A kit and method for detecting gene mutation sites by fluorescent quantitative PCR based on locked ring probes

Through the lock ring probe combined with fluorescence quantitative PCR technology, the existing gene mutation detection methods are solved, and rapid, sensitive and specific gene mutation detection is achieved, suitable for large-scale detection of new coronavirus and clinical diseases.

CN115927573BActive Publication Date: 2025-08-12DONGGUAN SOUTHEAST CENTRAL HOSPITAL (DONGGUAN SOUTHEAST TRADITIONAL CHINESE MEDICINE MEDICAL SERVICE CENTER DONGGUAN FIRST HOSPITAL AFFILIATED TO GUANGDONG MEDICAL UNIVERSITY)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310019274.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-06
Publication Date
2025-08-12
Estimated Expiration
2043-01-06

AI Technical Summary

Technical Problem

The existing gene mutation detection methods are complex in operation, high in cost, need expensive instruments and equipment, and are difficult to apply on a large scale. The existing technologies such as rolling ring amplification technology are cumbersome and costly, making it difficult to meet the needs of large-scale clinical screening.

Method used

The lock ring probe combined with fluorescence quantitative PCR technology is used to connect and amplify the padlock probe and primers to achieve high sensitivity and specific detection of gene mutation sites, simplifying the operation process and reducing costs.

Benefits of technology

It has achieved rapid, sensitive and specific detection of gene mutation sites, and is suitable for large-scale detection of new coronavirus mutant strains and detection of genetic mutations in clinical diseases. It has low cost and no special instruments are required. The detection limit is up to 54.9fM-55.12aM.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present invention discloses a kit and a detection method for detecting gene mutation sites based on fluorescent quantitative PCR using a lock ring probe. The present invention combines the lock ring probe ligation technology in RCA technology with real-time fluorescent quantitative PCR technology, utilizes the lock ring probe ligation characteristics to detect point mutations, and utilizes qPCR technology to achieve signal amplification with high sensitivity and good specificity. It has been used to detect the T478K mutation site of the SARS-cov2-Delta mutant strain, the CD17 mutation site of thalassemia, and the 531 mutation site of the rpoB gene of the rifampicin-resistant strain of Mycobacterium tuberculosis; wherein the minimum detection limit of SARS-cov2 can reach 54.9fM, and the detection limits of thalassemia and tuberculosis resistance are 95.35zM and 55.12aM, respectively. This method can also be widely used in the detection of gene mutation sites related to other diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a kit and a detection method for detecting gene mutation sites by fluorescent quantitative PCR based on locked ring probes. Background Art

[0002] PCR technology has been widely used in nucleic acid testing, but it struggles to directly detect gene mutations. The gold standard for detecting mutant strains or genes is gene sequencing. In 1977, Walter Gilbert and Frederick Sanger invented the first sequencer. This technology has evolved through high-throughput sequencing, single-molecule sequencing, and now into fourth-generation sequencing with nanopore single-molecule sequencing. DNA sequencing technology boasts high accuracy and sensitivity, enabling comprehensive analysis of target genes, enabling timely detection and monitoring of mutations. It can also provide comprehensive analysis of target genomes, accurately capturing whole-genome mutation information, and is used for disease treatment and epidemiological analysis. However, due to its complex operation, lengthy testing times, high costs, the need for expensive equipment, and the reliance on specialized personnel for analysis and interpretation of results, large-scale clinical testing is difficult.

[0003] In recent years, a variety of detection technologies have been used for mutation gene detection, such as multiplex ligation-dependent probe amplification (MLPA) [1] , amplification-blocking mutation system [2] , restriction fragment length polymorphism (RFLP) [3] , reverse linear hybridization method (INNOLIPA) [4] , gene chips [5] Detection technologies such as these have developed rapidly, but some of the above detection methods require expensive reagents and consumables, some require special instruments, some have high requirements for detection equipment or platforms, and have high requirements for personnel operation, which is not conducive to large-scale screening and wide application.

[0004] Constant temperature amplification of nucleic acid technology has attracted widespread attention in recent years due to its simplicity and ease. Among them, rolling circle amplification technology can be used to detect mutant genes. [6] The principle is simple, the reagents are cheap, the cost is low, it is easy to operate, and it is convenient for large-scale nucleic acid screening. As a molecular diagnostic technology with development potential, rolling circle amplification technology has a very broad application prospect; however, this technology also has certain disadvantages. Its operation steps require multiple experimental links such as connection and enzyme digestion, which require additional enzymes and increase the experimental costs; it requires multiple opening experiments, which also increases the operation steps, making the experiment too cumbersome; affecting large-scale clinical screening applications.

[0005] Mingcheng Xu's team developed a rolling circle-quantitative PCR (RC-qPCR) assay for miRNA detection. [7] However, this technology has yet to be applied or studied in gene mutation detection, and specific methodological performance evaluation remains unresolved. However, this technology has potential clinical applications in detecting certain diseases associated with gene mutations. For example, conditions such as thalassemia caused by gene mutations and tuberculosis resistance caused by gene mutations urgently require simple and easy-to-use gene mutation detection technology.

[0006] In summary, all of the above methods for detecting gene mutations have certain limitations. Therefore, a rapid, sensitive, specific, and inexpensive method for detecting gene mutations is urgently needed. Based on this, the present invention proposes a fluorescent quantitative PCR amplification technology based on a padlock probe (Padlock-qPCR) for detecting gene mutations.

[0007] [1] Uno N, Araki N, Kaku N, Kosai K, Hasegawa H, Yanagihara K. Clinical application of a ligation-independent pathway of multiplex ligation-dependentprobe amplification for the determination of quinolone susceptibility of Streptococcus pneumoniae. J Microbiol Methods. 2016 Sep; 128:13-15.

[0008] [2] Mahmood U, Imran M, Naik SI, Cheema HA, Saeed A, Arshad M, Mahmood S. Detection of common mutations in the GALT gene through ARMS.Gene.2012 Nov10;509(2):291-4.

[0009] [3]Montanez-Gonzalez R,Vallera AC,Calzetta M,Pichler V,Love RR,Guelbeogo MW,Dabire RK,Pombi M,Costantini C,Simard F,Della Torre A,BesanskyNJ.A PCR-RFLP method for genotyping of inversion 2Rc in Anophelescoluzzii.Parasit Vectors.2021 Mar 22;14(1):174.

[0010] [4]Swai P,Rasch V,Linde DS,Mchome B,Manongi R,Wu CS,Waldstrom M,Iftner T,Mwaiselage J,Kjaer SK.Persistence and risk factors of high-riskhuman papillomavirus infection among HIV positive and HIV negative tanzanianwomen:a cohort study.Infect Agent Cancer.2022 Jun 11;17(1):26.

[0011] [5]Long J.Parentage analysis using genome-wide high-density SNPmicroarray.Gene.2021 Jun 15;785:145605.

[0012] [6]Li R,Wang Y,Wang P,Lu J.A dual discrimination mode for improvedspecificity towards let-7a detection via a single-base mutated padlock probe-based exponential rolling circle amplification.Luminescence.2017 Dec;32(8):1574-1581.

[0013] [7] Xu M, Ye J, Yang D, Abdullah Al-Maskri AA, Hu H, Jung C, Cai S, Zeng S. Ultrasensitive detection of miRNA via one-step rolling circle-quantitativePCR (RC-qPCR). Anal Chim Acta. 2019 Oct 24; 1077:208-215. Summary of the Invention

[0014] The first aspect of the present invention aims to provide a padlock probe.

[0015] The second aspect of the present invention aims to provide a primer.

[0016] The third aspect of the present invention is to provide a kit.

[0017] The fourth aspect of the present invention aims to provide a method for detecting mutation sites.

[0018] The technical solution adopted by the present invention is:

[0019] In a first aspect of the present invention, a padlock probe is provided, wherein the sequence of the padlock probe is as follows:

[0020] Padlock T478K: 5'pTGCTACCGGCCTGATAGATTTCAGTTGAGTGGAACCGAGGAAATAGAGAACCCATCCAGCACTTCCCtatgTCTCTCCCACATCGTTTCTTTCAACACCATTACAAGGTT-3'; or

[0021] Padlock THA17: 5'pGCCCCACAGGGCAGTAACGGCGTGGAACCGAGGAAATAGAGAACCCCATCCAGCACTTCCCTATGTCTCTCCCACATCGTTTCTCTTCATCCACGTTCACCTA-3'; or

[0022] Padlock rpoB531: 5'pACAGTCGGCGCTTGTGGGTCAAGTGGAACCGAGGAAATAGAGAACCCCATCCAGCACTTCCCTATGTCTCTCCCACATCGTTTCTCGGGCCCCAGCGCCA-3'.

[0023] The second aspect of the present invention provides a primer comprising an upstream primer and a downstream primer.

[0024] The upstream primer sequence: 5'-CCATCCAGCACTTCCCTATGTCT-3';

[0025] The downstream primer sequence is: 5'-GGTTCTCTATTTCCTCGGTTCCAC-3'.

[0026] The third aspect of the present invention provides a kit comprising the padlock probe described in the first aspect of the present invention and / or the primer described in the second aspect of the present invention.

[0027] Preferably, the kit comprises a TaqMan probe or a DNA fluorescent dye.

[0028] Preferably, the sequence of the TaqMan probe is: 5'-CTCCCACATCGTTTCT-3'.

[0029] Preferably, the 5' end is connected to a fluorescent reporter group, and the 3' end of the probe fragment is connected to a quencher group.

[0030] Preferably, the reporter group is selected from FAM, ROX, VIC, HEX, TET, JOE, NED, Cy5, and Cy3.

[0031] Preferably, the quenching group is selected from BQH1, BHQ2, BHQ3, TAMARA, and NFQ-MGB.

[0032] Preferably, the DNA fluorescent dye comprises SYBR Green I.

[0033] Preferably, the kit further comprises DNA ligase, buffer, Taq enzyme, magnesium ions, and dNTPs.

[0034] Preferably, the concentration of the padlock probe in the kit is 1-100 nM.

[0035] Preferably, the concentration of the primer is 150-250 mM.

[0036] Preferably, the concentration of the Taqman probe is 100-200 nM.

[0037] A fourth aspect of the present invention provides a method for detecting a mutation site, comprising the following steps:

[0038] S1: Probe ligation: hybridize the padlock probe with the target DNA to be detected and connect them into a ring under the action of ligase;

[0039] S2: Amplification of the probe: using primers to perform fluorescent quantitative PCR amplification on the ligation product generated in step S1.

[0040] Preferably, the reaction system of step S1 comprises:

[0041]

[0042] Preferably, the reaction conditions of step S1 include: 92-96° C. for 3-7 s, 63-67° C. for 3-7 min, and 4-8 cycles.

[0043] Preferably, the reaction system of step S2 comprises (I) or (II):

[0044] (I) When using a DNA fluorescent dye, the reaction system comprises:

[0045]

[0046] (II) When Taqman probe is used, the reaction system includes:

[0047]

[0048]

[0049] Preferably, the reaction conditions of step S2 include: preheating at 93-95°C for 2-4 min, 93-95°C for 4-6 s, 58-62°C for 23-27 s, and 38-42 cycles; or preheating at 93-95°C for 25-35 s; 93-95°C for 15-25 s, 58-62°C for 15-25 s, 66-70°C for 25-35 s, and 55-65 cycles; 66-70°C for 4-6 min.

[0050] The beneficial effects of the present invention are:

[0051] The present invention aims to provide a method for detecting gene mutation sites by fluorescent quantitative PCR based on a locked ring probe. This method combines the locked ring probe ligation technology in RCA technology with real-time fluorescent quantitative PCR technology, uses the locked ring probe ligation characteristics to detect point mutations, and uses qPCR technology to achieve signal amplification. It has high sensitivity and good specificity. It has been used to detect the T478K mutation site of the Delta mutant strain, the CD17 mutation site of thalassemia, and the 531 mutation site of the rpoB gene of the rifampicin-resistant strain of Mycobacterium tuberculosis. The detection technology is simple to operate and has high feasibility. It can be directly detected for DNA point mutation templates; for RNA viruses, reverse transcription can be performed first and then detection can be performed. The required experimental materials are similar to those of ordinary PCR, no special instruments and reagents are required, the cost is low, and therefore the applicability is strong; it is conducive to the large-scale nucleic acid detection of new coronavirus mutant strains; and it can be used as the main method for detecting gene mutations in clinical diseases.

[0052] At present, the present invention has successfully established a detection system for the T478K mutation site of the SARS-CoV2-Delta strain, the CD17 (THA17) mutation site of thalassemia, and the rpoB gene 531 (rpoB531) mutation site of rifampicin-resistant Mycobacterium tuberculosis. The lowest detection limit of SARS-CoV2 can reach 54.9fM, and the detection limits of thalassemia and tuberculosis resistance are 95.35zM and 55.12aM, respectively. This means that this method can establish a sensitive, rapid, and simple detection system for a series of SARS-CoV2 mutants and can also be widely applied to the detection of gene mutation sites related to other diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 Schematic diagram of Padlock-qPCR.

[0054] Figure 2 The fluorescence curve is for T478K site-specific detection.

[0055] Figure 3 The bar graph shows the T478K site-specific detection signal.

[0056] Figure 4 This is the electropherogram for T478K site-specific detection.

[0057] Figure 5 This is the fluorescence curve diagram for sensitivity detection of T478K site.

[0058] Figure 6 This is the linear map of the T478K site.

[0059] Figure 7 This is the electrophoresis diagram for sensitivity detection of the T478K site.

[0060] Figure 8 This is the fluorescence curve diagram for sensitivity detection of THA17 site.

[0061] Figure 9 This is the linear map of the THA17 site.

[0062] Figure 10 The bar graph shows THA17-specific detection signals.

[0063] Figure 11 This is the fluorescence curve diagram for the sensitivity detection of the rpoB531 site.

[0064] Figure 12 This is the linear map of the rpoB531 site.

[0065] Figure 13 The bar graph shows the rpoB531-specific detection signal. DETAILED DESCRIPTION

[0066] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0067] Reagents: Taq DNA Ligase (catalog number M0208S) was purchased from New England Biotechnology Co., Ltd., and the ligation buffer was a matching product, containing [20 mM Tris-HCl (pH 7.6), 25 mM KAc, 10 mM Mg(Ac)2, 10 mM DTT, 1 mM NAD, and 0.1% Triton X-100]; Hot Start Taq DNA Polymerase (catalog number M0495S) was purchased from New England Biotechnology Co., Ltd., and the reaction buffer was a matching product; dNTPs (purchased from Sangon Biotechnology Co., Ltd.), 2X TaqMan Fast qPCR premix (Sangon Biotechnology Co., Ltd.), SYBR Green 1 (Sangon Biotechnology Co., Ltd.), upstream primer, downstream primer, locked circle DNA nucleic acid probe, DNA mutation site template, DNA original site template, DNA mismatch site template (M1, M2, M3), and Taqman specific probes (synthesized by Sangon Biotechnology Co., Ltd.).

[0068] The concentrations involved in the present invention are final concentrations.

[0069] The upstream primer and downstream primer sequences of the present invention are as follows:

[0070] Upstream primer sequence: 5′-CCATCCAGCACTTCCCTATGTCT-3′ (SEQ ID NO. 20);

[0071] Downstream primer sequence: 5'-GGTTCTCTATTTCCTCGGTTCCAC-3' (SEQ ID NO. 21).

[0072] The present invention can be used to detect T478K, THA17, and rpoB531 mutation sites, wherein the mutation site template sequence is shown in Table 1, the original site template sequence is shown in Table 2, the mismatch site template sequence is shown in Table 4, and the designed locked loop probe sequence is shown in Table 3.

[0073] Table 1: Mutation site template sequences

[0074]

[0075]

[0076] Table 2: Original site template sequences

[0077]

[0078] Table 3: Locked-circle probe sequences

[0079]

[0080] Table 4: Mismatch site template sequences

[0081]

[0082]

[0083] Taqman probe: 5'6-FAM-CTCCCACATCGTTTCT-3'BHQ1 (SEQ ID NO. 19).

[0084] The present invention combines the ring-locked probe ligation technology in RCA technology with real-time fluorescence quantitative PCR technology to provide a method for detecting gene mutation sites based on fluorescent quantitative PCR of ring-locked probes. The principle diagram is shown in FIG. Figure 1 shown.

[0085] Example 1: Sensitivity experiment of Padlock-qPCR technology for detecting SARS-CoV2-T478K mutation site

[0086] Experimental steps:

[0087] 1. Perform a gradient dilution of the synthesized DNA mutation template, using 10-fold as the standard dilution multiple, from 10nM to 100aM, for a total of 9 template concentrations. Dilute the ring-locked probe to 100nM; set up one blank control well.

[0088] 2. A 10 μL ligation reaction system includes: 1 μL of locked-loop probe (100 nM), 1 μL of DNA template (1 μM-100 nM), 2 μL of Taq DNA Ligase (4 U), 1 μL of 10× ligation buffer, and 5 μL of DEPC-treated water. Perform the ligation reaction using a standard PCR instrument; the reaction conditions are 94°C for 5 seconds to 65°C for 5 minutes, for a total of 6 cycles.

[0089] 3. A 20 μL amplification reaction system includes: 5 μL ligation product, 10 μL 2× TaqMan Fast qPCR MasterMix (containing fast hot-start polymerase, magnesium ions, stabilizer, dNTP Mix), 0.4 μL upstream primer (200 nM), 0.4 μL downstream primer (200 nM), 0.2 μL TaqMan probe (150 nM), and 4 μL water. Amplification was performed using a real-time fluorescence quantitative PCR instrument; the reaction conditions were preheating at 95°C for 3 min, followed by 40 cycles of heating from 95°C for 5 s to 60°C for 25 s.

[0090] See the results Figure 5 The fluorescence intensity of each group increased with the increase of SARS-cov2-T478K template concentration. The electrophoresis band of the amplified product changed from bright to dark as the concentration decreased. Figure 7 The linear graph of T478K site detection sensitivity is shown in Figure 6 In the range of 100aM to 10nM, the fluorescence and the logarithm of the template concentration showed a good linear relationship, and the linear curve fitting degree R 2 The limit of detection (LOD) was calculated to be 54.9 fM, with the mean value of the fluorescence results of the NC group from three independent experiments plus three times the standard deviation as the minimum detection fluorescence value.

[0091] Example 2: Padlock-qPCR technology to detect the specificity of the SARS-CoV-2-T478K mutation site

[0092] Experimental steps:

[0093] 1. Dilute the synthesized mutant DNA template to a concentration of 100 nM; dilute the synthesized original DNA template to a concentration of 10 nM; and dilute the locked ring probe to 100 nM. Dilute the three mismatch templates (M1, M2, and M3) to a concentration of 100 nM. Set up a blank control.

[0094] 2. A 10 μL ligation reaction system includes: 1 μL of locked-loop probe (100 nM), 1 μL of DNA template (mutation site / original site / M1 / M2 / M3), 2 μL of Taq DNA Ligase (4 U), and 1 μL of 10× ligation buffer, which is diluted to 10 μL. Perform the ligation reaction using a standard PCR instrument; the reaction conditions are 94°C for 5 seconds to 65°C for 5 minutes, for a total of 6 cycles.

[0095] 3. A 20 μL amplification reaction system includes: 5 μL of ligation product, 10 μL of 2xTaqMan Fast qPCR Master Mix (including fast hot-start polymerase, magnesium ions, stabilizer, and dNTP Mix), 0.4 μL of upstream primer (200 nM), 0.4 μL of downstream primer (200 nM), 0.2 μL of TaqMan probe (150 nM), and 4 μL of water. Amplification was performed using a real-time fluorescence quantitative PCR instrument; the reaction conditions were preheating at 95°C for 3 min, followed by 40 cycles of heating from 95°C for 5 s to 60°C for 25 s.

[0096] 4. Agarose gel electrophoresis: Dissolve agarose powder in 1% TAE solution to prepare a 2% agarose gel. Add 4 μL of gelred fluorescent dye and stain the gel. Load the sample with 5 μL of amplified product and 1 μL of buffer.

[0097] See the results Figure 2 When the amplification time was 30 minutes, only the T478K mutation site template produced a strong fluorescence signal; the fluorescence produced by amplification of other groups was significantly lower than that of the T478K mutation site template. Figure 3 The fluorescence intensity of the T478K mutation site was significantly different from that of the mismatched templates (M1, M2, M3), the original template, and the blank group; the difference was more than 3 times. Figure 4 The electrophoresis results of the amplified products are shown, and only the template with the T478K mutation site has a clear amplification band. The results of the methodological specificity evaluation show that the fluorescent quantitative PCR technology based on the locked ring probe has good specificity for detecting the SARS-CoV-2-T478K mutation point method, which can distinguish T478K from the wild-type sequence and templates with one to three mismatch sites (M1, M2, and M3).

[0098] Example 3: Sensitivity experiment of Padlock-qPCR technology for detecting THA17 mutation sites

[0099] Experimental steps:

[0100] 1. Perform a serial dilution of the synthesized DNA mutation template, using a 10-fold dilution step from 1 μM to 1 aM, for a total of 13 template concentrations: 1 μM, 100 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, 100 aM, 10 aM, and 1 aM. Dilute the ring-locked probe to 1 nM and set up one blank control well.

[0101] 2. A 10 μL ligation reaction system includes: 1 μL of locked-loop probe (1 nM), 1 μL of DNA template (1 aM-1 μM), 2 μL of TaqDNA Ligase (4 U), 1 μL of 10× ligation buffer, and 5 μL of DEPC-treated water. Perform the ligation reaction using a standard PCR instrument; the reaction conditions are 94°C for 5 seconds to 65°C for 5 minutes, for a total of 3 cycles.

[0102] 3. A 25 μL amplification reaction system includes: 10 μL ligation product, 2.5 μL reaction buffer, 2.5 μL 10× SYBR Green I, 0.5 μL upstream primer (200 nM), 0.5 μL downstream primer (200 nM), 0.5 μL dNTPs, 0.125 μL Hot start Taq polymerase, and 8.375 μL water. Amplification was performed using a real-time fluorescence quantitative PCR instrument. Reaction conditions were: preheat at 95°C for 30 seconds, followed by 60 cycles of 95°C for 20 seconds, 60°C for 20 seconds, and 68°C for 30 seconds; 68°C for 5 minutes, and 4°C for termination.

[0103] At the 20th cycle of amplification, the fluorescence intensity of each group increased with the increase of THA17 template concentration. The real-time fluorescence quantitative curves of template amplification at each concentration are shown in Figure 2. Figure 8 The linear graph of THA17 site detection sensitivity is shown in Figure 9 In the 20th cycle of the amplification reaction, the fluorescence and the logarithm of the template concentration showed a good linear relationship in the range of 1aM to 1μM, and the linear curve fitting degree R 2 The limit of detection (LOD) was calculated to be 95.35 zM, with the mean value of the fluorescence results of the NC group in three independent experiments plus three times the standard deviation as the minimum detection fluorescence value.

[0104] Example 4: Padlock-qPCR technology to detect THA17 mutation site specificity experiment

[0105] Experimental steps:

[0106] 1. Dilute the synthetic mutant DNA template, the original template, and three mismatch templates to a 1 μM concentration. Dilute the locked ring probe to 1 nM and set up a blank control well. Study the specificity of THA17 DNA detection by testing a perfectly matched template (Target THA17), a single-base mismatch template (Target THA17 M1), a double-base mismatch template (Target THA17 M2), a triple-base mismatch template (Target THA17 M3), and a wild-type template (WT) at 1 μM concentration.

[0107] 2. A 10 μL ligation reaction system includes: 1 μL of locked-loop probe (1 nM), 1 μL of DNA template (1 μM), 2 μL of Taq DNA Ligase (4 U), 1 μL of 10× ligation buffer, and 5 μL of DEPC-treated water. Perform the ligation reaction using a standard PCR instrument; the reaction conditions are 94°C for 5 seconds to 65°C for 5 minutes, for a total of 3 cycles.

[0108] 3. A 25 μL amplification reaction system includes: 10 μL ligation product, 2.5 μL reaction buffer, 2.5 μL 10× SYBR Green I, 0.5 μL upstream primer (200 nM), 0.5 μL downstream primer (200 nM), 0.5 μL dNTPs, 0.125 μL Hot start Taq polymerase, and 8.375 μL water. Amplification was performed using a real-time fluorescence quantitative PCR instrument. Reaction conditions were: preheat at 95°C for 30 seconds, followed by 60 cycles of 95°C for 20 seconds, 60°C for 20 seconds, and 68°C for 30 seconds; 68°C for 5 minutes, and 4°C for termination.

[0109] See the results Figure 10 , it can be seen that at the 20th cycle of amplification, only the perfect-match template group produced strong fluorescence. The fluorescence generated by the other groups was significantly lower than that of the perfect-match template group, with fluorescence intensity approximately 10% of the signal of the perfect-match template group. Methodological specificity evaluation results demonstrated that the lock-loop probe-based fluorescence quantitative PCR method for detecting THA17 mutations has good specificity and can distinguish THA17 from the wild-type sequence or templates with one to three mismatches.

[0110] Example 5: Sensitivity experiment of Padlock-qPCR technology for detecting rpoB531 mutation site

[0111] Experimental steps:

[0112] 1. Perform a serial dilution of the synthesized mutant DNA template, using a 10-fold dilution as the standard, from 1 μM to 10 aM, for a total of 12 template concentrations: 1 μM, 100 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, 100 aM, and 10 aM. Dilute the ring-locked probe to 1 nM and set up a blank control well. Detect the sensitivity and linear range of the rpoB531 mutant sequence at different concentrations.

[0113] 2. A 10 μL ligation reaction system includes: 1 μL of locked-loop probe (1 nM), 1 μL of DNA template (1 aM-1 μM), 2 μL of TaqDNA Ligase (4 U), 1 μL of 10× ligation buffer, and 5 μL of DEPC-treated water. Perform the ligation reaction using a standard PCR instrument; the reaction conditions are 94°C for 5 seconds to 65°C for 5 minutes, for a total of 3 cycles.

[0114] 3. A 25 μL amplification reaction system included: 10 μL ligation product, 2.5 μL reaction buffer, 2.5 μL 10× SYBR Green I, 0.5 μL upstream primer (200 nM), 0.5 μL downstream primer (200 nM), 0.5 μL dNTPs, 0.125 μL Hot Start Taq polymerase, and 8.375 μL water. Amplification was performed using a real-time fluorescence quantitative PCR instrument. The reaction conditions were: preheat at 95°C for 30 seconds, followed by 60 cycles of 95°C for 20 seconds, 60°C for 20 seconds, and 68°C for 30 seconds, followed by 68°C for 5 minutes and a final cycle at 4°C.

[0115] The real-time fluorescence quantitative curves of template amplification at each concentration are shown in Figure 11 The results showed that at the 20th cycle of amplification, the fluorescence intensity of each group increased with the increase of rpoB531 template concentration. The linear graph of rpoB531 site detection sensitivity is shown in Figure 12 In the 20th cycle of the amplification reaction, the fluorescence and the logarithm of the template concentration showed a good linear relationship in the range of 10aM to 1μM, and the linear curve fitting degree R 2 The limit of detection (LOD) was calculated to be 55.12 aM, with the mean value of the fluorescence results of the NC group from three independent experiments plus three times the standard deviation as the minimum detection fluorescence value.

[0116] Example 6: Padlock-qPCR technology to detect the specificity of rpoB531 mutation site

[0117] Experimental steps:

[0118] 1. Dilute the synthetic mutant DNA template, original template, and three mismatch templates to a concentration of 1pM; dilute the ring-locked probe to 1nM and set up a blank control well; investigate the specificity of rpoB531 DNA detection by testing a perfect match template (Target rpoB531), a single-base mismatch template (Target rpoB531 M1), a double-base mismatch template (Target rpoB531 M2), a triple-base mismatch template (Target rpoB531 M3), and a wild-type template (WT) at a concentration of 1pM.

[0119] 2. A 10 μL ligation reaction system includes: 1 μL of locked-loop probe (1 nM), 1 μL of DNA template (1 pM), 2 μL of Taq DNA Ligase (4 U), 1 μL of ligation buffer, and 5 μL of DEPC-treated water. Perform the ligation reaction using a standard PCR instrument; the reaction conditions are 94°C for 5 seconds to 65°C for 5 minutes, for a total of 3 cycles.

[0120] 3. A 25 μL amplification reaction system includes: 10 μL ligation product, 2.5 μL reaction buffer, 2.5 μL 10× SYBR Green I, 0.5 μL upstream primer (200 nM), 0.5 μL downstream primer (200 nM), 0.5 μL dNTPs, 0.125 μL Hot start Taq polymerase, and 8.375 μL water. Amplification was performed using a real-time fluorescence quantitative PCR instrument. Reaction conditions were: preheat at 95°C for 30 seconds, followed by 60 cycles of 95°C for 20 seconds, 60°C for 20 seconds, and 68°C for 30 seconds; 68°C for 5 minutes, and 4°C for termination.

[0121] See the results Figure 13 , it can be seen that at the 20th cycle of amplification, only the perfect-match template group produced strong fluorescence. The fluorescence generated by the other groups was significantly lower, with fluorescence intensity approximately 20% of the signal from the perfect-match template group. Methodological specificity evaluation results demonstrated that the ring-locked probe-based fluorescence quantitative PCR method for detecting rpoB531 mutations has good specificity, distinguishing rpoB531 from the wild-type sequence or templates with one to three mismatches.

[0122] The above specific embodiments provide a detailed description of the present invention. However, the present invention is not limited to the above embodiments. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with each other unless there is a conflict.

Claims

1. Use of padlock probes and primers in preparing a kit for detecting the T478K mutation site of SARS-CoV2-Delta strain, characterized in that: The sequence of the padlock probe is as follows: Padlock T478K: 5'pTGCTACCGGCCTGATAGATTTCAGTTGAGTGGAACCGAGGAAATAGAGAACCCCATCCAGCACTTCCCtatgTCTCTCCCACATCGTTTCTTTCAACACCATTACAAGGTT-3'; The primers include an upstream primer and a downstream primer: The upstream primer sequence: 5'-CCATCCAGCACTTCCCTATGTCT-3'; The downstream primer sequence: 5'-GGTTCTCTATTTCCTCGGTTCCAC-3'; The kit includes TaqMan probes; The sequence of the TaqMan probe is: 5'-CTCCCACATCGTTTCT-3'; The use comprises the following steps: S1: Probe ligation: hybridizing the padlock probe and the target DNA to be detected, and ligating them into a ring under the action of a ligase; S2: Probe amplification, using primers to perform fluorescent quantitative PCR amplification on the ligation product generated in step S1; The reaction system of step S1 includes: 0.5-1.5 μL of 1-100 nM locked ring probe, 0.5-1.5 μL of 1 aM-100 nM DNA template, 1-3 μL of 3-5 U Taq DNA Ligase, 0.5-1.5 μL of ligation reaction buffer and DEPC-treated water, and the volume is filled to 10 μL with water.

2. Use of padlock probes and primers in the preparation of a kit for detecting the 531 mutation site in the rpoB gene of rifampicin-resistant Mycobacterium tuberculosis strains, characterized in that: The sequence of the padlock probe is as follows: Padlock rpoB531: 5'pACAGTCGGCGCTTGTGGGTCAAGTGGAACCGAGGAAATAGAGAACCCCATCCAGCACTTCCCTATGTCTCTCCCACATCGTTTCTCGGGCCCCAGCGCCA-3'; The primers include an upstream primer and a downstream primer: The upstream primer sequence: 5'-CCATCCAGCACTTCCCTATGTCT-3'; The downstream primer sequence: 5'-GGTTCTCTATTTCCTCGGTTCCAC-3'; The kit contains a DNA fluorescent dye; The use comprises the following steps: S1: Probe ligation: hybridizing the padlock probe and the target DNA to be detected, and ligating them into a ring under the action of a ligase; S2: Probe amplification, using primers to perform fluorescent quantitative PCR amplification on the ligation product generated in step S1; The reaction system of step S1 includes: 0.5-1.5 μL of 1-100 nM locked ring probe, 0.5-1.5 μL of 1 aM-100 nM DNA template, 1-3 μL of 3-5 U Taq DNA Ligase, 0.5-1.5 μL of ligation reaction buffer and DEPC-treated water, and the volume is filled to 10 μL with water.

3. The use according to claim 1, characterized in that The 5' end of the TaqMan probe is connected to a fluorescent reporter group, and the 3' end of the probe fragment is connected to a quencher group.

4. The use according to claim 1, characterized in that The reaction conditions of step S1 include: 92-96° C. for 3-7 seconds, 63-67° C. for 3-7 minutes, and 4-8 cycles.

5. The use according to claim 1, characterized in that The reaction conditions of step S2 include: preheating at 93-95° C. for 2-4 min, 93-95° C. for 4-6 s, and 58-62° C. for 23-27 s, for 38-42 cycles.

6. The use according to claim 2, characterized in that The reaction conditions of step S2 include: preheating at 93-95° C. for 25-35 seconds; 55-65 cycles of 93-95° C. for 15-25 seconds, 58-62° C. for 15-25 seconds, and 66-70° C. for 25-35 seconds; and 66-70° C. for 4-6 minutes.

Citation Information

Patent Citations

  • Multi-RCA (rolling circle amplification) method based on split padlock probes

    CN102719550A

  • High throughput test method for tomato bacterial disease by locking-type probe

    CN103215357A

  • Lock type probe, kit and gene amplification method

    CN112176045A