Controlled rice heading date gene ehd5, its encoded protein and application
By cloning the rice heading date gene EHD5 and its encoded protein, the heading date of rice can be adjusted using transgenic or traditional hybridization methods. This solves the problems of regional adaptability and genetic diversity of rice varieties, achieves precise control over the heading date of rice, and provides a choice of rice varieties that head early or late.
Patent Information
- Application Number
- CN202211592738.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-13
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2042-12-13
AI Technical Summary
Existing technologies are insufficient to effectively regulate the heading stage of rice, which affects the regional adaptability and genetic diversity of rice varieties.
By cloning the rice heading date gene EHD5 and its encoded protein, the heading date of rice can be adjusted using transgenic or traditional hybridization methods, including the application of the mutant gene ehd5 and the introduction of functional defective genotypes, to achieve regulation of the rice heading date.
It enables precise control of the heading period of rice, expands the regional adaptability and genetic diversity of rice varieties, and provides a choice of rice varieties that head early or late, adapting to different climatic conditions.
Smart Images

Figure HDA0003995387610000011 
Figure HDA0003995387610000012 
Figure HDA0003995387610000013
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of genetic engineering, and particularly relates to a gene EHD5 for controlling heading date of rice and an encoded protein and application thereof. BACKGROUND
[0002] With the increasing world population, food security has become a great challenge for mankind. Rice is one of the most important cereal crops in the world, and feeds more than half of the world's population. Flowering (heading in rice) is an important sign of the conversion of higher plants from vegetative growth to reproductive growth, and is an important agronomic trait for determining regional and seasonal adaptability (Srikanth, A. and Schmid, M. (2011) Cell Mol. Life Sci. 68(12): 2013-2037). Global warming and natural disasters make it particularly important to breed varieties that are resistant to environmental fluctuations and adverse climates.
[0003] With the deepening understanding of the flowering mechanism, plant scientists have established a relatively complete network system for the heading date of rice, which is roughly divided into two pathways: one is the OsGI-Hd1-Hd3a (rice GIGATEA-Heading date 1-Heading date 3a) pathway homologous to GI-CO-FT (GIGATEA-CONSTANS-FLOWERING LOCUS T) in Arabidopsis thaliana (Kojima, S. et al. (2002) Plant Cell Physiol. 43(10): 1096-1105; Yano, M. et al. (2000) Plant Cell 12(12): 2473-2484), and the other is the Ehd1-centered pathway specific to monocotyledonous plants (Doi, K. et al. (2004) Genes Dev. 18(8): 926-936). Both pathways will affect the formation of florigen (Hd3a and RFT1). Florigen is produced from leaves, moves to the apical meristem through the sieve tube, and thus promotes the transition to flowering (Tsuji, H. et al. (2011) Curr. Opin. Plant Biol. 14(1): 45-52).
[0004] Research on genes related to heading date is of great significance for expanding the regional adaptability of rice varieties and improving the genetic diversity of hybrid rice. SUMMARY
[0005] The present application discloses a gene EHD5 for controlling heading date of rice and an encoded protein and application thereof.
[0006] The object of the present application can be achieved by the following technical solutions:
[0007] The application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0008] The application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0009] The application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0010] The application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0011] The application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0012] The application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0013] The application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0014] The application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0015] (1) the application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0016] (2) the application discloses a rice heading stage control gene EHD5, and the gene sequence is shown as SEQ ID NO. 1, and the gene encodes an RNA binding protein, and the amino acid sequence is shown as SEQ ID NO. 3.
[0017] (3) The phenotype of ehd5 heading slightly later than wild type is stable under long and short day length, so the mutant gene ehd5 can be introduced into conventional varieties by hybridization or transgenic editing methods.
[0018] (4) The heading time of rice can be adjusted by the gene of the application, thereby adjusting the regional adaptability of rice varieties, obtaining rice varieties with different growth periods in different regions, and providing technical support for expanding the genetic diversity of hybrid rice seed production. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 Statistical chart of the phenotype of wild type Dongjin and mutant ehd5 and the heading time under long and short day length.
[0020] Figure 2 MutMap analysis of EHD5.
[0021] Figure 3 Gene structure of EHD5.
[0022] Figure 4 Transgenic knockout phenotype.
[0023] Figure 5 Transgenic fusion complementation phenotype. DETAILED DESCRIPTION
[0024] The following examples facilitate a better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods, unless otherwise specified. In the following examples, the test materials used are commercially available from conventional biochemical reagent stores, unless otherwise specified.
[0025] Example 1, Molecular cloning of rice RNA binding protein mutant gene
[0026] 1. Positioning of mutant gene ehd5 site
[0027] The rice late heading mutant ehd5 (SEQ ID NO: 1) was crossed with the wild type rice variety Dongjin, and the F1 and F2 populations obtained were subjected to genetic analysis, and the results showed that the late heading phenotype of ehd5 was controlled by a recessive single gene. Early and late extreme 30 plants were selected from the F2 population, and DNA pools of the two extremes were constructed and sent to the company for second-generation sequencing. After sequencing, MutMap pipeline (Fekih, R. et al. (2013) Plos One 8(7): e68529) was used for analysis, and it was associated to chromosome 2 (SEQ ID NO: 2). Figure 1 Figure 2 The method for extracting DNA from the early and late extreme pools is as follows:
[0028] The method for extracting DNA from the early and late extreme pools is as follows:
[0029] a) Cut 0.1 g from each of the early and late extreme plants in F2 population, and construct two mixed pools for early and late, respectively. Grind the leaves in a mortar with liquid nitrogen thoroughly.
[0030] b) Add 10 ml CTAB extraction solution, and incubate the sample in a 65°C water bath for 30 min, and invert it every 10 min to ensure thorough mixing.
[0031] c) Add an equal amount of chloroform: isopropyl alcohol (24: 1), invert and mix, and stand for 3 min.
[0032] d) Centrifuge at 12000 rpm for 10 min.
[0033] e) Carefully pipette 6 ml of supernatant into a new centrifuge tube, and add 0.7 times the volume of isopropanol to the supernatant, mix, and place in a -20°C refrigerator.
[0034] f) After freezing for 4 hours, centrifuge at 12000 rpm for 10 min (4°C), and carefully discard the supernatant.
[0035] g) Wash the precipitate with 70% ethanol twice, and dry the precipitate in the fume hood. Dissolve the DNA precipitate in 500 μL of deionized water, and store at -20°C for later use.
[0036] 2. Cloning of the target gene
[0037] Using the Rice Genome Annotation project Rice Genome Browser-Release 7 website to predict within the correlation interval, it was found that one of the ORFs had a base substitution, i.e., the wild-type gene shown in SEQ ID NO. 1 was changed to the mutant gene shown in SEQ ID NO. 2, resulting in a cysteine to stop codon, and the encoded amino acid sequence was changed from SEQ ID NO. 3 to SEQ ID NO. 4.
[0038] 3. Sequence analysis of the wild-type EHD5 gene
[0039] The sequence of the wild-type EHD5 gene is shown in SEQ ID NO. 1, which encodes 1001 amino acids and contains 3 RNA recognition motifs. By searching the rice genome database, it was found that EHD5 is composed of 14 exons and 14 introns. Figure 3 ).
[0040] Example 2. Obtaining and identifying transgenic knockout and fusion complementation plants
[0041] 1. Construction of expression vector
[0042] a) The knockout primer of the candidate gene EHD5 was designed using CRISPR-P online website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), and the primer sequence was as follows:
[0043] CRISPR-F: 5' GGCACATCTCAGGTCATGGATCAG 3'
[0044] CRISPR-R: 5' AAACCTGATCCATGACCTGAGATG 3'
[0045] Two primers (10 μM) were mixed and incubated at 95 °C for 5 min to form dimer adapter, and the ligation system was as follows: 10x Buf: 1 μl, 50x oligo: 0.2 μl, ATP (10 mM): 1 μl, pCAMBIA 1305.1 (80 ng / μl): 1 μl, dimer adapter: 1 μl, Aar I: 0.2 μl, T4 ligase: 0.1 μl, water: 5.5 μl. The above ligation system was connected in a PCR instrument: 37 °C for 5 min, 20 °C for 5 min, 10 cycles, 4 °C for 5 min.
[0046] b) The promoter and CDS of EHD5 gene were obtained by PCR amplification using wild-type DNA and cDNA as templates, respectively, and the pCAMBIA1390 complementary vector was constructed, and the PCR primer sequences were as follows:
[0047] Pro-F:
[0048] 5' CCGGCGCGCCAAGCTTGGACCTTCCCTGCTTACTGT 3'
[0049] Pro-R:
[0050] 5' CATGACCTGAGATGGCATCCTGCAAGCGCATAGCCATGG 3'
[0051] CDS-F:
[0052] 5' CCATGGCTATGCGCTTGCAGGATGCCATCTCAGGTCATG 3'
[0053] CDS-R:
[0054] 5' ATCCGTCGACCTGCAGTCAGTCCTTGGCAGGCCCTG 3'
[0055] The PCR product amplified by the primers above was purified and recovered, and then recombined with the corresponding linearized vector (pCUBI1390). The recombination system: DNA fragment 1 (amplified promoter): 2 μL, DNA fragment 2 (amplified CDS): 2 μL, linear vector 1 μL, 2x Buf (ABclonal): 5 μL. The above recombination system was reacted at 50°C for 20 min.
[0056] c) Vector transformation step:
[0057] ①The ligation or recombination product was transferred to 100 μL of E. coli competent cells (DH5a) and mixed by blowing, and then incubated in an ice bath for 30 min. Then, heat shock at 42°C for 90 s in a water bath, and then placed on ice for 5 min.
[0058] ②700 μL of E. coli culture medium was added and incubated at 37°C for 1 h.
[0059] ③Spread on a plate containing kanamycin, and incubate in a 37°C incubator for 16 h.
[0060] ④Pick single colony strains for sequencing, and extract plasmids after sequencing is correct.
[0061] ⑤Use liquid nitrogen quick-freezing method to transfer the knockout vector and fusion complementary vector into Agrobacterium EHA105, respectively.
[0062] 2. Agrobacterium-mediated transformation to obtain transgenic plants
[0063] The knockout vector and fusion complementary expression vector constructed above were introduced into wild type variety Nipponbare and ehd5 mutant, respectively, using Agrobacterium EHA105 as a mediator
[0064] 1. Infection of callus
[0065] a) Incubate the knockout strain and fusion complementary strain at 28°C for 16 h, collect the bacterial cells, and dilute to N6 liquid medium (Sigma) to a concentration of OD600≈0.5 to obtain a bacterial solution;
[0066] b) Mix the corresponding mature embryo callus cultured for one month with the bacterial solution above for half an hour, and then transfer to N6 solid co-culture medium (Sigma) after absorbing the bacterial solution with sterile filter paper, and incubate at 24°C for 3 days;
[0067] c) Transfer the infected callus to N6 solid medium containing 150 mg / L hygromycin B (sigma) for the first screening for 15 days;
[0068] d) Pick healthy callus and use N6 solid medium containing 200 mg / L hygromycin B (sigma) for the second screening for 15 days, and subculture every 15 days.
[0069] e) picking the resistant calli and placing them on differentiation medium with 150 mg / L hygromycin B for differentiation.
[0070] 2. Identification of transgenic plants:
[0071] Identification of transgenic knockout plants:
[0072] The amplification primers (primer CR-de-F: 5' GATCCGGTGGAATCTAGTTG 3', CR-de-R: 5' GGTAATGACTCCTGCTTCCA 3') were designed near 300 bp upstream and downstream of the knockout target, and the transgenic plant DNA was extracted for amplification, and the editing mode was analyzed by sequencing. The T1 generation genotype and the heading stage phenotype co-segregation experiment analysis confirmed that the late heading trait after transgenic was caused by ehd5 ( Figure 4 ).
[0073] Identification of functional complementation plants: the transgenic plants of wild type RNA binding protein EHD5, T0 generation were detected by PCR (primer COM-de-F: 5' AGAGTGTCGTGCTCCACCAT 3', COM-de-R: 5'
[0074] GCACGCAGAATGAGAGAGCT 3'), T1 generation genotype and the heading stage phenotype co-segregation confirmed that after the introduction of wild type EHD5, the ehd5 mutant would restore from late heading to early heading, that is, the late heading phenotype before transgenic was caused by ehd5 ( Figure 5 ).
[0075] The mutant gene is introduced into wild type material by traditional hybridization or transgenic editing method, and ehd5 homozygous genotype is obtained, and the material with late heading than wild type can be used for directional regulation of heading stage of the variety.
[0076] The present application relates to the following well-known public varieties:
[0077] Dongjin (well-known public variety, japonica rice variety)
[0078] ehd5 late heading mutant (obtained by tissue culture mutagenesis of japonica rice variety Dongjin) ; Nipponbare (well-known public variety, japonica rice variety).
Claims
1. A gene represented by SEQ ID NO. 1 EHD5 or a transgenic vector comprising the gene represented by SEQ ID NO. 1 EHD5 for use in breeding early heading rice varieties, characterized in that, Specifically, the gene shown in SEQ ID NO. 1 EHD5 into the rice variety to be improved.
Citation Information
Patent Citations
Method for controlling grain size and grain weight
CN115135142A