A genetically engineered bacterium for fermentation production of cytidine diphosphate choline and its application
By overexpressing Cct, Cki, Hnm1, and sATP6 proteins in Pichia pastoris and downregulating the expression of related proteins, the fermentation conditions were optimized, solving the problems of low conversion rate and high cost in the production of citicoline and realizing efficient and low-cost industrial production.
Patent Information
- Application Number
- CN202110949063.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-08-18
- Publication Date
- 2026-03-06
- Estimated Expiration
- 2041-08-18
AI Technical Summary
Existing methods for producing cytidine diphosphate choline suffer from low conversion rates, high costs, and complex processes, making it difficult to meet the demands of large-scale industrial production.
By overexpressing Cct, Cki, Hnm1, and sATP6 proteins in Pichia pastoris and downregulating the expression or activity of His4, Ku70, 5'-NT, and Cda proteins, and using phosphocholine and CMP as substrates, fermentation conditions were optimized to improve the yield and productivity of cytidine diphosphate choline.
This technology enables efficient and low-cost production of citicoline, improves substrate conversion, and provides a new approach for industrial production.
Smart Images

Figure BDA0003217753300000091 
Figure BDA0003217753300000111 
Figure BDA0003217753300000121
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and more specifically, this invention relates to genetically engineered bacteria for the fermentation production of cytidine diphosphate choline and its applications. Background Technology
[0002] Cytidine diphosphate choline (CDP-choline) is an important intermediate product in lecithin biosynthesis. Lecithin is a crucial component of cell membranes, and its normal metabolism directly affects many biological functions, including cell permeability, energy metabolism, and protein biosynthesis. CDP-choline is an important nucleic acid drug and a first-line treatment for brain diseases. It possesses neurorepair, neuroprotective, and neurotransmitter-promoting effects and is currently used to treat stroke, Parkinson's disease, Alzheimer's disease, and vascular dementia.
[0003] Currently, the main methods for producing cytidine diphosphate choline are chemical synthesis and biosynthesis. Chemical methods were primarily used in early industrial processes, but these methods use various toxic organic reagents, have low conversion rates, and are unsuitable for large-scale production.
[0004] With the development of biotechnology, researchers can now use genetic engineering to modify microorganisms to meet people's needs. There is also some research on biosynthesis methods for citicoline in this field. Kyowa Hakko Co., Ltd. of Japan has developed a dual-strain fermentation method, using genetically engineered bacteria such as *Escherichia coli* and *Corynebacterium ammoniagenes* to produce citicoline, but the fermentation process is relatively complex. Enzymatic conversion utilizes enzyme systems in waste beer sludge for reaction; this is currently the method used for industrial synthesis of citicoline. Industrially, citicoline is mainly produced by adding cytidine monophosphate (CMP) and phosphocholine as substrates, but the substrate's membrane penetration efficiency is low, and citicoline can only be synthesized through permeabilization of cells or enzymatic reactions.
[0005] Currently, in industry, there is also a method of producing cytidine diphosphate choline by adding CMP and phosphocholine as substrates using beer sludge, but this method has a complex production process and high cost.
[0006] Due to the wide range of applications of cytidine diphosphate choline, its market demand is gradually expanding, with a significant demand gap. To address the low yield of cytidine diphosphate choline synthesized by live-cell fermentation, further modification of strains is needed to improve the yield and efficiency of cytidine diphosphate choline synthesis in Pichia pastoris, thereby enhancing the industrial application of cytidine diphosphate choline synthesis through live-cell fermentation.
[0007] Therefore, how to produce citicoline efficiently, with high quality and low cost is an urgent problem to be solved in this field. Summary of the Invention
[0008] The purpose of this invention is to provide a genetically engineered bacterium for fermentation production of cytidine diphosphate choline and its application.
[0009] In a first aspect of the invention, a method for producing citicoline is provided, the method comprising: (1) providing engineered yeast strains transformed with expression cassettes of the following proteins: Cct protein, Cki protein, Hnm1 protein, sATP6 protein; preferably, the engineered yeast strains further downregulated with proteins selected from the following group: His4 protein, 5'-NT protein, Cda protein, Ku70 protein, Shble protein, or combinations thereof; (2) culturing the engineered yeast strains of (1) thereby generating the citicoline product.
[0010] In one or more embodiments, the downregulation includes downregulating the expression of the protein or downregulating the activity of the protein; preferably, the downregulation includes (but is not limited to): knocking out or silencing the gene encoding the protein in engineered bacteria, or inhibiting the activity of the protein (e.g., by using an antibody or interacting substance of the protein).
[0011] In one or more embodiments, knocking out or silencing the coding gene of the protein in engineered bacteria includes: knocking out the coding gene by homologous recombination; knocking out the coding gene by gene editing using a CRISPR system; silencing the coding gene by interfering molecules that specifically interfere with the expression of the coding gene; performing a loss-of-function mutation on the coding gene in engineered bacteria containing the coding gene; or inhibiting it with a chemical inhibitor that specifically inhibits the signaling pathways in which the coding gene participates.
[0012] In one or more embodiments, (1) the Cct protein is derived from Pichia pastoris, the Cki protein and Hnm1 protein are derived from Saccharomyces cerevisiae BY4742, and the sATP6 protein is derived from Arabidopsis thaliana.
[0013] In one or more embodiments, (1) the expression cassette further includes a promoter, the promoter including (but not limited to): a constitutive promoter or a methanol-inducible promoter; preferably, the constitutive promoter includes (but is not limited to) a GAP promoter; preferably, the methanol-inducible promoter includes (but is not limited to) an AOX1 promoter.
[0014] In one or more embodiments, the transformed gene is a foreign gene.
[0015] In one or more embodiments, codon optimization and gene synthesis are performed in Pichia pastoris.
[0016] In one or more embodiments, the gene encoding the Cct protein (CCT gene) has the nucleotide sequence shown in SEQ ID NO:1, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:1.
[0017] In one or more embodiments, the gene encoding the Cki protein (CKI gene) has the nucleotide sequence shown in SEQ ID NO:2, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:2.
[0018] In one or more embodiments, the gene encoding the Hnm1 protein (HNM1 gene) has the nucleotide sequence shown in SEQ ID NO:3, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:3.
[0019] In one or more embodiments, the gene encoding the sATP6 protein (sATP6 gene) has the nucleotide sequence shown in SEQ ID NO:4, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:4.
[0020] In one or more embodiments, the gene encoding the His4 protein (HIS4 gene) has the nucleotide sequence shown in SEQ ID NO:5, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:5.
[0021] In one or more embodiments, the gene encoding the Ku70 protein (KU70 gene) has the nucleotide sequence shown in SEQ ID NO:6, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:6.
[0022] In one or more embodiments, the gene encoding the Shble protein (Shble gene) has the nucleotide sequence shown in SEQ ID NO:7, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:7.
[0023] In one or more embodiments, the gene encoding the 5'-NT protein (5'-NT gene) has the nucleotide sequence shown in SEQ ID NO:8, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:8.
[0024] In one or more embodiments, the gene encoding the Cda protein (CDA gene) has the nucleotide sequence shown in SEQ ID NO:9, or its degenerate sequence, or a nucleotide sequence encoding a functional protein that is 70% or more (preferably 80% or more; more preferably 90% or more; more preferably 93% or more; more preferably 95% or more; more preferably 97% or more) identical to the sequence in SEQ ID NO:9.
[0025] In one or more embodiments, in (2), phosphocholine and CMP are used as substrates.
[0026] In one or more embodiments, in (2), the culture medium used to cultivate engineered yeast includes (but is not limited to): YPD, YPG, YPM culture medium, or combinations thereof.
[0027] In one or more embodiments, in (2), phosphocholine and CMP are used as substrates: wherein the CMP concentration is 5 to 50 g / L (e.g., 8, 15, 20, 25, 30, 35, 40 g / L); preferably 10 to 30 g / L; more preferably 15 to 25 g / L (e.g., preferably 18 g / L or 23 g / L); or, wherein the phosphocholine concentration is 2 to 30 g / L (e.g., 3, 5, 6, 8, 10, 12, 15, 18, 20, 25 g / L); preferably 3 to 25 g / L; more preferably 12 to 20 g / L (e.g., preferably 15 g / L).
[0028] In one or more embodiments, the culture medium further includes magnesium ions; preferably MgSO4; preferably the concentration of MgSO4 is 1 to 10 g / L, more preferably 2 to 6 g / L; such as 3, 4, 5, 7, 8, or 9 g / L.
[0029] In one or more embodiments, the culture medium further includes citrate; preferably sodium citrate; preferably, the concentration of sodium citrate is 2 to 20 g / L, more preferably 2 to 15 g / L; such as 3, 4, 5, 7, 8, 9, 10, or 12 g / L.
[0030] In one or more embodiments, the culture medium includes a phosphate buffer pair with a pH of 7.5 ± 0.2.
[0031] In another aspect of the invention, the use of a regulatory substance in the preparation of or enhancement of the production of citicoline, wherein the citicoline is produced by engineered yeast; the regulatory substance comprises encoding genes or expression cassettes of the following proteins: Cct protein, Cki protein, Hnm1 protein, sATP6 protein; preferably, the regulatory substance further comprises downregulators of proteins selected from the following group in engineered yeast: His4 protein, 5'-NT protein, Cda protein, Ku70 protein, Shble protein, or combinations thereof.
[0032] In one or more embodiments, the downregulator comprises: a reagent that knocks out or silences the coding gene of the protein, or a reagent that inhibits the activity of the protein; preferably, the downregulator comprises: a homologous recombination reagent or site-directed mutagenesis reagent targeting the coding gene of the protein, the reagent performing a loss-of-function mutation on the coding gene, a CRISPR gene editing reagent, an interfering molecule that specifically interferes with the expression of the coding gene of the protein, or a chemical inhibitor that specifically inhibits the signaling pathways involved by the protein.
[0033] In another aspect of the invention, a yeast strain for producing cytidine diphosphate choline is provided, the yeast strain containing expression cassettes of the following proteins: Cct protein, Cki protein, Hnm1 protein, and sATP6 protein.
[0034] In one or more embodiments, proteins selected from the group consisting of His4 protein, 5'-NT protein, Cda protein, Ku70 protein, Shble protein, or combinations thereof are downregulated in the engineered yeast strain.
[0035] In one or more embodiments, the engineered yeast strain for producing cytidine diphosphate choline contains expression cassettes for the following histones: Cct protein, Cki protein, Hnm1 protein, sATP6 protein, and the His4 protein-coding gene is knocked out in the strain.
[0036] In one or more embodiments, the engineered yeast strain for producing cytidine diphosphate choline contains expression cassettes for the following histones: Cct protein, Cki protein, Hnm1 protein, and sATP6 protein, and the His4 and 5'-NT protein coding genes are knocked out in the strain.
[0037] In one or more embodiments, the engineered yeast strain for producing cytidine diphosphate choline contains expression cassettes for the following histones: Cct protein, Cki protein, Hnm1 protein, and sATP6 protein, and the His4 and Cda protein encoding genes are knocked out in the strain.
[0038] In one or more embodiments, the engineered yeast strain is Pichia pastoris.
[0039] In one or more embodiments, the Pichia pastoris is Pichia pastoris GS115.
[0040] In another aspect of the invention, a kit for producing cytidine diphosphate choline is provided, the kit comprising any of the yeast engineering methods described above.
[0041] In one or more embodiments, the kit further includes a component selected from the group consisting of a substrate, preferably including phosphocholine and CMP.
[0042] In one or more embodiments, the kit further includes a component selected from the group consisting of yeast culture medium, preferably including (but not limited to): YPD, YPG, YPM culture medium, or combinations thereof.
[0043] In one or more embodiments, the substrates in the kit are phosphocholine and CMP, which are added to a yeast culture medium; wherein the CMP concentration is 5–50 g / L (e.g., 8, 15, 20, 25, 30, 35, 40 g / L); preferably 10–30 g / L; more preferably 15–25 g / L (e.g., preferably 18 g / L or 23 g / L); and / or, wherein the phosphocholine concentration is 2–30 g / L (e.g., 3, 5, 6, 8, 10, 12, 15, 18, 20, 25 g / L); preferably 3–25 g / L; more preferably 12–20 g / L (e.g., preferably 15 g / L).
[0044] In one or more embodiments, the culture medium in the kit further includes magnesium ions; preferably MgSO4; preferably the concentration of MgSO4 is 1-10 g / L, more preferably 2-6 g / L; such as 3, 4, 5, 7, 8, 9 g / L.
[0045] In one or more embodiments, the culture medium in the kit further includes citrate; preferably sodium citrate; preferably, the concentration of sodium citrate is 2 to 20 g / L, more preferably 2 to 15 g / L; such as 3, 4, 5, 7, 8, 9, 10, or 12 g / L.
[0046] In one or more embodiments, the culture medium in the kit comprises a phosphate buffer pair with a pH of 7.5 ± 0.2.
[0047] In one or more embodiments, the engineered yeast and other components are placed in containers.
[0048] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description
[0049] Figure 1 A represents the cytidine diphosphate choline (CMP) production of the GS-sATP6-CKH, GS-sATP6-CKH-Δhis4, GS-sATP6-CKH-Δhis4Δku70, and GS-sATP6-CKH-Δhis4Δku70Δshble strains at different fermentation time points; B represents the CMP conversion rate of the GS-sATP6-CKH, GS-sATP6-CKH-Δhis4, GS-sATP6-CKH-Δhis4Δku70, and GS-sATP6-CKH-Δhis4Δku70Δshble strains at different fermentation time points.
[0050] Figure 2Optimization of CMP concentration for strain GS-sATP6-CKH-Δhis4Δku70Δshble. A represents the cytidine diphosphate choline (CMP) yield of the strain under different CMP concentrations; B represents the conversion efficiency of the strain to CMP substrate under different CMP concentrations; C represents the dry weight of the strain under different CMP concentrations; and D represents the CMP yield per cell of the strain under different CMP concentrations.
[0051] Figure 3 A represents the cytidine diphosphate choline (CMP) production of the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT and GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strains at different fermentation time points; B represents the CMP conversion rate of the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT and GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strains at different fermentation time points.
[0052] Figure 4 Optimization of phosphoric acid choline concentration in strain GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT. A represents the cytidine diphosphate choline (CMP) yield of the strain under different phosphoric acid choline concentrations; B represents the conversion rate of the strain to substrate CMP under different phosphoric acid choline concentrations; C represents the conversion rate of the strain to substrate phosphoric acid choline under different phosphoric acid choline concentrations.
[0053] Figure 5 Optimization of CMP concentration for strain GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT. A represents the cytidine diphosphate choline yield of the strain under different CMP concentrations; B represents the conversion rate of the strain to the substrate CMP under different CMP concentrations; C represents the conversion rate of the strain to the substrate phosphocholine under different CMP concentrations.
[0054] Figure 6 Optimization of phosphoric acid choline concentration in strain GS-sATP6-CKH-Δhis4Δku70Δsh bleΔcda. A represents the cytidine diphosphate choline (CMP) yield of the strain under different phosphoric acid choline concentrations; B represents the conversion rate of the strain to substrate CMP under different phosphoric acid choline concentrations; C represents the conversion rate of the strain to substrate phosphoric acid choline under different phosphoric acid choline concentrations.
[0055] Figure 7Optimization of CMP concentration for strain GS-sATP6-CKH-Δhis4Δku70Δsh bleΔcda. A represents the cytidine diphosphate choline yield of the strain under different CMP concentrations; B represents the conversion rate of the strain to the substrate CMP under different CMP concentrations; C represents the conversion rate of the strain to the substrate phosphocholine under different CMP concentrations. Detailed Implementation
[0056] Based on in-depth research, the inventors have disclosed an optimized genetically engineered strain for producing cytidine diphosphate choline (CDP-choline), its construction method, and a method for production using the strain. In this invention, Cct, Cki, Hnm1, and sATP6 proteins are overexpressed in engineered yeast strains using gene recombination technology. More preferably, the expression or activity of His4, Ku70, Shble, 5'-NT, and / or Cda proteins is downregulated to obtain an engineered yeast strain capable of producing CDP-choline. The engineered yeast strain described in this invention has characteristics such as low metabolic background, strong heterologous expression ability, and the ability to utilize phosphocholine and CMP (5'-CMP) as substrates for high-level fermentation production of CDP-choline with high substrate conversion rates, providing a new approach for the industrial production of CDP-choline. Simultaneously, this invention also optimizes the fermentation production system using the engineered strain, providing a fermentation method for high-yield CDP-choline production.
[0057] the term
[0058] As used herein, “regulatory substances” include substances that upregulate the expression / activity of target proteins / genes or substances that downregulate the expression / activity of target proteins / genes.
[0059] As used herein, an "expression cassette" or "gene expression cassette" refers to a gene expression system containing all the necessary elements required to express a target polypeptide, typically including the following elements: a promoter, a gene sequence encoding the polypeptide, and a terminator; additionally, it may optionally include a signal peptide encoding sequence, etc.; these elements are operatively linked.
[0060] As used herein, “operationally linked” or “operationally connected” refers to a functional spatial arrangement of two or more nucleic acid regions or sequences. For example, a promoter region is placed at a specific position relative to the nucleic acid sequence of a target gene, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby “operationally linked” to the nucleic acid sequence.
[0061] As used herein, an "expression construct" refers to a recombinant DNA molecule containing the intended nucleic acid coding sequence, which may contain one or more gene expression cassettes. These "constructs" are typically contained within an expression vector.
[0062] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) from different sources and a host cell. For example, if the combination of nucleic acid and host cell is not normally naturally occurring, then the nucleic acid is exogenous to that host cell. A particular sequence is "exogenous" to the cell or organism in which it is inserted.
[0063] As used herein, "downregulation," "inhibition," "weakening," or "reduction" refers to a statistically significant "downregulation," "inhibition," "weakening," or "reduction." This includes, for example, a significant "downregulation," "inhibition," "weakening," or "reduction" compared to the control group; more specifically, an inhibition of 20% or more, a better 50% or more, or an even better 80% or more.
[0064] As used herein, the term "downregulator" includes inhibitors, antagonists, blockers, and other similar terms, which are used interchangeably.
[0065] As used herein, the term "downregulator" includes downregulation at both the protein level and the gene / transcription level.
[0066] Target genes and their regulation
[0067] In this invention, expression cassettes of Cct, Cki, Hnm1, and sATP6 proteins were introduced into engineered yeast strains. Cki protein catalyzes the synthesis of phosphoric acid from choline chloride, while Hnm1 protein promotes the transport of choline chloride and phosphoric acid into yeast cells. Cct protein, with the participation of magnesium ions, can further catalyze the synthesis of cytidine diphosphate choline from phosphoric acid and CMP.
[0068] During their research, the inventors discovered that, in addition to the significant impact of enzyme expression levels on product synthesis, energy supply is also crucial for the synthesis of citicoline. The synthesis of one molecule of citicoline requires the consumption of three molecules of ATP; therefore, increasing intracellular ATP supply can promote the synthesis of citicoline. ATP regulation is an effective strategy for enhancing the synthesis of energy-consuming products. ATP is mainly produced through glycolysis, the tricarboxylic acid cycle, and the oxidative respiratory chain; therefore, ATP synthesis can be increased by increasing the flux of the tricarboxylic acid cycle and the oxidative respiratory chain. As an intermediate product of the tricarboxylic acid cycle, the addition of citrate can increase the flux of the tricarboxylic acid cycle, thereby enhancing ATP synthesis. The F1F0-ATPase complex on mitochondria is the main enzyme in the oxidative respiratory electron transport chain for ATP synthesis. Overexpression of MtATP6, a subunit of the mitochondrial F1F0-ATPase complex, can increase intracellular ATP levels.
[0069] Furthermore, the inventors have also focused on reducing the loss of substrate CMP, improving the utilization efficiency of substrate CMP, and thus enhancing the biosynthesis of citicoline. Through extensive research, the inventors discovered that downregulation of one or more target proteins is beneficial in reducing CMP loss. The inventors found that downregulation of the protein encoded by the PAS_chr1-3_0130 gene in yeast (named 5'-nucleotidases) is beneficial in reducing substrate CMP loss. The inventors also discovered that cytidine deaminase (Cda) can catalyze the conversion of cytidine to uridine. Therefore, downregulation of 5'-NT and Cda can reduce substrate CMP loss, improve substrate CMP utilization efficiency, and thus enhance the biosynthesis of citicoline.
[0070] Gene / protein upregulation
[0071] In this invention, the efficient production of cytidine diphosphate choline in engineered yeast is achieved by introducing (converting) expression cassettes of the following histones into engineered yeast: Cct protein, Cki protein, Hnm1 protein, and sATP6 protein; more preferably, by downregulating His4 protein, Ku70 protein, Shble protein, 5'-NT protein, and / or Cda protein.
[0072] The nucleotide sequences of the aforementioned genes may be identical to those shown in SEQ ID NO:1–9, or they may be degenerate variants of them. As used herein, “degenerate variant” refers to a nucleic acid sequence that encodes a protein having the same function but differs from the sequences selected from SEQ ID NO:1–9.
[0073] In this invention, the genes (CCT, CKI, HNM1, sATP6) used to establish the expression cassette can be naturally occurring, for example, they can be isolated or purified from autotrophic plants or microorganisms. Furthermore, the genes used to establish the expression cassette can also be artificially prepared, for example, obtained using conventional genetic engineering recombination techniques, or obtained through artificial synthesis.
[0074] The gene may include: a coding sequence that encodes only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and a non-coding sequence.
[0075] The present invention also relates to variants of the aforementioned gene that encode a polypeptide that differs from its corresponding wild-type polypeptide in amino acid sequence, and is a fragment, analogue, or derivative of the wild-type polypeptide. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a form of polynucleotide substitution, which may be the substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes.
[0076] The present invention also relates to polynucleotides that hybridize with the above-described sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. In the present invention, “stringent conditions” means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, more preferably at least 95%. Furthermore, the polypeptides encoded by the hybridizable polynucleotides have the same biological functions and activities as the corresponding wild-type polypeptides.
[0077] It should be understood that although the genes of this invention are preferably obtained from *Saccharomyces cerevisiae* and *Pichia pastoris*, other genes obtained from other microorganisms that are highly homologous to the corresponding genes in *Saccharomyces cerevisiae* and *Pichia pastoris* (e.g., having more than 70%, such as 80%, 90%, 95%, or even 98% sequence identity) are also within the scope of this invention. Methods and tools for comparing sequence identity are also well known in the art, such as BLAST.
[0078] The full-length sequences or fragments of the genes of this invention can generally be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed in this invention, especially the open reading frame sequences, to amplify the relevant sequences. When the sequences are long, two or more PCR amplifications can be performed, and then the fragments amplified from each amplification can be spliced together in the correct order.
[0079] The present invention also relates to a vector containing the aforementioned polynucleotide, and a host cell generated by genetic engineering using the aforementioned vector.
[0080] In this invention, the sequences of each gene can be inserted into a recombinant expression vector (expression construct). The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors well known in the art. In short, any plasmid and vector can be used as long as it can replicate and remain stable in the host. An important characteristic of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and translation control elements.
[0081] The sequences of each gene can be inserted separately into a recombinant expression vector, and multiple recombinant expression vectors can be co-transformed into host cells; expression cassettes of multiple genes can also be inserted in tandem into the same recombinant expression vector and transformed into host cells. The recombinant expression vector may also contain expression regulatory sequences operatively linked to the gene sequences to facilitate protein expression. It should be understood that those skilled in the art, after understanding the technical content of this invention, can easily construct recombinant expression vectors. The obtained recombinant expression vectors are also included in this invention.
[0082] In expression regulatory sequences or expression cassettes, inducible or constitutive promoters can be applied according to different needs. Inducible promoters can achieve more controllable protein expression and compound production, which is beneficial for industrial applications.
[0083] As a preferred embodiment of the present invention, an expression vector (expression construct) is provided, which includes expression cassettes of the following histones: Cct protein, Cki protein, Hnm1 protein, and sATP6 protein; and an expression vector (expression construct) is also provided, which includes expression cassettes of the following gene: sATP6 gene.
[0084] The creation of expression vectors (expression constructs) is a technique familiar to those skilled in the art. Therefore, once the desired gene is known, it is easy for those skilled in the art to create the expression construct. Gene sequences can be inserted into different expression constructs (such as expression vectors) or into the same expression construct, as long as the encoded polypeptide can be effectively expressed and active after transformation into cells. As a preferred embodiment of the present invention, the expression vectors are pPIC Z, pPIC 3.5K, and pAG32.
[0085] Vectors containing the aforementioned appropriate gene sequences and appropriate promoters or control sequences can be used to transform suitable host cells to enable them to express proteins. In this invention, the host cell is preferably an engineered yeast strain, more preferably Pichia pastoris, such as Pichia pastoris GS115.
[0086] downregulation of genes / proteins
[0087] Based on the above-mentioned new discovery of the inventors, the present invention provides the use of a downregulator of His4 protein, 5'-NT protein, Cda protein, Ku70 protein and / or Shble protein for the production of citicoline or to increase the yield of citicoline.
[0088] The downregulator refers to any substance that can reduce the activity of target proteins (target proteins: His4 protein, 5'-NT protein, Cda protein, Ku70 protein, and / or Shble protein), reduce the stability of target proteins or their encoding genes, downregulate the expression of target proteins, reduce the effective duration of target protein action, or inhibit the transcription and translation of the encoding genes of target proteins. These substances can all be used in this invention as useful for downregulating target proteins. For example, the downregulator is: interfering RNA molecules or antisense nucleotides that specifically interfere with the expression of the encoding genes of target proteins; antibodies or ligands that specifically bind to target proteins; etc.
[0089] As a preferred embodiment of the present invention, homologous recombination can be used to specifically target the desired downregulated protein, causing expression defects or loss of expression. Alternatively, Cre and Loxp methods can be used to selectively knock out related genes in the genome of animals or cells, resulting in reduced or inactivated expression.
[0090] As a preferred embodiment of the present invention, a CRISPR / Cas (e.g., Cas9) system can be used for targeted gene editing to specifically knock out the gene encoding the target protein. Common gene knockout methods include co-transferring sgRNA or a nucleic acid capable of forming said sgRNA, Cas9 mRNA or a nucleic acid capable of forming said Cas9 mRNA to the target region or target cell. After the target site is identified, known methods can be used to introduce sgRNA and Cas9 into the cell. The nucleic acid capable of forming said sgRNA is a nucleic acid construct or expression vector, or the nucleic acid capable of forming said Cas9 mRNA is a nucleic acid construct or expression vector. These expression vectors are introduced into the cell, thereby forming active sgRNA and Cas9 mRNA within the cell.
[0091] As an optional embodiment of the present invention, the downregulator can be a gene-specific interfering RNA molecule (such as siRNA, shRNA, miRNA, etc.) encoding the target protein. Those skilled in the art will understand that such interfering RNA molecules can be prepared using the sequence information provided in this invention. There are no particular limitations on the preparation method of the interfering RNA molecule, including but not limited to: chemical synthesis, in vitro transcription, etc. The interfering RNA can be delivered into cells using appropriate transfection reagents, or it can be delivered into cells using various techniques known in the art.
[0092] As an alternative to this invention, RNAi is used for the aforementioned downregulation. RNAi is an evolutionarily conserved cellular defense mechanism used to control the expression of exogenous genes in most eukaryotes, including humans. RNAi is typically triggered by double-stranded RNA (dsRNA) and induces sequence-specific mRNA degradation of the single-stranded target RNA. The mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), typically produced by the enzymatic cleavage of long dsRNA within the cell. siRNAs are typically about 21 nucleotides long (e.g., 21-23 nucleotides). After the small RNA or RNAi is introduced into the cell, the sequence is believed to be delivered to an enzyme complex called the RISC (RNA-induced silencing complex). The RISC recognizes the target and cleaves it with a nuclease. Notably, if a larger RNA sequence is delivered to the cell, the RNase III enzyme (Dicer) converts the longer dsRNA into a 21-23 nt ds-siRNA fragment.
[0093] In an optional embodiment, shRNA technology is used for interference. shRNA is an RNA sequence that can rotate a tight hairpin, which can be used to silence gene expression via RNA interference. shRNA uses a vector introduced into the cell and utilizes a promoter (such as U6) to ensure that the shRNA is always expressed. This vector is typically delivered to daughter cells, allowing gene silencing to be inherited. The shRNA hairpin structure is cleaved into siRNA by cellular mechanisms and then binds to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the bound siRNA. shRNA is transcribed by RNA polymerase III.
[0094] As an optional implementation, downregulation is performed using antisense compounds that specifically hybridize with one or more nucleic acids encoding the target protein to be downregulated. The specific hybridization of oligomers with their target nucleic acids interferes with the normal function of the nucleic acids. This regulation of target nucleic acid function through compounds that specifically hybridize with the target nucleic acid is commonly referred to as "antisense."
[0095] In a preferred embodiment of the present invention, the downregulator is a small molecule compound targeting the target protein. Those skilled in the art can employ methods suitable for screening small molecule compounds to perform such screening. The screening can rely on various existing or future compound libraries in the art, or new compound libraries can be established independently.
[0096] The above are some representative ways to upregulate / downregulate the expression / activity of target proteins. It should be understood that the present invention provides novel regulatory targets. After those skilled in the art understand the overall scheme of the present invention, other methods known in the art or methods under development can also be used to regulate target proteins, and these methods are also included in the present invention.
[0097] While both Pichia pastoris and Saccharomyces cerevisiae are commonly used genetically engineered strains, Pichia pastoris is preferred in this invention compared to Saccharomyces cerevisiae. Through optimization by the inventors, the recombinant yeast strain established in this invention can effectively achieve high-density fermentation, high expression levels, and simultaneously perform correct translation and post-translational processing and modification of exogenous eukaryotic genes. As a preferred embodiment of this invention, the expression of exogenous proteins can be strictly regulated using methanol by employing the AOX1 (Alcohol oxidase 1) promoter.
[0098] Transforming host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
[0099] The obtained transformants can be cultured using conventional methods, and the culture medium used can be a yeast culture medium well-known in the art. Culture should be carried out under conditions suitable for yeast cell growth.
[0100] According to the results of embodiments of the present invention, the method of the present invention to introduce the expression of target genes and target downregulate the expression / activity of target proteins is very effective in improving cytidine diphosphate choline synthesis.
[0101] The recombinant yeast strain obtained by this invention through gene recombination technology has the characteristics of low metabolic background, strong heterologous expression ability, whole-cell synthesis of end products, easy separation of end products and few by-products. It will largely solve the problems existing in traditional biological and chemical synthesis methods and provide new ideas for the industrial production of citicoline drugs.
[0102] Methods for synthesizing cytidine diphosphate choline
[0103] The structural formula of cytidine diphosphate choline is shown in formula (I) below.
[0104]
[0105] This invention discloses a method for synthesizing cytidine diphosphate choline using Pichia pastoris. The method includes: transforming four genes (CCT, CKI, HNM1, sATP6) into engineered yeast strains, and downregulating the expression or activity of His4, Ku70, Shble, 5'-NT and / or Cda proteins, thereby achieving high-yield production of cytidine diphosphate choline through live-cell fermentation.
[0106] CMP synthesizes CTP via CMPK and CDPK catalysis; choline chloride synthesizes phosphoric acid choline via Cki catalysis. Choline chloride has limited transport capacity into Pichia pastoris cells, while Hnm1 promotes choline chloride transport; phosphoric acid choline and CTP further synthesize cytidine diphosphate choline under the catalysis of Cct. sATP6 can enhance ATP synthesis, providing energy for the cytidine diphosphate choline synthesis reaction. His4 protein is integrated into the selection marker of strains overexpressing Cct, Cki, and Hnm1 proteins during construction. Shble protein is a bleomycin resistance protein integrated into strains overexpressing sATP6 proteins during construction. Ku70 is involved in non-homologous repair; downregulation of this protein can improve the homologous recombination efficiency of the strain. 5'-NT can catalyze the metabolism of CMP to cytidine. Cda can catalyze the conversion of cytidine to uridine.
[0107] The fermentation culture of recombinant yeast engineered strains can employ yeast fermentation methods known in the art. A preferred method is as follows: the recombinant strains are cultured to the logarithmic development phase in liquid YPD culture at 30°C and 200 rpm. The cells are then collected at 1 OD and inoculated into a fermentation medium containing phosphocholine and CMP, and cultured at 30°C and 200 rpm for 120-168 h. During fermentation, 2% glucose is added to the liquid medium every 24 h. The specific formulation of the fermentation medium is: 20 g / L tryptone, 10 g / L yeast extract, 6 g / L MgSO4·7H2O, 6.8 g / L KH2PO4, 0.608% g / L NaOH, 10 g / L CMP, 5 g / L phosphocholine, and 20 g / L glucose. It should be understood that, based on the disclosure of this invention, those skilled in the art can further modify the fermentation scale, fermentation conditions, substrate amount, and medium amount to obtain methods with one or more variations in conditions. These methods should also be included within the overall scope of this invention.
[0108] In a preferred embodiment of the present invention, phosphocholine and CMP are used as substrates, and the CMP concentration is 5-50 g / L; more preferably 10-30 g / L; and even more preferably 15-25 g / L. In a preferred embodiment of the present invention, the phosphocholine concentration is 2-30 g / L; more preferably 3-25 g / L; and even more preferably 12-20 g / L.
[0109] After obtaining the fermentation product, cytidine diphosphate choline can be extracted from it using techniques known in this invention. High-performance liquid chromatography (HPLC) can be used to analyze and detect the product to determine the amount of the desired compound obtained.
[0110] This patent utilizes recombinant Pichia pastoris to produce citicoline, which not only solves the problems of difficulty in transporting substrates from naturally occurring Saccharomyces cerevisiae (Saccharomyces cerevisiae) into cells and the instability of enzymatic methods in bio-fermentation, but also avoids the disadvantages of chemical synthesis methods such as numerous byproducts, difficult purification, and significant environmental pollution. Furthermore, it promotes the transport of phosphocholine into cells, opening up a new pathway for the industrial production of citicoline. Therefore, the recombinant Pichia pastoris strain of this invention has the potential for industrial-scale production of citicoline.
[0111] This invention represents a technological breakthrough in the whole-cell biosynthesis of citicoline using recombinant yeast with phosphocholine and CMP as substrates, providing a new approach for the production of citicoline.
[0112] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.
[0113] Material
[0114] The plasmid construction method used was Novizan Biosciences' Seamless Cloning Kit.
[0115] All enzymes used were purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). Specific reaction conditions and methods were described in the product instructions.
[0116] The following commercially available plasmids and strains were used for gene cloning and protein expression: plasmid pGAPZ B, plasmid pPIC3.5K, plasmid pAG32, plasmid pUC18, *E. coli* Top 10, and *Pichia pastoris* strain GS115, all purchased from Invitrogen. Plasmid BB3cN_pGAP_23_pLAT1_Cas9 was purchased from Addgene.
[0117] For plasmids pPIC3.5K-KU70-gRNA1 and pUC18-DKU70, see Liu Q, Shi X, Song L, Liu H, Zhou X, Wang Q, Zhang Y, Cai M. CRISPR–Cas9-mediated genomic multiloci integration in Pichia pastoris. Microbial Cell Factories. 2019, 18:144.
[0118] The primer sequences used in this invention are shown in Table 1.
[0119] Table 1. Primer sequences used
[0120]
[0121]
[0122] culture medium
[0123] YPD liquid culture medium: glucose 20.0 g / L, peptone 20.0 g / L, yeast extract 10.0 g / L;
[0124] YPD solid medium: glucose 20.0 g / L, peptone 20.0 g / L, yeast extract 10.0 g / L, agar 20 g / L;
[0125] YPM liquid medium: methanol 10.0 g / L, peptone 20.0 g / L, yeast extract 10.0 g / L;
[0126] MGY medium: 10.0 g / L glycerol, 0.67% YNB, 20 g / L agar.
[0127] Prepare the above culture
[0128] Sequence information
[0129] SEQ ID NO:1(CCT)
[0130]
[0131] SEQ ID NO:2(CKI)
[0132]
[0133] SEQ ID NO:3(HNM1)
[0134]
[0135] SEQ ID NO:4(sATP6)
[0136] atgagattgttcgacccatggccagtcttcttcaagagagagtggaagagatgctggccattcttgactggtttcgccgtcactggtgtcttgatcaccaagttgaccgccggtttgactgaggaggacgccaagaactccaagttcgttcagcaacatagaagatga
[0137] SEQ ID NO:5(HIS4)
[0138]
[0139] SEQ ID NO:6(KU70)
[0140]
[0141] SEQ ID NO:7(Sh ble)
[0142] atggccaagttgaccagtgccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccggctcgggttctcccgggacttcgtggaggacgacttcgccggtgtggtccgggacgacgtgaccctgttcatcagcgcggtccaggaccaggtggtgccggacaacaccctggcctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtgtccacgaacttccgggacgcctccgggccggccatgaccgagatcggcgagcagccgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggactga
[0143] SEQ ID NO:8(5’-NT)
[0144] atgtcattatcacttccagagttacaggatcctcatttagaatcgaatttcatagaagatgtcatatcagaacaagaagtactggatagaagctcatcccaggtcaatatccctctggagtcgtctttgcctaacgttcatttgacttatggtgtcgggccggtcccattagatgacggcaaggtgttcttttttgatattgacaattgccttta caaacgatctagcaagattcatgatctgatgcagatttacatacatcgctacttcaaggacactttacagattaatgataaagaagcatgggacttacatcacaagtactaccagcaatatggactgagtatggaggggctagttcgtcacaacaatattgatgccatggaatacaatagcaaagttgatgattcgcttccattggagaagattt tgcgacccaatagacgtttacgagaaatgattttacgcttgaagaaaagtggcaaagtcgacagactttggttgtttactaatgcctacaagaatcatgcattacgagttatttatctattgggtttgggtgatttatttgacggtctaacgtattgtgaatatgataagatccccattctgtgcaaaccaatgaaaccaatattcgacaaagcgttactagcggccggttgcaagtctactaagaatgcgtattttgttgatgatagtgctctcaatgtcaaggctgcccgagagttagggtttgcaaaagtgattcactacgttgaaaccgatgatgacatggaaaaattagacgagacgcataaggcaaatactgtcatcatcagagacatcttagagttggaaaaagtttgttctgagttgttttaa
[0145] SEQ ID NO:9(CDA)
[0146] atgcctcaattggacttgaataacctgcagccaccattctcccaagaccacaggggtcttactgatgtggaatttgagacacttaaaaccaaggccctggaaggtacgatcttaggctgaaacagtgaaac acgattcttactaaccactattccagccagaaacttatcatactcaccttattcaaacttcaaagtcggatgtagcattctgctgcccgataatacttttataaagggagcaaacgttgagaacgccagct atggtgcttgcatttgcgctgaaagaaccacgataactcatgccgtaatgttgggccatagatccttcaaagccctagcagtatccacagaactggaatcaattgcatcaccgtgtggaatttgtagacaa gtgatcagagagtttgcagatgagaaacttactttgcccatctttatgttcaataaagacggatcaaagtttgtgaaaatgacactagacgacttgttaccgttgagtttcgggccagaacaattacaatag
[0147] Example 1: Construction of expression plasmid
[0148] 1. Construction of expression plasmid integrating CCT, CKI, and HNM1 genes into the GAP promoter.
[0149] The PpCCT gene fragment was amplified using the genome of wild-type Pichia pastoris strain GS115 (GS) as a template, with primers PpCCT-F and PpCCT-R as primers. A linearized vector fragment was then amplified using pGG-F and pGG-R as primers and pGAPZ B plasmid as a template. Following the instructions of the non-ligase-dependent single-fragment rapid cloning kit, the amplified PpCCT gene fragment and vector fragment were ligated and transformed into *E. coli* Top 10 competent cells. Sequencing verification was performed, and the correct plasmid was named pGAPZ-PpCCT.
[0150] Using 3.5K-GAP-F and AOX1-PmeI-R as primers and pGAPZ-PpCCT plasmid as template, P was amplified. GAP-PpCCT expression cassette fragment. Using AOX1-PmeI-F and 3.5KR as primers and pPIC3.5K plasmid as a template, a linearized vector fragment was amplified. Then, following the instructions of the non-ligase-dependent single-fragment rapid cloning kit, the amplified gene and vector fragment were ligated and transformed into *E. coli* Top 10 competent cells. Transformants were screened using carbenicillin. The correctly sequenced plasmid was named pPIC3.5K-PpCCT.
[0151] Using ScCKI-F and ScCKI-R as primers and the Saccharomyces cerevisiae S288c genome as a template, the ScCKI gene fragment was amplified by PCR. Then, using pGG-F and pGG-R as primers and pGAPZ B plasmid as a template, a linearized vector fragment was amplified. Following the instructions of the non-ligase-dependent single-fragment rapid cloning kit, the amplified gene and vector were ligated and transformed into E. coli Top 10 competent cells. The correctly selected transformants were then identified as the pGAPZ-ScCKI plasmid.
[0152] Using SCHNM1-F and SCHNM1-R as primers and the S288c genome of *Saccharomyces cerevisiae* as a template, the SCHNM1 gene fragment derived from *Saccharomyces cerevisiae* was amplified by PCR. Using the pPIC3.5K-PpCCT plasmid as a template and primers 3.5K-HIS-F / pGG-R, the vector fragment was amplified by PCR. The plasmid vector was then ligated to the amplified SCHNM1 gene fragment using a seamless assembly kit and transformed into *E. coli* Top 10 competent cells. The correctly selected plasmid was named pPIC3.5K-ScHNM1 plasmid.
[0153] 2. Construction of plasmid pPIC3.5K-PpCCT-ScCKI-ScHNM1
[0154] Using plasmid pGAPZ-ScCKI as a template, and GAP-F and PmeI-R as primers, P was amplified by PCR. GAP The ScCKI expression cassette fragment was then inserted into the PmeI-digested linearized pPIC3.5K-PpCCT plasmid to obtain the pPIC3.5K-PpCCT-ScCKI plasmid.
[0155] Using plasmid pPIC3.5K-ScHNM1 as a template, and GAP-F and PmeI-R as primers, P was amplified by PCR. GAPThe -ScHNM1 expression cassette fragment was then inserted into the PmeI-digested linearized pPIC3.5K-PpCCT-ScCKI plasmid to obtain the pPIC3.5K-PpCCT-ScCKI-ScHNM1 plasmid.
[0156] 3. Construction of expression plasmid for sATP6 gene integration into GAP promoter
[0157] The Pichia pastoris codon-optimized sATP6 gene was synthesized by Genewiz Biotechnology Co., Ltd. The sATP6 gene fragment was amplified using primers ATP6-F and ATP6-R. The linearized vector pGAPZ B was then amplified using primers GAP-sATP-F and GAP-sATP6-R. The amplified sATP6 gene and the pGAPZ B vector fragment were then ligated and transformed into *E. coli* Top10 competent cells. Transformants with correct sequencing results were selected and identified as the pGAPZ-sATP6 plasmid.
[0158] 4. Construction of plasmid pUC18-DHIS4
[0159] The HIS4 gene sequence, consisting of approximately 1000 bp upstream and downstream of the genome, was amplified using primer pairs ghis-up F / ghis-up R and phis-do F / phis-do R. This sequence was then ligated and inserted into the pUC18 vector plasmid, which was linearized using EcoRI / HindIII restriction enzymes, to obtain the pUC18-DHIS4 plasmid containing the donor fragment.
[0160] 5. Construction of plasmid BB-HIS-gRNA1
[0161] Using the pPIC3.5K-KU70-gRNA1 plasmid as a template, the HH-HISgRNA1-HDV fragment was amplified using primers HH-HIS-gRNA1-F and HDV-HIS-gRNA1-R. The linearized BB3cN_pGAP_23_pLAT1_Cas9 vector fragment was then amplified using primers BB-Cas9-F and BB-Cas9-R. The amplified HH-HISgRNA1-HDV fragment and the linearized BB3cN_pGAP_23_pLAT1_Cas9 vector fragment were then ligated and transformed into competent *E. coli* cells, plated on LB agar plates supplemented with noroside. Transformants with correct sequencing results were identified as the BB-HIS-gRNA1 plasmid.
[0162] 6. Construction of plasmid pUC18-DZeocinR
[0163] The bleomycin resistance encoding gene Sh ble was amplified using primer pairs Zeo-up-F / Zeo-up-R and Zeo-do-F / Zeo-do-R to obtain 1000bp gene fragments upstream and downstream of Sh ble. The linearized pUC18 vector was then amplified using primer pair 18F / 18R. The amplified upstream and downstream fragments were then ligated with the linearized pUC18 vector to obtain the donor plasmid pUC18-DZeocinR.
[0164] 7. Construction of plasmid BB-ZeocinR-gRNA1
[0165] Using BB-HIS-gRNA1 plasmid as a template, two gene fragments were amplified using primer pairs Zeo-gRNA1-F / inOri R and inOri F / Zeo-gRNA1-R, respectively. The amplified fragments were then ligated to obtain BB-ZeocinR-gRNA1 plasmid.
[0166] 8. Construction of plasmid pUC18-D0130
[0167] The 5'-NT (5'-Nucleotidases) coding gene was amplified using primer pairs 0130-up-F / 0130-up-R and 0130-do-F / 0130-do-R to obtain gene fragments of approximately 1000 bp upstream and downstream. The linearized pUC18 vector was then amplified using primer pair 18F / 18R. Finally, the amplified upstream and downstream fragments were ligated with the linearized pUC18 vector to obtain the donor plasmid pUC18-D0130.
[0168] 9. Construction of plasmid pUC18-DCDA
[0169] The Cda (cytidine deaminase) encoding gene fragments of approximately 1000 bp upstream and downstream were amplified using primer pairs 0726-up-F / 0726-up-R and 0726-do-F / 0726-do-R. The linearized pUC18 vector was then amplified using primer pair 18F / 18R. Finally, the amplified upstream and downstream fragments were ligated with the linearized pUC18 vector to obtain the donor plasmid pUC18-DCDA.
[0170] 10. Construction of plasmid BZ-0130-gRNA1
[0171] Using the BB-HIS-gRNA1 plasmid as a template, gene fragments were amplified using primer pairs 0130-gRNA1-F / natMX6UP-R and natMX6DO-F / 0130-gRNA1-R. Gene fragments were then amplified using the pGAPZ-ScCKI plasmid as a template, using primer pair BleoRUP-F / BleoRUP-F. These three fragments were then ligated to construct the BB-0130-gRNA1 plasmid.
[0172] 11. Construction of plasmid BZ-0726-gRNA1
[0173] Using BZ-0130-gRNA1 plasmid as a template, gene fragments amplified using primer pairs 0726-gRNA1-F / inOri R and inOri F / 0726-gRNA1-R were ligated to construct BZ-0726-gRNA1 plasmid.
[0174] Example 2: Electroporation of Pichia pastoris and screening of strains
[0175] 1. Construction of GS-sATP6 strain
[0176] The pGAPZ-sATP6 plasmid was digested with BlnI, and the purified linearized plasmid fragment was then transformed into Pichia pastoris GS115 competent cells to obtain the GS-sATP6 strain.
[0177] 2. Construction of GS-sATP6-CKH strain
[0178] The pPIC3.5 K-PpCCT-ScCKI-ScHNM1 plasmid was digested with BspEI, and the purified linearized plasmid fragment was then transformed into the GS-sATP6 strain for selection to obtain the GS-sATP6-CKH strain.
[0179] 3. Construction of GS-sATP6-CKH-Δhis4 strain
[0180] Using the donor plasmid pUC18-DHIS4 as a template, the donor fragment UP-HIS4-DO was amplified using primers ghis-up-sF and pHis-do-sR. The donor fragment and the BB-HIS-gRNA1 plasmid were then co-electroporated onto the GS-sATP6-CKH strain and plated on YPD plates supplemented with noroside. After screening for the correct gene-deleted transformants, these transformants were cultured in YPD liquid medium for two days to remove the BB-HIS-gRNA1 plasmid. Single colonies were then streaked on YPD plates and picked. These single colonies were cultured in YPD liquid medium and plated onto YND plates and YPD plates supplemented with noroside. Transformants that failed to grow on both types of plates were identified as the correct strain GS-sATP6-CKH-Δhis4, which had the HIS4 gene knocked out and the BB-HIS-gRNA1 plasmid missing.
[0181] 4. Construction of GS-sATP6-CKH-Δhis4Δku70 strain
[0182] Using pUC18-DKU70 plasmid template, the donor fragment was amplified using primers KU70-UP-F and KU70-DO-R. The amplified donor fragment and pPIC3.5K-KU70-gRNA1 plasmid were then co-transformed into GS-sATP6-CKH-Δhis4 competent cells. Transformants were screened by plating on YND plates. After identifying the correct transformants with gene deletion, they were cultured in YPD liquid medium for two days to perform gRNA-Cas9 plasmid loss. Single colonies were then streaked on YPD plates and picked. These single colonies were cultured in YPD liquid medium and then plated on YND plates. No growth on YND plates indicated that the pPIC3.5K-KU70-gRNA1 plasmid had been lost. The strain that successfully lost the gRNA-Cas9 plasmid was identified as GS-sATP6-CKH-Δhis4Δku70.
[0183] 5. Construction of GS-sATP6-CKH-Δhis4Δku70Δsh ble strain
[0184] Using the donor plasmid pUC18-DZeocinR as a template, the donor fragment of the Shble gene knockout was amplified using primers Zeo-up-sF and Zeo-do-sR. The donor fragment and plasmid BB-ZeocinR-gRNA1 were then co-transformed into the GS-sATP6-CKH-Δhis4Δku70 strain. The transformed strain was plated on YPD plates supplemented with noroside. After screening for the correct gene-deleted transformants, the transformants were cultured in YPD liquid medium for two days to remove the BB-ZeocinR-gRNA1 plasmid. Single colonies were then streaked on YPD plates and picked. After two days of culture in YPD liquid medium, the selected single colonies were plated on YPD plates supplemented with bleomycin and YPD plates supplemented with noroside. Strains that failed to grow on both types of solid plates were the correct strain GS-sATP6-CKH-Δhis4Δku70Δshble, which had the Shble gene knocked out and the BB-ZeocinR-gRNA1 plasmid removed.
[0185] 6. Construction of GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strain
[0186] Using donor plasmid pUC18-D0130 as a template, the donor fragment with the knockout gene 5'-NT was amplified using primers 0130-up-sF and 0130-do-sR. The donor fragment and plasmid BZ-0130-gRNA1 were then co-transformed into the GS-sATP6-CKH-Δhis4Δku70Δsh ble strain. The transformed strains were plated on YPD plates supplemented with bleomycin. After screening for the correct gene-deleted transformants, they were cultured in YPD liquid medium for two days to remove the BZ-0130-gRNA1 plasmid. Single colonies were then streaked on YPD plates and picked. These single colonies were cultured in YPD liquid medium for two days and then plated on YPD plates supplemented with bleomycin. Strains that did not grow on the plates were the correct strain GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT, which had lost the BZ-0130-gRNA1 plasmid.
[0187] 7. Construction of GS-sATP6-CKH-Δhis4Δku70Δsh bleΔcda strain
[0188] Using the donor plasmid pUC18-DCDA as a template, the donor fragment of the knockout gene CDA was amplified using primer pair 0726-up-sF / 0726-do-sR. The donor fragment and plasmid BZ-0726-gRNA1 were then co-transformed into the GS-sATP6-CKH-Δhis4Δku70Δsh ble strain. The transformed strains were plated on YPD plates supplemented with bleomycin. After screening for the correct gene-deleted transformants, they were cultured in YPD liquid medium for two days to remove the BZ-0726-gRNA1 plasmid. Single colonies were then streaked on YPD plates and picked. These single colonies were cultured in YPD liquid medium for two days and then plated on YPD plates supplemented with bleomycin. Strains that did not grow on the plates were the correct strain GS-sATP6-CKH-Δhis4Δku70Δsh bleΔcda, which had lost the BZ-0726-gRNA1 plasmid.
[0189] Example 3: Shake-flask fermentation process of recombinant engineered bacteria
[0190] The recombinant bacteria were cultured to the logarithmic growth phase in liquid YPD culture at 30℃ and 200 rpm. After resuspending the bacterial cells, they were inoculated at 1 OD / mL into 50 mL 6-well plates containing 10 mL of YPD liquid medium (18 g / L phosphocholine, 10 g / L CMP, 4 g / L MgSO4·7H2O, 8 g / L sodium citrate, and a phosphate buffer at pH 7.5). (OD value is yeast concentration unit, 1 OD is approximately 5 x 10⁻⁶). 7 Yeast cells (OD values were measured at 600 nm using a UV spectrophotometer) were cultured at 30°C and 200 rpm for 120–168 h. 2% (m / v) glucose was added to the liquid culture medium every 24 h during fermentation.
[0191] Fermentation is terminated when the product concentration no longer increases.
[0192] Example 4: Detection of Fermentation Products from Recombinant Strains
[0193] After fermentation, 1 mL of the fermentation broth was centrifuged at 12000 g for 5 min. The supernatant was collected, filtered through a 0.22 μm filter membrane, and then analyzed by high performance liquid chromatography (HPLC).
[0194] High-performance liquid chromatography (HPLC) analysis was performed using an Agilent 1100 reverse-phase HPLC system with a C18 column. Column temperature: 25℃; mobile phase: phosphate buffer [equal volumes of 0.1 mol / L potassium dihydrogen phosphate solution and tetrabutylammonium hydroxide solution (adjusted to pH 4.5 with phosphoric acid from 0.01 mol / L tetrabutylammonium hydroxide solution)] - methanol (95:5); flow rate: 1.0 mL / min; detection wavelength: 276 nm; injection volume: 10 μL.
[0195] Example 5: Product yield produced by fermentation of engineered strains using phosphocholine as a substrate
[0196] Fermentation was carried out according to the method of Example 3.
[0197] The results are as follows Figure 1 As shown in AB, the GS-sATP6-CKH strain produced 6.0 g / L of citicoline at 120 h, with a conversion rate of 40% for the substrate CMP. The GS-sATP6-CKH-Δhis4 strain achieved a citicoline production of 13.2 g / L at 120 h, representing a 106% increase compared to the GS-sATP6-CKH strain. Furthermore, the molar conversion rate of the GS-sATP6-CKH-Δhis4 strain for CMP was 86.3%, a 46% increase compared to the GS-sATP6-CKH strain. There were no significant differences in yield and conversion rate between the GS-sATP6-CKH-Δhis4Δku70 and GS-sATP6-CKH-Δhis4Δku70Δshble strains and the GS-sATP6-CKH-Δhis4 strain.
[0198] Example 6: Optimization of CMP concentration in GS-sATP6-CKH-Δhis4Δku70Δshble strain
[0199] Fermentation was carried out according to the method of Example 3. The difference was that the amount of CMP added was varied, and the product yield under different addition amounts was compared; the amount of phosphocholine was 18 g / L.
[0200] Depend on Figure 2 According to AD, the GS-sATP6-CKH-Δhis4Δku70Δsh ble strain showed a high production of cytidine diphosphate choline when the CMP concentration was 23 g / L. After 168 h of fermentation, the cytidine diphosphate choline production was 20.7 g / L, with a conversion rate of 53% relative to the substrate CMP.
[0201] Example 7: Citicoline production in strains lacking the CMP metabolic pathway
[0202] Fermentation was carried out according to the method of Example 3, except that the concentration of CMP added was 23 g / L.
[0203] Depend on Figure 3 According to AB, after 168 h of fermentation, the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strain achieved a maximum cytidine diphosphate choline (CPC) yield of 23.7 g / L, representing a 14% increase compared to the GS-sATP6-CKH-Δhis4Δku70Δsh ble strain. The molar conversion efficiency of the substrate CMP was also improved by 15%.
[0204] Depend on Figure 3 As shown in AB, after 168 h of fermentation, the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔcda strain achieved a maximum cytidine diphosphate choline (CPC) yield of 24.0 g / L, representing a 16% increase compared to the GS-sATP6-CKH-Δhis4Δku70Δsh ble strain. The molar conversion efficiency of the substrate CMP was also improved by 17%.
[0205] Example 7: Optimization of substrate concentration for GS-sATP6-CKH-Δhis4Δku70ΔshbleΔ5'-NT strain
[0206] (1) Regarding the concentration of added phosphocholine
[0207] Fermentation was carried out according to the method of Example 3. The difference was that when the concentration of CMP added was 10 g / L, the concentration of phosphoric acid choline added was set to 6, 8, 10, 12, 15, 18, 20, 23 and 25 g / L respectively.
[0208] Depend on Figure 4 AC analysis revealed that when the phosphoric acid choline concentration was 6 g / L, the conversion rate of citicoline relative to both phosphoric acid choline and CMP substrates reached almost 100%, with the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strain exhibiting the highest utilization efficiency for both substrates. As the phosphoric acid choline concentration increased, the conversion rate of citicoline relative to phosphoric acid choline gradually decreased. However, within the phosphoric acid choline concentration range of 6–15 g / L, the conversion rate of citicoline to CMP remained consistently high with minimal variation.
[0209] (2) Regarding the concentration of CMP added
[0210] The concentration of CMP added to the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strain was optimized at a phosphoric acid choline concentration of 15 g / L. The CMP concentrations were set to 10, 12, 15, 18, 20, 23, 25, and 28 g / L.
[0211] Experimental results are as follows Figure 5 As shown in AC, when the CMP concentration was 23 g / L, the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strain produced 30.0 g / L of cytidine diphosphate choline, with conversion rates of 79.3% and 69.0% for the substrates CMP and phosphate choline, respectively.
[0212] Example 8: Optimization of substrate concentration for GS-sATP6-CKH-Δhis4Δku70Δsh bleΔcda strain
[0213] (1) Regarding the concentration of added phosphocholine
[0214] When the concentration of CMP added is 10 g / L, the concentrations of phosphoric acid choline added are set to 6, 8, 10, 12, 15, 18, 20, 23 and 25 g / L respectively.
[0215] Experimental results are as follows Figure 6 As shown in AC, when the phosphoric acid choline concentration was 6 g / L, the conversion rate of citicoline relative to both phosphoric acid choline and CMP substrates reached almost 100%, and the utilization efficiency of both substrates by the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strain was the highest at this concentration. With increasing phosphoric acid choline concentration, the conversion rate of citicoline relative to phosphoric acid choline gradually decreased. However, within the phosphoric acid choline concentration range of 6–15 g / L, the conversion rate of citicoline to CMP remained very high with minimal variation.
[0216] (2) Regarding the concentration of CMP added
[0217] The concentration of CMP added to the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strain was optimized at a phosphoric acid choline concentration of 15 g / L. The CMP concentrations were set to 10, 12, 15, 18, 20, 23, 25, and 28 g / L.
[0218] Experimental results are as follows Figure 7 As shown in AC, when the concentration of CMP added was 18 g / L, the GS-sATP6-CKH-Δhis4Δku70Δsh bleΔ5'-NT strain produced 29.7 g / L of cytidine diphosphate choline, with conversion rates of 84.7% and 61.7% for the substrates CMP and phosphate choline, respectively.
[0219] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> East China University of Science and Technology <120> A genetically engineered bacterium for fermentation production of cytidine diphosphate choline and its application <130> 215287 <160> 72 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1104 <212> DNA <213> Pichia sp. <400> 1 atggcttcca gaaagtctcc aagaaaaagg gtacgagatc aagaagaaag tgataactct 60 tcggtccaga caattaaggt agttagtgac gtacctacta agcggcctaa actttcccgt 120 aagacaagcg acgaattggc gtttgcggaa aatgaacgaa aactcgacga acaacttcct 180 gctgatcttc gaaaattcag gccgacaggc tttaagttca acttgcctcc agaaggacgc 240 tcaattcgta tttatgcaga cggagtcttc gacttgtttc atttaggtca catgaaacaa 300 ttggaacaat gtaagaaagc tttccccaat gttaccttgg tttgtggaat tcctaatgat 360 aaagaaacac acaaacgtaa gggattgacg gtccttacag ataagcaacg ctatgagact 420 attaacatt gccgttgggt ggatgaggtg attcctgatg ctccttgggt agttgatgtg 480 ggttttcttg agaaacaca aattgactat gttgcacatg atgaccttcc atacgccctcg 540 tctggttccg atgatatata cagacctatc aaggaaatcg gatgttttt agtgacacaa 600 aggacagaag gtgttctac ctctgacata atcactaag tattaggga ttacgacaaa 660 tacctgatgc gaacttcgc acggggagca actaggaaag agttaacgt cagttggttg 720 aaaaaaaatg attggattt gagaaacat atcaacat ttcgtagcta ttttaagaaa 780 gctaacatca atctcaatgc ttcgtccaag gacctatact ttgaggttag ggaatatcta 840 agaggaaaca acaacccaa tgggaacgaa agtagcccca acagtctga ttccgactct 900 aattctgtga atagtagcac tgcaagcact agtggcacaa tggatgatt gatgaatata 960 gtacaatctc gatctcccgc aacagacttt gctgcaaat atacagca tgaaatctg 1020 aagagaaatc gatcattcat stormttg aagaactact ggaaagaag atccgaatcc 1080 ggtgagaga accaagtaa ctga 1104 <210> 2 <211> 1749 <212> DNA <213> Saccharomyces cerevisiae <400> 2 atggtacaag aatcacgtcc agggagtgta agaagttact cggtcggtta ccaagcaagg 60 tccagatcga gttctcaaag aagacattcg ttaacacgcc aacgttcctc gcaaagactg 120 attagaacca tcagtatcga gtctgatgtg tctaatatta ctgacgatga cgatttgaga 180 gctgtcaatg agggagtac gggtgtgcaa ctggacgtct ctgaaaccgc aaataaggga 240 ccaagaagag catcagcaac tgatgtcaca gatagtttgg gttcgacttc gtcggaatat 300 attgagattc cctttgttaa ggaaacattg gatgcaagtt taccttcgga ttatctgaag 360 caggacatat taaatctcat tcagagtttg aagatatcca aatggtataa caacaagaaa 420 atccaaccgg tagcacaaga tatgaactta gtcaagatct ctggtgcgat gacaaacgca 480 attttcaaag ttgaataccc taagttacca tcgttgctat tgagaatata cggaccgaat 540 attgataata tcattgacag ggaatatgaa ttgcagattt tggctaggct ttcattgaaa 600 aatatagggtc cttcccttta cggctgttt gtaaacggta gatttgagca gtttctggag 660 aattctaaga ctttaacaaa agacgacatt agaaactgga agaactctca aaggattgca 720 aggagaatga aggagttaca tgtaggtgtt cctctcttga gttcagaaag gaagaacggg 780 tcggcttgtt ggcaaaagat taaccagtgg ttgcgcacga ttgagaaagt cgaccaatgg 840 gtgggggatc ctaaaaacat tgaaaactct ttattatgtg agaattggtc caagtttatg 900 gatattgtcg atagatatca caagtggctt atttctcaag aacagggtat agagcaagtc 960 aacaaaaatc ttatattctg ccataatgat gcccaatacg gcaatttact tttcactgct 1020 cctgtgatga acacaccgag cctatacact gcaccttcgt ctacatcatt gacttcccaa 1080 tcaagttcct tatttccttc gagctccaat gtcattgtag atgatataat caacccgcca 1140 aagcaggagc aaagccaaga ttccaaattg gtcgtcattg atttgaata tgcaggtgcc 1200 aatcccgccg catatgattt agcgaatcat ctttccgagt ggatgtatga ttacaacaat 1260 gctaaggccc cacatcagtg ccacgctgat agatatcccg ataaagaaca ggttttgaat 1320 ttcttatact cttatgtttc gcatctaagg ggtggtgcta aggaacccat agatgaagag 1380 gttcaaagac tctataagtc aatcattcaa tggagaccca ctgtacaact attttggtcg 1440 ctctgggcca tcctacaaag tggtaaatta gagaaaaaag aagcctccac tgccatcact 1500 agagaagaaa ttggacccaa tggaaaaaa tatatcatca agactgaacc cgaatcccct 1560 gaagaact ttgttgaaaa tgacgacgag cctgaagctg gcgtcagcat tgacacgttc 1620 gattatatgg cttatggtcg tgacaagatt gcggtctttt ggggcgacct cattggctta 1680 ggcataatca ccgaagaa atgcaaaaat ttcagctctt tcaagttcct cgatactagt 1740 tatttgtaa 1749 <210> 3 <211> 1692 <212> DNA <213> Saccharomyces cerevisiae <400> 3 atgagtattc ggaatgataa tgcttccggt ggctatatgc agccggatca atcttcgaac 60 gcttctatgc acaaaagaga cttaagagtt gagggaaa taaagccatt ggatgatatg 120 gatagcaagg gtgctgtagc agcagatggt gaagttcatc taagaaagtc atttcgttg 180 tggtcaattc ttggtgttgg attcggtttg actaattcct ggttcggtat ttctacatcg 240 atggttgcag gtatatcttc tggtggaccc atgatgattg tttacggtat aattattgtt 300 gccctgattt ctatttgcat tggtacctcg ttgggtgaat tatcttccgc atatccgcac 360 gccggtggtc agttttggtg gtctttgaag cttgcccctc ctaagtacaa aagatttgcg 420 gcctacatgt gcggttcatt tgcttacgca ggatccgtgt tcacaagtgc ttcaactacg 480 ttatccgttg ctaccgaagt ggttggtatg tacgctctga cgcaccctga attcatccca 540 aagagatggc atatattcgt ttgctttgaa ttgttgcatt tgttcttgat gtttttcaac 600 tgttacggta aatccttacc tatcatttca tcttcctctc tatacatttc cctactatcc 660 tttttcacaa ttacaattac tgtattggca tgttctcatg gaaagttcaa cgatgcaaag 720 tttgtttttg ccacatttaa taatgaaaca ggttggaaga acggcggtat cgcctttatt 780 gtcggtttga ttaacccagc ttggtcattt tcgtgccttg actgtgcaac ccatatggcg 840 tttgaagttg aaaaaccaga aagagttatt cccattgcta tcatgggaac agtcgccatt 900 gggtttgtca cttccttttg ttatgttatc gctatgttct tctctataca agatctggac 960 gctgtctttgt cttctacaac aggcgcccca atcttggaca tttataatca ggcattgggt 1020 aataaatcag gtgcgatttt cctgggttgc ttgattctat ttacctcttt tggttgcgtc 1080 attgcttgtc acacttggca ggcaaggtta tgttggtcat ttgccaggga caatggtctt 1140 ccattatccc gtttatggtc gcaagttaac ccacacactg gtgtaccttt gaacgctcat 1200 ttaatgtcat gcgcttggat aaccctcatt ggcctacttt atttggcttc cagtacggct 1260 tttcagtcct taattacagg ttgtattgca ttttattgt tatcctacat cattccggtt 1320 atatgtttac ttgctaaaaa gcgtaacata gctcatggtc cattctggct tggaaaattt 1380 ggatttttt caaacattgt tcttttgggt tggactgtct tttctgtggt cttttttttcc 1440 tttccaccag ttttacctgt gacaaaggat aacatgaact atgtttgtgt agttattgtt 1500 ggttatactg cgtattcgat tctttactgg aaatacaagg gtaagaagga attccacgct 1560 ttagaagaat ctgagaacga acaggctgaa tatagtaata acttcgatac cattgaagat 1620 agtcgagaat tttccgttgc ggcctctgac gttgaactcg aaaatgaaca cgtaccgtgg 1680 ggaaagagt ga 1692 <210> 4 <211> 168 <212> DNA <213> Arabidopsis thaliana <400> 4 atgagattgt tcgacccatg gccagtcttc ttcaagagag agtggaagag atgctggcca 60 ttcttgactg gttcgccgt cactggtgtc ttgatcacca agttgaccgc cggtttgact 120 gaggaggacg ccaagaactc caagttcgtt cagcaacata gaagatga 168 <210> 5 <211> 2535 <212> DNA <213> Pichia sp. <400> 5 atgacatttc ccttgctacc tgcatacgca agtgttgcag agtttgataa ttccttgagt 60 ttggtaggaa aagccgtgtt tccctatgct gctgaccagc tgcacaacct gatcaagttc 120 actcaatcga ctgagcttca agttaatgtg caagttgagt catccgttac agaggaccaa 180 tttgaggagc tgatcgacaa cttgctcaag ttgtacaata atggtatcaa tgaagtgatt 240 ttggacctag atttggcaga aagagttgtc caaaggatga tcccaggcgc tagggttatc 300 tataggaccc tggttgataa agttgcatcc ttgcccgcta atgctagtat cgctgtgcct 360 ttttctttc cactgggcga tttgaaaagt ttcactaatg gcggtagtag aactgtttat 420 gctttttctg agaccgcaaa gttggtagat gtgacttcca ctgttgcttc tggtataatc 480 cccattattg atgctcggca attgactact gaatacgaac tttctgaaga tgtcaaaaag 540 ttccctgtca gtgaaatttt gttggcgtct ttgactactg accgccccga tggtctattc 600 actactttgg tggctgactc ttctaattac tcgttgggcc tggtgtactc gtccaaaaag 660 tctattccgg aggctataag gacaaact ggagtctacc aatctcgtcg tcacggtttg 720 tggtataaag gtgctacatc tggagcaact caaaagttgc tgggtatcga attggattgt 780 gatggagact gcttgaaatt tgtggttgaa caaacaggtg ttggtttctg tcacttggaa 840 cgcacttcct gttttggcca atcaaagggt cttagagcca tggaagccac cttgtgggat 900 cgtaagagca atgctccaga aggttcttat accaaacggt tatttgacga cgaagttttg 960 ttgaacgcta aaattaggga ggaagctgat gaacttgcag aagctaaatc caaggaagt 1020 atagcctggg aatgtgctga cttattttat tttgcattag ttagatgtgc caagtacggt 1080 1140 aaaggagatg ccaagccagg atacaccaag gaacaaccta aagaagaatc acaacctaaa 1200 gaagtccctt ctgaaggtcg tattgaattg tgcaaaattg acgtttctaa ggcctcctca 1260 caagaaattg aagatgccct tcgtcgtcct atccagaaaa cggaacagat tatggaatta 1320 gtcaaaccaa ttgtcgacaa tgttcgtcaa aatggtgaca aagccctttt agaactact 1380 gccaagtttg atggagtcgc tttgaagaca cctgtgttag aagctccttt cccagaggaa 1440 cttatgcaat tgccagataa cgttaagaga gccattgatc tctttataga taacgtcagg 1500 aaattccatg aagctcaact aacggagacg ttgcaagttg agacttgccc tggtgtagtc 1560 tgctctcgtt ttgcaagacc tattgagaaa gttggcctct atattcctgg tggaaccgca 1620 attctgcctt ccacttccct gatgctgggt gttcctgcca aagttgctgg ttgcaaagaa 1680 attgtttttg catctccacc taagaaggat ggtaccctta ccccagaagt catctacgtt 1740 gcccacaagg ttggtgctaa gtgtatcgtg ctagcaggag gcgcccaggc agtagctgct 1800 atggcttacg gaacagaaac tgttcctaag tgtgacaaaa tatttggtcc aggaaaccag 1860 ttcgttactg ctgccaagat gatggttcaa aatgacacat cagccctgtg tagtattgac 1920 atgcctgctg ggccttctga agttctagtt attgctgata aatacgctga tccagatttc 1980 gttgcctcag accttctgtc tcaagctgaa catggtattg attcccaggt gattctgttg 2040 gctgtcgata tgacagacaa ggagcttgcc agaattgaag atgctgttca caaccaagct 2100 gtgcagttgc caagggttga aattgtacgc aagtgtattg cacactctac aaccctatcg 2160 gttgcaacct acgagcaggc tttggaaatg tccaatcagt acgctcctga acacttgatc 2220 ctgcaaatcg agaatgcttc ttcttatgtt gatcaagtac aacacgctgg atctgtgttt 2280 gttggtgcct actctccaga gagttgtgga gattactcct ccggtaccaa ccacactttg 2340 ccaacgtacg gatatgcccg tcaatacagc ggagttaaca ctgcaacctt ccagaagttc 2400 atcacttcac aagacgtaac tcctgaggga ctgaaacata ttggccaagc agtgatggat 2460 ctggctgctg ttgaaggtct agatgctcac cgcaatgctg ttaaggttcg tatggagaaa 2520 ctgggactta tttaa 2535 <210> 6 <211> 1865 <212> DNA <213> Pichia sp. <400> 6 atgagtgttg tcagcaagca atacgacatc cacgaaggca ttatctttgt aattgaattg 60 accccggagc ttcacgcgcc ggcttcagaa gggaaatctc agctccagat catcttagag 120 aatgtcagtg aggttatttc tgagctaatc attaccttgc ccggtacagg aatagggtgt 180 taccttatta attacgacgg tggtcaaaac gacgaaattt accccatttt tgagttacaa 240 gacctgaatt tggaaatgat gaaacaattg taccaagtct tggaggacca tgtaagtggg 300 cttaatcctc tcgagaagca attcccaatt gaacacagta aaccgttatc agccactctg 360 ttctttcact taaggtctct tttttacatg gcgaagactc ataagcgtac tggaagacat 420 tacaacttga aaaagatttt cttgttcact aataacgata aaccttacaa tggaaactct 480 cagctgagag ttcccttgaa gaaaaccctg gctgattaca atgacgtaga cattactttg 540 attccgtttc ttctgaacaa gccttcaggt gtcaagtttg acaagacgga atactcagaa 600 attttgttct atgataaaga tgcttgttcg atgtcaattg aggagatccg ccaacgaatt tctagacata aggagatcaa gcgggtttac ttcacctgtc ctttgaaaat cgcaataac ttgtgcattt ctgtgaaagg ttattctatg ttttatcatg aaactccaag gaagatcaaa 840. tttgtcgtca atgagggttc aactttcaaa gatgtggaga caaaatctca gtttgtcgat 900. ccaacatccg gaaagagtt ttccagtgaa cagctgatca aagcatatcc tctaggtgcc gatgcttaca ttcctttaaa ctcagagcaa gtcaaaacaa taaatcgatt taatgatatc atcaatatcc cctctttgga aattctaggt ttcagggata tatctaattg gttgccacag 1080. gcaaagcatc gtttttatcc cctaataact atggtgattt tacacattcg 1140. ttagttgtct tttacaatcc atgaccaaaa aatccaagtt tgcagtactt tttggtactt tgaagaacaa tgcggctcca aggttgtttg gcatgattcc ctctacgtta cctcaatacg aaagttgtaa tcttccccaa gggttcttcc tgataaagct cccgtatctg gatgatgtac gccagctgcc acccaaaatt gccccggtcg atgctgattt ggatgtatta gtttcacttt tcagcaacct ggtcggaaag atccacatca agaatggata ccaaccccaa 1380 gagtatgaaa atccttccct acaatggcac ttcaaaatgt tacgtgacga ttaccttcaa 1440 ttggaacacg atatcgacat cagtgacccc cttgagaaac aaaagtacat aaacagcctc 1500 gatgagacaa aaaccaagat catgaaacta cgggactatg tcaaggaaac tgccgatgat 1560 gacgaccctt cacggcttgc caacactctc aaagagctca accaagagct gaacaaatt 1620 tccaactttg atatcatcgc caataagaag ccaaagaccc ccacgacagt agaccctgtt 1680 cctactgatg atgacatcat caacgcctgg aaggcaggaa ctctgaacgg tttcaaggtg 1740 gatcaattac gaaaatacgt aaggtcacga aacaactttc tggagacggc ctccaaaaag 1800 gcagatctca tcgccaacat tgacaagtac tttcagcaga agttcaaaga gactaaggcc 1860 tgatt 1865 <210> 7 <211> 375 <212> DNA <213> Pichia sp. <400> 7 atggccaagt tgaccagtgc cgttccggtg ctcaccgcgc gcgacgtcgc cggagcggtc 60 gagttctgga ccgaccggct cgggttctcc cgggacttcg tggaggacga cttcgccggt 120 gtggtccggg acgacgtgac cctgttcatc agcgcggtcc aggaccaggt ggtgccggac 180 aacaccctgg cctgggtgtg ggtgcgcggc ctggacgagc tgtacgccga gtggtcggag 240 gtcgtgtcca cgaacttccg ggacgcctcc gggccggcca tgaccgagat cggcgagcag 300 ccgtgggggc gggagttcgc cctgcgcgac ccggccggca actgcgtgca cttcgtggcc 360 gaggagcagg actga 375 <210> 8 <211> 861 <212> DNA <213> Pichia sp. <400> 8 atgtcattat cacttccaga gttacaggat cctcatttag aatcgaattt catagaagat 60 gtcatatcag aacaagaagt actggataga agctcatccc aggtcaatat ccctctggag 120 tcgtcttttgc ctaacgttca tttgacttat ggtgtcggggc cggtcccatt agatgacggc 180 aaggtgttct tttttgatat tgacaattgc ctttacaaac gatctagcaa gattcatgat 240 ctgatgcaga tttacataca tcgctacttc aaggacactt tacagattaa tgataaagaa 300 gcatgggact tacatcacaa gtactaccag caatggac tgagtagga ggggctagtt 360 cgtcacaaca atattgatgc catggaatac atagcaaag ttgatgattc gcttccattg 420 gagaagattt tgcgaccca tagacgttta cgagaaatga ttttacgctt gagaaaagt 480 ggcaaagtcg acagactttg gttgtttact aatgcctaca agaatcatgc attacgagtt 540 atttatctat tgggtttggg tgatttatt gacggtctaa cgtattgtga atatgataag 600 atccccattc tgtgcaacc atgaaacca atattcgaca aagcgttact agcggccggt 660 tgcaagtcta ctaagaatgc gtattttgtt gatgatagtg ctctcaatgt caggctgcc 720 cgagagttag ggtttgcaaa agtgatcac tacgttgaaa ccgatgatga catggaaaaa 780 ttagacgaga cgcataaggc aaatactgtc atcatcagag acatcttaga gttggaaaaa 840 gtttgttctg agttgtttta a 861 <210> 9 <211> 525 <212> DNA <213> Pichia sp. <400> 9 atgcctcaat tggacttga taacctgcag ccaccattct cccagacca caggggtctt 60 actgatgtgg aatttgagac acttaaaacc aaggccctgg aaggtacgat cttaggctga 120 aacagtgaaa cacgattctt actaaccact attccagcca gaaacttatc atactcacct 180 tattcaaact tcaaagtcgg atgtagcatt ctgctgcccg ataatacttt tataaaggga 240 gcaaacgttg agaacgccag ctatggtgct tgcatttgcg ctgaaagaac cacgataact 300 catgccgtaa tgttgggcca tagatccttc aaagccctag cagtatccac agaactggaa 360 tcaattgcat caccgtgtgg aatttgtaga caagtgatca gagagtttgc agatgagaaa 420 cttactttgc ccatctttat gttcaataaa gacggatcaa agtttgtgaa aatgacacta 480 gacgacttgt taccgttgag tttcgggcca gaacaattac aatag 525 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 gttttagcct tagacatgac tgttc 25 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <400> 11 ggtggatcca tagttgttca attg 24 <210> 12 <211> 43 <212> DNA <213> Artificial Sequence <400> 12 tgaacaacta tggatccacc atggcttcca gaaagtctcc aag 43 <210> 13 <211> 45 <212> DNA <213> Artificial Sequence <400> 13 gtcatgtcta aggctaaaac tcagttactt tggttctctt caccg 45 <210> 14 <211> 38 <212> DNA <213> Artificial Sequence <400> 14 tgaacaacta tggatccacc atggtacaag aatcacgt 38 <210> 15 <211> 42 <212> DNA <213> Artificial Sequence <400> 15 gtcatgtcta aggctaaaac ttacaaataa ctagtatcga gg 42 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <400> 16 gtttaaacag ttcgtttgtg caagctt 27 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <400> 17 cgaataataa ctgttatttt tcagt 25 <210> 18 <211> 45 <212> DNA <213> Artificial Sequence <400> 18 aaaataacag ttattattcg agatcttttt tgtagaaatg tcttg 45 <210> 19 <211> 44 <212> DNA <213> Artificial Sequence <400> 19 cacaaacgaa ctgtttaaac tctcacttaa tcttctgtac tctg 44 <210> 20 <211> 43 <212> DNA <213> Artificial Sequence <400> 20 tgaacaacta tggatccacc atgagtattc ggaatgataa tgc 43 <210> 21 <211> 40 <212> DNA <213> Artificial Sequence <400> 21 gtcatgtcta aggctaaaac tcacttcttt ccccacggta 40 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <400> 22 gaattcccta gggcggccg 19 <210> 23 <211> 45 <212> DNA <213> Artificial Sequence <400> 23 agaagattaa gtgagagttt agatcttttt tgtagaaatg tcttg 45 <210> 24 <211> 44 <212> DNA <213> Artificial Sequence <400> 24 cacaaacgaa ctgtttaaac tctcacttaa tcttctgtac tctg 44 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <400> 25 atgagattgt tcgacccat 19 <210> 26 <211> 46 <212> DNA <213> Artificial Sequence <400> 26 gcgaattaat tcgcggccgc tcaatgatga tgatgatgat gtcttc 46 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 cggccgcgaa ttaattcgcc 20 <210> 28 <211> 38 <212> DNA <213> Artificial Sequence <400> 28 catgggtcga acaatctcat acccatggtc ctcgtttc 38 <210> 29 <211> 45 <212> DNA <213> Artificial Sequence <400> 29 acagctatga ccatgattac gaattccgtc gccatttgga gtgaa 45 <210> 30 <211> 38 <212> DNA <213> Artificial Sequence <400> 30 cggtaccatc gatgagctcg gtagcaaggg aaatgtca 38 <210> 31 <211> 40 <212> DNA <213> Artificial Sequence <400> 31 cgagctcatc gatggtaccg ctgttaaggt tcgtatggag 40 <210> 32 <211> 45 <212> DNA <213> Artificial Sequence <400> 32 gtaaaacgac ggccagtgcc aagctatccc gtttatggtc gcaag 45 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <400> 33 ccgtcgccat ttggagtg 18 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <400> 34 atcccgttta tggtcgcaag 20 <210> 35 <211> 86 <212> DNA <213> Artificial Sequence <400> 35 gctgcactga tgagtccgtg aggacgaaac gagtaagctc gtctgcagct ggtcagcagc 60 atagttttag agctagaaat agcaag 86 <210> 36 <211> 39 <212> DNA <213> Artificial Sequence <400> 36 atcagatgta cactaaaagc gtcccattcg ccatgccga 39 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <400> 37 gcttttagtg tacatctgat aa 22 <210> 38 <211> 42 <212> DNA <213> Artificial Sequence <400> 38 cacggactca tcagtgcagc catggtgttt tgatagttgt tc 42 <210> 39 <211> 23 <212> DNA <213> Artificial Sequence <400> 39 cacgggtgat tacttgttta cat 23 <210> 40 <211> 23 <212> DNA <213> Artificial Sequence <400> 40 caataccgat aaagtggtca act 23 <210> 41 <211> 63 <212> DNA <213> Artificial Sequence <400> 41 acgaaacgag taagctcgtc caacaccctg gcctgggtgt gttttagagc tagaaatagc 60 aag 63 <210> 42 <211> 65 <212> DNA <213> Artificial Sequence <400> 42 gacgagctta ctcgtttcgt cctcacggac tcatcagcaa caccatggtg ttttgatagt 60 tgttc 65 <210> 43 <211> 18 <212> DNA <213> Artificial Sequence <400> 43 cttggcactg gccgtcgt 18 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <400> 44 cgtaatcatg gtcatagctg t 21 <210> 45 <211> 38 <212> DNA <213> Artificial Sequence <400> 45 cagctatgac catgattacg cgaggaattc acgtggcc 38 <210> 46 <211> 36 <212> DNA <213> Artificial Sequence <400> 46 cgtgtcagac tagtggttta gttcctcacc ttgtcg 36 <210> 47 <211> 32 <212> DNA <213> Artificial Sequence <400> 47 actaaaccac tagtctgaca cgtccgacgg cg 32 <210> 48 <211> 40 <212> DNA <213> Artificial Sequence <400> 48 aaacgacggc cagtgccaag ctgagcgtca gaccccgtag 40 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <400> 49 cgaggaattc actgggcc 18 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <400> 50 ctgagcgtca gaccccgtag 20 <210> 51 <211> 41 <212> DNA <213> Artificial Sequence <400> 51 gctatgacca tgattacgaa ggcaaagacg actatgtgaa g 41 <210> 52 <211> 45 <212> DNA <213> Artificial Sequence <400> 52 ctttttccga attcggatcc ctctggaagt gataatgaca tcttg 45 <210> 53 <211> 43 <212> DNA <213> Artificial Sequence <400> 53 ttccagaggg atccgaattc ggaaaaagtt tgttctgagt tgt 43 <210> 54 <211> 53 <212> DNA <213> Artificial Sequence <400> 54 acgacggcca gtgccaagct tgcatgcctg ccctgcatac ttggactacc tag 53 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <400> 55 ggcaaagacg actatgtgaa g 21 <210> 56 <211> 22 <212> DNA <213> Artificial Sequence <400> 56 cctgcatact tggactacct ag 22 <210> 57 <211> 63 <212> DNA <213> Artificial Sequence <400> 57 acgaaacgag taagctcgtc gcaatatgga ctgagtatgg gttttagagc tagaaatagc 60 aag 63 <210> 58 <211> 65 <212> DNA <213> Artificial Sequence <400> 58 gacgagctta ctcgtttcgt cctcacggac tcatcaggca atacatggtg ttttgatagt 60 tgttc 65 <210> 59 <211> 63 <212> DNA <213> Artificial Sequence <400> 59 acgaaacgag taagctcgtc ccattctccc aagaccacag gttttagagc tagaaatagc 60 aag 63 <210> 60 <211> 65 <212> DNA <213> Artificial Sequence <400> 60 gacgagctta ctcgtttcgt cctcacggac tcatcagcca ttccatggtg ttttgatagt 60 tgttc 65 <210> 61 <211> 45 <212> DNA <213> Artificial Sequence <400> 61 tatgaccatg attacgaatt caccctatca tgttgatagt ccaac 45 <210> 62 <211> 46 <212> DNA <213> Artificial Sequence <400> 62 cccgacggta ccatcgatga gctccaagtc caattgaggc atcagg 46 <210> 63 <211> 48 <212> DNA <213> Artificial Sequence <400> 63 acttggagct catcgatggt accgtcgggc cagaacaatt acaataga 48 <210> 64 <211> 42 <212> DNA <213> Artificial Sequence <400> 64 acgacggcca gtgccaagct gacctgaact tgtcagacaa cg 42 <210> 65 <211> 25 <212> DNA <213> Artificial Sequence <400> 65 caccctatca tgttgatagt ccaac 25 <210> 66 <211> 21 <212> DNA <213> Artificial Sequence <400> 66 gacctgaact tgtcagacaa c 21 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <400> 67 gggagaaagg cggacaggta 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <400> 68 tacctgtccg cctttctccc 20 <210> 69 <211> 43 <212> DNA <213> Artificial Sequence <400> 69 caagctggcg ctaattcatg ccacacacca tagcttcaaa atg 43 <210> 70 <211> 42 <212> DNA <213> Artificial Sequence <400> 70 gcacgtgatg aaaaggaagc cagtatagcg accagcattc ac 42 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <400> 71 gcttcctttt catcacgtgc 20 <210> 72 <211> 19 <212> DNA <213> Artificial Sequence <400> 72 catgaattag cgccagctt 19
Claims
1. A method for producing cytidine 5'-monophosphate, characterized by, The method comprises: (1) providing a yeast engineering bacterium, wherein an expression cassette of the following group of proteins is transformed into the yeast engineering bacterium: Cct protein, Cki protein, Hnm1 protein and sATP6 protein; and the following group of proteins selected from any one of (a)-(c) is down-regulated: (a) His4, ku70 and shble, (b) his4, ku70, shble and 5'-NT, (c) his4, ku70, shble and Cda; the yeast engineering bacterium is Pichia pastoris; the Cct protein is derived from Pichia pastoris, the Cki protein and Hnm1 protein are derived from Saccharomyces cerevisiae BY4742, and the sATP6 protein is derived from Arabidopsis thaliana; wherein the nucleotide sequence of the coding gene of the Cct protein is as shown in SEQ ID NO: 1 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the Cki protein is as shown in SEQ ID NO: 2 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the Hnm1 protein is as shown in SEQ ID NO: 3 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the sATP6 protein is as shown in SEQ ID NO: 4 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the His4 protein is as shown in SEQ ID NO: 5 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the ku70 protein is as shown in SEQ ID NO: 6 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the shble protein is as shown in SEQ ID NO: 7 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the 5'-NT protein is as shown in SEQ ID NO: 8 or a degenerate sequence thereof; and the nucleotide sequence of the coding gene of the Cda protein is as shown in SEQ ID NO: 9 or a degenerate sequence thereof; (2) culturing the yeast engineering bacterium of (1) to generate cytidine diphosphate choline product with phosphocholine and CMP as substrates, wherein the concentration of CMP is 10-25 g / L, and the concentration of phosphocholine is 6-20 g / L.
2. The method of claim 1, wherein, The method for down-regulating the coding gene of the protein in the engineering bacterium comprises: knocking out the coding gene by homologous recombination; or knocking out the coding gene by gene editing using CRISPR system.
3. The method of claim 1, wherein, In the formula (1), the expression cassette further comprises a promoter, wherein the promoter comprises a constitutive promoter or a methanol inducible promoter; the constitutive promoter comprises GAP a promoter; and the methanol inducible promoter comprises AOX1 a promoter.
4. The method of claim 1, wherein, In (2), the culture medium for culturing the yeast engineering bacterium comprises YPD, YPG, YPM medium, or a combination thereof.
5. The method according to any one of claims 1 to 4, characterized in that, The concentration of CMP is 15-20 g / L, and the concentration of phosphocholine is 6-15 g / L.
6. The method according to any one of claims 1 to 4, characterized in that, The concentration of CMP is 18 g / L, and the concentration of phosphocholine is 15 g / L.
7. Use of a regulatory substance in the preparation of cytidine or in the improvement of the yield of cytidine, wherein the cytidine is produced by an engineered yeast strain; the regulatory substance comprises a coding gene or an expression cassette of a group of proteins consisting of Cct protein, Cki protein, Hnm1 protein and sATP6 protein; the regulatory substance further comprises a substance that knocks out the coding gene of a protein selected from any one of groups (a)-(c): (a) His4, ku70 and shble, (b) his4, ku70, shble and 5'-NT, (c) his4, ku70, shble and Cda; the engineered yeast strain is Pichia pastoris; the Cct protein is derived from Pichia pastoris, the Cki protein and the Hnm1 protein are derived from Saccharomyces cerevisiae BY4742, and the sATP6 protein is derived from Arabidopsis thaliana. wherein The nucleotide sequence of the coding gene of the Cct protein is shown in SEQ ID NO: 1 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the Cki protein is shown in SEQ ID NO: 2 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the Hnm1 protein is shown in SEQ ID NO: 3 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the sATP6 protein is shown in SEQ ID NO: 4 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the His4 protein is shown in SEQ ID NO: 5 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the ku70 protein is shown in SEQ ID NO: 6 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the shble protein is shown in SEQ ID NO: 7 or a degenerate sequence thereof; the nucleotide sequence of the coding gene of the 5'-NT protein is shown in SEQ ID NO: 8 or a degenerate sequence thereof; and the nucleotide sequence of the coding gene of the Cda protein is shown in SEQ ID NO: 9 or a degenerate sequence thereof.