, the morphology and structure of the bacteria were observed using a FESEM (SU8200, Hitachi Ltd., Japan). The results are as follows: Figure 6 As shown in A to F.
[0103] The results showed that under acid-free conditions, the BL21-ΔcbpA strain was slightly longer and had minor damage to its cell membrane. The wild-type and recombinant strains, however, exhibited normal cell morphology.
[0104] Under 35 mM acetic acid stress, the lengths of BL21(WT) and BL21-ΔcbpA / AccbpA were approximately 1.5 times that under acid-free conditions, while the defective BL21-ΔcbpA showed no significant elongation. The cell membrane of the defective BL21-ΔcbpA showed significant damage, indicating that external stress may affect cell membrane-related components, leading to changes in cell morphology. The bacterial membrane, in direct contact with the cellular environment, is the first line of defense against stress.
[0105] Example 5: Intracellular ATP Measurement
[0106] When microbial cells encounter acid stress, they consume ATP through various physiological pathways to maintain intracellular pH homeostasis. Intracellular ATP levels were measured (see Example 3 for specific methods).
[0107] The following steps are involved:
[0108] The strain was grown in LB medium to the early exponential phase (OD). 600 =0.4~0.6), followed by 35mM acetic acid stress. Cells were sampled and analyzed at 0h, 5h, and 10h of stress. Cells were centrifuged in centrifuge tubes, the supernatant was discarded, and the cells were gently dispersed. Lysis buffer was added at a ratio of 200μL to 2mL of cells to lyse the cells. After lysis, the cells were centrifuged at 12000g for 5 minutes at 4℃, and the supernatant was collected for subsequent measurements. Intracellular ATP content was calculated based on the standard curve, and the final ATP concentration was expressed as nmol mg. -1 Proteins, results are shown in Table 1 and Figure 7 As shown.
[0109] Table 1: Intracellular ATP content of different strains at different stress time points
[0110]
[0111] The results showed that at different stress time points, the ATP concentration of BL21-ΔcbpA was higher than that of BL21(WT) and BL21-ΔcbpA / AccbpA, indicating that CbpA participates in the ATP-dependent response to prevent the aggregation of denatured proteins. Furthermore, with prolonged stress time, the ATP levels of all strains gradually decreased, indicating that the strains require a large amount of energy to resist the damage caused by acid stress.
[0112] The ATP levels of the recombinant strain BL21-ΔcbpA / AccbpA at the corresponding stress points (0h, 5h, 10h) were 26.17%, 55.99%, and 37.96% lower than those of the defective strain, respectively. The ATP levels at 0h and 10h were the same as those of the wild type, while at 5h they were 47.96% lower than those of the wild type.
[0113] Compared with 5h, at 10h, the ATP concentration of BL21(WT) decreased by 64.50%, the ATP concentration of BL21-ΔcbpA decreased by 50.01%, and the ATP concentration of BL21-ΔcbpA / AccbpA integrating the A. caldus gene decreased by 29.53%.
[0114] Example 6: Determination of intracellular free amino acids
[0115] Amino acids play a crucial role in microbial resistance to acid stress, including regulating intracellular pH, energy production, and redox capacity. To verify CbpA... Ac The effects of free amino acids within bacterial cells were investigated.
[0116] The steps include (see Example 3 for details):
[0117] The strain was grown in LB medium to the early exponential phase (OD). 600 =0.4~0.6), followed by 10 hours of culture under 35mM acetic acid stress, then centrifugation (12,000×g, 10 min) to collect 50 mL of cells, washed twice with ultrapure water. The cells were resuspended in 1 mL of 5% (w / v) trichloroacetic acid, then mixed and sonicated at room temperature for 20 min. The mixture was allowed to stand for 2 h. Cell debris was removed by centrifugation at 12,000×g for 15 min, and the supernatant was filtered through a 0.22 μm filter membrane for intracellular amino acid content detection. Amino acid content was quantified using the external standard method. Results are shown in Table 2 and... Figure 8 shown.
[0118] Table 2: Intracellular amino acid content of different strains
[0119]
[0120] The results showed that arginine, alanine, aspartic acid, glutamic acid, lysine, and histidine, which are associated with cellular resistance to acidic environments, underwent significant changes.
[0121] The contents of glutamic acid, arginine, lysine and histidine in the defective strain changed significantly, decreasing by 12.35%, 59.11%, 68.29% and 24.44% respectively compared with the wild-type strain.
[0122] The recombinant strain showed higher concentrations of several amino acids than the defective strain, with arginine concentration approximately twice that of the defective strain. Aspartic acid and glutamic acid levels were 14.79% and 6.23% higher, respectively, than the wild-type BL21 strain. The arginine deaminase (ADI) system is considered a crucial factor in protecting microbial cells against acidic environments. The ADI pathway generates ATP and NH3 through metabolism, stabilizing intracellular H+. + This reduces the damage to cells caused by acid stress. Furthermore, the recombinant strain had an alanine content 88.74% higher than the wild type. Aspartic acid can be converted to arginine and enter the ADI pathway, or it can consume protons to form alanine. The glutamate decarboxylase (GAD) system is another important acid-resistance mechanism in bacteria. Under acid stress, the accumulation of glutamate promotes the decarboxylation reaction catalyzed by glutamate decarboxylase, producing γ-aminobutyric acid (GABA) and consuming one molecule of H+.+ This helps alleviate intracellular pH. The recombinant strain has a 29.80% higher histidine content than the wild type, and its decarboxylation to produce histamine and carbon dioxide is also a common strategy for cells to cope with acid stress.
[0123] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. An engineered Escherichia coli with improved acid stress resistance, characterized in that: The engineered Escherichia coli bacteria uses the molecular chaperone protein CbpA derived from the acidophilic thermothiobacillus to replace the molecular chaperone protein CbpA on the Escherichia coli genome. The amino acid sequence of the molecular chaperone protein CbpA derived from the acidophilic thermothiobacillus is shown in SEQ ID NO.
2.
2. The engineered Escherichia coli according to claim 1, wherein the nucleotide sequence encoding the molecular chaperone protein CbpA is shown in SEQ ID NO.
1.
3. The method for constructing an engineered Escherichia coli according to claim 1 or 2, characterized in that: The method comprises: using a cbpA containing a nucleotide sequence as shown in SEQ ID NO.1 Ec The integrative vector with the gene's guide sequence N20 sequence integrates the molecular chaperone protein CbpA from the acidophilic thermophilic thiobacillus into the molecular chaperone protein CbpA site on the Escherichia coli genome, and the N20 sequence is: CGTCGGTTTCACGCCCATGA.
4. A method for improving the acid stress resistance of Escherichia coli, characterized in that: The method comprises replacing the molecular chaperone protein CbpA on the Escherichia coli genome with the molecular chaperone protein CbpA derived from the acidophilic thermothiobacillus. The amino acid sequence of the molecular chaperone protein CbpA derived from the acidophilic thermothiobacillus is shown in SEQ ID NO.
2.
5. The method for improving the acid stress resistance of Escherichia coli according to claim 4, characterized in that: The ability to resist acid stress includes tolerance to 35 mM acetic acid.
Citation Information
Patent Citations
Process for improved protein expression by strain engineering
CN101031655A
Colibacillus with improved 3-hydroxypropionic acid tolerance and construction method of colibacillus
CN104726389A