H3f3a beta protein involved in regulating telomere length and application thereof

By constructing H3F3Aβ-specific knockout and mutation recovery cell lines, the regulatory role of H3F3Aβ protein on telomere length was studied. This solved the unknown problem of histone H3F3A protein subtypes in telomere length regulation, and achieved effective regulation of telomere length and cell proliferation, which has the potential for application as an anti-aging drug.

CN115925868BActive Publication Date: 2026-03-03KUORAN BIOMEDICAL TECH (SHANGHAI) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211439100.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-17
Publication Date
2026-03-03
Estimated Expiration
2042-11-17

AI Technical Summary

Technical Problem

In the existing technology, there are few studies on the subtypes of histone H3F3A protein, and its role in regulating telomere length is not fully understood, resulting in unclear telomere length regulation and cellular aging processes in tumor cells.

Method used

We constructed H3F3Aβ-specific knockout cell lines and H3F3Aβ mutation recovery cell lines. By constructing expression vectors for the H3F3Aβ gene and the H3F3Aβ mutant gene, we studied their effects on telomere length and found that H3F3Aβ is involved in the maintenance and regulation of telomere length.

Benefits of technology

The telomere length of H3F3Aβ-specific knockout cell lines was significantly shortened and cell proliferation was slowed, while the telomere length of H3F3Aβ-mutant restored cell lines was significantly increased and cell proliferation was accelerated, demonstrating the biological role of H3F3Aβ in maintaining telomere length and its potential for preparing anti-aging drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115925868B_ABST
    Figure CN115925868B_ABST
Patent Text Reader

Abstract

The application discloses H3F3A beta protein involved in regulating telomere length and application thereof. The amino acid sequence of the H3F3A beta protein is shown in the sequence table SEQ ID NO:1. The application constructs H3F3A beta specific knockout cell lines and H3F3A beta mutant recovery cell lines, finds that compared with a wild type control group, the telomere length of the H3F3A beta specific knockout cell lines is significantly shortened, and cell proliferation is significantly slowed down, the telomere length of the H3F3A beta mutant gene recovery cell lines is significantly lengthened, and cell proliferation is significantly accelerated, proves that H3F3A beta plays a biological role in maintaining the length of telomeres, and has an effective inhibiting effect on the shortening of the length of telomeres by overexpressing H3F3A beta. Since the length of telomeres can directly affect the aging process of the body, therefore, the H3F3A beta and the mutant related genes or the recombinant expression vector provided by the application have the potential for preparing anti-aging drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to an H3F3Aβ protein involved in regulating telomere length and its applications. Background Technology

[0002] Telomeres are repetitive TTAGGG sequences at the ends of chromosomes. Studies have shown that telomeres gradually shorten with age and are significantly associated with cellular aging. Telomerase is a reverse transcription DNA polymerase that uses its own mRNA as a template to synthesize DNA under the reverse transcription action of hTert, adding it to the ends of chromosomes to maintain telomere length. Telomerase activity is undetectable in most somatic cells, but its expression can be detected in highly proliferating cells such as stem cells, germ cells, and 85%-95% of tumor cells. Telomere shortening and telomerase reactivation play important roles in tumorigenesis and development. On the one hand, telomere shortening can cause chromosomal instability and tumor initiation; on the other hand, tumor formation requires telomerase reactivation to stabilize telomere consumption. Telomerase activation is closely related to tumor progression, poor prognosis, and the risk of recurrence. The maintenance of telomere length and telomerase activity are also closely related to the immortalization of tumor cells.

[0003] Histone mutations are associated with various cancers. Abnormalities in the post-translational modifications of histones, as well as abnormalities in the location of histone modifications, can lead to tumorigenesis. Histone H3 family protein 3A (H3F3A) encodes histone variant H3.3, and its K27M mutation is extremely common in gliomas in both children and adults. K27 is an important residue in all histone H3 variants, and can be modified by both acetylation and methylation. H3F3A protein is associated with glioblastoma, which is classified into six subtypes based on its mutation status. Each subtype has different DNA methylation patterns, and the pathological mechanisms differ between children and adults. For example, diffuse true pontine glioma is a rapidly progressing pediatric tumor that commonly occurs in the brainstem and is a leading cause of death from pediatric brain tumors. While the mutations of H3F3A protein are relatively well understood, research on whether new subtypes of H3F3A protein exist and the properties of these subtypes is limited. Summary of the Invention

[0004] The purpose of this invention is to provide an H3F3Aβ protein involved in regulating telomere length and its applications.

[0005] An H3F3Aβ protein involved in regulating telomere length, the amino acid sequence of which is shown in SEQ ID NO:1 of the sequence listing.

[0006] The nucleotide sequence of the H3F3Aβ gene is shown in the sequence listing SEQ ID NO:2.

[0007] An expression vector containing the H3F3Aβ gene.

[0008] Primers for amplifying any fragment of the H3F3Aβ gene.

[0009] The H3F3Aβ protein mutant involved in regulating telomere length, the amino acid sequence of which is shown in SEQ ID NO:3 of the sequence listing.

[0010] The nucleotide sequence of the H3F3Aβ mutant gene is shown in the sequence listing SEQ ID NO:4.

[0011] An expression vector containing the H3F3Aβ mutant gene.

[0012] Primers for amplifying any fragment of the H3F3Aβ mutant gene.

[0013] The application of the expression vector of the H3F3Aβ gene and the expression vector of the H3F3Aβ mutant gene in the preparation of anti-aging drugs.

[0014] An anti-aging drug comprising an expression vector for the H3F3Aβ gene and an expression vector for the H3F3Aβ mutant gene, as well as a pharmaceutically acceptable vector.

[0015] The beneficial effects of this invention: This invention constructs H3F3Aβ-specific knockout cell lines and H3F3Aβ mutant gene recovery cell lines. Compared with the wild-type control group, the telomere length of the H3F3Aβ-specific knockout cell lines was significantly shortened, and cell proliferation was significantly slowed. The telomere length of the H3F3Aβ mutant recovery cell lines was significantly increased, and cell proliferation was significantly accelerated. This demonstrates that H3F3Aβ plays a biological role in maintaining telomere length, and that overexpression of H3F3Aβ effectively inhibits telomere shortening. Given that telomere length directly affects the aging process, the H3F3Aβ and its mutant-related genes or recombinant expression vectors provided by this invention have the potential to prepare anti-aging drugs. Attached Figure Description

[0016] Figure 1 The image shows the SDS-PAGE results of H3F3A subtypes enriched and identified by immunoprecipitation with H3F3A antibody in HeLa cells.

[0017] Figure 2 Bar chart showing the relative telomere lengths of wild-type HeLa, H3F3Aβ-specific knockout HeLa cell lines, and H3F3Aβ' transgenic HeLa cell restorer lines. Detailed Implementation

[0018] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0019] Example 1

[0020] HeLa cell line was purchased from the cell bank of Shanghai Institute of Cell Biology, Chinese Academy of Sciences. HeLa cells were cultured in DMEM containing 10% fetal bovine serum in a 37°C, 5% CO2 saturated humidity incubator. The culture medium contained 100 U / mL of ampicillin and streptomycin.

[0021] Extraction of total mRNA and preparation of cDNA from cells:

[0022] (1) Collect cultured HeLa cells, wash 3 times with 1×PBS, and add 1ml / 1×10 6 Cells were pipetted with Trizol and incubated at room temperature for 5 min to allow for complete lysis. The cells were then centrifuged at 12,000 rpm at 4°C for 10 min, and the supernatant was collected.

[0023] (2) Add 200 μl of chloroform to each 1 ml of Trizol, shake vigorously to mix, and let it stand at room temperature for 5 min to allow it to separate naturally; centrifuge at 12000 rpm for 30 min at 4℃, and the sample will be separated into three layers: an upper colorless aqueous phase, a middle layer and a yellow organic phase. The RNA is mainly in the upper aqueous phase. Then transfer the aqueous phase to a new 1.5 ml EP tube and aspirate the supernatant.

[0024] (3) Add an equal volume of ice-cold isopropanol to the supernatant, place at room temperature for 15 min, then centrifuge at 12000 rpm for 20 min at 4℃, discard the supernatant, and the RNA precipitate at the bottom of the EP tube.

[0025] (4) Add 1 ml of 75% ethanol to the RNA precipitate, slowly vortex the EP tube to suspend the precipitate, centrifuge at 8000 rpm at 4℃ for 2 min, repeat the washing once, carefully aspirate the supernatant with a pipette, and let the precipitate dry at room temperature for 20 min.

[0026] (5) Add 50-100 μl of RNase-free water to the precipitate, gently pipette to dissolve and mix, take a small amount to dilute, and detect the concentration of RNA with a UV spectrophotometer. The 260 / 280 ratio is between 1.8 and 2.0, and the 260 / 230 ratio is between 2.0 and 2.4, which is acceptable.

[0027] (6) Take 4 μg of quantified RNA, add 1 μl of primer oligo(T)18, 1 μl of 10 mM dNTP, and add nuclease-free water to 12 μl. After the mixture is incubated in a water bath at 65°C for 5 min, it is quickly placed on ice to cool. After a short centrifugation, add 2 μl of 0.1 MDTT, 4 μl of M-MLV RT 5× buffer, and 1 μl of nuclease inhibitor. Mix gently and incubate at 37°C for 2 min. Then, add 1 μl of M-MLV reverse transcriptase at room temperature, mix gently, and incubate at 37°C for 50 min. After incubation, store at -20°C for later use.

[0028] Using the prepared HeLa cDNA as a template, PCR amplification was performed using the H3F3Aβ-F / H3F3Aβ-R primer pair (Table 1) to obtain the H3F3Aβ encoding gene. The H3F3Aβ-F primer sequence is shown in SEQ ID NO:5 of the nucleotide sequence listing; the H3F3Aβ-R primer sequence is shown in SEQ ID NO:6 of the nucleotide sequence listing. The H3F3Aβ encoding gene sequence was inserted into the pEGFP-N1 eukaryotic expression vector to obtain the recombinant expression vector pEGFP-N1-H3F3Aβ containing the gene.

[0029] H3F3Aβ-F: ATT GGATCC GGTACCATGGCTCGTACAAAGC (SEQ ID NO:5, with the introduction of a BamHI restriction site);

[0030] H3F3Aβ-R:GCA GAATTC AATGAAATGTTTCCCATCATAG (SEQ ID NO:6, with an EcoRI restriction site introduced).

[0031] Table 1

[0032] Volume (uL) template 2uL Primer F / R 1uL each dNTPs 5uL fast Pfu buffer 10uL <![CDATA[ddH2O]]> 1uL

[0033] PCR reaction conditions: 98℃, 2 min; 98℃, 30 s, 53℃, 30 s, 72℃, 90 s, 36 cycles; extension at 72℃ for 5 min.

[0034] Example 2

[0035] Using the pEGFP-N1-H3F3Aβ expression vector as a template, mutants were obtained by overlapping extension PCR. The mutation sites were GK to TT at amino acid residues 47 and 48. The expression vector pEGFP-N1-H3F3Aβ' was then reconstructed.

[0036] The specific steps are as follows:

[0037] (1) Design primers

[0038] H3F3Aβ-F: ATT GGATCC GGTACCATGGCTCGTACAAAGC (SEQ ID NO:5, with the introduction of a BamHI restriction site);

[0039] H3F3Aβ'-R: AAGAAATGTAGTTCTCATTCTGAC (SEQ ID NO: 7);

[0040] H3F3Aβ'-F:GAATGAGAACTACATTTCTTGCTG (SEQ ID NO: 8);

[0041] H3F3Aβ-R:GCA GAATTC AATGAAATGTTTCCCATCATAG (SEQ ID NO:6, with an EcoRI restriction site introduced).

[0042] Gene fragment 1 was obtained by PCR using H3F3Aβ-F and H3F3Aβ'-R primer pairs, and gene fragment 2 was obtained by PCR using H3F3Aβ'-F and H3F3Aβ-R primer pairs. The PCR reaction system consisted of: 0.2 mM dNTPs, 10 μL 10X Pfu Buffer, 5 U Pfu DNA polymerase, 100 ng template, 1 mM primers each, and ddH2O to a final volume of 100 μL. The PCR program was as follows: denaturation at 94 °C for 2 min; 30 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 55 s; and extension at 72 °C for 10 min. The amplified gene fragments 1 and 2 were recovered by 1% gel electrophoresis and purified.

[0043] Gene fragment 1 and gene fragment 2 were mixed in equal amounts and primer-free PCR was performed. The fragments served as templates for each other, and the long fragments were amplified by overlapping extension PCR. The PCR reaction system was as follows: 0.2 mM dNTP, 2 μL 10X Pfu Buffer, 1 U Pfu DNA polymerase, 10 ng each of gene fragment 1 and gene fragment 2, and ddH2O to 20 μL. The PCR program was as follows: denaturation at 94℃ for 2 min; 30 cycles of 94℃ for 20 s, 60℃ for 30 s, 72℃ for 85 s; extension at 72℃ for 10 min.

[0044] Full-length DNA synthesis: 50 pmol of outer primers H3F3Aβ-F and H3F3Aβ-R were added to the above reaction product for PCR amplification. The PCR program was as follows: denaturation at 94℃ for 2 min; 30 cycles of 94℃ for 20 s, 60℃ for 30 s, 72℃ for 90 s; extension at 72℃ for 10 min; the reaction product was recovered by 1% gel electrophoresis and purified using a gel extraction kit.

[0045] The mutant gene was digested with BamHI and EcoRI restriction enzymes and then cloned into the pEGFP-N1 eukaryotic expression vector to obtain the recombinant expression vector pEGFP-N1-H3F3Aβ' containing the gene.

[0046] Example 3

[0047] HeLa cells were lysed using a hypotonic buffer containing NP40 as the main functional component and mixed with SDS-PAGE loading buffer. After boiling at 100°C for 10 min, the cells were electrophoresed in 6% SDS-PAGE and subjected to Western blotting. Electrophoresis was performed at a constant voltage of 80V for 2 h to ensure the 10 kDa molecular weight marker was located at the bottom of the polyacrylamide gel. Transfer was performed at a constant current of 100 mA for 6 h. H3F3A and its isotypes were identified using a rabbit-derived H3F3A-specific antibody. An unknown band of approximately 21 kDa was found above the H3F3A band in each cell line.

[0048] Immunoprecipitation was performed on the cell lysate of the cervical cancer cell line HeLa using A / G glue beads and a self-made antibody that specifically recognizes the H3F3A protein sequence. The results showed that the 21 kDa band was well recognized and bound by the H3F3A antibody. Figure 1 This demonstrates the existence of an unknown H3F3A subtype, and we name this unknown subtype protein H3F3Aβ.

[0049] Example 4

[0050] Construction of H3F3Aβ-specific knockout cell lines using the VQR-BE3 method: An expression vector containing gRNA targeting the H3F3Aβ start codon was designed and constructed. The specific method is as follows: With the aim of mutating the sequence corresponding to the H3F3Aβ start codon to a sequence without translation initiation ability, gRNA was designed based on the PAM sequence NGAN of VQR-BE3 and the mutation mode G>A or C>T, combined with the DNA sequence near the H3F3Aβ start codon.

[0051] Two complementary single-stranded gRNA sequences were denatured and annealed at 95°C to form double-stranded gRNA, which was then ligated into the pX459 vector using T4 ligase. The pX459 vector and the pBK-VQR-BE3 vector were co-transfected into HeLa cells under the conditions shown in Table 2.

[0052] Table 2

[0053] Volume (uL) pBK-VQR-BE3 5.8uL (3.8ug) pX459 1.5uL (1.3ug) jetPRIME 10uL jetPRIME buffer 400uL

[0054] The experiment was performed using the jetPRIME reagent from Polyplus. The medium was changed in HeLa cells cultured in 6cm plates, 5mL of DMEM was added, and the cells were transfected using the above system. Homozygous target mutations were identified and labeled as HeLa' cells for later use.

[0055] HeLa cells were transfected with the expression vector pEGFP-N1-H3F3Aβ', and positive cells were identified and labeled as HeLa" cells.

[0056] Example 5

[0057] The proliferation of the H3F3Aβ knockout cell line HeLa' and the restored cell line HeLa" was determined using a colony formation assay. The steps included: using the wild-type HeLa monoclonal cell line as a control, the H3F3Aβ-specific knockout cell line was seeded at a density of 250 cells / well in 6-well plates, with the culture medium changed every 6 days. After 15 days of culture, colonies formed from single cells were visible at the bottom of the wells. The culture medium was discarded, and the cells were fixed with 4% paraformaldehyde for 15 min, then stained with Giemsa stain for 30 min. The cells were washed several times with PBS and double-distilled water, and the number of single colonies in each well was counted.

[0058] The results showed that the number of monoclonal antibodies formed in each group of H3F3Aβ-specific knockout cell lines was significantly less than that in each wild-type control group, indicating that H3F3Aβ knockout led to a slowdown in cell proliferation. The number of monoclonal antibodies formed in each group of H3F3Aβ' transfected cell lines was significantly greater than that in each wild-type control group, indicating that H3F3Aβ' transfection led to the recovery of cell proliferation and exceeded the original level.

[0059] The changes in telomere length in H3F3Aβ knockout cell lines and H3F3Aβ' transgenic cell lines were determined by real-time quantitative PCR, including the following steps: Genomic DNA from H3F3Aβ knockout cell lines, H3F3Aβ' transgenic cell lines, and corresponding wild-type control groups was isolated and purified by centrifugation column method. Simultaneously, genomic DNA from a group of untreated HeLa cells was purified. Five tubes of genomic DNA were serially diluted three-fold with nuclease-free water as standards for subsequent experiments to create concentration-absorbance standard curves. The following two pairs of primers were used to amplify telomere repeat sequences and the single-copy internal reference gene HbG, respectively:

[0060] The primers used for telomere repeat sequence amplification are as follows:

[0061] tel1b: 5′-CGGTTT(GTTTGG)5GTT-3′;

[0062] tel2b: 5′-GGCTTG(CCTTAC)5CCT-3′;

[0063] The primers used for amplifying a single-copy internal reference gene are as follows:

[0064] hbg1: 5′GCTTCTGACACAACTGTGTTCACTAGC-3′;

[0065] hbg2: 5′-CACCAACTTCATCCACGTTCACC-3′.

[0066] The qPCR reaction system is shown in Table 3.

[0067] Table 3

[0068] Volume (uL) Genomic DNA 1uL Nuclease-free water 7uL forward / reverse primers 2uL Mix 10uL

[0069] The primers tel1b and tel2b were added in a 1:9 ratio; hbg1 and hbg2 were added in a 3:7 ratio; the mix used was Thermo Fisher Scientific's PowerUp SYBR Green mix, and the two systems were prepared separately before being mixed.

[0070] Telomeric repeat sequences and single-copy internal reference genes were amplified by two rounds of qPCR. The amplification program for telomeric repeat sequences was 95℃, 15s, 54℃, 2min, for a total of 18 cycles; the amplification program for the single-copy gene HbG was 95℃, 15s, 58℃, 1min, for 30 cycles. Linear fitting was performed using the corresponding CT values ​​of HeLa cell genomic DNA and their concentrations. Within the serial dilution range, there was no significant difference in the slope of the telomere curve and the single-copy gene curve, proving the method's effectiveness within this concentration range. Log2(T / S) was calculated based on the CT values ​​(T) of telomere measurements in each experimental group and the CT values ​​(S) of the two single-copy gene measurements, serving as the standard for assessing the relative length of telomeres.

[0071] The results are as follows Figure 2 As shown, the relative telomere length of H3F3Aβ knockout cell lines was generally shorter than that of the wild-type control group, while the relative telomere length of H3F3Aβ' cell restorer lines was generally longer than that of the wild-type control group. This demonstrates that H3F3Aβ is involved in telomere length maintenance, and H3F3Aβ' activity is higher.

[0072] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A H3F3A β protein involved in regulating telomere length, characterized in that, The amino acid sequence of the H3F3Aβ protein is shown in the sequence table SEQ ID NO:

1.

2. A gene encoding the H3F3A protein of claim 1, characterized in that, The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO:

2.

3. An expression vector containing the gene of claim 2.

4. A primer for amplifying any fragment of the gene of claim 2.

5. The mutant of H3F3A β protein involved in the regulation of telomere length according to claim 1, characterized in that, The amino acid sequence of the H3F3Aβ protein mutant is shown in the sequence table SEQ ID NO:

3.

6. A gene encoding the H3F3A β protein mutant of claim 5, characterized in that, The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO:

4.

7. An expression vector containing the gene of claim 6.

8. A primer for amplifying any fragment of the gene of claim 6.

9. Use of the expression vector of claim 3 and the expression vector of claim 7 in the preparation of an anti-aging drug.

10. A medicament for anti-aging, characterized by, The expression vector of claim 3 and the expression vector of claim 7, and a pharmaceutically acceptable carrier.