Primer probe sets, kits, and uses thereof

By designing a primer and probe set targeting specific mutation sites in the HLA-B*35:01 gene and combining it with qPCR amplification, the problems of high cost, long time consumption, and false positives in existing HLA-B*35:01 allele detection have been solved, achieving rapid and accurate HLA-B*35:01 allele detection.

CN115838788BActive Publication Date: 2026-07-10CHANGSHA DUXACT BIOTECH CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211574483.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-08
Publication Date
2026-07-10
Estimated Expiration
2042-12-08

AI Technical Summary

Technical Problem

Existing methods for HLA-B*35:01 allele detection are costly, time-consuming, and require specialized equipment and highly skilled personnel for result analysis. PCR-SBT method suffers from peak overlap issues, high-throughput sequencing is cumbersome and expensive, and qPCR is prone to false positives.

Method used

A primer-probe set was designed, including a primer-probe set of specific mutation sites targeting the HLA-B*35:01 gene, namely rs1055348, rs697742, rs4997052 and rs3179865. The allele arrest mutation system (ARMS) method was combined to introduce base mismatches to improve detection specificity, and the detection was performed using qPCR amplification reaction.

Benefits of technology

It enables rapid, efficient, and accurate detection of the HLA-B*35:01 allele, improves the specificity and accuracy of the detection, can distinguish HLA-B*35 types, and reduces the detection cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003988718820000091
    Figure BDA0003988718820000091
  • Figure BDA0003988718820000141
    Figure BDA0003988718820000141
  • Figure BDA0003988718820000151
    Figure BDA0003988718820000151
Patent Text Reader

Abstract

The present application relates to the technical field of gene detection, in particular to a primer probe set, a kit and application thereof. The primer probe set provided by the present application comprises a first primer probe set, a second primer probe set and optionally a third primer probe set. The present application also provides a kit comprising the primer probe set. The primer probe set or the kit provided by the present application can be used for detecting HLA-B*35:01 allele, has high accuracy and specificity, and can quickly and efficiently realize the detection of HLA-B*35:01 allele.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection, specifically to a primer-probe set and its use in detecting the HLA-B*35:01 allele, a kit and its use in detecting the HLA-B*35:01 allele, and a method for detecting the HLA-B*35:01 allele. Background Technology

[0002] The major histocompatibility complex (MHC) is a group of tightly linked genes, discovered early in tissue and organ transplantation experiments. In humans, the MHC is commonly referred to as the HLA gene or HLA complex, encoding molecules expressed on leukocytes called human leukocyte antigens (HLA). Abundant polymorphism is one of the most important characteristics of the HLA gene system; many DNA sequences within the HLA complex contain variants called alleles.

[0003] Currently, the methods for detecting the HLA-B*35:01 allele are PCR-SBT, high-throughput sequencing, and qPCR. PCR-SBT, or direct sequencing, directly obtains the DNA sequence and identifies all possible polymorphisms, making it the most direct method. It also boasts high specificity and sensitivity, and is internationally recognized as the "gold standard" for HLA allele typing. However, this method suffers from drawbacks such as high cost, long processing time, reliance on specialized equipment for result analysis, and high skill requirements for analysts. Furthermore, due to the specificity of the target gene sequence and primer design, sequencing results may exhibit overlapping peaks, hindering interpretation and leading to ambiguous results. High-throughput sequencing, like PCR-SBT, is cumbersome, time-consuming, and expensive, gradually failing to meet the "fast and convenient" requirements of modern medical testing. qPCR, or real-time quantitative PCR, is relatively simple to operate and less time-consuming than sequencing, making it suitable for rapid HLA-B*35:01 typing. However, the existing qPCR method is prone to false positives when detecting the HLA-B*35:01 allele. Summary of the Invention

[0004] This invention provides a primer and probe set, a kit, and its use in detecting the HLA-B*35:01 allele, aiming to improve the specificity and accuracy of HLA-B*35:01 allele detection.

[0005] Accordingly, in a first aspect, the present invention provides a primer-probe set, comprising a first primer-probe set and a second primer-probe set, wherein the first primer-probe set comprises a first upstream primer as shown in SEQ ID NO:1, a first downstream primer as shown in SEQ ID NO:2, and a first probe as shown in SEQ ID NO:3; and the second primer-probe set comprises a second upstream primer as shown in SEQ ID NO:4, a second downstream primer as shown in SEQ ID NO:5, and a second probe as shown in SEQ ID NO:6.

[0006] In a second aspect, the present invention provides the use of the primer-probe set in the detection of the HLA-B*35:01 allele, or in the preparation of a kit for the detection of the HLA-B*35:01 allele.

[0007] In a third aspect, the present invention provides a kit comprising the primer and probe set described herein.

[0008] In a fourth aspect, the present invention provides the use of the kit in detecting the HLA-B*35:01 allele.

[0009] In a fifth aspect, the present invention provides a method for detecting the HLA-B*35:01 allele, comprising:

[0010] Provide the genomic DNA of the sample to be tested;

[0011] The genomic DNA was mixed with an amplification reaction solution comprising a first primer and probe set, a second primer and probe set, and a third primer and probe set, and then subjected to a qPCR amplification reaction.

[0012] When the absolute value of the difference between the CT value of the genomic DNA at mutation site rs105534 and the CT value of the internal reference gene ACTB, and the absolute value of the difference between the CT values ​​of the mutation sites rs697742, rs4997052 and rs3179865 and the CT value of the internal reference gene ACTB are all less than 4, the genomic DNA carries the HLA-B*35:01 allele.

[0013] The present invention has the following beneficial effects:

[0014] The primer-probe set provided by this invention is a combination of rs1055348, rs697742, rs4997052, and rs3179865 targeting specific mutation sites in the HLA-B*35:01 gene. It was designed based on the region near the mutation sites and combined with the Allele Arrest Mutation System (ARMS) method. When used to detect the HLA-B*35:01 allele, the primer-probe set provided by this invention can solve the problem of incomplete HLA-B type differentiation and can even achieve differentiation within the HLA-B*35 type. Simultaneously, the primer-probe set provided by this invention introduces base mismatches, thereby improving the specificity of HLA-B*35:01 allele detection. Therefore, the primer-probe set provided by this invention, or a kit containing this primer-probe set, can be used to detect the HLA-B*35:01 allele with high accuracy and specificity, enabling rapid and efficient detection of the HLA-B*35:01 allele, and has promising application prospects. Attached Figure Description

[0015] Figure 1 This is a real-time fluorescence amplification result of FAM and VIC dual-channel at rs1055348 (the site amplified by the first primer and probe set) for 8 samples in Example 2 of the present invention.

[0016] Figure 2 The image shows the ROX and VIC dual-channel real-time fluorescence amplification results of 8 samples in Example 2 of this invention at rs697742, rs4997052 and rs3179865 (the sites amplified by the second primer and probe set);

[0017] Figure 3 The image shows the real-time fluorescence amplification results of FAM and VIC dual-channel fluorescence amplification in the HLA-B*35:01 allele detection as a comparative example.

[0018] Figure 4 The results of real-time fluorescence amplification in the FAM and VIC dual channels of rs1055348 are shown in the experiment for verifying the accuracy of Example 3 of the present invention.

[0019] Figure 5 The results of real-time fluorescence amplification of ROX and VIC dual channels in rs697742, rs4997052 and rs3179865 are shown in the experiment for verifying the accuracy of Example 3 of the present invention. Detailed Implementation

[0020] This invention provides a primer-probe set, which includes a first primer-probe set and a second primer-probe set. The first primer-probe set includes a first upstream primer as shown in SEQ ID NO:1, a first downstream primer as shown in SEQ ID NO:2, and a first probe as shown in SEQ ID NO:3. The second primer-probe set includes a second upstream primer as shown in SEQ ID NO:4, a second downstream primer as shown in SEQ ID NO:5, and a second probe as shown in SEQ ID NO:6.

[0021] The primer-probe set provided in this embodiment of the invention is a specific primer-probe set designed for a specific combination of mutation sites rs1055348, rs697742, rs4997052, and rs3179865 of the HLA-B*35:01 gene. Among them, rs1055348, rs697742, rs4997052, and rs3179865 are ID numbers in a single nucleotide polymorphism database. The mutation sites selected in this embodiment of the invention are divided into two sets: one set (rs1055348) is used to distinguish between genotype 35 and other genotypes, and the other set (rs697742, rs4997052, and rs3179865) is used for differentiation within genotype 35. Both sets of sites work together to distinguish whether the same sample carries the B*35:01 allele. Specifically, the mutation site corresponding to the first primer-probe set provided in this embodiment of the invention is rs1055348 (used to distinguish type 35 from other types); the mutation sites corresponding to the second primer-probe set are rs697742, rs4997052 and rs3179865 (used to distinguish types within type 35).

[0022] Furthermore, in the first primer-probe set and the second primer-probe set provided in the embodiments of the present invention, a base mismatch is introduced at the 3rd or 4th position of the 3' end of the primer, thereby causing a mismatch with the target gene, which is beneficial to improving the specificity of HLA-B*35:01 allele detection.

[0023] In some implementations, the nucleotide sequence of the first upstream primer is shown in SEQ ID NO:1.

[0024] The nucleotide sequence of the first upstream primer (SEQ ID NO:1):

[0025] 5'-gagatgaaggacttcttcact-3'

[0026] In some implementations, the nucleotide sequence of the first downstream primer is shown in SEQ ID NO:2.

[0027] The nucleotide sequence of the first downstream primer (SEQ ID NO:2):

[0028] 5'-tctgcacctcttcacactag-3'

[0029] In some embodiments, the nucleotide sequence of the first probe is shown in SEQ ID NO:3.

[0030] The nucleotide sequence of the first probe (SEQ ID NO:3):

[0031] 5'-aagggcctctcgcatctcttactgc-3'

[0032] In some implementations, the nucleotide sequence of the second upstream primer is shown in SEQ ID NO:4.

[0033] The nucleotide sequence of the second upstream primer (SEQ ID NO:4):

[0034] 5'-tcacatcatgcagacgatgtat-3'

[0035] In some embodiments, the nucleotide sequence of the second downstream primer is shown in SEQ ID NO:5.

[0036] The nucleotide sequence of the second downstream primer (SEQ ID NO:5):

[0037] 5'-cctcgagctaggctctca-3'

[0038] In some embodiments, the nucleotide sequence of the second probe is shown in SEQ ID NO:6.

[0039] The nucleotide sequence of the second probe (SEQ ID NO:6):

[0040] 5'-cctccgcagtcatgaccggtc-3'

[0041] In some embodiments, the first probe and / or the second probe are TaqMan probes, with a fluorescent group labeled at the 5' end and a quenching group labeled at the 3' end. The fluorescent group and the quenching group can be selected according to different instruments and the number of primers and probes.

[0042] In some embodiments, the first probe and / or the second probe are dual-labeled probes. Preferably, the 5' end of the first probe and / or the second probe is labeled with different fluorescent groups, and the 3' end is labeled with different quenching groups. More preferably, the fluorescent groups are selected from FAM, ROX, and CY5, and the quenching groups are selected from BHQ1 and BHQ2. Accordingly, in some specific embodiments, the first probe is: 5'-FAM-aagggcctctcgcatctcttactgc-BHQ1-3'; and the second probe is: 5'-ROX-cctccgcagtcatgaccggtc-BHQ2-3'.

[0043] In some embodiments, the primer-probe set further includes a third primer-probe set for the specific detection of the internal reference gene ACTB (as disclosed in patent document CN110358814A) for quality control and result analysis. The third primer-probe set includes a third upstream primer as shown in SEQ ID NO:7, a third downstream primer as shown in SEQ ID NO:8, and a third probe as shown in SEQ ID NO:9.

[0044] In some embodiments, the nucleotide sequence of the third upstream primer is shown in SEQ ID NO:7.

[0045] The nucleotide sequence of the third upstream primer (SEQ ID NO:7):

[0046] 5'-cagcagatgtggatcagcaag-3'

[0047] In some embodiments, the nucleotide sequence of the third downstream primer is shown in SEQ ID NO:8.

[0048] The nucleotide sequence of the third downstream primer (SEQ ID NO:8):

[0049] 5'-gcatttgcggtggacgat-3'

[0050] In some embodiments, the nucleotide sequence of the third probe is shown in SEQ ID NO:9.

[0051] The nucleotide sequence of the third probe (SEQ ID NO:9):

[0052] 5'-aggagtatgacgagtccggcccc-3'

[0053] In some embodiments, the 5' end of the third probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group; preferably, the fluorescent group is VIC, and the quenching group is BHQ1 or BHQ2. Accordingly, in one specific embodiment, the third probe is: 5'-VIC-aggagtatgacgagtccggcccc-BHQ1-3'.

[0054] The primer and probe sets (first primer and probe set, second primer and probe set, and third primer and probe set) provided in this embodiment of the invention can be used to detect the HLA-B*35:01 allele.

[0055] The primer and probe set provided in this embodiment of the invention can also be used to prepare a kit for detecting the HLA-B*35:01 allele.

[0056] Accordingly, embodiments of the present invention also provide a kit comprising the primer and probe set provided in embodiments of the present invention.

[0057] In some embodiments, the kit further includes a positive control, a negative control, and water. Preferably, the positive control includes a positive plasmid that explicitly contains the HLA-B*35:01 mutation sites rs1055348, rs697742, rs4997052, and rs3179865, thus guaranteeing a positive result; the negative control includes a negative plasmid containing sequences of other types corresponding to the HLA-B*35:01 mutation sites; and the water is PCR-grade purified water.

[0058] In one specific implementation, the positive plasmid is a sequence containing the HLA-B*35:01 mutation sites rs1055348, rs697742, rs4997052, and rs3179865. Its construction method involves selecting the sequences of the HLA-B*35:01 mutation sites (rs1055348, rs697742, rs4997052, and rs3179865) from the IPD-IMGT / HLA database, assembling the sequences, sending them to a universal biosynthetic plasmid database, and then dissolving and diluting the synthesized plasmid for later use. The sequence of this positive plasmid is shown in SEQ ID NO:10. In one specific implementation, the negative plasmid is a mixed plasmid containing HLA-B*35:02, HLA-B*35:03, HLA-B*35:08, HLA-B*35:14, and HLA-B*57:01 plasmids. The construction method is to select the sequences of these types corresponding to the mutation sites of HLA-B*35:01 from the IPD-IMGT / HLA database, send them to Universal Biotech to synthesize plasmids, and then mix the synthesized plasmids in equal proportions after dissolution and dilution. The sequences of plasmids HLA-B*35:02, HLA-B*35:03, HLA-B*35:08, HLA-B*35:14, and HLA-B*57:01 are shown in SEQ ID NO:11-14, respectively; the sequences of plasmids HLA-B*35:08 and HLA-B*35:14 are identical.

[0059] Positive plasmid sequence (SEQ ID NO:10):

[0060] 5’-ttcatgactgttgttttctgtagcctgagacagctgtcttgtgagggactgagatgcaggatttcttcactcctcc cctttgtgacttcaagggcctctggcatctctttctgcaaaggcacctgaatgtgtctgcgtccctgttagcctaatgtgaggaggtggagagacagcccacccccgtgtccactgtgaccccttcacatcatccagaggatgtatggctgcgacctggggcccgacgggcgcctcctccgcgggcatgaccagtccgcctacgacggcaaggattacatcgccctgaacgaggacctgagctcctggaccgcggcggacaccgcggctcagatcacccagcgcaagtgggaggcggcccgtgtggcggagcagctgagagcctacctggagg-3’

[0061] Negative plasmid sequence:

[0062] HLA-B*35:02 plasmid sequence (SEQ ID NO:11):

[0063] 5’-ccgcggggccggggccagggtctcacatcatccagaggatgtatggctgcgacctggggcccgacggg cgcttcctccgcgggcataaccagtacgcctacgacggcaaggattacatcgccctgaacgaggacctgagctcctg gaccgcggcggacaccgcggctcagatcacccagcgcaagtgggagg-3’

[0064] HLA-B*35:03 plasmid sequence (SEQ ID NO:12):

[0065] 5'-ccgcggggccggggccagggtctcacatcatccagaggatgtatggctgcgacctggggcccgacggg cgcctcctccgcgggcatgaccagttcgcctacgacggcaaggattacatcgccctgaacgaggacctgagctcctg gaccgcggcggacaccgcggctcagatcacccagcgcaagtgggaggcggcccg-3'

[0066] HLA-B*35:08 / 14 plasmid sequence (SEQ ID NO:13):

[0067] 5'-catcgccctgaacgaggacctgagctcctggaccgcggcggacaccgcggctcagatcacccagcgca agtgggaggcggcccgtgtggcggagcagcggagagcctacctggagggcctgtgcgtggagtggctccgcagat acctggagaacgggaaggagacgctgcagcgcgcgggtaccaggggcagtggggagccttccccatctcct-3'

[0068] HLA-B*57:01 plasmid sequence (SEQ ID NO:14):

[0069] 5'-ggtggggcagaggggaaaggcctgggtaatggagaattctttgattgggatgtttcgcgtgtgtggtgggct gttcagagtgtcatcacttaccatgactcaccagaatttgttcatgactgttgttttctgtagcctgagacagctgtcttgtga gggactgagatgcaggatttcttcacgcctcccctttgtgactt-3'

[0070] The kit provided in this embodiment of the invention can be used to detect the HLA-B*35:01 allele.

[0071] In some embodiments, the kit for detecting the HLA-B*35:01 allele includes:

[0072] (1) Provide the genomic DNA of the sample to be tested;

[0073] (2) After mixing the genomic DNA with the components in the kit, perform a qPCR amplification reaction;

[0074] (3) When the absolute value of the difference between the CT value of the genomic DNA at the mutation site rs1055348 and the CT value of the internal reference gene ACTB, and the absolute value of the difference between the CT values ​​of the mutation sites rs697742, rs4997052 and rs3179865 and the CT values ​​of the internal reference gene are all less than 4, the genomic DNA carries the HLA-B*35:01 allele.

[0075] Specifically, in step (1), the sample to be tested includes, but is not limited to, whole blood, oral swabs, cells, and tissues. The method for obtaining the genomic DNA of the sample to be tested is known in the art and will not be described in detail here.

[0076] In step (2), the components of the kit include a first primer probe set, a second primer probe set and a third primer probe set, as well as a qPCR enzyme premix (purchased from Aikerui Biotechnology).

[0077] When performing qPCR amplification after mixing the genomic DNA with the components in the kit, the two sets of sites are processed separately (i.e., one set is rs1055348, and the other set is rs697742, rs4997052, and rs3179865). The resulting amplification reaction solution is divided into two portions (one portion consists of the first primer / probe set, the third primer / probe set, and the qPCR enzyme premix; the other portion consists of the second primer / probe set, the third primer / probe set, and the qPCR enzyme premix). Preferably, the concentrations of the first, second, and third primer / probe sets are 1.3-13 μM / L.

[0078] In some specific implementations, the components and contents of the amplification reaction solution are shown in Table 1.

[0079] Table 1

[0080] Components Volume (μL) per reaction 2×ProTaqHSProbePremix 10 First primer / probe set / Second primer / probe set 1.5 Third primer and probe set (IP) 1.5 <![CDATA[ddH2O]]> 6 Sample DNA template 1 Total 20μL

[0081] In Table 1, the concentrations of the upstream primer, downstream primer, and probe in the first, second, and third primer-probe sets are all 3.3 μM / L.

[0082] In some specific implementations, the reaction procedure for the qPCR amplification reaction is shown in Table 2.

[0083] Table 2

[0084]

[0085] Note: * indicates that fluorescence signals were collected during this stage.

[0086] In step (3), the internal reference gene serves as a quality control. The sample quality is considered acceptable only if an amplification curve of the internal reference gene appears in each sample. Under the premise that the internal reference gene shows a normal amplification curve, HLA-B*35:01 also shows amplification curves at mutation sites rs105534, rs697742, rs4997052, and rs3179865. Furthermore, the absolute value of the difference (ΔCT) between the CT value of the target gene and the CT value of the internal reference gene at both sites is less than 4. Therefore, it can be determined that the sample carries the HLA-B*35:01 allele.

[0087] This invention also provides a method for detecting the HLA-B*35:01 allele, comprising:

[0088] (i) Provide genomic DNA of the sample to be tested;

[0089] (ii) The genomic DNA is mixed with the amplification reaction solution including the first primer and probe set, the second primer and probe set and the third primer and probe set as described in the embodiments of the present invention, and then a qPCR amplification reaction is performed;

[0090] (iii) When the absolute value of the difference between the CT value of the genomic DNA at the mutation site rs1055348 and the CT value of the internal reference gene ACTB, and the absolute value of the difference between the CT values ​​of the mutation sites rs697742, rs4997052 and rs3179865 and the CT value of the internal reference gene ACTB are all less than 4, the genomic DNA carries the HLA-B*35:01 allele.

[0091] Specifically, in step (i), the sample to be tested includes, but is not limited to, whole blood, oral swabs, cells, and tissues. The method for obtaining the genomic DNA of the sample to be tested is known in the art and will not be described further here.

[0092] In step (ii), the amplification reaction solution may further include a qPCR enzyme premix.

[0093] The amplification reaction solution was divided into two portions for qPCR amplification, which were used to detect the two groups of sites mentioned above.

[0094] In some specific implementations, the components and contents of the amplification reaction solution are shown in Table 1 above.

[0095] In some specific implementations, the reaction procedure for the qPCR amplification reaction is shown in Table 2 above.

[0096] In step (iii), the internal reference gene serves as a quality control; the sample quality is considered acceptable only if an amplification curve of the internal reference gene appears in each sample. Provided the internal reference gene shows a normal amplification curve, if HLA-B*35:01 also shows amplification curves at mutation sites rs105534, rs697742, rs4997052, and rs3179865, and the absolute value of the difference (ΔCT) between the CT value of the target gene and the CT value of the internal reference gene at both sites is less than 4, then it can be determined that the sample carries the HLA-B*35:01 allele.

[0097] The detection method provided in this invention can solve the problem of incomplete HLA-B type differentiation in the prior art, especially the differentiation problem within the HLA-B*35 type, thereby improving the detection accuracy. Simultaneously, the detection method can also improve the detection specificity by using a primer-probe set that introduces base mismatches. Furthermore, the accuracy verification of this invention's embodiments confirms the reliability of the detection method provided in this invention.

[0098] The present invention will be further described below with reference to embodiments, but these embodiments do not constitute any limitation on the present invention.

[0099] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0100] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0101] Example 1

[0102] The kit consists of primer and probe sets, and qPCR enzyme premix (purchased from Aikerui Biotechnology Co., Ltd.).

[0103] The preparation process of the primer and probe set is as follows: Based on the mutation sites (rs1055348, rs697742, rs4997052, and rs3179865), primer and probe sets for the internal reference gene ACTB and the HLA-B*35:01 specific site were designed. Specifically, the first primer and probe set targets rs1055348, with the upstream primer's nucleotide sequence shown in SEQ ID NO:1 and the downstream primer's nucleotide sequence shown in SEQ ID NO:2; the probe is 5'-FAM-aagggcctctcgcatctcttactgc-BHQ1-3'. The second primer and probe set targets rs697742, rs4997052, and rs3179865, with the upstream primer's nucleotide sequence shown in SEQ ID NO:4 and the downstream primer's nucleotide sequence shown in SEQ ID NO:5'. As shown in NO:5, the probe is: 5'-ROX-cctccgcagtcatgaccggtc-BHQ2-3'; the third primer probe set targets the internal reference gene ACTB, and the nucleotide sequence of its upstream primer is shown in SEQ ID NO:7, and the nucleotide sequence of its downstream primer is shown in SEQ ID NO:8, with the probe being: 5'-VIC-acagatcatgtttgagaccttcaacaccc-BHQ1-3'). The primers and probes were synthesized by Universal Biosynthetic, and were dissolved in an appropriate amount of TE buffer according to the primer and probe synthesis instructions (information sheet provided by the manufacturer after synthesis). All primers and probes were directly prepared into 10 μM / L working solutions. Equal volumes of the prepared upstream and downstream primers and probes were mixed into one tube and labeled as the first primer probe set, the second primer probe set, and the third primer probe set (internal reference). When not in use, they were stored at -20℃ for future use.

[0104] Example 2

[0105] (21) Sample extraction: Eight clinical samples with known HLA-B types were selected, including one sample carrying the HLA-B*35:01 gene, one sample carrying the HLA-B*35:08 gene, one sample carrying the HLA-B*35:14 gene, and five samples of other types (sample information is shown in Table 3). DNA was extracted from the eight samples using the blood genomic DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA solution were determined using a Nanodrop2000 micro spectrophotometer from Thermo Fisher Scientific Co., Ltd. The DNA solution was stored at -20℃ for later use.

[0106] Table 3

[0107] Sample number genotype G002210001 B*35:01 B*40:01 G002210002 B*35:08 B*15:02 G002210003 B*35:14 B*46:01 G002210004 B*15:01 B*57:01 G002210005 B*39:01 B*54:01 G002210006 B*55:02 B*67:01 G002210007 B*46:01 B*55:02 G002210008 B*35:05 B*40:02

[0108] (22) Perform QPCR amplification reactions using the kit obtained in Example 1 and the DNA in step (21). The QPCR reaction system is shown in Table 1 (where Pro Taq HS Probe Premix is purchased from Aikrui Biotechnology Co., Ltd.), and the reaction program is shown in Table 2. When performing the amplification reaction, the two loci are done separately.

[0109] (23) Result analysis: The internal reference gene is used as quality control. Only when the amplification curve of the internal reference gene appears in each sample can it be shown that the sample quality is qualified. On the premise that the normal amplification curve of the internal reference gene appears, if the amplification curves also appear at the mutation sites rs105534 and the mutation sites rs697742, rs4997052, and rs3179865 of HLA-B*35:01, and the absolute value of the difference between the CT value of the target gene at the two groups of loci and the CT value of its internal reference gene, that is, △CT, is less than 4, then it is judged that the sample carries the HLA-B*35:01 allele. The detection results of 8 samples in this example are as Figure 1 and Figure 2 shown.

[0110] Specifically, Figure 1 is the FAM and VIC dual-channel real-time fluorescence amplification result diagram of 8 samples at rs1055348 (the locus amplified by the first primer-probe group). In the figure, the green curve is the fluorescence signal of the internal reference gene of 8 samples, that is, the VIC channel; the blue line is the fluorescence signal of the target gene of 8 samples, that is, the FAM channel. Through Figure 1 it can be seen that the amplification curves of the internal reference gene appear in all 8 samples at rs1055348, indicating that there is no abnormality in the samples and the experimental process; there is 1 rising blue curve, that is, the rs105534 positive sample, indicating that the sample carries the rs105534 mutant gene; the blue lines of other samples do not show obvious rise, indicating that no amplification curves appear in other samples, and these samples do not carry the rs105534 mutant gene.

[0111] Figure 2 is the ROX and VIC dual-channel real-time fluorescence amplification result diagram of 8 samples at rs697742, rs4997052, and rs3179865 (the locus amplified by the second primer-probe group). In the figure, the green curve is the fluorescence signal of the internal reference gene, that is, the VIC channel, and the orange curve is the fluorescence signal of the target gene, that is, the FAM channel. Through Figure 2As can be seen, the samples of rs697742, rs4997052, and rs3179865 all showed amplification curves for the internal reference gene, indicating that there were no abnormalities in the samples and the experimental process. The orange curves represent samples that are positive for rs697742, rs4997052, and rs3179865, indicating that these samples carry the rs697742, rs4997052, and rs3179865 mutant genes; other samples did not show amplification curves (the orange lines for other samples did not show a significant increase), indicating that they do not carry the rs697742, rs4997052, and rs3179865 mutant genes.

[0112] (15) Conclusion: Among the 8 samples, 1 sample was found to carry the mutated genes rs105534, rs697742, rs4997052 and rs3179865, which means that the sample carries the HLA-B*35:01 gene. The result is consistent with the actual situation, proving that the kit and detection method of the present invention can distinguish HLA-B*35:01 from HLA-B*35:08 and HLA-B*35:14.

[0113] Comparative Example

[0114] Based on the primers and probes described in patent application CN110358814A, a generic biosynthesis was commissioned, and the eight samples from Example 2 of this application were tested according to the reaction system and reaction procedure provided in patent application CN110358814A. The results are as follows: Figure 3 As shown. (Through) Figure 3 It can be seen that the primers and probes provided in patent application CN110358814A detected three samples carrying the HLA-B*35:01 gene. However, two of these samples were actually one carrying the HLA-B*35:08 gene and one carrying the HLA-B*35:14 gene. Therefore, the primers and probes provided in patent application CN110358814A cannot distinguish between HLA-B*35:01 and HLA-B*35:08 or HLA-B*35:14, which can easily lead to false positives.

[0115] Example 3

[0116] The accuracy of the detection method in Example 1 was verified.

[0117] (31) Sample extraction: Twenty-eight clinical samples with known HLA-B types were selected. Among them, 1 sample carried the HLA-B*35:01 gene, and 27 samples had other types (sample information is shown in Table 4). The blood genomic DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract DNA from the 28 samples. The concentration and purity of the extracted DNA solution were measured using a micro-spectrophotometer (Nanodrop2000) from Thermo Fisher Scientific Inc. The DNA solution was stored at -20°C for later use.

[0118] Table 4

[0119]

[0120]

[0121] Note: The sample numbers in Table 3 and Table 4 are independent of each other and are for different experimental samples.

[0122] (32) Perform QPCR amplification reaction using the kit obtained in Example 1 and the DNA in step (31). The QPCR reaction system is shown in Table 1, and the reaction program is shown in Table 2. During the amplification reaction, the two loci are done separately.

[0123] (33) Result analysis: The internal reference gene is used as quality control. Only when the amplification curve of the internal reference gene appears for each sample can it be shown that the sample quality is qualified. On the premise that the normal amplification curve of the internal reference gene appears, if the amplification curves also appear for HLA-B*35:01 at the mutation sites rs105534 and the mutation sites rs697742, rs4997052, and rs3179865, and the absolute value of the difference between the CT value of the target gene at the two groups of loci and the CT value of its internal reference gene, that is, △CT, is less than 4, then it is determined that the sample carries the HLA-B*35:01 allele. The detection results of the 28 samples in this example are as <00..​​​​​​​​​​​​As can be seen, all samples from the second group of loci showed amplification curves for the internal reference gene, indicating that there were no abnormalities in the samples and the experimental process. The orange curves represent samples that were positive for rs697742, rs4997052, and rs3179865, indicating that these samples carried the rs697742, rs4997052, and rs3179865 mutant genes; other samples did not show amplification curves (the orange lines for other samples did not show a significant increase), indicating that they did not carry the rs697742, rs4997052, and rs3179865 mutant genes.

[0126] Conclusion: Among the 28 samples, one sample was found to carry the mutated genes rs105534, rs697742, rs4997052 and rs3179865, indicating that the sample carried the HLA-B*35:01 gene, which is consistent with the actual situation.

[0127] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A primer-probe set, characterized in that, The primer-probe set consists of a first primer-probe set and a second primer-probe set. The first primer-probe set consists of a first upstream primer as shown in SEQ ID NO: 1, a first downstream primer as shown in SEQ ID NO: 2, and a first probe as shown in SEQ ID NO:

3. The second primer-probe set consists of a second upstream primer as shown in SEQ ID NO: 4, a second downstream primer as shown in SEQ ID NO: 5, and a second probe as shown in SEQ ID NO:

6.

2. The primer-probe set according to claim 1, characterized in that, The first probe and / or the second probe are Taqman probes.

3. The primer-probe set according to claim 2, characterized in that, The first probe and the second probe are labeled with different fluorescent groups at their 5' ends and different quenching groups at their 3' ends.

4. The primer-probe set according to claim 3, characterized in that, The fluorescent group is selected from FAM, ROX, and CY5, and the quenching group is selected from BHQ1 and BHQ2.

5. A primer-probe set, characterized in that, The primer and probe set comprises a first primer and probe set, a second primer and probe set, and a third primer and probe set for specific detection of the internal reference gene ACTB. The first primer and probe set comprises a first upstream primer as shown in SEQ ID NO: 1, a first downstream primer as shown in SEQ ID NO: 2, and a first probe as shown in SEQ ID NO:

3. The second primer and probe set comprises a second upstream primer as shown in SEQ ID NO: 4, a second downstream primer as shown in SEQ ID NO: 5, and a second probe as shown in SEQ ID NO:

6. The third primer and probe set comprises a third upstream primer as shown in SEQ ID NO: 7, a third downstream primer as shown in SEQ ID NO: 8, and a third probe as shown in SEQ ID NO:

9.

6. The primer-probe set according to claim 5, characterized in that, The third probe has a fluorescent group labeled at its 5' end and a quenching group labeled at its 3' end.

7. The primer-probe set according to claim 6, characterized in that, The fluorescent group is VIC, and the quenching group is BHQ1 or BHQ2.

8. Use of the primer-probe set according to any one of claims 1-7 in the preparation of a kit for detecting the HLA-B*35:01 allele.

9. A reagent kit, characterized in that, It comprises the primer and probe set according to any one of claims 1-7.

10. The reagent kit according to claim 9, characterized in that, The kit also includes a positive control, a negative control, and water.

Citation Information

Patent Citations

  • Method for detecting HLA-B*35:01 gene, specific primer set and kit

    CN110358814A

  • Risk assessment for cutaneous adverse drug reactions from antiretroviral agent

    WO2010067900A1