New coordination peptide qey127 and its application in assembling luminescent material with rare earth ions
By co-incubating the novel coordination peptide QEY127 with rare earth metal salts, dendritic, network, or linear complex structures were formed, solving the problems of mechanical strength and stability of rare earth complex materials and realizing the preparation of efficient and environmentally friendly luminescent materials.
Patent Information
- Application Number
- CN202211129655.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-04-08
- Filing Date
- 2022-09-16
- Publication Date
- 2026-05-15
- Estimated Expiration
- 2042-09-16
AI Technical Summary
Existing rare earth complex materials suffer from poor mechanical strength, poor stability, and high film-forming costs, making it difficult to meet the requirements for the curling and large size of luminescent materials.
Luminescent materials were prepared by co-incubating the novel coordination peptide QEY127 with rare earth metal salts and catalyzing the formation of dendritic, network, or linear complex structures by glutamine transaminase.
It has achieved the preparation of luminescent materials with high yield, low cost and no chemical pollution, and has excellent rare earth metal coordination properties and product stability, which are suitable for the fields of biomedicine and luminescent materials.
Smart Images

Figure CN115960255B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biopolymer research, and mainly relates to a novel coordination peptide QEY127 and its application in assembling with rare earth ions into luminescent materials. Background Technology
[0002] Europium, a rare earth element, has been a major research focus in recent years. Related rare earth ions can exhibit both photoluminescence and electroluminescence, and they have shown remarkable performance in fields such as biological calibration, chemical analysis, and civilian lighting, making them a class of high-performance materials.
[0003] Most small-molecule doped rare-earth ions have inherent problems, such as poor mechanical strength, poor stability, difficulty in film formation, and relatively high costs associated with vacuum evaporation film formation. An effective approach to solving these problems is to physically dope small-molecule rare-earth complexes with organic polymers such as polymethyl methacrylate (PMMA), thus polymerizing them to obtain polymeric white organic light-emitting diode (OLED) materials. Alternatively, appropriate chemical polymerization methods can be used to prepare homopolymers or copolymers, such as PMMA, silica aerogel, and chloroform, and then use these as polymeric ligands. Benzoylmethane, trifluoroacetylthiophenecarboxymethylmethane, β-diketone, and acetylacetone can be selected as small-molecule ligands to synthesize relevant polymeric fluorescent complexes through synergistic coordination reactions. Polymerization of rare-earth complexes is an effective method that can significantly reduce processing costs and allows for wet spin-coating to meet the future trend of curled and large-size luminescent materials.
[0004] Peptides (or proteins) are novel carrier materials with superior performance, exhibiting more diverse assembly forms and superior material properties. Coordination peptides with excellent uranium-coordination properties can be created through the appropriate combination of amino acid residues. Currently, there are relatively few reports on research on peptide coordination compounds or polymers. Summary of the Invention
[0005] The first objective of this invention is to address the shortcomings of the prior art by providing a coordination peptide QEY127.
[0006] The main functional region of the novel coordination peptide QEY127 is composed of 10 copies of the 12-amino acid peptide QSEPGDPGEPSY (QEY12). The upstream (N-terminus) 6-polyhistidine tag (6X His) facilitates the isolation and purification of the target protein. Its amino acid sequence is as follows:
[0007] MHHHHHHQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSY, as shown in SEQ NO.2.
[0008] Preferably, the coordination peptide QEY127 is composed of methionine encoded by the start codon before the 6-polyhistidine tag, the 6-polyhistidine tag (6X His), and 10 repeating QEY12 sequences connected sequentially, with a length of 127 amino acid residues.
[0009] A second objective of this invention is to provide the gene sequence encoding the coordination peptide QEY127, as follows:
[0010] ATGCATCATCACCATCACCATCAGAGCGAACCGGGTGATCCGGGTGAACCGAGCTATCAATCTGAGCCTGGAGATCCGGGTGAAGTGAACCAGGCGACCCTGGAGAACCGTCTTACCAGAGCGAACCGGGTGATCCGGGTGAACCGAGCTATCAATCTGAGCCTGGAGATCCGGGTGAACC TAGTTATCAACCCTGGAGAACCGTCTTACCAGAGCGAACCGGGTGATCCGGGTGAACCGAGCTATCAATCTGAGCCTGGAGATCCGGGTGAACCTAGTTATCAGAGTGAACCAGGCGACCCTGGAGAACCGTCTTACCAGAGCGAACCGGGTGATCCGGGTGAACCGAGCTATTAA, see SEQ. Shown in NO.1.
[0011] Preferably, the upstream of the gene sequence encoding the coordination peptide QEY127 also includes expression elements: the Lac promoter, the Lac operon, and the Lac ribosome binding site (RBS).
[0012] As a preferred option, the expression vector for the coordination peptide QEY127 is PUC57, with the insertion site being the EcoRⅤ restriction enzyme site, and the expression host bacterium being Escherichia coli DH5α strain.
[0013] As a preferred embodiment, the coordination peptide QEY127 has a total gene length of 384bp, including a 3bp start codon preceding the 6-polyhistidine tag (6X His), a 18bp codon of the 6-polyhistidine tag (6X His), 10 codons encoding 12 amino acid residues totaling 360bp, and a 3bp stop codon.
[0014] As a preferred option, the upstream sequence of the coordination peptide QEY127 gene is 196 bp in length, including a 34 bp Lac promoter, a 25 bp Lac operon, and an 8 bp ribosome binding site (RBS).
[0015] Preferably, the synthetically produced sequence located at the EcoRⅤ site on PUC57 is 580 bp in length.
[0016] A third objective of this invention is to provide a method for preparing the coordination peptide QEY127, comprising the following steps:
[0017] Step (1), Construction of the expression vector for the coordination peptide QEY127:
[0018] Synthesize the target gene fragment according to the sequence shown in SEQ NO:3, which contains the gene sequence shown in SEQ NO:1, and insert the synthesized sequence into the EcoRⅤ site on the PUC57 vector to obtain the QEY127 expression vector.
[0019] Step (2): The coordination peptide QEY127 expression vector was introduced into Escherichia coli DH5α to obtain the QEY127 expression strain;
[0020] Step (3), self-induced expression of coordination peptide QEY127: The QEY127 expression strain was inoculated into the self-induced expression medium and cultured at a certain temperature for a certain time to obtain the product fermentation broth;
[0021] The self-induced expression medium formulation is as follows: yeast extract 0.5–2.5 g / L, tryptone 1.0–3.0 g / L, potassium nitrate 0.1–0.5 g / L, glucose 0.1–1.5 g / L, dipotassium hydrogen phosphate 1.0–3.0 g / L, potassium dihydrogen phosphate 1.0–3.0 g / L, ammonium phosphate 2.0–6.0 g / L, magnesium sulfate 0.2–1.6 g / L, calcium chloride 2.0–5.0 mg / L, cobalt chloride 0.5–3.5 mg / L, and copper chloride 0.5–1.5 mg / L. / L, manganese sulfate 1.2~5.0mg / L, sodium molybdate 3.2~8.0mg / L, boric acid 0.1~0.5mg / L, ferric chloride 1.0~8.0mg / L, zinc chloride 0.5~3.0mg / L, glycerol 1.0~10.0g / L, serine 0.5~2.0g / L, glycine 2.0~10.0g / L, isopropyl thio-β-D-galactoside (IPTG) 20~300mg / L; fermentation temperature 16~40℃; fermentation time 12~24h;
[0022] Step (4), isolation and purification of coordination peptide QEY127:
[0023] The fermentation broth of the product from step (3) was centrifuged to collect the cells, and then resuspended in phosphate buffer solution. The cells were then sonicated and the supernatant was collected by centrifugation again. Finally, the supernatant was passed through a nickel ion column and eluted with imidazole at a gradient concentration. The eluent of the coordination peptide QEY127 was collected and then dialyzed and freeze-dried to obtain the target coordination peptide QEY127 of the present invention.
[0024] A third objective of this invention is to provide the application of the coordination peptide QEY127 in the preparation of luminescent materials.
[0025] The fourth objective of this invention is to provide a luminescent coordination material, which is formed by cross-linking the coordination peptide QEY127 with transglutaminase to form a dendritic, network, or linear composite structure with an average degree of polymerization of 100-20000 and a stretching ratio of 200%-1000%, and then drying it to form a film; the above-mentioned coordination peptide QEY127 polymer is co-incubated with rare earth metal salts to form a material that emits red light under ultraviolet light.
[0026] Uranium is preferred as a rare earth metal.
[0027] As a preferred option, the mass ratio of the coordination peptide QEY127 polymer to the rare earth metal salt is 100-1:1-100.
[0028] The beneficial effects of this invention are as follows:
[0029] The novel coordination peptide QEY127 of this invention possesses advantages such as uniform length, complete biodegradability, compatibility with rare earth metals to form luminescent materials, high yield from microbial preparation, and absence of chemical pollution; its specific characteristics are as follows:
[0030] (1) The coordination peptide QEY127 of this invention is an artificially designed and prepared protein, and there is no natural counterpart or analogue. The amino acid sequence (SEQ NO:2) of the coordination peptide QEY127 was compared and analyzed by BLASTp in the NCBI database. The results showed that the coordination peptide QEY127 had a similarity of 62.1% with the protein sequences in the database when the highest coverage rate was 93%, and the sequence with the highest similarity was the putative protein.
[0031] (2) The gene sequence used in this invention to prepare the coordination peptide QEY127 is not a natural gene sequence, but a novel gene sequence that has been codon-modified and artificially synthesized. The gene (SEQ NO: 1) of the novel artificial coordination peptide QEY127 was obtained by whole-genome synthesis. The coordination peptide QEY127 gene sequence was compared with the BLASTn database of NCBI, and the result showed that no significantly similar sequences were found.
[0032] (3) A Lac gene expression element was designed upstream of the coordination peptide QEY127 gene, which enabled it to be expressed in Escherichia coli DH5α strain by IPTG, and finally the fusion protein of the present invention was obtained by cell disruption and nickel ion column affinity chromatography.
[0033] (4) The recurring glutamine and lysine residues in the coordination peptide QEY12 provide active sites for intramolecular and intermolecular cross-linking via TG enzymes. The carboxyl groups on glutamic acid and aspartic acid residues provide sites for rare earth metal ion coordination. Proline residues provide the peptide with flexibility and elasticity. Glycine and serine mainly serve as steric buffers and protect adjacent active sites. These properties endow the coordination peptide QEY127 with excellent rare earth metal coordination properties, easy processing, and excellent product stability, making it promising for applications in the biopharmaceutical and luminescent materials fields.
[0034] The coordination peptide QEY127 of this invention has a yield of 100-1200 mg / L fermentation broth and a purity of 82-95%. The coordination peptide QEY127 of this invention possesses the characteristics of cross-linking catalyzed by transglutaminase (TG enzyme), high elasticity, and the ability to form luminescent coordination compounds with rare earth metals, showing broad application prospects in the fields of biomedicine and luminescent materials. Attached Figure Description
[0035] Figure 1 This is a schematic diagram of the PUC57 plasmid map and the insertion sites of the gene sequence. Detailed Implementation
[0036] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments.
[0037] The coordination peptide QEY12 sequence was artificially designed and is not a natural protein. BLAST sequence alignment on NCBI revealed no identical DNA or protein sequence in GenBank. No studies on the same peptide segment have been reported, nor have any related preparation methods been reported.
[0038] In all the following examples, the host bacterium was Escherichia coli DH5α (accession number: GIM1.571), the expression vector framework was the PUC57 plasmid, and the insertion site of the coordination peptide QEY127 expression cassette was the EcoRⅤ restriction endonuclease site. Figure 1 This is a schematic diagram of the PUC57 plasmid map and the insertion site of the gene sequence. *Escherichia coli* DH5α, purchased from Takara Bio Engineering (Dalian) Co., Ltd., is classified as *Escherichia coli* DH5α, with accession number GIM1.571, and deposited at Guangdong Provincial Microbial Culture Collection Center. The plasmid PUC57, 2710 bp, derived from *Escherichia coli*, was provided free of charge by Nanjing Genscript Biotech Co., Ltd. All percentage contents in this invention, unless otherwise specified, refer to mass percentage contents.
[0039] The following embodiments are illustrated using representative implementations, but the scope of protection of the present invention is not limited to the following embodiments.
[0040] Example 1
[0041] Step 1: The QEY127 expression cassette sequence was synthesized in its entirety by a biotechnology company (SEQ NO: 3), and inserted into the EcoRⅤ site on PUC57 using restriction enzyme ligation. Then, it was introduced into Escherichia coli DH5α strain by chemical or electroporation methods. After screening with carbenicillin-resistant medium and DNA sequencing verification, the QEY127 expression strain was obtained.
[0042] The restriction enzyme digestion and ligation method was as follows: The PUC57 plasmid was digested with EcoRⅤ, and the linearized PUC57 fragment was separated by agarose gel electrophoresis. The linearized PUC57 plasmid was then recovered using an agarose gel extraction kit. The synthetic coordination peptide QEY127 expression cassette sequence was amplified using high-fidelity DNA polymerase, and the QEY127 expression cassette fragment was also separated by agarose gel electrophoresis and recovered using an agarose gel extraction kit. 200 ng of the linearized PUC57 plasmid and 100 ng of the QEY127 expression cassette fragment were ligated overnight in a 20 μL T4 ligase reaction system to obtain the ligation product containing the QEY127 expression vector.
[0043] The transformation method of Escherichia coli DH5α strain is as follows (taking the chemical method as an example): 5 μL of the ligation product containing the coordination peptide QEY127 expression vector was added to 200 μL of Escherichia coli DH5α chemically competent cells purchased from Takara Bio Engineering (Dalian) Co., Ltd. The mixture was thoroughly mixed and incubated on ice for 30 min, then incubated in a water bath at 42℃ for 90 s, then incubated on ice for 2 min, and finally 800 μL of antibiotic-free liquid LB medium was added. The mixture was then incubated at 37℃ for 1 h to obtain a mixture containing the coordination peptide QEY127 expression strain.
[0044] The transformant screening method was as follows: A mixture containing strains expressing the coordination peptide QEY127 was plated on LB agar plates containing 100 μg / mL carbenicillin and incubated upside down overnight at 37°C to obtain regenerated single colonies. Single colonies were picked and sent to a biotechnology company for DNA sequencing. From these, *E. coli* DH5α strains carrying the correct coordination peptide QEY127 expression vector were selected; these were the correct coordination peptide QEY127 expression strains.
[0045] Step 2: The QEY127 coordinating peptide expression strain was cloned and inoculated into 200 mL of self-induction medium. It was cultured at 16 °C with a shaking speed of 220 rpm for 12 h, and then the bacterial cells were collected by centrifugation at 6000 × g at room temperature for 5 min. The self-induction culture medium formula is as follows: yeast extract 0.5 g / L, tryptone 1.0 g / L, potassium nitrate 0.1 g / L, glucose 0.1 g / L, dipotassium hydrogen phosphate 1.0 g / L, potassium dihydrogen phosphate 1.0 g / L, ammonium phosphate 2.0 g / L, magnesium sulfate 0.2 g / L, calcium chloride 2.0 mg / L, cobalt chloride 0.5 mg / L, copper chloride 0.5 mg / L, manganese sulfate 1.2 mg / L, sodium molybdate 3.2 mg / L, boric acid 0.1 mg / L, ferric chloride 1.0 mg / L, zinc chloride 0.5 mg / L, glycerol 1.0 g / L, serine 0.5 g / L, glycine 2.0 g / L, and isopropyl thio-β-D-galactoside (IPTG) 20 mg / L.
[0046] Step 3: The bacterial cells collected in Step 2 by centrifugation were resuspended in 20 mL of cell disruption buffer. After thorough vortexing and resuspending, the cells were sonicated for 30 min at 130 W with a 5-second sonication cycle followed by a 5-second pause. Then, the cells were centrifuged at 12000 × g at room temperature for 30 min. The supernatant was transferred to a new centrifuge tube, filtered through a 0.45 μm aqueous filter, and then loaded onto a nickel ion column (using GenScript High Affinity Ni-Charged Resin as an example). Elution was performed with a gradient of imidazole solutions, and the target eluent was collected.
[0047] The cell disruption buffer formulation is as follows: 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 1.0 M urea, pH 8.0; the nickel ion column affinity chromatography pre-elution buffer formulation is as follows: 10 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 1.0 M urea, pH 8.0; and the elution buffer formulation is as follows: 50 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 1.0 M urea, pH 8.0.
[0048] Step 4: Collect the eluent in a dialysis bag with a size exclusion molecular weight of 14 kDa, dialyze it three times in ultrapure water, and then freeze-dry it to obtain the target coordination peptide QEY127.
[0049] Based on Example 1, the yield of coordination peptide QEY127 was 100 mg / L of fermentation broth with a purity of 80%. A 2 mg / mL solution of this coordination peptide QEY127 can be catalyzed by TG enzyme to form dendritic, network, and linear complexes with a degree of polymerization of 100. After drying and forming a film, the stretch ratio is 1000%. When the coordination peptide QEY127 polymer is co-incubated with uranium chloride at a mass ratio of 100:1, it can form a material that emits red light under ultraviolet light. It has a strong ultraviolet absorption peak in the range of 195 nm to 230 nm, with a maximum emission wavelength of 587 nm at 195 nm and a maximum emission wavelength of 625 nm at 230 nm. The relative fluorescence intensity at 587 nm and 625 nm is 3.5.
[0050] Example 2
[0051] Step 1: Following the method in Step 1 of Example 1, obtain the strain expressing the coordination peptide QEY127.
[0052] Step 2: The QEY127 expression strain clone was inoculated into 200 mL of self-induction medium and cultured at 40 °C with a shaking speed of 220 rpm for 24 h. The bacterial cells were then collected by centrifugation at 6000 × g at room temperature for 5 min. The self-induction culture medium formula is as follows: yeast extract 2.5 g / L, tryptone 3.0 g / L, potassium nitrate 0.5 g / L, glucose 1.5 g / L, dipotassium hydrogen phosphate 3.0 g / L, potassium dihydrogen phosphate 3.0 g / L, ammonium phosphate 6.0 g / L, magnesium sulfate 1.6 g / L, calcium chloride 5.0 mg / L, cobalt chloride 3.5 mg / L, copper chloride 1.5 mg / L, manganese sulfate 5.0 mg / L, sodium molybdate 8.0 mg / L, 0.1–0.5 mg / L, ferric chloride 8.0 mg / L, zinc chloride 3.0 mg / L, glycerol 10.0 g / L, serine 2.0 g / L, glycine 10.0 g / L, and isopropyl thio-β-D-galactopyranoside (IPTG) 300 mg / L.
[0053] Step 3: The bacterial cells collected in Step 2 by centrifugation were resuspended in 20 mL of cell disruption buffer. After thorough vortexing and resuspending, the cells were sonicated for 30 min at 130 W with a 5-second sonication cycle followed by a 5-second pause. Then, the cells were centrifuged at 12000 × g at room temperature for 30 min. The supernatant was transferred to a new centrifuge tube, filtered through a 0.45 μm aqueous filter, and then loaded onto a nickel ion column (using GenScript High Affinity Ni-Charged Resin as an example). Elution was performed with a gradient of imidazole solutions, and the target eluent was collected.
[0054] The cell disruption buffer formulation is as follows: 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 3.0 M urea, pH 8.0; the nickel ion column affinity chromatography pre-elution buffer formulation is as follows: 10 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 3.0 M urea, pH 8.0; and the elution buffer formulation is as follows: 100 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 3.0 M urea, pH 8.0.
[0055] Step 4: Collect the eluent in a dialysis bag with a size exclusion molecular weight of 14 kDa, dialyze it three times in ultrapure water, and then freeze-dry it to obtain the target coordination peptide QEY127.
[0056] Based on Example 2, the yield of coordination peptide QEY127 was 800 mg / L of fermentation broth with a purity of 87%. A 200 mg / mL solution of this coordination peptide QEY127 can be catalyzed by TG enzyme to form dendritic, network, and linear complexes with a degree of polymerization of 20,000. After drying and forming a film, the stretch ratio is 600%. When the coordination peptide QEY127 polymer is co-incubated with uranium chloride at a mass ratio of 1:100, it can form a material that emits red light under ultraviolet light. It has a strong ultraviolet absorption peak between 195 nm and 230 nm, with a maximum emission wavelength of 587 nm at 195 nm and a maximum emission wavelength of 625 nm at 230 nm. The relative fluorescence intensity at 587 nm and 625 nm is 2.1.
[0057] Example 3
[0058] Step 1: Following the method in Step 1 of Example 1, obtain the strain expressing the coordination peptide QEY127.
[0059] Step 2: The QEY127 expression strain clone was inoculated into 200 mL of self-induction medium and cultured at 28 °C with a shaking speed of 220 rpm for 18 h. The bacterial cells were then collected by centrifugation at 6000 × g at room temperature for 5 min. The self-induction culture medium formula is as follows: yeast extract 1.5 g / L, tryptone 2.0 g / L, potassium nitrate 0.3 g / L, glucose 0.8 g / L, dipotassium hydrogen phosphate 2.0 g / L, potassium dihydrogen phosphate 2.0 g / L, ammonium phosphate 4.0 g / L, magnesium sulfate 0.9 g / L, calcium chloride 3.5 mg / L, cobalt chloride 2.0 mg / L, copper chloride 1.0 mg / L, manganese sulfate 3.1 mg / L, sodium molybdate 5.6 mg / L, boric acid 0.3 mg / L, ferric chloride 4.5 mg / L, zinc chloride 1.75 mg / L, glycerol 5.5 g / L, serine 1.25 g / L, glycine 6.0 g / L, and isopropyl thio-β-D-galactoside (IPTG) 160 mg / L.
[0060] Step 3: The bacterial cells collected in Step 2 by centrifugation were resuspended in 20 mL of cell disruption buffer. After thorough vortexing and resuspending, the cells were sonicated for 30 min at 130 W with a 5-second sonication cycle followed by a 5-second pause. Then, the cells were centrifuged at 12000 × g at room temperature for 30 min. The supernatant was transferred to a new centrifuge tube, filtered through a 0.45 μm aqueous filter, and then loaded onto a nickel ion column (using GenScript High Affinity Ni-Charged Resin as an example). Elution was performed with a gradient of imidazole solutions, and the target eluent was collected.
[0061] The cell disruption buffer formulation is as follows: 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 2.0 M urea, pH 8.0; the nickel ion column affinity chromatography pre-elution buffer formulation is as follows: 10 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 2.0 M urea, pH 8.0; and the elution buffer formulation is as follows: 75 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 2.0 M urea, pH 8.0.
[0062] Step 4: Collect the eluent in a dialysis bag with a size exclusion molecular weight of 14 kDa, dialyze it three times in ultrapure water, and then freeze-dry it to obtain the target coordination peptide QEY127.
[0063] Based on Example 3, the yield of coordination peptide QEY127 was 900 mg / L of fermentation broth, with a purity of 93%. A 100 mg / mL solution of this coordination peptide QEY127 can be catalyzed by TG enzyme to form dendritic, network, and linear complexes with a degree of polymerization of 500. After drying and forming a film, the stretch ratio is 500%. When the coordination peptide QEY127 polymer is co-incubated with uranium chloride at a mass ratio of 1:1, it can form a material that emits red light under ultraviolet light. It has a strong ultraviolet absorption peak between 195 nm and 230 nm, with a maximum emission wavelength of 587 nm at 195 nm and a maximum emission wavelength of 625 nm at 230 nm. The relative fluorescence intensity at 587 nm and 625 nm is 1.9.
[0064] Example 4
[0065] Step 1: Following the method in Step 1 of Example 1, obtain the strain expressing the coordination peptide QEY127.
[0066] Step 2: The QEY127 coordinating peptide expression strain was cloned and inoculated into 200 mL of self-induction medium. It was cultured at 34 °C with a shaking speed of 220 rpm for 16 h, and then the bacterial cells were collected by centrifugation at 6000 × g at room temperature for 5 min. The self-induction culture medium formula is as follows: yeast extract 1.2 g / L, tryptone 1.80 g / L, potassium nitrate 0.3 g / L, glucose 0.5 g / L, dipotassium hydrogen phosphate 1.5 g / L, potassium dihydrogen phosphate 2.0 g / L, ammonium phosphate 2.0 g / L, magnesium sulfate 1.0 g / L, calcium chloride 3.0 mg / L, cobalt chloride 2.0 mg / L, copper chloride 0.9 mg / L, manganese sulfate 3.2 mg / L, sodium molybdate 6.0 mg / L, boric acid 0.2 mg / L, ferric chloride 4.0 mg / L, zinc chloride 1.0 mg / L, glycerol 6.0 g / L, serine 1.0 g / L, glycine 5.0 g / L, and isopropyl thio-β-D-galactoside (IPTG) 120 mg / L.
[0067] Step 3: The bacterial cells collected in Step 2 by centrifugation were resuspended in 20 mL of cell disruption buffer. After thorough vortexing and resuspending, the cells were sonicated for 30 min at 130 W with a 5-second sonication cycle followed by a 5-second pause. Then, the cells were centrifuged at 12000 × g at room temperature for 30 min. The supernatant was transferred to a new centrifuge tube, filtered through a 0.45 μm aqueous filter, and then loaded onto a nickel ion column (using GenScript High Affinity Ni-Charged Resin as an example). Elution was performed with a gradient of imidazole solutions, and the target eluent was collected.
[0068] The cell disruption buffer formulation is as follows: 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 2.0 M urea, pH 8.0; the nickel ion column affinity chromatography pre-elution buffer formulation is as follows: 10 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 2.0 M urea, pH 8.0; and the elution buffer formulation is as follows: 80 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 2.0 M urea, pH 8.0.
[0069] Step 4: Collect the eluent in a dialysis bag with a size exclusion molecular weight of 14 kDa, dialyze it three times in ultrapure water, and then freeze-dry it to obtain the target coordination peptide QEY127.
[0070] Based on Example 4, the yield of coordination peptide QEY127 was 1000 mg / L of fermentation broth with a purity of 95%. A 160 mg / mL solution of this coordination peptide QEY127 can be catalyzed by TG enzyme to form dendritic, network, and linear complexes with a degree of polymerization of 17000. After drying and forming a film, the stretch ratio is 1000%. When the coordination peptide QEY127 polymer is co-incubated with uranium chloride at a mass ratio of 80:3, a material emitting red light under ultraviolet light can be formed. It has a strong ultraviolet absorption peak between 195 nm and 230 nm, with a maximum emission wavelength of 587 nm at 195 nm and a maximum emission wavelength of 625 nm at 230 nm. The relative fluorescence intensity at 587 nm and 625 nm is 1.9.
Claims
1. A coordination peptide QEY127, characterized in that, Its amino acid sequence is as follows: MHHHHHHQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSYQSEPGDPGEPSY, as shown in SEQ ID NO:
2.
2. A gene encoding the coordination peptide QEY127 as described in claim 1, characterized in that, Its nucleotide sequence is as follows: ATGCATCATCACCATCACCATCAGAGCGAACCGGGTGATCCGGGTGAACCGAGCTATCAATCTGAGCCTGGAGATCCGGGTGAACCTAGTTATCAGAGTGAACCAGGCGACCCTGGAGAACCGTCTTACCAGAGCGAACCGGGTGATCCGGGTGAACCGAGCTATCAATCTGAGCCTGGAGATCCGGGTGAACC TAGTTATCAGAGTGAACCAGGCGACCCTGGAGAACCGTCTTACCAGAGCGAACCGGGTGATCCGGGTGAACCGAGCTATCAATCTGAGCCTGGAGATCCGGGTGAACCTAGTTATCAGAGTGAACCAGGCGACCCTGGAGAACCGTCTTACCAGAGCGAACCGGGTGATCCGGGTGAACCGAGCTATTAA, see SEQ. Shown as ID NO:
1.
3. A method for preparing the coordination peptide QEY127 as described in claim 1, characterized in that, Includes the following steps: Step (1), Construction of the expression vector for the coordination peptide QEY127: Synthesize the target gene fragment according to the sequence shown in SEQ ID NO:3, which contains the gene sequence shown in SEQ ID NO:1, and insert the synthesized sequence into the EcoRⅤ site on the PUC57 vector to obtain the QEY127 expression vector. Step (2): The coordination peptide QEY127 expression vector was introduced into Escherichia coli DH5α to obtain the QEY127 expression strain; Step (3), self-induced expression of coordination peptide QEY127: The QEY127 expression strain was inoculated into the self-induced expression medium and cultured at a certain temperature for a certain time to obtain the product fermentation broth; Step (4): Isolation and purification of coordination peptide QEY127.
4. The method as described in claim 3, characterized in that, The self-induced expression medium formulation in step (3) is as follows: yeast extract 0.5~2.5 g / L, tryptone 1.0~3.0 g / L, potassium nitrate 0.1~0.5 g / L, glucose 0.1~1.5 g / L, dipotassium hydrogen phosphate 1.0~3.0 g / L, potassium dihydrogen phosphate 1.0~3.0 g / L, ammonium phosphate 2.0~6.0 g / L, magnesium sulfate 0.2~1.6 g / L, calcium chloride 2.0~5.0 mg / L, cobalt chloride 0.5~3.5 mg / L, copper chloride 0.5~1.5 mg / L, manganese sulfate 1.2~5.0 mg / L, sodium molybdate 3.2~8.0 mg / L, boric acid 0.1~0.5 mg / L. mg / L, ferric chloride 1.0~8.0 mg / L, zinc chloride 0.5~3.0 mg / L, glycerol 1.0~10.0 g / L, serine 0.5~2.0 g / L, glycine 2.0~10.0 g / L, isopropyl thio-β-D-galactoside (IPTG) 20~300 mg / L.
5. The method as described in claim 4, characterized in that, Step (3) The culture temperature is 16~40℃; the culture time is 12~24h.
6. A luminescent coordination material, characterized in that, The coordination peptide QEY127 as described in claim 1 is cross-linked with glutamine transaminase to form a dendritic, network, and / or linear complex, which is then dried to form a film to obtain a coordination peptide QEY127 polymer; the coordination peptide QEY127 polymer is co-incubated with a rare earth metal salt, wherein the rare earth metal salt is uranium chloride.