Primer compositions, kits, and their applications for monitoring minimal residual disease in human leukemia.
By providing specific primer combinations and kits, a B-cell receptor gene library was constructed. PCR and next-generation high-throughput sequencing were used to solve the sensitivity and operational complexity problems of existing detection methods, achieving efficient and simplified detection of minimal residual disease in leukemia.
Patent Information
- Application Number
- CN202211368181.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-03
- Publication Date
- 2026-03-10
- Estimated Expiration
- 2042-11-03
AI Technical Summary
Existing methods for detecting minimal residual disease (MRD) in leukemia suffer from low sensitivity, complex operation, high cost, and difficulty in standardization. In particular, flow cytometry and PCR methods are insufficient in terms of sensitivity and reliability, while NGS detection, although highly sensitive, has an uncontrollable process.
Specific primer compositions and kits, including upstream and downstream primers for IGH, IGK, and IGL, as well as upstream and downstream adapters, are provided for constructing B-cell receptor gene libraries. Through PCR reaction and next-generation high-throughput sequencing, the operation process is simplified and the detection efficiency and sensitivity are improved.
It achieves highly sensitive detection of minimal residual disease in leukemia, shortens library preparation time, reduces operational complexity and personnel skill requirements, and can accurately count the copy number and B cell count of significant clones associated with hematologic malignancies.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure BDA0003924228650000051
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to primer composition, kit for monitoring of minimal residual disease of human leukemia and application thereof. BACKGROUND
[0002] With the continuous iteration of gene sequencing technology, the current second-generation sequencing technology (NGS) can be used to detect a large number of tumor marker panels with high throughput, and its application has gradually expanded to blood tumors. Taking lymphoid leukemia caused by clonal proliferation of lymphoid system cells (mainly B cells and T cells) as an example, cancer cells can be specifically identified by sequencing TCR and BCR. One of the basic characteristics of the lymphoid system cells is the rearrangement of Ig genes in B cells and TCR genes in T cells. Abnormal single Ig / TCR gene rearrangement is an important feature of B cell / T cell blood tumor patients at the molecular level. For each B or T cell, the antibody it secretes has its own unique VDJ combination, resulting in the diversity of Ig / TCR molecules, which can then serve as a specific target for tumor MRD monitoring.
[0003] Currently, there are various methods for detecting minimal residual disease (MRD) after complete remission of leukemia, such as flow cytometry detection, PCR detection, and NGS detection. Flow cytometry detection is the most commonly used detection method at present, which can be carried out in hospitals, and the detection sensitivity can reach 10 -4 , especially the multi-color flow cytometry performance is better, which can achieve lower sensitivity, the cost and period of detection are relatively low, but the disadvantages are also obvious. The type and integrity of the sample are required to be high, the experiment and result determination need rich experience, different doctors and different immune markers will get inconsistent results, the detection sensitivity is relatively low among the compared methods, and it cannot well predict the patient's relapse signs in the early stage. PCR detection has higher sensitivity than flow cytometry detection, which can reach 10 -5 , that is, one leukemia cell is detected in 100,000 cells. The disadvantage is that the time of PCR detection MRD is uncontrollable, and the primers and probes need to be designed for each patient, which is difficult to ensure the success rate at one time, and the requirements for experimenters are high, and the process is difficult to standardize. With the development of new technologies, the immunorepertoire detection method based on NGS platform can further improve the detection sensitivity, which can reach 10 -6 , or even lower, and the detection panel does not need to be customized for patients, that is, the same product is used before and after treatment to detect the sample, and new significant clones can be found in the monitoring process, which is a more ideal MRD monitoring method. SUMMARY
[0004] One of the purposes of the present application is to provide a primer composition for human leukemia minimal residual disease monitoring.
[0005] To achieve the above-mentioned purposes, the present application provides a primer composition for human leukemia minimal residual disease monitoring, comprising an IGH upstream primer composition, an IGK upstream primer composition, an IGL upstream primer composition, an IGH downstream primer composition, an IGL downstream primer composition, an IGK downstream primer composition, an upstream adapter, and a downstream adapter.
[0006] The IGH upstream primer composition comprises IGH upstream primers with sequences as shown in SEQ ID No. 2-17. The IGK upstream primer composition comprises IGK upstream primers with sequences as shown in SEQ ID No. 18-23. The IGL upstream primer composition comprises IGL upstream primers with sequences as shown in SEQ ID No. 24-30. The IGH downstream primer composition comprises IGH downstream primers with sequences as shown in SEQ ID No. 32-33. The IGL downstream primer composition comprises an IGL downstream primer with a sequence as shown in SEQ ID No. 34. The IGK downstream primer composition comprises IGK downstream primers with sequences as shown in SEQ ID No. 35-37. The upstream adapter comprises at least one primer with a sequence as shown in SEQ ID No. 38-45. The sequence of the downstream adapter is as shown in SEQ ID No. 46.
[0007] Optionally, the primer composition described above further comprises an internal reference upstream primer and an internal reference downstream primer. The sequence of the internal reference upstream primer is as shown in SEQ ID No. 1. The sequence of the internal reference downstream primer is as shown in SEQ ID No. 31.
[0008] The present application also provides a kit for human leukemia minimal residual disease monitoring, comprising an IGH / K / L upstream primer mixture, an IGH / K / L downstream primer mixture, the above-mentioned upstream adapter, and the above-mentioned downstream adapter.
[0009] The IGH / K / L upstream primer mixture comprises the above-mentioned IGH upstream primer composition, the above-mentioned IGK upstream primer composition, the above-mentioned IGL upstream primer composition, and the above-mentioned internal reference upstream primer. The IGH upstream primers in the IGH upstream primer composition, the IGK upstream primers in the IGK upstream primer composition, the IGL upstream primers in the IGL upstream primer composition, and the internal reference upstream primer are in equal molar amounts.
[0010] The IGH / K / L downstream primer mixture comprises the IGH downstream primer composition, the IGK downstream primer composition, the IGL downstream primer composition, and the internal reference downstream primer, and the IGH downstream primer in the IGH downstream primer composition, the IGK downstream primer in the IGK downstream primer composition, the IGL downstream primer in the IGL downstream primer composition, and the internal reference downstream primer are in equal molar amounts.
[0011] Optionally, according to the kit described above, the upstream adaptor, the IGH / K / L upstream primer mixture, the IGH / K / L downstream primer mixture, and the downstream adaptor constitute an IGH / K / L amplification primer mixture, and the molar ratio of the upstream adaptor, the IGH / K / L upstream primer mixture, the IGH / K / L downstream primer mixture, and the downstream adaptor in the IGH / K / L amplification primer mixture is (2-5):1:1:(1-3).
[0012] Optionally, according to the kit described above, further comprising a PCR premix, and the PCR premix comprises a DNA polymerase, Mg 2+ , and dNTPs.
[0013] The present application also provides a method for constructing a B cell receptor gene library, comprising using gDNA of a sample to be tested as a template and performing PCR reaction by using the primer composition or the kit described above to obtain a B cell receptor gene library of the sample to be tested.
[0014] Optionally, according to the method for constructing a B cell receptor gene library described above, the gDNA of the sample to be tested is used as a template, and PCR reaction is performed by using the IGH / K / L amplification primer mixture to obtain a B cell receptor gene IGH / K / L library of the sample to be tested; the amount of the gDNA of the sample to be tested is 200 ng-20 μg, and the amount of the IGH / K / L amplification primer mixture is 2 μL, and the concentration is 3.3 μM. The PCR reaction program comprises 95 ℃, 3 min; 95 ℃, 30 sec, 60 ℃, 90 sec, 72 ℃, 90 sec, 26 cycles; and 72 ℃, 10 min.
[0015] The method for constructing a B cell receptor gene library can further comprise purifying the B cell receptor gene library, for example, by using magnetic beads.
[0016] The primer composition described above or the kit described above in the preparation of a product for monitoring human leukemia minimal residual disease, a product for monitoring human leukemia minimal residual disease, a product for constructing a gene library, or the use of the primer composition or the kit in the construction of a gene library also belong to the protection scope of the present application.
[0017] The monitoring of the minimal residual disease of human leukemia can comprise: using the primer combination or the kit to perform PCR reaction to obtain a pre-treatment DNA library and a post-treatment DNA library, respectively using DNA of a pre-treatment sample and a post-treatment sample of the same detection object as a template; aligning the DNA sequencing data with the internal reference sequence to obtain internal reference sequence reads support numbers of the pre-treatment sample and the post-treatment sample, aligning the DNA sequencing data with the IMGT immunodatabase or the NCBI database to obtain clonotype sequences of IGH, IGK and IGL chains of the pre-treatment sample and the post-treatment sample and reads support numbers of the clonotype sequences; determining a main clonotype sequence according to the internal reference sequence reads support numbers of the pre-treatment sample, the clonotype sequences of IGH, IGK and IGL chains and the reads support numbers of the clonotype sequences; and obtaining an MRD value according to the main clonotype sequence, the internal reference sequence reads support numbers of the post-treatment sample, the clonotype sequences of IGH, IGK and IGL chains and the reads support numbers of the clonotype sequences.
[0018] The application further provides a system for monitoring the minimal residual disease of human leukemia, comprising the primer combination or the kit, and further comprising:
[0019] a receiving module configured to receive DNA sequencing data obtained by using the primer combination or the kit to perform PCR reaction to obtain a pre-treatment DNA library and a post-treatment DNA library of the same detection object;
[0020] an aligning module configured to align the DNA sequencing data with the internal reference sequence to obtain internal reference sequence reads support numbers of a pre-treatment sample and a post-treatment sample, and align the DNA sequencing data with the IMGT immunodatabase or the NCBI database to obtain clonotype sequences of IGH, IGK and IGL chains of the pre-treatment sample and the post-treatment sample and reads support numbers of the clonotype sequences;
[0021] a main clonotype determining module configured to determine a main clonotype sequence according to the internal reference sequence reads support numbers of the pre-treatment sample, the clonotype sequences of IGH, IGK and IGL chains and the reads support numbers of the clonotype sequences;
[0022] an MRD value calculating module configured to obtain an MRD value according to the main clonotype sequence, the internal reference sequence reads support numbers of the post-treatment sample, the clonotype sequences of IGH, IGK and IGL chains and the reads support numbers of the clonotype sequences.
[0023] Optionally, according to the system, the MRD value calculating module is configured to,
[0024] If the clonoid sequences of the IGH, IGK, and IGL chains in the post-treatment sample do not contain the master clonoid sequence, the MRD value is lower than the detection range of the human leukemia minimal residual disease monitoring system.
[0025] If the clonoid sequences of the IGH, IGK, and IGL chains in the post-treatment sample contain the master clonoid sequence, then the cell content of the clonoid sequence is obtained based on the number of reads supporting the clonoid sequence in the post-treatment sample and the number of reads supporting the internal reference sequence in the post-treatment sample, and the maximum value of the cell content of the clonoid sequence is taken as the MRD value.
[0026] The number of supported reads is the number of supported reads in the DNA sequencing data, where a supported read is a read that perfectly matches the reference sequence.
[0027] The primer composition provided by this invention fully considers the TM value, GC content, fragment size, specificity and coverage of the primers during primer design, ensuring that the amplification efficiency of different primers is uniform, specific and comprehensive in covering potential clonal forms.
[0028] The primer composition provided by this invention can be used to construct B cell receptor gene libraries. Conventional two-round PCR library construction takes 6-8 hours, while the primer composition provided by this invention can shorten the entire process to less than 2.5 hours, greatly reducing the library construction time.
[0029] The primer composition and kit provided by this invention can mix the initial nucleic acid sample to be tested, primers, DNA polymerase and buffer in a specific ratio, and obtain the library required for sequencing in only one round of PCR reaction and library purification, which greatly reduces the potential risk of contamination; the detection of IGH / K / L is mixed into one pool for detection, which simplifies the operation process; the requirements for operators are low, and ordinary PCR operators can complete the library construction by simple training.
[0030] Amplification using the primer composition and kit provided by this invention can produce amplification products containing two internal reference gene fragments, maximizing the stability and accuracy of the internal reference information.
[0031] The primer compositions, kits, and systems provided by this invention can be used for next-generation high-throughput sequencing to detect minimal residual disease (MRD) in hematological malignancies. By performing high-throughput sequencing on the CDR3 region of B-cell receptor (BCR) gene rearrangements such as IGH, IGH(DJ), IGK, and IGL in bone marrow samples before treatment, significant and specific clonal rearrangements in tumor cells can be screened out. These tumor cells can then be tracked after treatment, thereby enabling highly accurate and sensitive detection of MRD in patients with acute lymphoblastic leukemia, chronic lymphocytic leukemia, or multiple myeloma. The primer compositions, kits, and systems provided by this invention can accurately count the copy number, B-cell count, and total cell count of significant clones associated with hematological malignancies. Attached Figure Description
[0032] Figure 1 This is a flowchart of the MRD database construction process in Embodiment 1 of the present invention.
[0033] Figure 2 The results for the IGH / K / L library are 2200. The size of the nucleic acid fragments in the library is mainly distributed between 220-400bp, and the target library accounts for more than 80%.
[0034] Figure 3 This is a comparison chart of the MRD detection results of the NALM6 cell line in Example 2.
[0035] Figure 4 This is a comparison chart of MRD detection results for 35 ALL samples in Example 35. Detailed Implementation
[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0038] The NALM6 cell line (human acute B-lymphoblastic leukemia suspension cell line) was donated by Hangzhou Aimuen Biotechnology Co., Ltd.
[0039] Example 1: Construction of a method for monitoring minimal residual disease in human leukemia
[0040] The patient's bone marrow DNA was used as the starting sample for library construction. The specific procedure is as follows:
[0041] 1. Sample extraction
[0042] 1.1 Preprocessing
[0043] (1) Pretreatment of bone marrow samples or controls was performed using the recommended erythrocyte lysis buffer (Tiangen Biotech, RT122). Add 6 ml of erythrocyte lysis buffer to 2 ml of bone marrow sample, invert to mix, and incubate at room temperature for 5 min, inverting to mix 2-3 times during this period. Four leukemia cell lines can be selected as controls (Reh, Nanjing Kebai, CBP60607; Raji, Nanjing Kebai, CBP60272; NALM6, provided by Aimuan; RPMI 8226, Nanjing Kebai CBP60244). Only one of these lines needs to be selected.
[0044] (2) Centrifuge at 3000 rpm for 5 min, remove the supernatant, leave the white blood cell pellet, add 400 μl of sterile PBS solution, slowly resuspend the cell pellet to obtain a resuspended solution, and extract gDNA in time. If storage is required, it can be stored at -80℃.
[0045] 1.2 DNA extraction and purification
[0046] The resuspension obtained in step 1.1 was subjected to gDNA extraction, purification, washing, and elution using the QIAamp DNA Mini Kit (QiaGEN, catalog number 51304).
[0047] 1.3 Quantitative
[0048] The gDNA extracted in step 1.2 above was quantified using the Qubit 3.0 reaction reagent (Invitrogen, Q32851). If quantification is not performed immediately, the sample was stored at -20°C.
[0049] 2. Library Construction
[0050] For the main process of building a library, please refer to [link / reference]. Figure 1 .
[0051] Different specific adapters are used for different samples; gDNA from the same sample is mixed into one pool and uses a specific adapter; samples are divided into pre-treatment samples and post-treatment samples, and the starting amount of pre-treatment samples and post-treatment samples is different, with 200ng for pre-treatment samples and 2-20μg for post-treatment samples.
[0052] For each clinical sample, take an equal amount of gDNA in a single tube for library construction, and take 0.2 mL of PCR tubes equal to the number of clinical samples + 1 (control). Prepare the reaction system according to Table 1.
[0053] Table 1 PCR amplification reaction system
[0054]
[0055]
[0056] Preparation of amplification primer mixture:
[0057] The primers in Table 2 were mixed in equal amounts to obtain IGH / K / L upstream primer mixtures (i.e., a mixture of internal control upstream primers, IGH upstream primers, IGK upstream primers, and IGL upstream primers in Table 2), IGH / K / L downstream primer mixtures (i.e., a mixture of internal control downstream primers, IGH downstream primers, IGK downstream primers, and IGL downstream primers in Table 2), upstream adapters (any one of the upstream adapters in Table 2), and downstream adapters. The total primer concentration of each mixture was adjusted to 50 μM. The IGH / K / L amplification primer mixture was obtained by mixing the primers in the following molar ratio: upstream adapter: IGH / K / L upstream primer mixture: IGH / K / L downstream primer mixture: downstream adapter = (2-5): 1: 1: (1-3).
[0058] The upstream primers in Table 2 (i.e., internal reference upstream primers, IGH upstream primers, IGK upstream primers, and IGL upstream primers) consist of an upstream adapter sequence (GGCACCCGAGAATTCCA) and an upstream specific primer sequence.
[0059] The downstream primers in Table 2 (i.e., internal reference downstream primers, IGH downstream primers, IGK downstream primers, and IGL downstream primers) consist of a downstream adapter sequence (TCAGAGTTCTACAGTCCGACGATC) and a downstream specific primer sequence.
[0060] The upstream adapter in Table 2 consists of the upstream sequencing adapter (CAAGCAGAAGACGGCATACGAGAT), the barcode sequence (underlined in Table 2), the ligation sequence (GTGACTGGAGTTCCTT), and the upstream adapter sequence (GGCACCCGAGAATTCCA).
[0061] The downstream adapters in Table 2 consist of the downstream sequencing adapter (AATGATACGGCGACCACCGAGATCTACACGT) and the downstream adapter sequence (TCAGAGTTCTACAGTCCGACGATC).
[0062] Table 2 Primer sequences
[0063]
[0064]
[0065]
[0066] After preparing the PCR amplification reaction system, tighten the PCR tube cap, vortex to mix for 30 seconds, centrifuge rapidly for 15 seconds, and then perform the amplification reaction according to Table 3 to obtain the amplification product (i.e., DNA library). These amplification conditions do not differentiate between pre-treatment and post-treatment samples. This DNA library solution can be stored at 4°C overnight (not exceeding 16 hours). For longer storage, it should be stored below -18°C.
[0067] Table 3 PCR amplification reaction conditions
[0068]
[0069] 3. Library purification
[0070] The amplification products obtained in step 2 were purified using the MPure XP-PCR product purification kit (Beckman Coulter, A63882) to obtain a purified DNA library. The purified DNA library solution can be stored at 4°C for no more than 16 hours. For longer storage, it should be stored below -18°C.
[0071] 4. Quantitative Library Analysis
[0072] The concentration and band size of the purified DNA library obtained above were quantified using a TapeStation 2200. The sum of the concentrations of the target fragment within the 220-400 bp region is the library concentration. A schematic diagram of the TapeStation 2200 quantification results is shown below. Figure 2 .
[0073] Agilent 2200 / 4200 quality control: After purification with magnetic beads, libraries with a target fragment between 220-400 bp and a dimeric band (less than 200 bp) accounting for no more than 20% are acceptable and can be directly processed. Libraries with a dimeric percentage greater than 20% after purification are unacceptable and require library reconstruction.
[0074] 4. Library pooling and dilution
[0075] (1) Based on the concentration of each library quantified by TapeStation2200, mix all DNA libraries together and label them as library mixture (adjustment can be made according to the quality of the libraries).
[0076] (2) Quantify the library mixture using TapeStation2200. The sum of the concentrations in the target fragment region of about 220-400bp is the library concentration. It is recommended that the data volume for each sample be 3G.
[0077] Note: Vortex the mixed library for 1 minute, centrifuge for 2 seconds, and repeat this step at least 3 times until the mixed library is thoroughly mixed. Ensure the library is completely mixed before performing quantitative analysis.
[0078] 5. Sequencing
[0079] After the prepared library mixture was quantified by qPCR, it was sequenced on the Novaseq 6000 platform according to the predetermined data volume requirements. The resulting data was a PE150 fastq file, which is the raw sequencing data.
[0080] 6. Data Analysis
[0081] (1) Two conserved human sequences were set as internal references (hg19: chr5:17,374,840-17,374,979; chr20:15,124,894-15,125,033). The internal reference sequences were present on all nucleated human cells involved in the detection. The above sequencing raw data were aligned to the hg19 reference genome using the bwa (0.7.17-r1188) software to obtain the read support number of the internal reference sequence, which can determine whether there is enough data for detection.
[0082] (2) The raw sequencing data were aligned to the IMGT immune database using the InHouse software IgBcrBlast to obtain various clonal sequences and read support numbers for the IGH, IGK, and IGL strands. The read support number for the strand (IGH, IGK, or IGL) is the sum of the read support numbers for all clonal sequences of IGH, IGK, or IGL. IMGT immune database address: http: / / www.imgt.org / vquest / refseqh.html#VQUEST.
[0083] (3) Calculate the clonus frequency and cell content for each clonus type, using the following formula:
[0084]
[0085]
[0086] The number of reads supporting the clone type is the number of reads supported by the clone type sequence, and the average number of reads supported by the two human conserved sequences is the average number of reads supported by the internal reference sequence in step (1).
[0087] (4) Screening for significant clonates in pre-treatment samples. The screening criteria are that clonates meeting the following (a1)-(a3) are considered significant clonates:
[0088] (a1) Clonal frequency ≥ 0.03;
[0089] (a2) Cell count ≥ 0.002;
[0090] (a3) The frequency distribution is discontinuous, that is, the clone frequency must be greater than 10 times the 5th clone in the part where the clone frequency does not reach 3%.
[0091] If no significant clonal pattern is found, the pre-treatment sample is defined as polyclonal.
[0092] (5) For post-treatment samples, if no significant clonogenic sequence of the patient's pre-treatment sample is detected, the MRD is considered to be below the product's detection range, and no residue is reported. If a significant clonogenic sequence is detected, residue is reported, and the reported MRD is the maximum value of the content of all residual clonogenic cells.
[0093] Example 2: Standard Product Validation
[0094] NALM6 cell line (human acute B-lymphoblastic leukemia suspension cell line) was selected and serially diluted to 10⁻⁶ gDNA using healthy human blood leukocytes. -1 -10 -6 Six gradients were used as standards, and then steps 2-6 of Example 1 were performed, wherein the amplification primer mixture used in step 2 had an upstream adapter: IGH / K / L upstream primer mixture: IGH / K / L downstream primer mixture: downstream adapter = 3:1:1:2. The MRD value of the standards was determined three times.
[0095] The results are shown in Table 4 and Figure 3 The theoretical value is the concentration after dilution of the standard. The results show that the measurement results of the standard using the monitoring method provided by this invention are consistent with the theoretical value of the standard, and the repeatability is good, indicating that the detection method has practical applicability.
[0096] Table 4. Results of Standard Sample Determination
[0097] Standard Theoretical value Replicate 1 Replicate 2 Replicate 3 L1 1.00E-06 2.60E-06 4.57E-06 1.82E-06 L2 1.00E-05 9.97E-06 1.52E-05 6.64E-06 L3 1.00E-04 1.43E-04 9.49E-05 9.47E-05 L4 1.00E-03 1.08E-03 1.03E-03 1.71E-03 L5 1.00E-02 1.22E-02 1.02E-02 1.13E-02 L6 1.00E-01 8.58E-02 9.39E-02 8.82E-02
[0098] Example 3: Comparison and verification of the monitoring method provided by the present invention with multicolor flow cytometry.
[0099] Bone marrow samples were selected from 5 patients with acute lymphoblastic leukemia, and the MRD value was determined according to steps 1-6 of Example 1. In step 2, the ratio of upstream adapter: IGH / K / L upstream primer mixture: IGH / K / L downstream primer mixture: downstream adapter = 3:1:1:2.
[0100] The MRD values of the above 5 patients with acute lymphoblastic leukemia were detected by multicolor flow cytometry.
[0101] Specific results are shown in Table 5 and Figure 4 The results show that the "pre-treatment CDR3 significant clone information" refers to the detection results of the pre-treatment samples using the monitoring method of this invention, the "post-treatment MRD value" refers to the detection results of the post-treatment samples using the monitoring method of this invention, and the "post-treatment flow cytometry results" refers to the detection results using multicolor flow cytometry. The results show that the two are consistent.
[0102] Table 5. Comparison of one-step MRD detection and multicolor flow cytometry results for 5 ALL samples.
[0103]
[0104]
[0105] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A primer composition for human leukemia minimal residual disease monitoring, characterized by: compositions, an IGK upstream primer composition, an IGL upstream primer composition, an IGH downstream primer composition, an IGL downstream primer composition, an IGK downstream primer composition, an upstream adaptor, a downstream adaptor, an internal control upstream primer, and an internal control downstream primer; the IGH upstream primer composition comprises IGH upstream primers with sequences as shown in SEQ ID No. 2-17; the IGK upstream primer composition comprises IGK upstream primers with sequences as shown in SEQ ID No. 18-23; the IGL upstream primer composition comprises IGL upstream primers with sequences as shown in SEQ ID No. 24-30; the IGH downstream primer composition comprises IGH downstream primers with sequences as shown in SEQ ID No. 32-33; the IGL downstream primer composition comprises an IGL downstream primer with a sequence as shown in SEQ ID No. 34; the IGK downstream primer composition comprises IGK downstream primers with sequences as shown in SEQ ID No. 35-37; the upstream adaptor comprises at least one primer with a sequence as shown in SEQ ID No. 38-45; the sequence of the downstream adaptor is as shown in SEQ ID No. 46; the sequence of the internal control upstream primer is as shown in SEQ ID No. 1; the sequence of the internal control downstream primer is as shown in SEQ ID No.
31.
2. A kit for the monitoring of minimal residual disease in human leukemias, characterized in that: an IGH / K / L upstream primer mixture, an IGH / K / L downstream primer mixture, the upstream adaptor as claimed in claim 1, and the downstream adaptor as claimed in claim 1; the IGH / K / L upstream primer mixture comprises the IGH upstream primer composition as claimed in claim 1, the IGK upstream primer composition as claimed in claim 1, the IGL upstream primer composition as claimed in claim 1, and the internal control upstream primer as claimed in claim 1, the IGH upstream primers in the IGH upstream primer composition, the IGK upstream primers in the IGK upstream primer composition, the IGL upstream primers in the IGL upstream primer composition, and the internal control upstream primer are in equal molar amounts; the IGH / K / L downstream primer mixture comprises the IGH downstream primer composition as claimed in claim 1, the IGK downstream primer composition as claimed in claim 1, the IGL downstream primer composition as claimed in claim 1, and the internal control downstream primer as claimed in claim 1, the IGH downstream primers in the IGH downstream primer composition, the IGK downstream primers in the IGK downstream primer composition, the IGL downstream primers in the IGL downstream primer composition, and the internal control downstream primer are in equal molar amounts.
3. The kit of claim 2, wherein: The upstream adaptor, the IGH / K / L upstream primer mixture, the IGH / K / L downstream primer mixture and the downstream adaptor constitute an IGH / K / L amplification primer mixture, wherein the molar ratio of the upstream adaptor, the IGH / K / L upstream primer mixture, the IGH / K / L downstream primer mixture and the downstream adaptor in the IGH / K / L amplification primer mixture is (2-5):1:1:(1-3).
4. The kit of claim 2 or 3, wherein: Also included is a PCR master mix comprising DNA polymerase, Mg 2+ , dNTPs.
5. A method for constructing a library of B-cell receptor genes, characterized in that: The method comprises: using gDNA of a sample to be tested as a template, and performing PCR reaction by using the primer composition of claim 1 or the kit of any one of claims 2-4 to obtain a B cell receptor gene library of the sample to be tested.
6. The construction method of claim 5, wherein: The method comprises: using gDNA of a sample to be tested as a template, and performing PCR reaction by using the primer composition of claim 1 or the kit of any one of claims 2-4 to obtain a B cell receptor gene library of the sample to be tested.
7. Use of the primer composition of claim 1 or the kit of any one of claims 2-4 in the preparation of a product for monitoring minimal residual disease of human leukemia, a product for monitoring minimal residual disease of human leukemia, a product for constructing a gene library or a method for constructing a gene library.
8. A system for monitoring minimal residual disease in human leukemia, characterized by: The method comprises: using gDNA of a sample to be tested as a template, and performing PCR reaction by using the primer composition of claim 1 or the kit of any one of claims 2-4 to obtain a B cell receptor gene library of the sample to be tested. The receiving module is configured to perform PCR reaction by using the primer composition of claim 1 or the kit of any one of claims 2-4 to obtain DNA sequencing data of a pre-treatment DNA library and a post-treatment DNA library of the same detection object; The comparison module is configured to compare the DNA sequencing data with the reference sequence to obtain reference sequence reads support numbers of the pre-treatment sample and the post-treatment sample, and compare the DNA sequencing data with the IMGT immunodatabase or the NCBI database to obtain clonotype sequences of IGH, IGK and IGL chains of the pre-treatment sample and the post-treatment sample and reads support numbers of the clonotype sequences; The main clonotype determination module is configured to determine a main clonotype sequence according to the reference sequence reads support numbers of the pre-treatment sample, the clonotype sequences of IGH, IGK and IGL chains and the reads support numbers of the clonotype sequences; The MRD value calculation module is configured to obtain an MRD value according to the main clonotype sequence, the reference sequence reads support numbers of the post-treatment sample, the clonotype sequences of IGH, IGK and IGL chains and the reads support numbers of the clonotype sequences; The screening criteria of the main clonotype are clonotypes satisfying (a1)-(a3): (a1) clonotype frequency ≥ 0.03; (a2) cell content ≥ 0.002; (a3) frequency distribution is discontinuous, i.e., the clonotype frequency is greater than 10 times the clonotype frequency of the fifth clonotype in the part where the clonotype frequency does not reach 3%; The calculation formulae of the clonotype frequency and the cell content are as follows: ; 。 9. The system of claim 8, wherein: The MRD value calculation module is configured to, If the clonal sequences of IGH, IGK and IGL chains of the post-treatment sample do not contain the main clonal sequence, the MRD value is lower than the detection range of the monitoring human leukemia minimal residual disease system; If the clonal sequences of IGH, IGK and IGL chains of the post-treatment sample contain the main clonal sequence, the cell content of the clonal sequence is obtained according to the read support number of the clonal sequence in the post-treatment sample and the read support number of the internal reference sequence of the post-treatment sample, and the maximum value of the cell content of the clonal sequence is taken as the MRD value.
Citation Information
Patent Citations
Method for detecting MRD (Minimal Residual Disease)
CN109680062A
Kit and device for BCR / TCR gene rearrangement detection
CN114657254A