Compositions and methods for TCR reprogramming using CD70-specific fusion proteins
By introducing a TCR fusion protein into T cells, which binds to the antigenic domain of CD70, the current challenge of targeting CD70 malignant tumors in cancer immunotherapy has been solved, improving treatment efficacy and reducing side effects.
Patent Information
- Application Number
- CN202180048074.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-04-07
- Filing Date
- 2021-05-05
- Publication Date
- 2026-03-10
- Estimated Expiration
- 2041-05-05
AI Technical Summary
Existing cancer immunotherapies are difficult to effectively target and kill malignant tumors that express CD70, and traditional treatments have serious side effects and immune system resistance.
A TCR fusion protein containing extracellular, transmembrane, and intracellular domains was developed, which binds to the antigen-binding domain of CD70-specific T cells, and is used to engineer T cells to enhance cytotoxicity against CD70-expressing cells.
It enhanced the killing ability of T cells against CD70-expressing cells, reduced cannibalism, and improved the effectiveness and safety of immunotherapy.
Smart Images

Figure BDA0004038419630002221 
Figure BDA0004038419630002231 
Figure BDA0004038419630002241
Abstract
Description
[0001] Cross-references
[0002] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 020,196, filed May 5, 2020; U.S. Provisional Patent Application No. 63 / 129,718, filed December 23, 2020; U.S. Provisional Patent Application No. 63 / 147,618, filed February 9, 2021; and U.S. Provisional Patent Application No. 63 / 171,751, filed April 7, 2021, each of which is incorporated herein by reference in its entirety. Technical Field
[0003] This invention relates to novel therapeutic agents and methods for treating CD70-related diseases and conditions. Background Technology
[0004] Human cancers, by their very nature, are composed of normal cells that have undergone genetic or epigenetic transformation into abnormal cancer cells. In this case, cancer cells begin to express proteins and other antigens that differ from those expressed by normal cells. These abnormal tumor antigens can be used by the body's innate immune system to specifically target and kill cancer cells. However, cancer cells employ various mechanisms to prevent immune cells (such as T and B lymphocytes) from successfully targeting them.
[0005] Most patients with advanced solid tumors are not cured with standard therapies. Furthermore, traditional treatment options often have serious side effects. Many attempts have been made to get the patient's immune system to reject cancer cells—a method collectively known as cancer immunotherapy. However, several obstacles make achieving clinical efficacy quite difficult. Although hundreds of so-called tumor antigens have been identified, these antigens are often derived from the tumor itself and therefore can either guide cancer immunotherapy against healthy tissue or have poor immunogenicity. In addition, cancer cells use a variety of mechanisms to make themselves invisible or hostile to the initiation and spread of an immune attack by cancer immunotherapy.
[0006] Human T-cell therapy relies on enriched or modified human T cells to target and kill a patient's cancer cells. To enhance the ability of T cells to target and kill specific cancer cells, methods have been developed to engineer T cells into constructs that express structures that guide T cells to specific target cancer cells. Chimeric antigen receptors (CARs) and engineered T-cell receptors (TCRs) containing binding domains capable of interacting with specific tumor antigens allow T cells to target and kill cancer cells expressing specific tumor antigens.
[0007] In addition to the ability of genetically modified T cells expressing CARs or engineered TCRs to recognize and destroy their respective target cells in vitro / in vitro, successful patient therapies using engineered T cells require that the T cells be strongly activated, expanded, persistent over time, effectively target tumors, reduce, and, in the case of relapsed disease, activate a "memory" response. Furthermore, currently developing CAR therapies are associated with the release of high levels of pro-inflammatory cytokines, which are linked to dose-limiting toxicities. Summary of the Invention
[0008] There is a clear need to develop improved genetically engineered T cells to combat a wide range of human malignancies, including those expressing CD70. This article describes novel fusion proteins of TCR subunits (including CD3ε, CD3γ, and CD3δ) and TCRα and TCRβ chains with CD70-specific binding domains, which have the potential to overcome the limitations of existing approaches.
[0009] This document provides a recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, and (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain; and (b) an antigen-binding domain that specifically binds to CD70; and wherein the TCR subunit is operatively linked to the antigen-binding domain.
[0010] In some implementations, when the TFP is expressed in T cells, the TFP functionally interacts with the endogenous TCR complex.
[0011] In some embodiments, the intracellular domain of the TCR includes a stimulatory domain derived from the intracellular signal transduction domain of CD3γ, CD3δ, or CD3ε.
[0012] In some implementations, T cells expressing the TFP exhibit increased cytotoxicity against human cells expressing CD70 compared to T cells that do not contain the TFP.
[0013] In some implementations, the antigen-binding domain is linked to the TCR extracellular domain via a adapter sequence.
[0014] In some embodiments, the length of the connector is 120 amino acids or less.
[0015] In some implementations, the connector sequence includes (G4S). n , where G is glycine, S is serine, and n is an integer from 1 to 10.
[0016] In some implementations, n is an integer from 1 to 4.
[0017] In some embodiments, at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain originate from the same TCR subunit.
[0018] In some embodiments, at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from TCRα.
[0019] In some embodiments, at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from TCRβ.
[0020] In some embodiments, at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from TCRγ.
[0021] In some embodiments, at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from TCRδ.
[0022] In some embodiments, at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from CD3ε.
[0023] In some embodiments, at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from CD3δ.
[0024] In some embodiments, at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from CD3γ.
[0025] In some implementations, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain all originate from the same TCR subunit.
[0026] In some implementations, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from CD3ε.
[0027] In some implementations, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from CD3δ.
[0028] In some implementations, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are derived from CD3γ.
[0029] In some embodiments, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain contain a constant domain of TCRα.
[0030] In some implementations, the constant structural domain of TCRα is mouse-based.
[0031] In some embodiments, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain include a constant domain of TCRβ.
[0032] In some implementations, the constant domain of TCRβ is mouse-based.
[0033] In some embodiments, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain include a constant domain of TCRγ.
[0034] In some embodiments, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain include a constant domain of TCRδ.
[0035] In some implementations, the antigen-binding domain is a camel antibody or a binding fragment thereof.
[0036] In some implementations, the antigen-binding domain is a mouse antibody or a binding fragment thereof.
[0037] In some implementations, the antigen-binding domain is a human or humanized antibody or a binding fragment thereof.
[0038] In some implementations, the antigen-binding domain is a single-chain variable fragment (scFv) or a single-domain antibody (sdAb) domain.
[0039] In some implementations, the antigen-binding domain is a single-domain antibody (sdAb).
[0040] In some implementations, sdAb is V HH .
[0041] In some embodiments, the antigen-binding domain is at a Kc of 100 nM or less or about 0.001 nM to about 100 nM. D The value is combined with the CD70 of the individual.
[0042] In some embodiments, the antigen-binding domain does not compete with CD27 for binding to CD70, does not inhibit the interaction between CD70 and CD27, and / or does not bind to the same epitope of CD70 that is bound by CD27.
[0043] In some embodiments, the antigen-binding domain competes with CD27 for binding to CD70, inhibits the interaction between CD70 and CD27, and / or binds to the same epitope of CD70 that is bound to CD27.
[0044] In some embodiments, the antigen-binding domain specifically binds to an epitope within the amino acid sequence HRDGIYMVHIQVTLAICSSTTAS (SEQ ID NO: 1230).
[0045] In some embodiments, the antigen-binding domain includes an scFv that has at least about 90% sequence identity with any of the sequences in SEQ ID NO:1207-1222, 1246 and 1247.
[0046] In some embodiments, the antigen-binding domain includes an sdAb domain having at least about 90% sequence identity with any of the sequences in SEQ ID NO:1223-1227.
[0047] In some embodiments, the antigen-binding domain includes a variable domain containing complementarity-determining regions 1 (CDR1), 2 (CDR2), and 3 (CDR3).
[0048] In some embodiments, the antigen-binding domain includes a variable domain having at least 90% sequence identity with any of SEQ ID NO:603-620 and 622-688.
[0049] In some embodiments, (i) CDR1 contains the sequence of any one of SEQ ID NO: 87-104 and 107-172; (ii) CDR2 contains the sequence of any one of SEQ ID NO: 259-276 and 279-344; and (iii) CDR3 contains the sequence of any one of SEQ ID NO: 431-448 and 451-516.
[0050] In some embodiments, the antigen-binding domain includes a variable domain having at least 90% sequence identity with SEQ ID NO:618.
[0051] In some implementations, the variable structural domain has at least 95% sequence identity with SEQ ID NO:618.
[0052] In some implementations, the variable structural domain comprises the sequence of SEQ ID NO:618.
[0053] In some implementations, CDR1 is SEQ ID NO:102, CDR2 is SEQ ID NO:274 and CDR3 is SEQ ID NO:446.
[0054] In some embodiments, the antigen-binding domain includes an sdAb domain having at least about 90% sequence identity with any of the sequences in SEQ ID NO:1224-1227.
[0055] In some implementations, the antigen-binding domain is a single-stranded variable fragment (scFv).
[0056] In some embodiments, the scFv includes a heavy chain variable (VH) domain having at least 90% sequence identity with any of SEQ ID NO:783-835.
[0057] In some embodiments, the scFv includes a heavy chain variable (VH) domain having at least 95% sequence identity with any of SEQ ID NO:783-835.
[0058] In some embodiments, the scFv comprises a heavy chain variable (VH) domain having a sequence of any of SEQ ID NO:783-835.
[0059] In some embodiments, the scFv includes a light chain variable (VL) domain having at least 90% sequence identity with any of SEQ ID NO:995-1047.
[0060] In some embodiments, the scFv includes a light chain variable (VL) domain having at least 95% sequence identity with any of SEQ ID NO:995-1047.
[0061] In some embodiments, the scFv comprises a light chain variable (VL) domain having a sequence of any of SEQ ID NO:995-1047.
[0062] In some embodiments, the VH domain includes a heavy chain complementarity determination region 1 (CDRH1) having a sequence of any one of SEQ ID NO:836-888, a CDRH2 having a sequence of any one of SEQ ID NO:889-941, and a CDRH3 having a sequence of any one of SEQ ID NO:942-994.
[0063] In some embodiments, the VL domain includes a light chain complementarity determination region 1 (CDRL1) having a sequence of any of SEQ ID NO:1048-1100, a CDRL2 having a sequence of any of SEQ ID NO:1101-1153, and a CDRL3 having a sequence of any of SEQ ID NO:1154-1206.
[0064] In some embodiments, the scFv includes a VH domain that has at least 90% sequence identity with SEQ ID NO:1248.
[0065] In some implementations, the scFv contains the VH domain of the sequence SEQ ID NO:1248.
[0066] In some embodiments, the scFv includes a VL domain that has at least 90% sequence identity with SEQ ID NO:1249.
[0067] In some implementations, the scFv contains the VL domain of the sequence SEQ ID NO:1249.
[0068] In some embodiments, the scFv includes a VH domain having at least 90% sequence identity with SEQ ID NO:1248 and a VL domain having at least 90% sequence identity with SEQ ID NO:1249.
[0069] In some embodiments, the scFv includes the VH domain of the sequence of SEQ ID NO:1248 and the VL domain of the sequence of SEQ ID NO:1249.
[0070] In some embodiments, the VH domain of the sequence of SEQ ID NO:1248 is operatively connected via its C-terminus to the N-terminus of the VL domain of the sequence of SEQ ID NO:1249.
[0071] In some embodiments, the VL domain of the sequence of SEQ ID NO:1249 is operatively connected via its C-terminus to the N-terminus of the VH domain of the sequence of SEQ ID NO:1248.
[0072] In some implementations, the scFv contains the connector sequence of SEQ ID NO:1237.
[0073] In some embodiments, the VH domain of the sequence SEQ ID NO:1248 and the VL domain of the sequence SEQ ID NO:1249 are operatively connected via the connector sequence SEQ ID NO:1237.
[0074] In some embodiments, the scFv contains a sequence that has at least 90% sequence identity with SEQ ID NO:1207 or SEQ ID NO:1208.
[0075] In some implementations, the scFv contains a sequence of SEQ ID NO:1207 or SEQ ID NO:1208.
[0076] In some embodiments, the scFv includes a VH domain that has at least 90% sequence identity with SEQ ID NO:1250.
[0077] In some implementations, the scFv contains the VH domain of the sequence SEQ ID NO:1250.
[0078] In some embodiments, the scFv includes a VL domain that has at least 90% sequence identity with SEQ ID NO:1251.
[0079] In some implementations, the scFv contains the VL domain of the sequence SEQ ID NO:1251.
[0080] In some embodiments, the scFv includes a VH domain having at least 90% sequence identity with SEQ ID NO:1250 and a VL domain having at least 90% sequence identity with SEQ ID NO:1251.
[0081] In some embodiments, the scFv includes the VH domain of the sequence of SEQ ID NO:1250 and the VL domain of the sequence of SEQ ID NO:1251.
[0082] In some embodiments, the VH domain of the sequence of SEQ ID NO:1250 is operatively connected via its C-terminus to the N-terminus of the VL domain of the sequence of SEQ ID NO:1251.
[0083] In some embodiments, the VL domain of the sequence of SEQ ID NO:1251 is operatively connected via its C-terminus to the N-terminus of the VH domain of the sequence of SEQ ID NO:1250.
[0084] In some implementations, the scFv contains the connector sequence of SEQ ID NO:1237.
[0085] In some embodiments, the VH domain of the sequence SEQ ID NO:1250 and the VL domain of the sequence SEQ ID NO:1251 are operatively connected via the connector sequence SEQ ID NO:1237.
[0086] In some embodiments, the scFv contains a sequence that has at least 90% sequence identity with SEQ ID NO:1209 or SEQ ID NO:1210.
[0087] In some implementations, the scFv contains the sequence of SEQ ID NO:1209 or SEQ ID NO:1210.
[0088] In some embodiments, the scFv includes a VH domain that has at least 90% sequence identity with SEQ ID NO:1252.
[0089] In some implementations, the scFv contains the VH domain of the sequence SEQ ID NO:1252.
[0090] In some embodiments, the scFv includes a VL domain that has at least 90% sequence identity with SEQ ID NO:1253.
[0091] In some implementations, the scFv contains the VL domain of the sequence SEQ ID NO:1253.
[0092] In some embodiments, the scFv includes a VH domain having at least 90% sequence identity with SEQ ID NO:1252 and a VL domain having at least 90% sequence identity with SEQ ID NO:1253.
[0093] In some embodiments, the scFv includes the VH domain of the sequence of SEQ ID NO:1252 and the VL domain of the sequence of SEQ ID NO:1253.
[0094] In some embodiments, the VH domain of the sequence of SEQ ID NO:1252 is operatively connected via its C-terminus to the N-terminus of the VL domain of the sequence of SEQ ID NO:1253.
[0095] In some embodiments, the VL domain of the sequence of SEQ ID NO:1253 is operatively connected via its C-terminus to the N-terminus of the VH domain of the sequence of SEQ ID NO:1252.
[0096] In some implementations, the scFv contains the connector sequence of SEQ ID NO:1237.
[0097] In some embodiments, the VH domain of the sequence SEQ ID NO:1252 and the VL domain of the sequence SEQ ID NO:1253 are operatively connected via the connector sequence SEQ ID NO:1237.
[0098] In some embodiments, the scFv contains a sequence that has at least 90% sequence identity with SEQ ID NO:1246 or SEQ ID NO:1247.
[0099] In some implementations, the scFv contains a sequence of SEQ ID NO:1246 or SEQ ID NO:1247.
[0100] In some embodiments, the antigen-binding domain specifically binds to a second epitope within the amino acid sequence ASRHHPTTLAVGICSPASRSISL (SEQ ID NO:1231).
[0101] In some implementations, the scFv includes a VH domain and a VL domain, wherein the VH domain includes CDRH1 of SEQ ID NO:853, CDRH2 of SEQ ID NO:906, and CDRH3 of SEQ ID NO:959, and the VL domain includes CDRL1 of SEQ ID NO:1065, CDRL2 of SEQ ID NO:1118, and CDRL3 of SEQ ID NO:1171.
[0102] In some embodiments, the scFv includes a VH domain that has at least 90% sequence identity with SEQ ID NO:800.
[0103] In some implementations, the scFv contains the VH domain of the sequence SEQ ID NO:800.
[0104] In some embodiments, the scFv includes a VL domain that has at least 90% sequence identity with SEQ ID NO:1012.
[0105] In some implementations, the scFv contains the VL domain of the sequence SEQ ID NO:1012.
[0106] In some embodiments, the scFv includes a VH domain having at least 90% sequence identity with SEQ ID NO:800 and a VL domain having at least 90% sequence identity with SEQ ID NO:1012.
[0107] In some embodiments, the scFv includes the VH domain of the sequence of SEQ ID NO:800 and the VL domain of the sequence of SEQ ID NO:1012.
[0108] In some implementations, the scFv contains the connector sequence of SEQ ID NO:782.
[0109] In some implementations, when expressed in T cells, T cells expressing the TFP suppress tumor growth.
[0110] In some implementations, T cells expressing the TFP exhibit increased self-cannibalism relative to TFPs with different antigen-binding domains.
[0111] In some implementations, T cells expressing the TFP exhibit reduced self-killing compared to TFPs with different antigen-binding domains.
[0112] In some embodiments, the recombinant nucleic acid molecule encodes any amino acid sequence selected from the amino acid sequences of SEQ ID NO:1233, 1236, 1240, and 1264.
[0113] In one aspect, this disclosure provides a recombinant nucleic acid molecule comprising a sequence encoding an antibody or a fragment thereof that specifically binds to CD70.
[0114] In some embodiments, the antibody or antibody fragment is a camel antibody or a binding fragment thereof.
[0115] In some embodiments, the antibody or antibody fragment is a mouse antibody, a human or humanized antibody, or a binding fragment thereof.
[0116] In some implementations, the antibody or antibody fragment is a single-chain variable fragment (scFv) or a single-domain antibody (sdAb) domain.
[0117] In some implementations, the antibody or antibody fragment is a single-domain antibody (sdAb).
[0118] In some implementations, sdAb is V HH .
[0119] In some embodiments, the antibody or antibody fragment is in K+ of 100 nM or less or about 0.001 nM to about 100 nM. DThe value is combined with the CD70 of the individual.
[0120] In some embodiments, the antibody or antibody fragment does not compete with CD27 for binding to CD70, does not inhibit the interaction between CD70 and CD27, and / or does not bind to the same epitope of CD70 that is bound to CD27.
[0121] In some embodiments, the antibody or antibody fragment competes with CD27 for binding to CD70, inhibits the interaction between CD70 and CD27, and / or binds to the same epitope of CD70 that is bound to CD27.
[0122] In some embodiments, the antigen-binding domain specifically binds to an epitope within the amino acid sequence HRDGIYMVHIQVTLAICSSTTAS (SEQ ID NO: 1230).
[0123] In some embodiments, the antibody or antibody fragment comprises an scFv having at least about 90% sequence identity with any of the sequences in SEQ ID NO:1207-1222, 1246 and 1247.
[0124] In some embodiments, the antibody or antibody fragment includes an sdAb domain having at least about 90% sequence identity with any of the sequences in SEQ ID NO:1223-1227.
[0125] In some embodiments, the antibody or antibody fragment includes variable domains containing CDR1, CDR2, and CDR3.
[0126] In some embodiments, the antibody or antibody fragment includes a variable domain having at least 90% sequence identity with any of SEQ ID NO:603-620 and 622-688.
[0127] In some embodiments, (i) CDR1 contains the sequence of any one of SEQ ID NO: 87-104 and 107-172; (ii) CDR2 contains the sequence of any one of SEQ ID NO: 259-276 and 279-344; and (iii) CDR3 contains the sequence of any one of SEQ ID NO: 431-448 and 451-516.
[0128] In some embodiments, the antibody or antibody fragment includes a variable structural domain having at least 90% sequence identity with SEQ ID NO:618.
[0129] In some implementations, the variable structural domain has at least 95% sequence identity with SEQ ID NO:618.
[0130] In some implementations, the variable structural domain comprises the sequence of SEQ ID NO:618.
[0131] In some implementations, CDR1 is SEQ ID NO:102, CDR2 is SEQ ID NO:274 and CDR3 is SEQ ID NO:446.
[0132] In some embodiments, the antibody or antibody fragment includes an sdAb domain having at least about 80% sequence identity with any of the sequences in SEQ ID NO:1224-1227.
[0133] In some implementations, the antibody or antibody fragment is scFv.
[0134] In some embodiments, the scFv includes a heavy chain variable (VH) domain having at least 90% sequence identity with any of SEQ ID NO:783-835.
[0135] In some embodiments, the scFv includes a heavy chain variable (VH) domain having at least 95% sequence identity with any of SEQ ID NO:783-835.
[0136] In some embodiments, the scFv comprises a heavy chain variable (VH) domain having a sequence of any of SEQ ID NO:783-835.
[0137] In some embodiments, the scFv includes a light chain variable (VL) domain having at least 90% sequence identity with any of SEQ ID NO:995-1047.
[0138] In some embodiments, the scFv includes a light chain variable (VL) domain having at least 95% sequence identity with any of SEQ ID NO:995-1047.
[0139] In some embodiments, the scFv comprises a light chain variable (VL) domain having a sequence of any of SEQ ID NO:995-1047.
[0140] In some embodiments, the VH domain includes CDRH1 having a sequence of any one of SEQ ID NO:836-888, CDRH2 having a sequence of any one of SEQ ID NO:889-941, and CDRH3 having a sequence of any one of SEQ ID NO:942-994.
[0141] In some embodiments, the VL domain includes CDRL1 having a sequence of any one of SEQ ID NO:1048-1100, CDRL2 having a sequence of any one of SEQ ID NO:1101-1153, and CDRL3 having a sequence of any one of SEQ ID NO:1154-1206.
[0142] In some embodiments, the scFv includes a VH domain that has at least 90% sequence identity with SEQ ID NO:1248.
[0143] In some implementations, the scFv contains the VH domain of the sequence SEQ ID NO:1248.
[0144] In some embodiments, the scFv includes a VL domain that has at least 90% sequence identity with SEQ ID NO:1249.
[0145] In some implementations, the scFv contains the VL domain of the sequence SEQ ID NO:1249.
[0146] In some embodiments, the scFv includes a VH domain having at least 90% sequence identity with SEQ ID NO:1248 and a VL domain having at least 90% sequence identity with SEQ ID NO:1249.
[0147] In some embodiments, the scFv includes the VH domain of the sequence of SEQ ID NO:1248 and the VL domain of the sequence of SEQ ID NO:1249.
[0148] In some embodiments, the VH domain of the sequence of SEQ ID NO:1248 is operatively connected via its C-terminus to the N-terminus of the VL domain of the sequence of SEQ ID NO:1249.
[0149] In some embodiments, the VL domain of the sequence of SEQ ID NO:1249 is operatively connected via its C-terminus to the N-terminus of the VH domain of the sequence of SEQ ID NO:1248.
[0150] In some implementations, the scFv contains the connector sequence of SEQ ID NO:1237.
[0151] In some embodiments, the VH domain of the sequence SEQ ID NO:1248 and the VL domain of the sequence SEQ ID NO:1249 are operatively connected via the connector sequence SEQ ID NO:1237.
[0152] In some embodiments, the scFv contains a sequence that has at least 90% sequence identity with SEQ ID NO:1207 or SEQ ID NO:1208.
[0153] In some implementations, the scFv contains a sequence of SEQ ID NO:1207 or SEQ ID NO:1208.
[0154] In some embodiments, the scFv includes a VH domain that has at least 90% sequence identity with SEQ ID NO:1250.
[0155] In some implementations, the scFv contains the VH domain of the sequence SEQ ID NO:1250.
[0156] In some embodiments, the scFv includes a VL domain that has at least 90% sequence identity with SEQ ID NO:1251.
[0157] In some implementations, the scFv contains the VL domain of the sequence SEQ ID NO:1251.
[0158] In some embodiments, the scFv includes a VH domain having at least 90% sequence identity with SEQ ID NO:1250 and a VL domain having at least 90% sequence identity with SEQ ID NO:1251.
[0159] In some embodiments, the scFv includes the VH domain of the sequence of SEQ ID NO:1250 and the VL domain of the sequence of SEQ ID NO:1251.
[0160] In some embodiments, the VH domain of the sequence of SEQ ID NO:1250 is operatively connected via its C-terminus to the N-terminus of the VL domain of the sequence of SEQ ID NO:1251.
[0161] In some embodiments, the VL domain of the sequence of SEQ ID NO:1251 is operatively connected via its C-terminus to the N-terminus of the VH domain of the sequence of SEQ ID NO:1250.
[0162] The recombinant nucleic acid molecule is as described herein, wherein the scFv contains the adapter sequence of SEQ ID NO:1237.
[0163] In some embodiments, the VH domain of the sequence SEQ ID NO:1250 and the VL domain of the sequence SEQ ID NO:1251 are operatively connected via the connector sequence SEQ ID NO:1237.
[0164] In some embodiments, the scFv contains a sequence that has at least 90% sequence identity with SEQ ID NO:1209 or SEQ ID NO:1210.
[0165] In some implementations, the scFv contains the sequence of SEQ ID NO:1209 or SEQ ID NO:1210.
[0166] In some embodiments, the scFv includes a VH domain that has at least 90% sequence identity with SEQ ID NO:1252.
[0167] In some implementations, the scFv contains the VH domain of the sequence SEQ ID NO:1252.
[0168] In some embodiments, the scFv includes a VL domain that has at least 90% sequence identity with SEQ ID NO:1253.
[0169] In some implementations, the scFv contains the VL domain of the sequence SEQ ID NO:1253.
[0170] In some embodiments, the scFv includes a VH domain having at least 90% sequence identity with SEQ ID NO:1252 and a VL domain having at least 90% sequence identity with SEQ ID NO:1253.
[0171] In some embodiments, the scFv includes the VH domain of the sequence of SEQ ID NO:1252 and the VL domain of the sequence of SEQ ID NO:1253.
[0172] In some embodiments, the VH domain of the sequence of SEQ ID NO:1252 is operatively connected via its C-terminus to the N-terminus of the VL domain of the sequence of SEQ ID NO:1253.
[0173] In some embodiments, the VL domain of the sequence of SEQ ID NO:1253 is operatively connected via its C-terminus to the N-terminus of the VH domain of the sequence of SEQ ID NO:1252.
[0174] In some implementations, the scFv contains the connector sequence of SEQ ID NO:1237.
[0175] In some embodiments, the VH domain of the sequence SEQ ID NO:1252 and the VL domain of the sequence SEQ ID NO:1253 are operatively connected via the connector sequence SEQ ID NO:1237.
[0176] In some embodiments, the scFv contains a sequence that has at least 90% sequence identity with SEQ ID NO:1246 or SEQ ID NO:1247.
[0177] In some implementations, the scFv contains a sequence of SEQ ID NO:1246 or SEQ ID NO:1247.
[0178] In some embodiments, the antibody or antibody fragment specifically binds to a second epitope within the amino acid sequence ASRHHPTTLAVGICSPASRSISL (SEQ ID NO:1231).
[0179] In some implementations, the scFv includes a VH domain and a VL domain, wherein the VH domain includes CDRH1 of SEQ ID NO:853, CDRH2 of SEQ ID NO:906, and CDRH3 of SEQ ID NO:959, and the VL domain includes CDRL1 of SEQ ID NO:1065, CDRL2 of SEQ ID NO:1118, and CDRL3 of SEQ ID NO:1171.
[0180] In some embodiments, the scFv includes a VH domain that has at least 90% sequence identity with SEQ ID NO:800.
[0181] In some embodiments, the scFv includes a VL domain that has at least 90% sequence identity with SEQ ID NO:1012.
[0182] In some embodiments, the scFv includes a VH domain having at least 90% sequence identity with SEQ ID NO:800 and a VL domain having at least 90% sequence identity with SEQ ID NO:1012.
[0183] In some implementations, the scFv contains the connector sequence of SEQ ID NO:782.
[0184] In some implementations, such as the recombinant nucleic acid molecules described herein, the recombinant nucleic acid molecules also include a sequence encoding a constant TCR domain.
[0185] In some embodiments, the antibody or antibody fragment is operatively linked to a sequence encoding a constant TCR domain, thereby forming a TFP.
[0186] In some embodiments, the TCR constant structural domain is a TCRα constant structural domain or a portion thereof, a TCRβ constant structural domain or a portion thereof, a TCRα constant structural domain or a portion thereof and a TCRβ constant structural domain or a portion thereof, a TCRγ constant structural domain or a portion thereof, a TCRδ constant structural domain or a portion thereof, or a TCRγ constant structural domain or a portion thereof and a TCRδ constant structural domain or a portion thereof.
[0187] In some implementations, such as the recombinant nucleic acid molecules described herein, the recombinant nucleic acid molecule also includes a leader sequence.
[0188] In some implementations, the nucleic acid is selected from the group consisting of DNA and RNA.
[0189] In some implementations, the nucleic acid is mRNA.
[0190] In some implementations, the nucleic acid is a circular RNA.
[0191] In some implementations, the nucleic acid comprises a nucleotide analog.
[0192] In some embodiments, the nucleotide analogue is selected from nucleic acids modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamido (2'-O-NMA), locked nucleic acids (LNA), ethylene nucleic acids (ENA), peptide nucleic acids (PNA), 1',5'-dehydrated hexitol nucleic acids (HNA), morpholinonucleotides, methylphosphonate nucleotides, thiophosphonate nucleotides, and 2'-fluoroN3-P5'-phosphamide.
[0193] In some implementations, such as the recombinant nucleic acid molecules described herein, a promoter is also included.
[0194] In some implementations, the nucleic acid is an in vitro transcribed nucleic acid.
[0195] In some implementations, the nucleic acid also includes a sequence encoding an A-tail.
[0196] In some implementations, the nucleic acid also includes a 3'UTR sequence.
[0197] In one aspect, this disclosure provides polypeptides encoded by recombinant nucleic acid molecules as described herein.
[0198] In one aspect, this disclosure provides a vector comprising a recombinant nucleic acid molecule encoding a TFP as described herein.
[0199] In one aspect, this disclosure provides a vector comprising a recombinant nucleic acid molecule encoding an antibody or antigen-binding fragment as described herein.
[0200] In some implementations, the vector, as described herein, also includes a sequence encoding siRNA, shRNA, or miRNA for reducing endogenous CD70 levels.
[0201] In some embodiments, the vector, as described herein, further comprises a sequence encoding an inhibitory molecule, the inhibitory molecule comprising at least a first polypeptide constituting a portion of the inhibitory molecule, the first polypeptide being associated with a second polypeptide comprising a positive signal from an intracellular signal transduction domain.
[0202] In some implementations, such as the vector described herein, the vector also includes a sequence encoding a constant structural domain of the TCR.
[0203] In some embodiments, the TCR constant structural domain is a TCRα constant structural domain or a portion thereof, a TCRβ constant structural domain or a portion thereof, a TCRα constant structural domain or a portion thereof and a TCRβ constant structural domain or a portion thereof, a TCRγ constant structural domain or a portion thereof, a TCRδ constant structural domain or a portion thereof, or a TCRγ constant structural domain or a portion thereof and a TCRδ constant structural domain or a portion thereof.
[0204] In some embodiments, the vector is selected from the group consisting of DNA, RNA, plasmid, lentiviral vector, adenovirus vector, Rous sarcoma virus (RSV) vector or retroviral vector.
[0205] In some implementations, such as the vector described herein, a promoter is also included.
[0206] In some implementations, the vector is an in vitro transcription vector.
[0207] In some implementations, the nucleic acid sequence in the vector also includes a polymeric (A) tail.
[0208] In some implementations, the nucleic acid sequence in the vector also includes a 3'UTR.
[0209] In one aspect, this disclosure provides cells comprising recombinant nucleic acid molecules, polypeptides, or vectors as described herein.
[0210] In one aspect, this disclosure provides a cell comprising a recombinant nucleic acid molecule containing a sequence encoding a T cell receptor (TCR) fusion protein (TFP), wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, and (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain; and (b) an antigen-binding domain that specifically binds to CD70; and wherein the TCR subunit is operatively linked to the antigen-binding domain.
[0211] In some implementations, the cell is a T cell.
[0212] In some implementations, the T cells are human T cells.
[0213] In some implementations, the T cells are CD8+ or CD4+ T cells.
[0214] In some implementations, the T cells are human αβ T cells.
[0215] In some implementations, the T cells are human γδT cells.
[0216] In some implementations, the cells are human NKT cells.
[0217] In one aspect, this disclosure provides T cells comprising recombinant nucleic acid molecules, polypeptides, or vectors as described herein.
[0218] In one aspect, this disclosure provides a T cell comprising a recombinant nucleic acid molecule containing a sequence encoding a T cell receptor (TCR) fusion protein (TFP), wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, and (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain; and (b) an antigen-binding domain that specifically binds to CD70; and wherein the TCR subunit is operatively linked to the antigen-binding domain.
[0219] In some implementations, the T cells are human T cells.
[0220] In some implementations, the T cells are CD8+ or CD4+ T cells.
[0221] In some implementations, the T cells are human αβ T cells.
[0222] In some implementations, the T cells are human γδT cells.
[0223] In some embodiments, the cells or T cells described herein also contain nucleic acids encoding inhibitory molecules, said inhibitory molecules comprising at least a portion of a first polypeptide that associates with a second polypeptide containing a positive signal from an intracellular signal transduction domain.
[0224] In some embodiments, the inhibitory molecule comprises: a first polypeptide constituting at least a portion of PD-1 and a second polypeptide comprising a co-stimulatory domain and a primary signal transduction domain.
[0225] In some embodiments, the inhibitory molecule comprises the sequence of SEQ ID NO:1239 or SEQ ID NO:1244.
[0226] In some implementations, the sequence encoding the TFP and the nucleic acid encoding the repressive molecule are contained in a single nucleic acid molecule.
[0227] In some embodiments, the sequence encoding the TFP and the nucleic acid encoding the repressive molecule are contained in two separate nucleic acid molecules.
[0228] In some implementations, the cells or T cells described herein also contain a second nucleic acid sequence encoding a polypeptide or a fragment thereof that encodes interleukin-15 (IL-15).
[0229] In some implementations, the sequence encoding TFP and the second nucleic acid sequence are contained in a single nucleic acid molecule.
[0230] In some implementations, the sequence encoding TFP and the second nucleic acid sequence are contained in two separate nucleic acid molecules.
[0231] In some implementations, the sequence encoding TFP and the second nucleic acid sequence are operatively linked by a second adapter.
[0232] In some embodiments, the second connector includes a protease cleavage site.
[0233] In some implementations, the protease cleavage site is a 2A cleavage site.
[0234] In some implementations, the 2A cleavage site is a T2A cleavage site.
[0235] In some implementations, IL-15 expression increases cell durability.
[0236] In some implementations, the IL-15 peptide is secreted when expressed in the cells or T cells.
[0237] In some implementations, the IL-15 peptide comprises the sequence of SEQ ID NO:1242.
[0238] In some implementations, the second nucleic acid sequence also encodes an IL-15 receptor (IL-15R) subunit or a fragment thereof.
[0239] In some implementations, the IL-15R subunit is IL-15R alpha (IL-15Rα).
[0240] In some implementations, IL-15 and IL-15Rα are operatively connected via a third connector.
[0241] In some implementations, the third connector is not a cuttable connector.
[0242] In some implementations, the third connector includes (G4S) n The sequence is given by , where G is glycine, S is serine, and n is an integer from 1 to 10.
[0243] In some implementations, n is an integer from 1 to 4.
[0244] In some implementations, n is 3.
[0245] In some implementations, the third connector contains the sequence of SEQ ID NO:1243.
[0246] In some implementations, the second nucleic acid sequence encodes a fusion protein containing an IL-15 polypeptide linked to the IL-15Rα subunit.
[0247] In some embodiments, the IL-15 peptide is linked to the N-terminus of the IL-15Rα subunit.
[0248] In some embodiments, the fusion protein comprises amino acids 30-162 of IL-15.
[0249] In some embodiments, the fusion protein comprises amino acids 31-267 of IL-15Rα.
[0250] In some implementations, the fusion protein further includes a sushi domain.
[0251] In some embodiments, the fusion protein comprises the sequence of SEQ ID NO:1244.
[0252] In some embodiments, when the fusion protein is expressed in the cell or T cell, the fusion protein is expressed on the cell surface.
[0253] In some embodiments, the fusion protein is secreted when expressed in the cells or T cells.
[0254] In some embodiments, the cell or T cell also contains a third nucleic acid sequence encoding a PD-1 polypeptide.
[0255] In some embodiments, the PD-1 peptide is operatively linked via its C-terminus to the N-terminus of the intracellular domain of the co-stimulatory peptide.
[0256] In some implementations, the third nucleic acid sequence is contained in the same nucleic acid molecule as the first and second nucleic acid sequences.
[0257] In some embodiments, the PD-1 peptide is linked to the intracellular domain of the co-stimulatory peptide via the transmembrane domain of PD-1.
[0258] In some embodiments, the co-stimulatory peptide is selected from the group comprising OX40, CD2, CD27, CDS, ICAM-1, ICOS (CD278), 4-1BB (CD137), GITR, CD28, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, CD226, FcγRI, FcγRII, and FcγRIII.
[0259] In some embodiments, the intracellular domain of the co-stimulatory peptide comprises at least a portion of CD28.
[0260] In some implementations, the extracellular and transmembrane domains of PD-1 are linked to the intracellular domain of CD28.
[0261] In some embodiments, the cell or T cell contains a fusion protein comprising an extracellular domain and a transmembrane domain of PD-1 linked to an intracellular domain of CD28, the intracellular domain of CD28 being linked to IL-15Rα.
[0262] In some embodiments, the fusion protein comprises the sequence of SEQ ID NO:1254 or SEQ ID NO:1262.
[0263] In some embodiments, the cell or T cell further comprises a second nucleic acid sequence encoding a polypeptide or a fragment thereof that encodes the interleukin-15 receptor α (IL-15Rα) peptide.
[0264] In some implementations, the sequence encoding TFP and the second nucleic acid sequence are contained in a single nucleic acid molecule.
[0265] In some implementations, the sequence encoding TFP and the second nucleic acid sequence are contained in two separate nucleic acid molecules.
[0266] In some implementations, the sequence encoding TFP and the second nucleic acid sequence are operatively linked by a second adapter.
[0267] In some embodiments, the second connector includes a protease cleavage site.
[0268] In some implementations, the protease cleavage site is a 2A cleavage site.
[0269] In some implementations, the 2A cleavage site is a T2A cleavage site.
[0270] In some implementations, the second nucleic acid sequence also encodes PD-1 or a fragment thereof.
[0271] In some implementations, the second nucleic acid sequence encodes the extracellular domain of PD-1.
[0272] In some implementations, the second nucleic acid sequence encodes the extracellular and transmembrane domains of PD-1.
[0273] In some implementations, the second nucleic acid sequence also encodes CD28 or a fragment thereof.
[0274] In some implementations, the second nucleic acid sequence encodes the intracellular domain of CD28.
[0275] In some embodiments, the second nucleic acid sequence encodes a fusion protein comprising the PD-1 extracellular domain and transmembrane domain linked to the CD28 intracellular domain, the CD28 intracellular domain being linked to IL-15Rα.
[0276] In some embodiments, the CD28 intracellular domain is linked to the intracellular domain of IL-15Rα.
[0277] In some implementations, the second nucleic acid sequence comprises the sequence of SEQ ID NO:1245.
[0278] In some embodiments, the recombinant nucleic acid molecule further comprises a third nucleic acid sequence encoding a polypeptide or a fragment thereof of interleukin-15 (IL-15).
[0279] In some embodiments, the IL-15 peptide or a fragment thereof is secreted when expressed in the cells or T cells.
[0280] In some embodiments, the cells or T cells secrete the IL-15 polypeptide in response to a T cell activator.
[0281] In some implementations, IL-15 signaling increases in response to T cell activators.
[0282] In some embodiments, the T-cell activator includes an anti-CD3 antibody or a fragment thereof, an anti-CD28 antibody or a fragment thereof, a cytokine, an antigen binding to the antigen-binding domain of the TFP, or any combination thereof.
[0283] In some implementations, when the TFP is expressed in T cells, the TFP functionally interacts with the endogenous TCR complex.
[0284] In some implementations, the cells or T cells contain functionally disrupted endogenous TCRs.
[0285] In some embodiments, the cell or T cell is an allogeneic cell or T cell.
[0286] In some implementations, the cells or T cells contain functional disruption of the endogenous CD70 gene.
[0287] In some implementations, the cells or T cells contain functional disruption of the endogenous CIITA gene.
[0288] In some implementations, the cells or T cells also contain antisense siRNA, shRNA, or miRNA for reducing endogenous CD70 levels.
[0289] In some implementations, the cells or T cells also contain antisense siRNA, shRNA, or miRNA for reducing endogenous CIITA levels.
[0290] In some embodiments, the cell or T cell further includes a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.
[0291] In some embodiments, the recombinant nucleic acid comprises a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.
[0292] In some embodiments, the sequence encoding the TFP and the sequence encoding the fusion protein containing an anti-CD70 antibody domain and an ER retention domain are contained in the same operon.
[0293] In some implementations, the ER retention domain is encoded by any of SEQ ID NO:756-779.
[0294] In some embodiments, the sequence encoding the fusion protein further includes a CD8α transmembrane domain located between the anti-CD70 antibody domain and the ER retention domain.
[0295] In some embodiments, the sequence encoding the fusion protein further includes a sequence encoding a CD8α signal peptide located at the 5' of the sequence encoding the anti-CD70 antibody domain.
[0296] In some implementations, the antibody domain comprises a recombinant nucleic acid as described herein.
[0297] In some embodiments, the cells or T cells contain CD70 expressed on the cell surface that binds to the anti-CD70 antibody.
[0298] In some embodiments, the anti-CD70 antibody is an antibody or antigen-binding fragment encoded by a recombinant nucleic acid as described herein.
[0299] In some embodiments, the anti-CD70 antibody has a higher affinity for CD70 than the antibody or antigen-binding fragment encoded by the recombinant nucleic acid as described herein.
[0300] In some embodiments, the cell or T cell further includes a heterologous sequence encoding an inhibitory molecule comprising a first polypeptide constituting at least a portion of the inhibitory molecule, the first polypeptide being associated with a second polypeptide comprising a positive signal from an intracellular signal transduction domain.
[0301] In some embodiments, the cell or T cell also contains a heterologous sequence encoding the TCR constant domain.
[0302] In some embodiments, the TCR constant structural domain is a TCRα constant structural domain or a portion thereof, a TCRβ constant structural domain or a portion thereof, a TCRα constant structural domain or a portion thereof and a TCRβ constant structural domain or a portion thereof, a TCRγ constant structural domain or a portion thereof, a TCRδ constant structural domain or a portion thereof, or a TCRγ constant structural domain or a portion thereof and a TCRδ constant structural domain or a portion thereof.
[0303] In some implementations, the TCRα constant domain or the TCRβ constant domain is mouse-based.
[0304] In some embodiments, the cell or T cell comprises a recombinant nucleic acid molecule encoding an amino acid sequence selected from SEQ ID NO: 1233, 1236, 1240 and 1264.
[0305] In one aspect, this disclosure provides pharmaceutical compositions comprising cells or T cells as described herein and pharmaceutically acceptable carriers.
[0306] In one aspect, this disclosure provides a method for generating cells or T cells as described herein, the method comprising: (i) disrupting an endogenous CD70 gene to generate cells or T cells containing a functionally disrupted endogenous CD70 gene; and (ii) transducing the cells or T cells containing a functionally disrupted endogenous CD70 gene using a recombinant nucleic acid as described herein or a vector as described herein.
[0307] In some embodiments, the disruption includes transducing the cell or T cell with a nuclease protein targeting the endogenous CD70 gene or a nucleic acid sequence encoding the nuclease protein.
[0308] In some implementations, the method further includes disrupting endogenous TCR.
[0309] In one aspect, this disclosure provides a method for generating cells or T cells as described herein, the method comprising transducing cells or T cells containing a disrupted endogenous CD70 gene with a recombinant nucleic acid as described herein or a vector as described herein.
[0310] In some implementations, the cells or T cells also contain disruption of endogenous TCRs.
[0311] In one aspect, this disclosure provides a method for generating cells or T cells as described herein, the method comprising: (i) transducing cells or T cells with a recombinant nucleic acid or a vector as described herein; and (ii) contacting the cells or T cells with an anti-CD70 antibody that binds to CD70 on the cell surface.
[0312] In some embodiments, the anti-CD70 antibody is an antibody or antigen-binding fragment encoded by a recombinant nucleic acid as described herein.
[0313] In some embodiments, the anti-CD70 antibody has a higher affinity for CD70 than the antibody or antigen-binding fragment encoded by the recombinant nucleic acid as described herein.
[0314] In some implementations, the contact occurs prior to the transduction.
[0315] In some implementations, the contact occurs at most one day before the transduction.
[0316] In some implementations, the contact occurs after the transduction.
[0317] In some implementations, the contact occurs up to 5 days after the transduction.
[0318] In some embodiments, such as the method described herein, the cells are further subcultured in a culture medium that does not contain the anti-CD70 antibody four or more days after the transduction.
[0319] In some embodiments, the subculture includes subculturing the cells in a culture medium that does not contain the anti-CD70 antibody for 7 days or more after the transduction.
[0320] In one aspect, this disclosure provides a method of treating cancer in a subject in need, comprising administering to the subject an effective amount of a pharmaceutical composition as described herein.
[0321] In one aspect, this disclosure provides a method of treating cancer in a subject in need, the method comprising administering a pharmaceutical composition to the subject, the pharmaceutical composition comprising (a) cells or T cells as described herein; and (b) a pharmaceutically acceptable carrier.
[0322] In some implementations, the cancer is one associated with elevated CD70 expression.
[0323] In some implementations, such as the method described herein, the administration of an agent to the subject that increases CD70 levels in cancer cells is also included.
[0324] In some implementations, the agent that increases CD70 levels is a hypomethylating agent.
[0325] In some embodiments, the hypomethylating agent is 5-azacitidine or decitabine.
[0326] In some implementations, the disease or symptom is selected from the group consisting of T-cell lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), Epstein-Barr virus (EBV) + cancer and / or human papillomavirus (HPV) + cancer.
[0327] In some implementations, the disease or symptom is selected from the group consisting of renal cell carcinoma, renal cell carcinoma, lung cancer, pancreatic cancer, ovarian cancer, esophageal cancer, nasopharyngeal carcinoma, mesothelioma, glioblastoma, thymic carcinoma, breast cancer, head and neck cancer, and gastric cancer.
[0328] In some implementations, the subject is a human being.
[0329] In one aspect, this disclosure provides a method for generating cells or T cells as described herein, the method comprising: (i) disrupting an endogenous CIITA gene to generate cells or T cells containing a functionally disrupted endogenous CIITA gene; and (ii) transducing the cells or T cells containing a functionally disrupted endogenous CIITA gene using a recombinant nucleic acid as described herein or a vector as described herein.
[0330] In some embodiments, the disruption includes transducing the cell or T cell with a nuclease protein targeting the endogenous CIITA gene or a nucleic acid sequence encoding the nuclease protein.
[0331] In some implementations, the method further includes disrupting endogenous TCR.
[0332] In one aspect, this disclosure provides a method for generating cells or T cells as described herein, the method comprising transducing cells or T cells containing a disrupted endogenous CIITA gene with a recombinant nucleic acid as described herein or a vector as described herein.
[0333] In some implementations, the cells or T cells also contain disruption of endogenous TCRs.
[0334] In one aspect, this disclosure provides a method for generating cells or T cells as described herein, the method comprising transducing cells or T cells with a recombinant nucleic acid as described herein or a vector as described herein and a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.
[0335] In some implementations, the recombinant nucleic acid or vector and the sequence encoding a fusion protein containing an anti-CD70 antibody domain and an ER retention domain are simultaneously transduced.
[0336] In some embodiments, the recombinant nucleic acid or vector comprises a sequence encoding a fusion protein containing an anti-CD70 antibody domain and an ER retention domain.
[0337] In some embodiments, the sequence encoding the TFP and the sequence encoding the fusion protein containing an anti-CD70 antibody domain and an ER retention domain are contained in the same operon.
[0338] In some embodiments, the recombinant nucleic acid or vector is transduced before or after a sequence encoding a fusion protein containing an anti-CD70 antibody domain and an ER retention domain.
[0339] In some implementations, the ER retention domain is encoded by any of SEQ ID NO:756-779.
[0340] In some embodiments, the sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain further comprises a CD8α transmembrane domain between the anti-CD70 antibody domain and the ER retention domain.
[0341] In some embodiments, the sequence encoding the fusion protein comprising the anti-CD70 antibody domain and the ER retention domain further comprises a sequence encoding a CD8α signal peptide located at the 5' of the sequence encoding the anti-CD70 antibody domain.
[0342] In some implementations, the antibody domain constitutes an anti-CD70 antibody as described herein.
[0343] By incorporating via reference
[0344] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the extent that each individual publication, patent, or patent application is specifically and individually indicated to be incorporated herein by reference. Attached Figure Description
[0345] The novel features of the invention are specifically set forth in the appended claims. A better understanding of the features and advantages of the invention will be obtained by referring to the following detailed description and accompanying drawings, which illustrate illustrative embodiments utilizing the principles of the invention, and in which:
[0346] Figure 1 This is an illustration of an ELISA assay that detects the binding of anti-CD70VHH and scFv to CHO-CD70 cells (high CD70 expression), JVM3 cells (medium-low CD70 expression), wild-type CHO cells (negative control), and HL60 cells (negative control).
[0347] Figure 2 The results of the octet binding assay used to determine the affinity of each of the shown anti-CD70 VHH and scFv for CD70 are shown.
[0348] Figure 3 The results of an epitope binning assay used to determine each of the shown anti-CD70 VHH and scFv, as well as the clustering against CD27, are shown.
[0349] Figure 4 This is a schematic diagram of the competitive determination method described in Example 2.
[0350] Figure 5It is used to evaluate the anti-CD70 VHH and scFv resistance against CD27 and their binding to CD70. Figure 4 The diagram shows the competitive assay method.
[0351] Figures 6A-6C This is a graph of flow cytometry data, which was obtained by detecting cell surface TFP expression in T cells transduced with the indicated binder or in untransduced control T cells using anti-VHH antibody and CD70-Fc tag staining. Figure 6A The detection using anti-VHH antibody and CD70-Fc tag is shown. Figure 6B The detection using anti-VHH antibody is shown. Figure 6C The detection was performed using the CD70-Fc tag.
[0352] Figures 7A-7C This is a diagram of flow cytometry data used to detect the positivity rates of CD4+ and CD8+ in T cells transduced with TFP containing the indicated binder or in untransduced control T cells. Figure 7A Total T cells are shown. Figure 7B TFP+ T cells are shown. Figure 7C TFP-T cells are shown.
[0353] Figures 8A-8F This is a diagram of flow cytometry data used to detect T cell memory status in T cells transduced with TFP containing the indicated binder or in untransduced control T cells by staining for cell surface expression of CD45RA and CCR7. Figure 8A Total CD4+ T cells are shown. Figure 8B TFP-CD4+ T cells are shown. Figure 8C TFP+CD4+ T cells are shown. Figure 8D Total CD8+ T cells are shown. Figure 8E TFP-CD8+ T cells were shown. Figure 8F TFP+CD8+ T cells were shown.
[0354] Figures 9A-9D This is a graph of flow cytometry data that detected the cell surface expression of CD45RA and CD27 in T cells transduced with TFP containing the indicated binder or in untransduced control T cells. Figure 9A and Figure 9B TFP-T cells are shown. Figure 9C and Figure 9D TFP+ T cells are shown.
[0355] Figure 10It is a series of graphs showing the proliferation of T cells transduced with TFP containing the indicated binder from three donors, or untransduced control T cells, after 24 hours of co-culture with CHO-WT cells or THP-1 cells at effector cell:target cell ratios of 9:1, 3:1, and 1:1.
[0356] Figure 11 The charts show the cytotoxicity of T cells transduced with TFP containing the indicated binder from three donors, or untransduced control T cells, when co-cultured with CHO-WT cells or THP-1 cells at effector cell:target cell ratios of 9:1, 3:1, and 1:1 for 24 hours.
[0357] Figure 12A and Figure 12B It is a series of graphs showing cytokine secretion from T cells transduced with TFP containing the indicated binder from three donors, or untransduced control T cells, when co-cultured for 24 hours with CHO-WT cells or THP-1 cells at effector cell:target cell ratios of 9:1, 3:1, and 1:1. Figure 12A The results show IFN-γ, TNF-α, and IL-2. Figure 12B The GM-CSF is shown.
[0358] Figure 13 A series of graphs are provided showing the expansion and viability of T cells transduced with the indicated TFP and untransduced controls generated 10 days after expansion, in the presence and absence of anti-CD70 antibody, according to the method described in Example 9.
[0359] Figure 14 A graph illustrating the transduction efficiency of cells transduced with the indicated TFP in the presence and absence of anti-CD70 antibody, according to the method described in Example 9, is shown.
[0360] Figure 15 A series of charts are provided showing the proportions of CD4+ and CD8+ T cells when TFP+ T cells are generated in the presence and absence of anti-CD70 antibody according to the method described in Example 9.
[0361] Figure 16A and Figure 16B It is a series of charts illustrating the memory phenotypes of T cells when TFP+ T cells are generated in the presence and absence of anti-CD70 antibodies according to the method described in Example 9. Figure 16A CD4+ T cells were shown and Figure 16B CD8+ T cells are shown.
[0362] Figure 17 A series of charts are provided showing the proportions of CCR7+CD4+ and CD8+ T cells when TFP+ T cells are generated in the presence and absence of anti-CD70 antibody according to the method described in Example 9.
[0363] Figure 18 A series of charts are provided showing the proportions of CCR69+CD4+ and CD8+ T cells when TFP+ T cells are generated in the presence and absence of anti-CD70 antibody according to the method described in Example 9.
[0364] Figure 19A and Figure 19B It is a series of charts illustrating the proportions of CD27+ and CD70+ T cells when generating TFP+ T cells in the presence and absence of anti-CD70 antibodies according to the method described in Example 9. Figure 19A CD4+ T cells were shown and Figure 19B CD8+ T cells are shown.
[0365] Figure 20 This is a series of figures illustrating RNAseq on TFP+ T cells generated in the presence and absence of anti-CD70 antibody according to the method described in Example 9.
[0366] Figure 21 This is a series of graphs illustrating the cytotoxicity of TFP+ T cells generated according to the method described in Example 9 in the presence and absence of anti-CD70 antibody. Cells were co-cultured at target cell:effect cell ratios of 1:1, 3:1, or 9:1. CD70-negative K562 cells, CD70-positive THP-1AML cells, or CD70-positive RCC786-O cells were modified to overexpress firefly luciferase, and cell lysis was determined by the luciferase activity of live cells.
[0367] Figures 22A-22H This is a series of charts illustrating the cytokine expression of TFP+ T cells when co-cultured for 24 or 72 hours with CD70-negative K562 cells, CD70-positive THP-1AML cells, or CD70-positive RCC 786-O cells at a target cell:effect cell ratio of 1:1, 3:1, or 9:1. The TFP+ T cells were generated in the presence and absence of anti-CD70 antibodies according to the method described in Example 9. The charts show the 24-hour (…) Figure 22A ) and 72 hours ( Figure 22B GM-CSF levels were shown. The 24-hour ( Figure 22C ) and 72 hours ( Figure 22DThe IFN-γ levels were shown over 24 hours. Figure 22E ) and 72 hours ( Figure 22F IL-2 levels were shown over 24 hours. Figure 22G ) and 72 hours ( Figure 22H TNF-α levels.
[0368] Figure 23A and Figure 23B This is a series of charts illustrating the time 7 days after CRISPR editing to knock out CD70. Figure 23A ) and 9 days ( Figure 23B The ratio of TFP+CD70+ and CD70- cells.
[0369] Figure 24 Graphs and figures illustrating the transduction efficiency of cells transduced with the TFP shown, according to the method described in Example 10, in unedited cells and CD70 CRISPR-edited cells.
[0370] Figure 25 A series of charts are provided showing the proportions of CD4+ and CD8+ T cells when TFP+ T cells are generated in unedited cells and CD70 CRISPR-edited cells according to the method described in Example 10.
[0371] Figure 26 This is a series of graphs illustrating the ratio of CD27+ and CD70+ T cells when TFP+ T cells are generated in unedited cells and CD70CRISPR-edited cells according to the method described in Example 10.
[0372] Figure 27A and Figure 27B It is a series of charts illustrating the memory phenotypes of T cells when TFP+ T cells are generated in unedited cells and CD70 CRISPR-edited cells according to the method described in Example 10. Figure 27A CD4+ T cells were shown and Figure 27B CD8+ T cells are shown.
[0373] Figure 28 A series of charts are provided showing the proportion of CCR69+CD4+ and CD8+ T cells when TFP+ T cells are generated in unedited cells and CD70 CRISPR-edited cells according to the method described in Example 10.
[0374] Figure 29This is a series of graphs showing the expression of 70-001TFP in wild-type and CD3ε knockout jurkat cells as detected by flow cytometry using CD70-Biotin / SA-PE and anti-VHH-AF488. TruC was generated using VIN70069 virus (IU titer 6.5E7).
[0375] Figure 30 This is a series of figures illustrating the proportions of VHH+ and CD69+ jurkat cells (wild-type or CD3ε knockout) transduced with 70-001TFP when co-cultured for 16 hours with CD70-negative K562 cells, CD70-positive THP-1AML cells, CD70-positive JVM3 cells, or a target-free control in the presence or absence of 5 μM 41D12 anti-CD70 antibody at a 1:1 ratio.
[0376] Figure 31 yes Figure 30 The diagram shows the flow graph data.
[0377] Figure 32 This is a series of figures illustrating the proportion of VHH+ and CD69+CD3ε knockout jurkat cells transduced with 70-001TFP when co-cultured for 16 hours with CD70-negative K562 cells, CD70-positive THP-1AML cells, CD70-positive JVM3 cells, or a target-free control, in the presence or absence of anti-CD70 antibodies (5 μM 1F6-hFc or 70-001-hFc or 10 μM 41D12) at a 1:1 ratio.
[0378] Figure 33 yes Figure 32 The diagram shows the flow graph data.
[0379] Figure 34 This is a schematic diagram of an ELISA assay for measuring the ability of CD27 to block CD70 binding, which is performed by the ELISA described in Example 12.
[0380] Figure 35 This is a graph showing the octet titration of the affinity of anti-CD70 scFv antibodies 1885 (B08), 1985 (A11), and 1867 (C10) for CD70. A set of scFvs was identified by panning a natural fully human scFv library, and a subset of these have been converted to TruC and characterized here.
[0381] Figure 36 The results of the epitope clustering assay used to determine each of the shown anti-CD70 VHH and scFv, as well as the clustering against CD27, are shown.
[0382] Figures 37A-37C The results of the epitope plotting analysis are shown. Figure 37A This is a graph showing the epitope mapping results of the VHH antibody shown. Figure 37B This is a graph showing the epitope mapping results of the scFv antibody. Figure 37C This is a summary from... Figure 36 , Figure 37A and Figure 37B A schematic diagram of epitope clustering and epitope mapping data.
[0383] Figure 38 This is a series of figures showing flow cytometry data, as determined by CD3 expression, of CD69 expression and transduction efficiency in jurakat cells transduced with TFP containing the indicated scFv binder or in untransduced control T cells.
[0384] Figure 39A and Figure 39B This is a series of figures showing flow cytometry data of CD3 and CD69 expression detected in jurkat cells transduced with TFP containing the indicated scFv binder after co-culturing for 24 hours with K562, THP-1, ACHN, or 786-O target cells at a 1:1 ratio. Figure 39A The scFv binder with vLvH orientation is shown and Figure 39B A scFv binder with a vHvL orientation is shown.
[0385] Figure 40 This diagram illustrates the production of cytokines TNF-α, GM-CSF, and IL-2 in CD3ε knockout jurkat cells transduced with TFP containing the indicated scFv binder after 24 hours of co-culturing with K562, THP-1, ACHN, or 786-O target cells at a 1:1 ratio. CD70 TFP T cells were co-cultured with CD70-K562 cells or CD70+ TFP+, ACHN, or 786-0 cells.
[0386] Figure 41 This is a diagram showing the expansion of T cells transduced with CD70TFP with the scFv binder shown, with 70-001CD70 TFP, or with TC-110.
[0387] Figure 42 This is a graph illustrating the transduction efficiency of cells transduced using the TFP construct shown, as indicated in Example 16.
[0388] Figure 43A series of graphs are provided showing the proportions of CD4+ and CD8+ T cells in T cell populations transduced with the TFP shown as indicated in Example 16, or in untransduced control T cells. Some CD70 TRuCs show CD4 / CD8 ratios similar to those of NT and TC-110.
[0389] Figure 44 It is a graph showing the proportion of CD69+ T cells transduced with TFP having the indicated binder as indicated in Example 16, or untransduced control T cells.
[0390] Figure 45 It is a graph showing the memory phenotype as determined by flow cytometry, which detects the cell surface expression of CD45RA and CD27 in T cells transduced with TFP having the indicated binder as indicated in Example 16 or in untransduced control T cells.
[0391] Figure 46 It is a summary Figures 42-45 The table showing the data.
[0392] Figure 47 This is a series of graphs showing the detection of CD70 surface expression in THP-1, ACHN, and 786-O cell lines.
[0393] Figure 48 It is a series of graphs showing the cytotoxicity of T cells transduced with TFP containing the indicated binder from a representative donor or untransduced control T cells when co-cultured with THP-1, ACHN, 786-O, or K562 cells at a ratio of 3:1, 1:1, or 1:3 for 24 hours.
[0394] Figures 49A-49D This is a series of graphs showing cytokine production in T cells transduced with TFP containing the indicated binder from a representative donor, or untransduced control T cells, after 24 hours of co-culture with THP-1, ACHN, 786-O, or K562 cells at a ratio of 3:1, 1:1, or 1:3. IFN-γ (...) was measured. Figure 49A ), IL-2 Figure 49B ), TNF-α Figure 49C ) and GM-CSF ( Figure 49D ).
[0395] Figure 50 The diagram shows expansions from three donors using CD70TFP with the indicated scFv or humanized VHH binder, or T cells transduced with 70-001CD70 TFP (P3E8), TC-110, or untransduced controls.
[0396] Figure 51 This is a series of figures illustrating cell surface CD70 expression and transduction efficiency as determined by VHH expression in T cells transduced with CD70TFPs from three donors, either with the indicated scFv or humanized VHH binder, or with 70-001CD70 TFP(P3E8), TC-110, or in untransduced controls.
[0397] Figure 52 This is a series of graphs showing flow cytometry data on CD4+ and CD8+ positivity rates in T cells transduced with scFv or humanized VHH binders from three donors, or with 70-001CD70 TFP (P3E8), TC-110, or in untransduced controls.
[0398] Figure 53 This is a series of figures illustrating memory phenotypes, as determined by flow cytometry, in T cells transduced with CD70TFP (70-001CD70 TFP(P3E8)) or humanized VHH binders from two donors, or with untransduced controls, such as those determined by detecting cell surface expression of CD45RA and CD27.
[0399] Figure 54 This is a series of figures showing flow cytometry data on CD69 cell surface expression in T cells transduced with CD70TFP from three donors with the indicated scFv or humanized VHH binder, or with 70-001CD70 TFP (P3E8), TC-110, or in untransduced controls.
[0400] Figure 55 It is a series of graphs showing the cytotoxicity of T cells transduced with TFP containing the indicated binder from a representative donor or untransduced control T cells when co-cultured with THP-1, ACHN, 786-O, or K562 cells at a ratio of 3:1, 1:1, or 1:3 for 24 hours.
[0401] Figure 56 This is a series of graphs illustrating cytokine production in T cells transduced with TFP containing the indicated binder from a representative donor, or in untransduced control T cells, after 24 hours of co-culture with THP-1, ACHN, 786-O, or K562 cells at ratios of 3:1, 1:1, or 1:3. IFN-γ, IL-2, TNF-α, and GM-CSF were measured.
[0402] Figure 57 It is a series of graphs showing expansions from three donors using CD70TFP with the indicated scFv or humanized VHH binder, or T cells transduced with 70-001CD70 TFP (P3E8), C10 TFP, or untransduced controls.
[0403] Figure 58 This is a series of figures illustrating the transduction efficiency, as determined by the detection of VHH expression, in T cells transduced with 70-001CD70 TFP (P3E8) from a representative donor using CD70 TFP with the indicated humanized VHH binder, or in untransduced controls.
[0404] Figure 59 This is a series of figures showing flow cytometry data on CD4+ and CD8+ positivity rates in T cells transduced with 70-001CD70 TFP (P3E8) from a representative donor, using CD70 TFP with the indicated humanized VHH binder, or in untransduced controls.
[0405] Figure 60A-60C This is a series of figures illustrating the memory phenotypes in T cells transduced with 70-001CD70 TFP (P3E8) from a representative donor with CD70 TFP containing the humanized VHH binder shown, and in untransduced controls, as determined by flow cytometry by detecting cell surface expression of CD45RA and CD27. Figure 60A Total CD3+ T cells are shown. Figure 60B CD4+ T cells are shown. Figure 60C CD8+ T cells are shown.
[0406] Figure 61 It is a series of graphs showing the cytotoxicity of T cells transduced with TFP containing the indicated binder, generated from a representative donor in the presence or absence of the indicated 41D12 antibody, or untransduced control T cells, when co-cultured for 24 hours with THP-1, ACHN, 786-O, MOLM14, or K562 cells at a ratio of 3:1, 1:1, or 1:3.
[0407] Figures 62A-62DThis is a series of charts showing cytokine production in T cells transduced with TFP containing the indicated binder, or untransduced control T cells, generated from a representative donor in the presence or absence of the indicated 41D12 antibody, after 24 hours of co-culture with THP-1, ACHN, 786-O, MOLM13, or K562 cells at a ratio of 3:1, 1:1, or 1:3. IFN-γ (...) was measured. Figure 62A ), GM-CSF ( Figure 62B ), IL-2 Figure 62C ) and TNF-α Figure 62D ).
[0408] Figure 63 This is a graph showing the expansion of T cells transduced with C10 CD 70TFP with or without the PD-1-CD28 fusion protein or membrane-bound IL-15, or an untransduced control.
[0409] Figure 64 This is a series of figures showing the transduction efficiency (as determined by detection of VHH expression), cell surface PD-1 expression, and cell surface IL15Rα expression in T cells transduced with C10 CD70 TFP or untransduced controls with or without PD-1-CD28 fusion protein or membrane-bound IL-15.
[0410] Figure 65 This is a series of figures showing flow cytometry data on CD4+ positivity in T cells transduced with C10 CD70 TFP with or without PD-1-CD28 fusion protein or membrane-bound IL-15, or in untransduced controls.
[0411] Figure 66 This is a series of figures illustrating the memory phenotypes, as determined by flow cytometry, in T cells transduced with C10 CD70 TFP with or without the PD-1-CD28 fusion protein or membrane-bound IL-15, or in untransduced controls, as determined by detecting cell surface expression of CD45RA and CD27.
[0412] Figure 67 This is a series of graphs showing the expansion of T cells transduced with CD70 TFP from two donors, or untransduced controls.
[0413] Figure 68A and Figure 68BThis is a series of figures showing the CD8 positivity rate and transduction efficiency, as determined by detection of scFv expression, in T cells transduced with CD70 TFP containing the human scFv binder shown from two representative donors or in untransduced controls. Figure 68A T cells from donor R017 were shown and Figure 68B T cells from donor R022 are shown.
[0414] Figure 69A and Figure 69B This is a series of figures showing flow cytometry data for detecting CD70 cell surface expression in T cells transduced with CD70 TFP from two donors, or in untransduced controls. Figure 69A T cells from donor R017 were shown and Figure 69B T cells from donor R022 are shown.
[0415] Figures 70A-70D This is a series of figures illustrating the memory phenotypes, as determined by flow cytometry, in T cells transduced with CD70 TFP containing the human scFv binder shown from two donors, or in untransduced controls, as determined by detecting cell surface expression of CD45RA and CD27. Figure 70A The image shows CD8+ T cells from donor R017. Figure 70B The image shows CD4+ T cells from donor R017. Figure 70C The image shows CD8+ T cells from donor R022. Figure 70D The image shows CD4+ T cells from donor R022.
[0416] Figure 71A and Figure 71B It is a series of graphs showing the cytotoxicity of T cells transduced with TFP containing the indicated binder from two donors, or untransduced control T cells, when co-cultured with THP-1, ACHN, 786-O, or K562 cells at a ratio of 3:1, 1:1, or 1:3 for 24 hours. Figure 71A T cells from donor R017 were shown and Figure 71B T cells from donor R022 are shown.
[0417] Figure 72A and Figure 72B It is a series of graphs showing tumor volumes in mice treated with CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibodies, using the method described in Example 21, in a mouse model of renal cell carcinoma. Figure 72A The tumor volume at the time of initial treatment was shown and Figure 72B The tumor volume upon re-excitation is shown.
[0418] Figures 73A-73C Tumor growth in mice treated with CD70 TFP+ T cells generated in the presence and absence of anti-CD70 antibodies, according to the method described in Example 21, is shown in a mouse model of systemic human Burkitt lymphoma. Tumor growth was determined by luminescence. Figure 73A A graph showing tumor growth in all groups is displayed on a single chart. Figure 73B A separate graph for each group is shown. Figure 73C The luminescent images of each subject are shown.
[0419] Figure 74A and Figure 74B Tumor growth in mice treated with CD70 TFP+ T cells generated according to the method described in Example 21, in the presence and absence of anti-CD70 antibodies, is shown in a mouse model of systemic human acute myeloid leukemia. Tumor growth was determined by luminescence. Figure 74A A graph showing tumor growth in all groups is displayed on a single chart. Figure 74B Individual plots for each group are shown at a dose of 1e7 TFP+ T cells.
[0420] Figure 75 This is a graph showing the tumor volume of mice treated with CD70TFP+ T cells generated according to the method described in Example 21 in the presence and absence of anti-CD70 antibody in a mouse model of renal cell carcinoma (ACHN). Detailed Implementation
[0421] This disclosure provides a recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), wherein the TFP comprises: (a) a TCR subunit, the TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, and (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain; and (b) an antigen-binding domain that specifically binds to CD70; and wherein the TCR subunit is operatively linked to the antigen-binding domain, or this disclosure provides a vector comprising the recombinant nucleic acid molecule. This document also provides a recombinant nucleic acid molecule comprising a sequence encoding an antibody or a fragment thereof that specifically binds to CD70. This document also discloses cells comprising recombinant nucleic acids, such as T cells, wherein the recombinant nucleic acid comprises a sequence encoding the TFP as described herein. The cells may also comprise: nucleic acids encoding an inhibitory molecule comprising a first polypeptide constituting at least a portion of an inhibitory molecule (e.g., PD-1), the first polypeptide being associated with a second polypeptide comprising a positive signal from an intracellular signaling domain (e.g., a co-stimulatory domain and a primary signaling domain); and / or nucleic acids encoding an interleukin-15 (IL-15) polypeptide or a fragment thereof, an IL-15 receptor (IL-15R) subunit or a fragment thereof, or a combination thereof. This document also discloses pharmaceutical compacts comprising cells as described herein and pharmaceutically acceptable carriers, methods for treating a subject's cancer by administering a pharmaceutical composition as described herein, and methods for generating cells as described herein.
[0422] definition
[0423] Unless otherwise defined, all specialized terms, symbols, and other scientific terms used herein are intended to have the meaning commonly understood by one of ordinary skill in the art to which this invention pertains. In some instances, for clarity and / or ease of reference, terms are defined herein with their commonly understood meanings, and the inclusion of such definitions herein is not necessarily construed as indicating a difference from the commonly understood meaning in the art. The techniques and procedures described or referenced herein are generally well understood by one of ordinary skill in the art and commonly used with conventional methods, such as the widely used molecular cloning methods described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th Edition (2012), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Where applicable, unless otherwise stated, procedures involving the use of commercially available kits and reagents are generally performed according to the manufacturer's defined protocols and conditions.
[0424] As used herein, unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” include plural indicators. Unless otherwise clearly indicated, the terms “comprising,” “such as,” etc., are intended to convey inclusion without limitation.
[0425] As used herein, the term "comprising" or its variations such as "containing" or "including" should be understood to indicate that any of the listed integers (e.g., features, elements, characteristics, properties, method / process steps, or limitations) or groups of integers (e.g., features, elements, characteristics, properties, method / process steps, or limitations) are included, but no other integers or groups of integers are excluded. Therefore, as described herein, the term "comprising" is inclusive and does not exclude additional, unlisted integers or method / process steps.
[0426] In any embodiments of the compositions and methods provided herein, "comprising" may be replaced by "consistently consisting of" or "consisting of". The phrase "consistently consisting of" is used herein to refer to specifically named integers or steps and those that do not substantially affect the nature or function of the claimed invention. As used herein, the term "consisting of" is used to indicate the individual presence of either the listed integers (e.g., features, elements, characteristics, properties, method / process steps, or limitations) or the group of integers (e.g., features, elements, characteristics, properties, method / process steps, or limitations).
[0427] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0428] The term "about" indicates and covers the indicated value and the range above and below that value. In some embodiments, the term "about" indicates a specified value ±10%, ±5%, or ±1%. In some embodiments, where applicable, the term "about" indicates a specified value ± one standard deviation of that value.
[0429] As used herein, the term "antibody" refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that binds specifically to an antigen. Antibodies can be complete immunoglobulins or fragments thereof from polyclonal or monoclonal sources, and can be derived from natural or recombinant sources.
[0430] The term "antigen-binding domain" refers to the portion of an antibody that specifically binds to an antigen or epitope. An example of an antigen-binding domain is the V-shaped structure of an antibody. H -V LAntigen-binding domains formed by dimers. Another example of an antigen-binding domain is an antigen-binding domain formed by the diversification of certain loops from the tenth type III fibronectin domain of adnectin.
[0431] The term "antibody fragment" or "antibody-binding domain" refers to at least one portion of an antibody or its recombinant variant containing an antigen-binding domain (i.e., the antigen-determining variable region of the complete antibody) sufficient to confer recognition and specific binding of the antibody fragment to targets such as antigens and their defined epitopes. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2 and Fv fragments, single-chain (sc)Fv ("scFv") antibody fragments, linear antibodies, and single-domain antibodies (abbreviated as "sdAb") (V L or V H Camel V HH Domains and multispecific antibodies formed from antibody fragments.
[0432] The term "scFv" refers to a fusion protein comprising at least one antibody fragment containing a light chain variable region and at least one antibody fragment containing a heavy chain variable region, wherein the light chain and heavy chain variable regions are continuously linked by a short, flexible polypeptide linker and are capable of being expressed as a single polypeptide chain, and wherein the scFv retains the specificity of the intact antibody from which it is derived.
[0433] Regarding the "heavy chain variable region" or "V" of antibodies H (or, in the case of single-domain antibodies such as nanobodies, "V") HH ") refers to a heavy chain segment containing three CDRs inserted between flank chain segments called frame regions, which are typically more conservative than the CDRs and form a support structure for the CDRs.
[0434] Unless otherwise stated, as used herein, scFv can have V in any order (e.g., relative to the N-terminus and C-terminus of the polypeptide). L and V H The variable region, scFv, can contain V. L -Connector-V H Or it may contain V H -Connector-V L .
[0435] The portion of the TFP composition of the present invention comprising an antibody or an antibody fragment thereof may be present in various forms, wherein the antigen-binding domain is expressed as part of a continuous polypeptide chain, including, for example, single-domain antibody fragments (sdAbs) or heavy-chain antibodies (HCAbs), single-chain antibodies (scFvs) derived from mouse, humanized, or human antibodies (Harlow et al., 1999, in: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, in: Antibodies: A Laboratory Manual, Cold Spring Harbor, NY; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). In one aspect, the antigen-binding domain of the TFP composition of the present disclosure comprises an antibody fragment. In a further aspect, the TFP comprises an antibody fragment containing scFv or sdAb.
[0436] The term "antibody heavy chain" refers to the larger of two types of polypeptide chains that exist in the antibody molecule in their naturally occurring conformation, and it usually determines the class to which the antibody belongs.
[0437] The term "antibody light chain" refers to the smaller of two types of polypeptide chains that exist in the antibody molecule in their naturally occurring conformation. The kappa ("κ") and lambda ("λ") light chains refer to the two main isotypes of antibody light chains.
[0438] The term "recombinant antibody" refers to an antibody generated using recombinant DNA technology, such as antibodies expressed, for example, by a phage or yeast expression system. The term should also be interpreted as meaning an antibody produced by synthesizing a DNA molecule encoding an antibody, said DNA molecule expressing an antibody protein or specifying the amino acid sequence of that antibody, wherein said DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequencing technologies available and known in the art.
[0439] The term "antigen" or "Ag" refers to a molecule that can be specifically bound by an antibody or otherwise elicit an immune response. This immune response may involve the production of antibodies or the activation of specific immune cells, or both.
[0440] Those skilled in the art will understand that any macromolecule, including virtually all proteins or peptides, can be used as an antigen. Furthermore, antigens can be derived from recombinant DNA or genomic DNA. Those skilled in the art will understand that any DNA containing a nucleotide sequence or a portion of a protein encoding an immune response thus encodes an "antigen," as the term means as used herein. Furthermore, those skilled in the art will understand that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It is apparent that this disclosure includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit the desired immune response. Furthermore, those skilled in the art will understand that an antigen does not necessarily need to be encoded by a "gene." It is apparent that antigens can be synthesized, derived from biological samples, or can be macromolecules other than polypeptides. Such biological samples can include, but are not limited to, tissue samples, tumor samples, cells, or fluids containing other biological components.
[0441] CD70 is a cytokine belonging to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27 / CD27. It is a surface antigen on activated, rather than resting, T and B lymphocytes. CD70 induces co-stimulated T cell proliferation, enhances the generation of cytolytic T cells, and promotes T cell activation. CD70 has been reported to play a role in regulating B cell activation, the cytotoxic function of natural killer cells, and immunoglobulin synthesis.
[0442] The term "class II major histocompatibility complex transactivator," or "CIITA," encodes a protein containing an acidic transcriptional activation domain, four LRRs (leucine-rich repeats), and a GTP-binding domain. This protein resides in the cell nucleus and acts as a positive regulator of transcription of class II major histocompatibility complex genes, often referred to as the "master regulator" of their expression. The protein also binds to GTP and uses GTP binding to facilitate its own transport to the nucleus. Once in the nucleus, it does not bind to DNA but instead functions in a co-activator-like manner using intrinsic acetyltransferase (AT) activity.
[0443] The term "antitumor effect" refers to biological effects that can be manifested in various ways, including but not limited to, reductions in tumor volume, number of tumor cells, number of metastases, life expectancy, tumor cell proliferation, tumor cell survival, or improvement of various physiological symptoms associated with cancer. "Antitumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells, and antibodies of the present invention to prevent tumorigenesis.
[0444] A “humanized” form of a nonhuman antibody is a chimeric antibody containing a minimal sequence derived from a nonhuman antibody. Humanized antibodies are typically human antibodies (recipient antibodies) in which residues from one or more CDRs are replaced by residues from one or more CDRs from a nonhuman antibody (donor antibody). The donor antibody can be any suitable nonhuman antibody with the desired specificity, affinity, or biological effect, such as mouse, rat, rabbit, chicken, or nonhuman primate antibodies. In some cases, selected frame region residues of the recipient antibody are replaced by corresponding frame region residues from the donor antibody. Humanized antibodies may also contain residues not found in either the recipient or donor antibody. Such modifications can be made to further improve antibody function. For further details, see Jones et al., Nature, 1986, 321:522-525; Riechmann et al., Nature, 1988, 332:323-329; and Presta, Curr. Op. Struct. Biol., 1992, 2:593-596, each of which is incorporated herein by reference in its entirety.
[0445] "Human antibody" is an antibody having an amino acid sequence that corresponds to the amino acid sequence of an antibody produced by a human or human cell, or derived from an antibody from a non-human source that utilizes a human antibody library or a human antibody coding sequence (e.g., obtained from a human source or redesigned). Human antibodies specifically exclude humanized antibodies.
[0446] “Affinity” refers to the strength of the sum of all non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise stated, as used herein, “affinity” refers to intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen or epitope). The affinity of molecule X for its partner Y can be expressed using the dissociation equilibrium constant (K0). D The following describes in more detail the kinetic components that contribute to the dissociation equilibrium constant. Affinity can be measured by methods commonly known in the art, including those described herein, such as surface plasmon resonance (SPR) techniques (e.g., ) or biological layer interferometry (e.g., ).
[0447] Regarding the binding of antibodies or fragments thereof to target molecules, the terms "binding to a specific antigen (e.g., a peptide target) or an epitope on a specific antigen," "specifically binding to a specific antigen (e.g., a peptide target) or an epitope on a specific antigen," "specifically binding to a specific antigen (e.g., a peptide target) or an epitope on a specific antigen," "specifically binding to a specific antigen (e.g., a peptide target) or an epitope on a specific antigen," "selectively binding to a specific antigen (e.g., a peptide target) or an epitope on a specific antigen," and "selectively binding to a specific antigen (e.g., a peptide target) or an epitope on a specific antigen" mean a binding that is measurably different from (e.g., with non-target molecules) non-specific or non-selective interactions. Specific binding can be measured, for example, by measuring the binding to a target molecule and comparing it to the binding to a non-target molecule. Specific binding can also be determined by competition with a control molecule that simulates an identified epitope on a target molecule. In this case, if the binding of the antibody to the target molecule is competitively inhibited by the control molecule, it indicates specific binding.
[0448] The term "self" refers to any substance that originates from the same individual and will later be reintroduced into that individual.
[0449] The term "allotype" refers to any substance that originates from a different animal of the same species as the individual to which the substance was introduced, or from a different patient than the individual to which the substance was introduced. Two or more individuals are said to be allotypes of each other when the genes at one or more loci are not identical. In some respects, allotypes from individuals of the same species may be genetically sufficiently different to interact in terms of antigenicity.
[0450] The term "heterogeneous" refers to grafts derived from animals of different species.
[0451] The term "treating" (and its variations, such as "treat" or "treatment") refers to a clinical intervention that attempts to alter the natural course of a disease or symptom in a subject in need. Treatment can be for prevention and during clinicopathological processes. Desired therapeutic outcomes include: preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or reducing the disease state, and alleviating or improving prognosis.
[0452] As used herein, a “therapeutic effective amount” is an amount of composition or its active ingredient sufficient to provide a beneficial effect to an individual administering the composition or otherwise reduce harmful non-beneficial events. A “therapeutic effective dose” as used herein means a dose that produces one or more desired or anticipated (e.g., beneficial) effects with respect to its administration, which occurs once or more over a given period of time. The exact dose will depend on the purpose of treatment and will be determined by someone skilled in the art using known techniques (see, for example, Lieberman, Pharmaceutical Dosage Forms (Vols. 1–3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); and Pickar, Dosage Calculations (1999)).
[0453] As used herein, “T cell receptor (TCR) fusion protein” or “TFP” includes a recombinant polypeptide derived from various polypeptides constituting a TCR that is typically capable of i) binding to a surface antigen on a target cell and ii) interacting with other polypeptide components of the intact TCR complex, typically when co-located within or on the surface of a T cell. A “TFP T cell” is a T cell that has been transduced according to the methods disclosed herein and expresses a TFP (e.g., a TFP incorporated into a native TCR). In some embodiments, the T cell is a CD4+ T cell, a CD8+ T cell, or a CD4+ / CD8+ T cell. In some embodiments, the TFP T cell is an NK cell or a regulatory T cell.
[0454] As used herein, the terms “T cell receptor” and “T cell receptor complex” are used interchangeably and refer to molecules found on the surface of T cells that are typically responsible for recognizing antigens. In 95% of T cells, the TCR contains a heterodimer composed of TCRα and TCRβ chains, while 5% of T cells have a TCR composed of TCRγ and TCRδ chains. The TCR also contains one or more of CD3ε, CD3γ, and CD3δ. In some embodiments, the TCR contains CD3ε. In some embodiments, the TCR contains CD3γ. In some embodiments, the TCR contains CD3δ. In some embodiments, the TCR contains CD3ζ. The binding of the TCR to an antigen, such as the antigen and MHC, leads to the activation of its T cell through a series of biochemical events mediated by associated enzymes, co-receptors, and specific helper molecules. In some embodiments, the constant domain of human TCRα has the sequence of SEQ ID NO:711. In some embodiments, the constant domain of human TCRα has: an IgC domain having the sequence of SEQ ID NO:712; a transmembrane domain having the sequence of SEQ ID NO:713; and an intracellular domain having the sequence of SS. In some embodiments, the constant domain of mouse TCRα has the sequence of SEQ ID NO:1267. In some embodiments, the constant domain of human TCRβ has the sequence of SEQ ID NO:715. In some embodiments, the constant domain of human TCRβ has: an IgC domain having the sequence of SEQ ID NO:716; a transmembrane domain having the sequence of SEQ ID NO:717; and an intracellular domain having the sequence of SEQ ID NO:719. In some embodiments, the constant domain of mouse TCRβ has the sequence of SEQ ID NO:1268. In some embodiments, the constant domain of TCRδ has the sequence of SEQ ID NO:725. In some embodiments, the constant domain of TCRδ has: an IgC domain having the sequence of SEQ ID NO:726; a transmembrane domain having the sequence of SEQ ID NO:727; and an intracellular domain having the sequence of L. In some embodiments, the constant domain of TCRγ has the sequence of SEQ ID NO:721. In some embodiments, the constant domain of TCRγ has: an IgC domain having the sequence of SEQ ID NO:722; a transmembrane domain having the sequence of SEQ ID NO:723; and an intracellular domain having the sequence of SEQ ID NO:724. In some embodiments, CD3ε has the sequence of SEQ ID NO:694.In some embodiments, CD3ε has: an extracellular domain having the sequence of SEQ ID NO:696; a transmembrane domain having the sequence of SEQ ID NO:697; and an intracellular domain having the sequence of SEQ ID NO:698, such as an intracellular signal transduction domain. In some embodiments, CD3δ has the sequence of SEQ ID NO:704. In some embodiments, CD3δ has: an extracellular domain having the sequence of SEQ ID NO:706; a transmembrane domain having the sequence of SEQ ID NO:707; and an intracellular domain having the sequence of SEQ ID NO:708, such as an intracellular signal transduction domain. In some embodiments, CD3γ has the sequence of SEQ ID NO:699. In some embodiments, CD3γ has: an extracellular domain having the sequence of SEQ ID NO:701; a transmembrane domain having the sequence of SEQ ID NO:702; and an intracellular domain having the sequence of SEQ ID NO:703, such as an intracellular signal transduction domain.
[0455] As used herein, the term "subject" means a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, goats, rabbits, and sheep. In some embodiments, the subject is a human. A "patient" is a subject who has a disease, condition, or symptom, is at risk of developing a disease, condition, or symptom, or otherwise requires the compositions and methods provided herein. In some embodiments, the subject has cancer, such as the cancer described herein.
[0456] As used herein, “prevention” refers to the prevention of disease or condition, such as tumor formation, in a patient. For example, if an individual at risk of developing a tumor or other form of cancer is treated with the method of the present invention, and the individual subsequently does not develop the tumor or other form of cancer, then the disease has been prevented in that individual for at least a period of time.
[0457] The term "instructions for use" is used to refer to instructions that are typically included in the commercial packaging of a therapeutic or diagnostic product (e.g., a test kit), which contain information about the indications, usage, dosage, administration, combination therapy, contraindications, and / or warnings for the use of such a therapeutic or diagnostic product.
[0458] As used in this article, the term "cytotoxic agent" refers to a substance that inhibits or prevents cell function and / or causes cell death or destruction.
[0459] "Chemotherapy agents" are compounds that can be used to treat cancer. Chemotherapy agents include "anti-hormonal agents" or "endocrine therapy agents," which regulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.
[0460] The term "tumor" refers to all proliferative cell growth and proliferation (whether malignant or benign), as well as all precancerous and cancerous cells and tissues. The terms "cancer," "cancerous," "cellular proliferative disorder," "proliferative disorder," and "tumor" are not mutually exclusive when used herein. The terms "cellular proliferative disorder" and "proliferative disorder" refer to a condition associated with a certain degree of abnormal cell proliferation. In some implementations, a cellular proliferative disorder is cancer. In some aspects, a tumor is a solid tumor. In some aspects, a tumor is a hematologic malignancy.
[0461] The term "cancer" refers to a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the blood and lymphatic system. This article describes examples of various cancers, including but not limited to breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, and lung cancer.
[0462] The term "pharmaceutical composition" refers to a preparation in a form in which the bioactivity of the active ingredient contained therein is effective in treating a subject, and which does not contain any other components that would have unacceptable toxicity to the subject in the amount provided in the pharmaceutical composition.
[0463] The term "regulation" refers to reducing or inhibiting, or alternatively activating or increasing, the listed variables.
[0464] The terms “increase” and “activation” refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times, 100 times or more in the listed variables.
[0465] The terms “reduction” and “suppression” refer to a reduction of the listed variables by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times, 100 times or more.
[0466] The term "agonist" refers to the activation of receptor signaling to induce a biological response associated with receptor activation. An "agonist" is an entity that binds to and activates the receptor.
[0467] The term "antagonist" refers to the inhibition of receptor signaling to suppress biological responses associated with receptor activation. An "antagonist" is an entity that binds to and antagonizes the receptor.
[0468] The term "effective T cells" includes helper T cells (i.e., CD4+) and cytotoxic T cells (i.e., CD8+). CD4+ effector T cells contribute to the development of several immune processes, including the maturation of B cells into plasma cells and memory B cells, and the activation of cytotoxic T cells and macrophages. CD8+ effector T cells destroy virus-infected cells and tumor cells. For further information on effector T cells, see Seder and Ahmed, Nature Immunol., 2003, 4:835-842, cited in its entirety.
[0469] The term "regulatory T cells" includes, for example, cells that regulate immune tolerance by suppressing effector T cells. In some respects, regulatory T cells have a CD4+CD25+Foxp3+ phenotype. In other respects, they have a CD8+CD25+ phenotype. See further information on CD70-expressing regulatory T cells in Nocentini et al., Br. J. Pharmacol., 2012, 165:2089-2099, incorporated herein by reference in its entirety.
[0470] The term "dendritic cell" refers to a professional antigen-presenting cell that can activate natural T cells and stimulate the growth and differentiation of B cells.
[0471] The phrase “diseases associated with CD70 expression” includes, but is not limited to, diseases associated with CD70 expression or symptoms associated with cells expressing CD70, including, for example, proliferative diseases such as cancer or malignancies or precancerous lesions. In one aspect, the disease is cancer.
[0472] In some cases, the cancer is selected from T-cell lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), Epstein-Barr virus (EBV) + cancer, or human papillomavirus (HPV) + cancer. In some cases, the cancer is kidney cancer, renal cell carcinoma, lung cancer, pancreatic cancer, ovarian cancer, esophageal cancer, nasopharyngeal carcinoma, mesothelioma, glioblastoma, thymic carcinoma, breast cancer, head and neck cancer, or gastric cancer.
[0473] In some cases, the cancer may be acute lymphoblastic carcinoma, acute myeloid leukemia, alveolar rhabdomyosarcoma, bladder cancer (e.g., bladder carcinoma), bone cancer, brain cancer (e.g., medulloblastoma), breast cancer, anal cancer, anal canal cancer or anorectal cancer, eye cancer, intrahepatic bile duct cancer, joint cancer, cervical cancer, gallbladder cancer or pleural cancer, nasal cancer, nasal cavity cancer or middle ear cancer, oral cancer, vulvar cancer, chronic lymphocytic leukemia (CLL), chronic myeloid carcinoma, colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumors, head and neck cancer (e.g., head and neck squamous cell carcinoma), glioblastoma, Hodgkin's lymphoma. Lymphoma, hypopharyngeal cancer, kidney cancer, laryngeal cancer, leukemia, fluid-filled tumors, liver cancer, lung cancer (e.g., non-small cell lung cancer), lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, malignant mesothelioma, mast cell tumor, melanoma, multiple myeloma, nasopharyngeal carcinoma, non-Hodgkin lymphoma (NHL), B chronic lymphocytic leukemia, hairy cell leukemia, acute lymphoblastic leukemia (ALL), Burkitt's lymphoma, ovarian cancer, pancreatic cancer, peritoneal cancer, omental cancer, mesenteric cancer, pharyngeal cancer, prostate cancer, RCC, ccRCC, rectal cancer, kidney cancer, skin cancer, small bowel cancer, soft tissue cancer, solid tumors, gastric cancer, testicular cancer, thyroid cancer, or ureteral cancer.
[0474] The term "conserved sequence modification" refers to amino acid modifications that do not significantly affect or alter the binding characteristics of an antibody or antibody fragment containing an amino acid sequence. Such conserved modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies or antibody fragments of the present invention using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. "Conserved amino acid substitution" is an amino acid substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, one or more amino acid residues within the TFP of the present invention can be substituted with other amino acid residues from the same side chain family, and the altered TFP can be tested using the functional assays described herein.
[0475] The term "stimulus" refers to a primary response induced by signal transduction events (such as, but not limited to, signal transduction via the TCR / CD3 complex) mediated by the binding of a stimulating domain or stimulating molecule (e.g., the TCR / CD3 complex) to its cognate ligand. Stimuli can mediate alterations in the expression of certain molecules and / or reorganization of the cytoskeleton.
[0476] The terms "stimulatory molecule" or "stimulatory domain" refer to a molecule or portion thereof expressed by T cells that provides one or more primary cytoplasmic signaling sequences that stimulatorily regulate primary activation of the TCR complex in at least some aspects of T cell signaling pathways. In one aspect, primary signaling is initiated, for example, by the binding of the TCR / CD3 complex to a peptide-loaded MHC molecule, and said binding leads to the mediation of T cell responses (including, but not limited to, proliferation, activation, differentiation, etc.). Primary cytoplasmic signaling sequences acting in a stimulatory manner (also referred to as "primary signaling domains") may contain signaling motifs known as immune receptor tyrosine-based activation motifs or "ITAMs". Examples of ITAM-containing primary cytoplasmic signaling sequences particularly useful in this invention include, but are not limited to, those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD278 (also referred to as "ICOS"), and CD66d.
[0477] The term "antigen-presenting cell" or "APC" refers to immune system cells, such as helper cells (e.g., B cells, dendritic cells, etc.), that display foreign antigens complexed with the major histocompatibility complex (MHC) on their surface. T cells can recognize these complexes using their T cell receptors (TCRs). APCs process the antigens and present them to T cells.
[0478] As used herein, an "intracellular signaling domain" refers to the intracellular portion of a molecule. Intracellular signaling domains generate signals that promote the immune effector function of TFP-containing cells (e.g., TFP-expressing T cells). Examples of immune effector functions in TFP-expressing T cells include cytolytic activity and T helper cell activity, including cytokine secretion. In one embodiment, the intracellular signaling domain may comprise a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from molecules responsible for primary stimulation or antigen-dependent mimicry. In another embodiment, the intracellular signaling domain may comprise a co-stimulatory intracellular domain. Exemplary co-stimulatory intracellular signaling domains include those derived from molecules responsible for co-stimulatory signals or antigen-independent stimulation.
[0479] Primary intracellular signaling domains may contain ITAMs (“immunoreceptor tyrosine-based activation motifs”). Examples of ITAMs containing primary cytoplasmic signaling sequences include, but are not limited to, those derived from CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD66d, DAP10, and DAP12.
[0480] The term "co-stimulatory molecule" refers to a homologous binding partner on a T cell that specifically binds to a co-stimulatory ligand, thereby mediating a co-stimulatory response in the T cell, such as, but not limited to, proliferation. Co-stimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response. Co-stimulatory molecules include, but are not limited to, MHC class 1 molecules, BTLA and Toll ligand receptors, and DAP10, DAP12, CD30, LIGHT, OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), and 4-1BB (CD137). The intracellular signaling domain of a co-stimulatory molecule can be the intracellular portion of the molecule. Co-stimulatory molecules can be represented in the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), and activated NK cell receptors. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, and ligands that specifically bind to CD83. Intracellular signal transduction domains may comprise the entire intracellular portion of the molecule from which they originate, the entire native intracellular signal transduction domain, or a functional fragment thereof. The term “4-1BB” refers to a member of the TNFR superfamily having an amino acid sequence provided as GenBank accession number AAA62478.2 or equivalent residues from non-human species (e.g., mice, rodents, monkeys, apes, etc.); and the “4-1BB co-stimulatory domain” is defined as amino acid residues 214-255 of GenBank accession number AAA62478.2 or equivalent residues from non-human species (e.g., mice, rodents, monkeys, apes, etc.).
[0481] The term "coding" refers to the inherent property of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA, or mRNA) to serve as a template for the synthesis of other polymers and macromolecules in biological processes having defined nucleotide sequences (e.g., rRNA, tRNA, and mRNA) or defined amino acid sequences and the resulting biological characteristics. Thus, a gene, cDNA, or RNA encodes a protein if the transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system. The coding strand, which is identical to the mRNA sequence and is usually provided in the sequence listing, as well as the non-coding strand used as a transcription template for the gene or cDNA, can both be referred to as encoding the protein or other product of that gene or cDNA.
[0482] Unless otherwise stated, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate forms of each other and encode the same amino acid sequence. A nucleotide sequence encoding a protein or RNA phrase may also include introns, to the extent that a nucleotide sequence encoding a protein may contain one or more introns in some forms.
[0483] The term "endogenous" refers to any material that originates from or is produced within an organism, cell, tissue, or system.
[0484] The term “exogenous” means any material introduced from or generated outside an organism, cell, tissue, or system.
[0485] The term "expression" refers to the transcription and / or translation of a specific nucleotide sequence driven by a promoter.
[0486] The term "functional disruption" refers to a physical or biochemical change in a specific (e.g., target) nucleic acid (e.g., a gene, RNA transcript, protein encoded by it) that prevents its normal expression and / or behavior in a cell. In one embodiment, functional disruption refers to a modification of a gene by a gene-editing method. In one embodiment, functional disruption prevents the expression of a target gene (e.g., an endogenous gene).
[0487] The term "transfer vector" refers to a composition containing isolated nucleic acids and capable of delivering the isolated nucleic acids into the cell. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term "transfer vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to further include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral transfer vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.
[0488] The term "expression vector" refers to a vector containing a recombinant polynucleotide comprising an expression control sequence operatively linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression may be provided by a host cell or in an in vitro expression system. Expression vectors include all vectors known in the art, including viscera, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating recombinant polynucleotides.
[0489] The term "lentivirus" refers to a genus within the family Retroviridae. Lentivirals are unique among retroviruses in that they can infect non-dividing cells; they can transfer a large amount of genetic information into the host cell's DNA, making them one of the most efficient gene delivery vectors. HIV, SIV, and FIV are examples of lentiviruses.
[0490] The term "lentiviral vector" refers to a vector derived from at least a portion of a lentiviral genome, particularly including, for example, self-inactivated lentiviral vectors as described in Milone et al., Mol. Ther. 17(8):1453-1464 (2009). Other examples of lentiviral vectors that may be used clinically include, but are not limited to, LENTIVECTOR from Oxford BioMedica. TM Gene delivery technology, LENTIMAX from Lentigen Technology TM Vector systems, etc. Non-clinical types of lentiviral vectors are also available and are known to those skilled in the art.
[0491] The term "circular RNA" or "circular RNA" refers to a class of single-stranded RNAs with a continuous structure that possess enhanced stability but lack the terminal motifs necessary for interaction with various cellular proteins. Circular RNAs are 3–5' covalently closed RNA loops and do not exhibit cap or poly(A) tails. The lack of free ends necessary for exonuclease-mediated degradation makes them resistant to several mechanisms of RNA turnover and confers them a longer lifespan compared to their linear mRNA counterparts. For this reason, circularization can stabilize mRNAs that typically have short half-lives and thus improve their overall efficacy in a variety of applications. Circular RNAs are generated through splicing processes, and circularization primarily occurs at annotated exon boundaries using conventional splicing sites (Starke et al., 2015; Szabo et al., 2015). For circularization, the splice site is used in reverse: the downstream splice donor is "backspliced" to the upstream splice acceptor (see reviews in Jeck and Sharpless, 2014; Barrett and Salzman, 2016; Szabo and Salzman, 2016; Holdt et al., 2018).
[0492] Three general strategies for RNA circularization have been reported to date: chemical methods using cyanogen bromide or similar condensing agents, enzymatic methods using RNA or DNA ligases, and ribozymatic methods using self-splicing introns. In a preferred embodiment, precursor RNA is synthesized via runaway transcription, followed by heating in the presence of magnesium ions and GTP to promote circularization. The resulting RNA can be efficiently transfected into various cell types. In one aspect, the template includes sequences of TFP, CAR, and TCR, or combinations thereof.
[0493] In some exemplary embodiments, a ribozyme method utilizing group I catalytic introns is used. This method is more suitable for the circularization of long RNAs and requires only the addition of GTP and Mg2+ as cofactors. This intron-exon (PIE) splicing strategy consists of fused exons flanked by hemi-intron sequences. In vitro, these constructs undergo the double transesterification reaction characteristic of group I catalytic introns, but because the exons are fused, they are cleaved as covalently 5' and 3' linked loops.
[0494] The term "homology" or "identity" refers to the subunit sequence identity between two polymeric molecules, such as two nucleic acid molecules, like two DNA molecules, two RNA molecules, or two polypeptide molecules. When subunit positions in two molecules are occupied by the same monomeric subunits; for example, if a position in each of two DNA molecules is occupied by adenine, then they are homologous or identical at that position. Homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half the positions in two sequences (e.g., five positions in a polymer of ten subunits) are homologous, then the two sequences are 50% homologous; if 90% of the positions (e.g., nine out of ten) are matching or homologous, then the two sequences are 90% homologous.
[0495] The term "isolated" means altered or removed from its natural state. For example, nucleic acids or peptides naturally present in living organisms are not "isolated," but the same nucleic acid or peptide partially or completely isolated from its native coexisting material is "isolated." Isolated nucleic acids or proteins can exist in substantially purified forms or in non-natural environments such as host cells.
[0496] In the context of this invention, the following abbreviations for commonly used nucleic acid bases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.
[0497] The terms "operably linked" or "transcriptional control" refer to a functional link between a regulatory sequence and a heterologous nucleic acid sequence that results in the expression of the heterologous nucleic acid sequence. For example, the first nucleic acid sequence is operably linked to the second nucleic acid sequence when they are in a functional relationship. Similarly, if a promoter enables transcription or expression of a coding sequence, the promoter is operably linked to the coding sequence. Operatively linked DNA sequences can be contiguous, for example, in the case of needing to link two protein-coding regions, they are located within the same reading frame.
[0498] The term “parenteral” administration of an immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection, intratumoral, or infusion techniques.
[0499] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in single-stranded or double-stranded form and their polymers. Unless specifically limited, the term covers nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise stated, a particular nucleic acid sequence also implicitly covers variants of its conserved modifications (e.g., degenerate codon substitutions), alleles, orthologs, SNPs and complementary sequences, as well as explicitly indicated sequences. Specifically, degenerate codon substitution can be achieved by generating a sequence in which the third position of one or more of the selected (or all) codons is replaced by a mixed base and / or deoxyinosine residue (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).
[0500] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably to refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked together by peptide bonds. As used herein, the term refers to short chains and long chains; short chains are generally also referred to in the art as peptides, oligopeptides, and oligomers, while long chains are generally referred to in the art as proteins, which exist in many types. “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, and so on. Polypeptides include natural peptides, recombinant peptides, or combinations thereof.
[0501] The term "promoter" refers to a DNA sequence that is recognized by the cell's transcriptional machinery or introduced synthetic machinery and can initiate the specific transcription of a polynucleotide sequence.
[0502] The term "promoter / regulatory sequence" refers to a nucleic acid sequence that can be used to express a gene product operatively linked to a promoter / regulatory sequence. In some cases, this sequence may be a core promoter sequence, and in others, it may include enhancer sequences and other regulatory elements required for gene product expression. A promoter / regulatory sequence may, for example, be a sequence that expresses a gene product in a tissue-specific manner.
[0503] The term “constitutive” promoter refers to a nucleotide sequence that, when operatively linked to a polynucleotide encoding or specifying a gene product, results in the production of the gene product in the cell under most or all physiological conditions of the cell.
[0504] The term "inducible" promoter refers to a nucleotide sequence that, when operatively linked to a polynucleotide encoding or specifying a gene product, essentially produces the gene product in the cell only when an inducer corresponding to that promoter is present in the cell.
[0505] The term "tissue-specific" promoter refers to a nucleotide sequence that, when operatively linked to a gene-encoding gene or a polynucleotide specified by the gene, substantially produces a gene product in the cell only if the cell is a cell of a tissue type corresponding to the promoter.
[0506] As used in the context of scFv, the terms "linker" and "flexible peptide linker" refer to peptide linkers used alone or in combination to connect variable heavy chain and variable light chain regions, which consist of amino acid residues such as glycine and / or serine. In one embodiment, the flexible peptide linker is a Gly / Ser linker and comprises the amino acid sequence (Gly-Gly-Gly-Ser)n, where n is a positive integer equal to or greater than 1. For example, n = 1, n = 2, n = 3, n = 4, n = 5, n = 6, n = 7, n = 8, n = 9, and n = 10. In one embodiment, the flexible peptide linker includes, but is not limited to, (Gly4Ser)4 or (Gly4Ser)3. In another embodiment, the linker comprises multiple repeating sequences of (Gly2Ser), (GlySer), or (Gly3Ser). Linkers described in WO2012 / 138475 (incorporated herein by reference) are also included within the scope of this invention. In some cases, the linker sequence comprises (G4S). n Where n = 2 to 4. In some cases, the connector sequence contains (G4S). n , where n = 1 to 3.
[0507] As used herein, the 5' cap (also known as the RNA cap, RNA 7-methylguanosine cap, or RNA m7G cap) is a modified guanine nucleotide added to the "front" or 5' end of eukaryotic messenger RNA shortly after transcription begins. The 5' cap consists of a terminal group linked to the first nucleotide transcribed. Its presence is crucial for ribosome recognition and protection from RNase degradation. Cap addition is coupled to transcription and occurs co-transcribedly, influencing each other. Shortly after transcription begins, the 5' end of the synthesized mRNA is bound to a synthetic cap complex associated with RNA polymerase. This enzymatic complex catalyzes the chemical reactions required for mRNA capping. Synthesis continues as a multi-step biochemical reaction. The capped portion can be modified to modulate mRNA functionality, such as its stability or translation efficiency.
[0508] As used herein, "in vitro transcribed RNA" refers to RNA that has been synthesized in vitro, preferably mRNA. Typically, in vitro transcribed RNA is generated using an in vitro transcription vector. The in vitro transcription vector contains a template for generating in vitro transcribed RNA.
[0509] As used herein, “poly(A)” refers to a series of adenosines linked to mRNA via polyadenylation. In a preferred embodiment of the construct used for transient expression, the poly(A) is 50 to 5000, preferably greater than 64, more preferably greater than 100, and most preferably greater than 300 or 400. The poly(A) sequence can be chemically or enzymatically modified to modulate mRNA functionality, such as localization, stability, or translation efficiency.
[0510] As used herein, “polyadenylation” refers to the covalent bonding of a polyadenylated moiety or its modified variants to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at their 3' ends. The 3' poly(A) tail is a long sequence (typically hundreds) of adenine nucleotides added to the precursor mRNA by the action of an enzyme, polyadenylate polymerase. In higher eukaryotes, the poly(A) tail is added to transcripts containing a specific sequence, the polyadenylation signal. The poly(A) tail and the proteins bound to it help protect mRNA from degradation by exonucleases. Polyadenylation is also important for transcription termination, mRNA export from the nucleus, and translation. Polyadenylation occurs immediately in the nucleus after DNA is transcribed into RNA, but can also occur later in the cytoplasm. After transcription termination, the mRNA chain is cleaved by an endonuclease complex associated with RNA polymerase. The cleavage site is typically characterized by the presence of the base sequence AAUAAA (SEQ ID NO: 689) near the cleavage site. After cleaving the mRNA, adenosine residues are added to the 3' end of the cleavage site.
[0511] As used in this article, “transient” refers to the time it takes for non-integrated transgenes to be expressed, which may be hours, days, or weeks. If the transgene is integrated into the genome or contained within a stable plasmid replicon in the host cell, the expression time is shorter than the gene expression time.
[0512] The term "signal transduction pathway" refers to the biochemical relationships among various signal transduction molecules that play a role in the transmission of signals from one part of the cell to another. The phrase "cell surface receptor" includes molecules and complexes of molecules capable of receiving signals and transmitting them across the cell membrane.
[0513] The term "substantially purified" cells refer to cells that are essentially free of other cell types. Substantially purified cells also refer to cells that have been separated from other cell types that normally bind to them in their natural state. In some cases, a substantially purified cell population refers to a homogeneous cell population. In other cases, the term refers only to cells that have been separated from the cells that naturally bind to them in their natural state. In some respects, cells are cultured in vitro. In other respects, cells are not cultured in vitro.
[0514] As used in this article, the term "therapeutic" means treatment. Therapeutic effects are achieved by reducing, suppressing, alleviating, or eradicating a disease state.
[0515] As used in this article, the term "prevention" means the prevention or preventive treatment of a disease or disease state.
[0516] In the context of this invention, "tumor antigen," "hyperplastic disease antigen," or "antigen associated with a hyperplastic disease" refers to an antigen common to a specific hyperplastic disease. In some aspects, the hyperplastic disease antigens of this invention are derived from cancer, including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, mesothelioma, renal cell carcinoma, gastric cancer, breast cancer, lung cancer, ovarian cancer, NHL, leukemia, uterine cancer, prostate cancer, colon cancer, cervical cancer, bladder cancer, kidney cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, brain cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, endometrial cancer, and gastric cancer.
[0517] In some cases, the disease is a cancer selected from the group consisting of: acute lymphoblastic carcinoma, acute myeloid leukemia, alveolar rhabdomyosarcoma, bladder cancer (e.g., bladder carcinoma), bone cancer, brain cancer (e.g., medulloblastoma), breast cancer, anal cancer, anal canal cancer or anorectal cancer, eye cancer, intrahepatic bile duct cancer, joint cancer, cervical cancer, gallbladder cancer or pleural cancer, nasal cancer, nasal cavity cancer or middle ear cancer, oral cancer, vulvar cancer, chronic lymphocytic leukemia (CLL), chronic myeloid carcinoma, colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumors, head and neck cancer (e.g., head and neck squamous cell carcinoma), glioblastoma, Hodgkin lymphoma, Hypopharyngeal cancer, kidney cancer, laryngeal cancer, leukemia, fluid-filled tumors, liver cancer, lung cancer (e.g., non-small cell lung cancer), lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, malignant mesothelioma, mast cell tumor, melanoma, multiple myeloma, nasopharyngeal carcinoma, non-Hodgkin lymphoma (NHL), B-cell chronic lymphocytic leukemia, hairy cell leukemia, acute lymphoblastic leukemia (ALL), Burkitt lymphoma, ovarian cancer, pancreatic cancer, peritoneal cancer, omental cancer, mesenteric cancer, pharyngeal cancer, prostate cancer, RCC, ccRCC, rectal cancer, kidney cancer, skin cancer, small bowel cancer, soft tissue cancer, solid tumors, gastric cancer, testicular cancer, thyroid cancer, or ureteral cancer.
[0518] In some cases, the disease is a cancer selected from the group consisting of: T-cell lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), Epstein-Barr virus (EBV) + cancer, or human papillomavirus (HPV) + cancer. In some cases, the cancer is kidney cancer, renal cell carcinoma, lung cancer, pancreatic cancer, ovarian cancer, esophageal cancer, nasopharyngeal carcinoma, mesothelioma, glioblastoma, thymic carcinoma, breast cancer, head and neck cancer, or gastric cancer.
[0519] The terms “transfected,” “transformed,” or “transduced” refer to the process of transferring or introducing exogenous nucleic acids into host cells. “Transfected,” “transformed,” or “transduced” cells are cells that have been transfected, transformed, or transduced with exogenous nucleic acids. These cells include primary subject cells and their progeny.
[0520] The term "specifically binding" refers to antibodies, antibody fragments, or specific ligands that recognize and bind to homologous binding partners (e.g., CD70) present in a sample, but do not necessarily and substantially not recognize or bind to other molecules in the sample.
[0521] Scope: Throughout this disclosure, various aspects of this disclosure may be presented in a range format. It should be understood that descriptions in range format are merely for convenience and brevity and should not be construed as a rigid limitation on the scope of this disclosure. Therefore, a description of a range should be considered as specifically disclosing all possible subranges and individual numerical values within that range. For example, a description of a range such as 1 to 6 should be considered as specifically disclosing subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another example, a range such as 95-99% identity includes things having 95%, 96%, 97%, 98%, or 99% identity, and includes subranges such as 96-99%, 96-98%, 96-97%, 97-99%, 97-98%, and 98-99% identity. This applies regardless of how broad the range.
[0522] Programmed cell death protein 1 (PD-1), also known as CD279 (differentiation cluster 279), PDCD1, PD1, SLEB2, hPD-1, hSLE1, and programmed cell death 1, refers to a protein on the cell surface that regulates the immune system's response to human cells by downregulating the immune system and promoting self-tolerance by suppressing T cell inflammatory activity. This can prevent autoimmune diseases, but it can also prevent the immune system from killing cancer cells. PD-1 is an immune checkpoint and protects against autoimmunity through two mechanisms, for example. First, it promotes apoptosis (programmed cell death) of antigen-specific T cells in lymph nodes. Second, it reduces apoptosis of regulatory T cells (anti-inflammatory, suppressive T cells). PD-1 is a cell surface receptor belonging to the immunoglobulin superfamily and is expressed on T cells and progenitor B cells. PD-1 binds to two ligands, PD-L1 and PD-L2. As used herein, PD-1 includes any recombinant or naturally occurring form of PD-1 or its variants or homologs having or retaining PD-1 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some aspects, said variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity with naturally occurring PD-1 over the entire sequence or a portion thereof (e.g., 50, 100, 150, or 200 consecutive amino acid segments). In some implementations, PD-1 is substantially identical to the protein identified by UniProt reference number Q15116 or a variant or homolog thereof that has substantial identity with it. The human and mouse amino acid and nucleic acid sequences of PD-1 can be found in public databases such as GenBank, UniProt, and SwissProt. For example, the mouse and human PD-1 sequences correspond to UniProt accession numbers Q02242 and Q15116, respectively, and have the following sequences:
[0523] Human PD-1 (UniProt login number Q15116)
[0524] MQIPQAPWPVVWAVLQLGWRPGWFLDSPDRPWNPPTFSPALLVVTEGDNATFTCSFSNTSESFVLNWYRMSPSNQTDKLAAFPEDRSQPGQDCRFRVTQLPNGRDFHMSVVRARRNDSGTYLCGAISLAPKAQIKESLRAELRVTERRAEVPTAHPSPSPRPAGQFQTLVVGVVGGLLGSLVLLVWVLAVICSRAARGTIGARRTGQPLKEDPSAVPVFSVDYGELDFQWREKTPEPPVPCVPEQTEYATIVFPSGMGTSSPARRGSADGPRSAQPLRPEDGHCSWPL(SEQ ID NO:1228).
[0525] Mouse PD-1 (UniProt accession number Q02242)
[0526] MWVRQVPWSFTWAVLQLSWQSGWLLEVPNGPWRSLTFYPAWLTVSEGANATFTCSLSNWSEDLMLNWNRLSPSNQTEKQAAFCNGLSQPVQDARFQIIQLPNRHDFHMNILDTRRNDSGIYLCGAISLHPKAKIEESPGAELVVTERILETSTRYPSPSPKPEGRFQGMVIGIMSALVGIPVLLLLAWALAVFCSTSMSEARGAGSKDDTLKEEPSAAPVPSVAYEELDFQGREKTPELPTACVHTEYATIVFTEGLGASAMGRRGSADGLQGPRPPRHEDGHCSWPL(SEQ ID NO:1229)
[0527] Programmed death-ligand 1 (PD-L1), also known as differentiation cluster 274, CD274, B7 homolog 1, B7-H, B7-H1, B7H1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1, and CD274, refers to a 40 kDa type I transmembrane protein. In some embodiments, PD-L1 can play a major role in suppressing the adaptive arm of the immune system during specific events such as pregnancy, tissue allogeneic transplantation, autoimmune diseases, and other disease states such as hepatitis. Typically, the adaptive immune system responds to antigens associated with immune system activation by exogenous or endogenous danger signals. This is further propagated by clonal expansion of antigen-specific CD8+ T cells and / or CD4+ helper cells. The binding of PD-L1 to the inhibitory checkpoint molecule PD-1 delivers an inhibitory signal based on interaction with phosphatases (SHP-1 or SHP-2) via an immune receptor tyrosine-based switching motif (ITSM). This reduces the proliferation of antigen-specific T cells in lymph nodes, while also reducing apoptosis of regulatory T cells (anti-inflammatory, suppressive T cells)—further mediated by lower regulation of the Bcl-2 gene. As used herein, PD-L1 includes any recombinant or naturally occurring form of PD-L1 or its variants or homologs that have or retain PD-L1 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some aspects, the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity with the naturally occurring PD-L1 over its entire sequence or a portion thereof (e.g., 50, 100, 150, or 200 consecutive amino acid segments). In some embodiments, PD-L1 is substantially identical to the protein identified by UniProt reference number Q9NZQ7 or to a variant or homolog thereof that has substantial identity with it.
[0528] In the context of this invention, "PD-1 ligand," "PD-L1," and "PD-L2" refer to proteins that have binding affinity for PD-1. In some embodiments, the PD-1 protein or its binding fragments (such as the extracellular domains of the PD-1 protein) are characterized by being able to bind the natural ligands of human PD-1, namely human PD-L1 (also known as CD274, UniProt accession number Q9NZQ7) and / or human PD-L2 (also known as CD273, UniProt accession number Q9BQ51), with the same (i.e., equal), enhanced, or reduced (i.e. weakened) affinity compared to the natural PD-1 protein.
[0529] As used herein, the term "fusion protein" refers to a protein composed of polypeptide motifs from different sources. Therefore, it can also be understood as a chimeric protein. In the context of the PD-1 fusion protein described herein, the term "fusion protein" is used interchangeably with the term "conversion receptor." Typically, a fusion protein is a protein produced by linking two or more genes (or preferably cDNAs) that originally encode individual proteins. Translation of the fusion gene (or fusion cDNA) produces a single polypeptide, preferably a single polypeptide having functional properties derived from each of the original proteins. Recombinant fusion proteins are artificially produced using recombinant DNA technology for biological research or therapy. Further details regarding the production of the fusion proteins of the present invention are described herein.
[0530] As used herein, the terms “PD-1 fusion protein,” “PD-1 switching receptor,” or “PD-1 switching molecule” refer to a PD-1 fusion protein that receives an inhibitory signal by binding to PD-L1 or PD-L2 and converts (i.e., “switches”) that signal into an activation signal via a co-stimulatory domain of the fusion protein.
[0531] As used herein, the term "IL-15," also known as interleukin-15 and IL15, refers to a pleiotropic cytokine that plays a crucial role in the maintenance and homeostatic expansion of various immune cells. In some embodiments, IL-15 plays a key role in the development of the NK lineage, as well as the survival, expansion, and function of NK cells. In some embodiments, IL-15 contributes to enhanced antitumor immunity. In some embodiments, IL-15 is involved in lymphocyte homeostasis. In some embodiments, IL-15 plays multiple roles in the function of peripheral innate and adaptive immune cells. In some embodiments, IL-15 plays a key role in inducing central memory T cell subsets and in enhanced cytolytic effectors following trans-presentation of antigen-presenting cells. In some embodiments, IL-15 helps T cell survival by reducing activation-induced cell death (AICD). In some embodiments, the human IL-15 precursor protein has two known isoforms based on the length of the signal peptide: for example, IL-15 (also known as IL-15-S48AA or IL-15LSP for “long signal peptide”) has a 48-amino acid signal peptide and propeptide, while IL-15-S21AA or IL-15SSP (for “short signal peptide”) expressed by alternately spliced mRNA has a 21-amino acid signal peptide and propeptide. In some embodiments, IL-15SSP is not secreted but stored intracellularly in the cytoplasm. As used herein, IL-15 includes any recombinant or naturally occurring form of IL-15 or a variant or homolog of IL-15 that has or retains IL-15 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some aspects, the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity with naturally occurring IL-15 over the entire sequence or a portion thereof (e.g., 50, 100, 150, or 200 consecutive amino acid segments). In some embodiments, IL-15 is substantially identical to the protein identified by UniProt reference number P40933 or to a variant or homolog thereof that has substantial identity with it.
[0532] In some embodiments, the IL-15 signal peptide comprises amino acids 1-29 of the IL-15 protein sequence. In some embodiments, the IL-15 signal peptide comprises the sequence of SEQ ID NO:1246. In some embodiments, IL-15 comprises amino acids 30-162 of the IL-15 protein sequence. In some embodiments, IL-15 comprises any sequence or fragment thereof listed in Table 11. In some embodiments, IL-15 comprises the sequence of SEQ ID NO:1242.
[0533] The term "interleukin-15 receptor" or "IL-15R" refers to a type I cytokine receptor to which IL-15 binds and signals. In some embodiments, IL-15R consists of three subunits: the IL-15 receptor α chain ("IL-15Rα" or CD215), the IL-2 receptor β chain ("IL-2Rβ" or CD122), and the IL-2 receptor γ / common γ chain ("IL-2Rγ / γc" or CD132). For example, in some embodiments, the human IL-15Rα precursor protein has a 30-amino acid signal peptide, a 175-amino acid extracellular domain, a 23-amino acid single transmembrane segment, and a 39-amino acid cytoplasmic (or intracellular) domain, and contains N- and O-linked glycosylation sites. In some embodiments, IL-15Rα contains a Sushi domain (amino acids 31-95) essential for IL-15 binding. In some embodiments, IL-15Rα exists in a soluble form (sIL-15Rα). In some embodiments, sIL-15Rα is constitutively generated from a transmembrane receptor via defined proteolytic cleavage, and this process can be enhanced by certain chemical agents such as PMA. In some embodiments, human sIL-15Rα of approximately 42 kDa can prolong the half-life of IL-15 or enhance IL-15 signaling by binding to IL-15 and IL-2Rβ / γc heterodimers. Although IL-15R shares a subunit with IL-2R, which contains the cytoplasmic motif required for signal transduction, in some embodiments, IL-15 signaling has separate in vivo biological effects in addition to many biological activities that overlap with IL-2 signaling, attributed to the unique IL-15Rα subunit of IL-15R, the availability and concentration of IL-15, and the kinetics and affinity of IL-15-IL-15Rα binding. In some embodiments, IL-15 binds specifically to IL-15Rα with high affinity, and then IL-15Rα associates with a complex consisting of IL-2Rβ and IL-2Rγ / γc subunits expressed on the same cell (“cis-presentation”) or on different cells (“trans-presentation”). In some embodiments, the interaction between IL-15 and IL-15Rα is independent of the complex consisting of IL-2Rβ and IL-2Rγ / γc subunits. In some embodiments, the binding of IL-15 to the IL-2Rβ / γc heterodimer receptor induces activation of JAK1 phosphorylated via the β chain and activation of JAK3 phosphorylated via the γ chain. In some embodiments, the IL-15 / IL-15R interaction regulates T cell development and homeostasis in memory CD8+ T cells. In some embodiments, the IL-15 / IL-15R interaction also regulates NK cell development, maintenance, expansion, and activity.
[0534] As used herein, “IL-15Rα”, also known as CD215, IL-15 receptor subunit α, IL-15R-α, IL-15RA, and interleukin-15 receptor subunit α, includes any recombinant or naturally occurring form of IL-15Rα or its variants or homologs that have or retain IL-15Rα activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some aspects, the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity with the naturally occurring IL-15Rα over the entire sequence or a portion thereof (e.g., 50, 100, 150, or 200 consecutive amino acid segments). In some embodiments, IL-15Rα is substantially identical to the protein identified by UniProt reference number Q13261 or to a variant or homolog thereof that has substantial identity with it.
[0535] As used herein, “IL-2Rβ”, also known as CD122, IL-2 receptor subunit β, IL-2R subunit β, IL-2RB, P70-75, IMD63, and interleukin-2 receptor subunit β, includes any recombinant or naturally occurring form of IL-2Rβ or its variants or homologs that have or retain IL-2Rβ activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some aspects, the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity with the naturally occurring IL-2Rβ over the entire sequence or a portion thereof (e.g., 50, 100, 150, or 200 consecutive amino acid segments). In some embodiments, IL-2Rβ is substantially identical to the protein identified by UniProt reference number P14784 or to a variant or homolog thereof that has substantial identity with it.
[0536] As used herein, “IL-2 receptor γ / common γ chain”, also known as IL-2Rγ / γc, IL2RG, CIDX, IL-2RG, IMD4, P64, SCIDX, SCIDX1, interleukin 2 receptor subunit γ, or CD132, includes any recombinant or naturally occurring form of IL-2Rγ / γc or variants or homologs of IL-2Rγ / γc that have or retain IL-2Rγ / γc activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity). In some aspects, the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity with the naturally occurring IL-2Rγ / γc over the entire sequence or a portion thereof (e.g., 50, 100, 150, or 200 consecutive amino acid segments). In some embodiments, IL-2Rγ / γc is substantially identical to the protein identified by UniProt reference number P31785 or to a variant or homolog thereof that has substantial identity with it.
[0537] In some embodiments, the IL-15Rα cytoplasmic (or intracellular) domain comprises amino acids 229-267 of the IL-15Rα protein. In some embodiments, the IL-15Rα cytoplasmic (or intracellular) domain comprises the sequence of SEQ ID NO:1248. In some embodiments, the IL-15Rα Sushi domain comprises amino acids 31-95 of the IL-15Rα protein. In some embodiments, the IL-15Rα Sushi domain comprises the sequence of SEQ ID NO:1250. In some embodiments, IL-15Rα comprises both a transmembrane domain and a cytoplasmic (intracellular) domain of the IL-15Rα protein. In some embodiments, IL-15Rα comprises amino acids 96-267 of the IL-15Rα protein. In some embodiments, IL-15Rα comprises the sequence of SEQ ID NO:1251. In some embodiments, sIL-15Rα comprises amino acids 21-205 of the IL-15Rα protein. In some implementations, sIL-15Rα comprises the sequence of SEQ ID NO:1249.
[0538] CD70 combined with structural domain
[0539] CD70 is a type II transmembrane trimeric protein belonging to the tumor necrosis factor (TNF) ligand superfamily. CD70 regulates the activation, proliferation, and differentiation of T cells and B cells, and plays a role in maintaining the body's immune response. CD70 binds to its ligand CD27 (a member of the TNF receptor superfamily (TNFRSF)), subsequently inducing T cell co-stimulation and B cell activation. Upon binding to CD27, CD70 triggers intracellular signaling and CD27 cleavage.
[0540] CD70 is expressed on highly activated T and B cells, thymic epithelial cells, and some dendritic cells. Immune cell co-stimulation via CD27 binding activates the co-stimulatory CD27 / CD70 pathway, promoting proliferation or apoptosis. CD70 plays a role in cancer pathogenesis. For example, CD70 can increase the frequency and activation of regulatory T cells (e.g., Tregs) in the tumor microenvironment. In some hematologic malignancies (e.g., AML and MCL), CD70 can be co-overexpressed with CD27, leading to self-signaling and the generation of survival / proliferation signals. Soluble CD27 is elevated in many AML patients and is associated with worse prognosis. Cleavage CD27 remains bound to CD70. CD70 expression can be associated with the “steminess” of cancer in AML and can worsen patient outcomes.
[0541] Under physiological conditions, CD70 expression is transiently limited to highly activated T and B cells, thymic epithelial cells, and some dendritic cells, but it is upregulated in AML, DLBCL, RCC, MPM, and many other cancer types. For example, CD70 is highly expressed in 38% to 68% of clear cell renal cell carcinoma cases, 30% to 60% of papillary renal cell carcinoma cases, and in primary tumors expressing CD70. High expression of CD70 can also be found in metastatic tumors. Elevated CD70 expression levels in multiple cancer cell types make it a promising target for oncology and hematologic immunotherapy. Targeting CD70 could be used to treat patients with CD70-expressing cancers.
[0542] T-cell receptor (TCR) fusion protein (TFP). This disclosure covers recombinant nucleic acid constructs encoding TFP and variants thereof, wherein the TFP includes a binding domain that specifically binds to CD70 (e.g., human CD70), such as an antigen-binding domain, an antibody or antibody fragment, a ligand or ligand-binding protein, wherein the sequence of the binding domain is adjacent to and within the same reading frame as a nucleic acid sequence encoding a TCR subunit or a portion thereof. The TFPs provided herein can associate with one or more endogenous (or alternatively, one or more exogenous, or a combination of endogenous and exogenous) TCR subunits to form a functional TCR complex. The CD70-specifically binding TFPs described herein may be referred to as anti-CD70 TFP or CD70.TFP.
[0543] This disclosure also covers binding domains that are not components of the anti-CD70 TFP, such as the anti-CD70 antibody or fragment thereof described herein. In some embodiments, the binding domain contains only the anti-CD70 antibody described herein and is not fused with any other peptide. In some embodiments, the anti-CD70 antibody or fragment thereof described herein is a component of a fusion protein other than TFP, such as a CAR or other fusion protein.
[0544] The binding domain provided in this article can be an antigen-binding domain. This antigen-binding domain can be an anti-CD70 binding domain. The binding domain provided in this article can be any domain that binds to CD70, including but not limited to monoclonal antibodies, polyclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, and their functional fragments, including but not limited to single-domain antibodies, such as the heavy chain variable domain (V) of camel-derived nanobodies. H ), light chain variable structural domain (V) L ) and variable structural domain (V HH The antigen-binding domain can be an alternative scaffold, such as recombinant fibronectin domains, anticalin, and DARPIN. Similarly, natural or synthetic ligands that specifically recognize and bind to CD70 can serve as the antigen-binding domain of the TFP. In some cases, the antigen-binding domain can be derived from the same species in which the TFP will be used. For example, for use in humans, the antigen-binding domain of the TFP can contain human or humanized residues of the antigen-binding domain of an antibody or antibody fragment.
[0545] In one aspect, the antigen-binding domain is a fragment, such as a single-chain variable fragment (scFv). In another aspect, the antigen-binding domain is VHH. In another aspect, the antigen-binding domain is Fv, Fab, (Fab')2, or a bifunctional (e.g., bispecific) hybrid antibody. In another aspect, the antibodies and fragments disclosed herein bind to the CD70 protein with wild-type or enhanced affinity.
[0546] Humanized antibodies or antibody fragments may retain antigen specificity similar to that of the original antibody (e.g., the ability to bind human CD70 in this disclosure). In some embodiments, humanized antibodies or antibody fragments may have improved affinity and / or specificity for binding to CD70.
[0547] In one aspect, the antigen-binding domain comprises a humanized or human antibody or antibody fragment, or a camel antibody or antibody fragment, or a mouse antibody or antibody fragment. The antigen-binding domain of a TFP may comprise one or more (e.g., all three) of the humanized or human anti-CD70 binding domain described herein, including light chain complementarity-determining regions 1 (LC CDR1), 2 (LC CDR2), and 3 (LC CDR3), and / or one or more (e.g., all three) of the humanized or human anti-CD70 binding domain described herein, including heavy chain complementarity-determining regions 1 (HC CDR1), 2 (HCCDR2), and 3 (HC CDR3), for example, the humanized or human anti-CD70 binding domain comprising one or more (e.g., all three) LC CDRs and one or more (e.g., all three) HC CDRs. The antigen-binding domain of a TFP may include one or more (e.g., all three) heavy chain complementarity-determining regions 1 (HC CDR1), 2 (HC CDR2), and 3 (HC CDR3) of the humanized or human anti-CD70 binding domain described herein. For example, the antigen-binding domain of a TFP may include one HC CDR1, HC CDR2, and HC CDR3. As another example, the antigen-binding domain of a TFP may have two variable heavy chain regions, each containing HC CDR1, HC CDR2, and HC CDR3 as described herein. The antigen-binding domain of a TFP may include the humanized or human light chain variable region and / or the humanized or human heavy chain variable region described herein. The antigen-binding domain of a TFP may include the humanized heavy chain variable region described herein, for example, at least two of the humanized or human heavy chain variable regions described herein. The antigen-binding domain of a TFP may be an scFv containing the amino acid sequence provided herein for both the light and heavy chains. The antigen-binding domain of TFP can be a single-domain antibody, such as V which contains a heavy chain variable region. HHThe antigen-binding domain of a TFP (e.g., scFv or VHH) may comprise: a light chain variable region comprising an amino acid sequence having at least one, two, or three modifications (e.g., substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions) of the amino acid sequence of the light chain variable region provided herein, or a sequence having 95-99% identity with the amino acid sequence provided herein; and / or a heavy chain variable region comprising an amino acid sequence having at least one, two, or three modifications (e.g., substitutions) but no more than 30, 20, or 10 modifications (e.g., substitutions) of the amino acid sequence of the heavy chain variable region provided herein, or a sequence having 95-99% identity with the amino acid sequence provided herein. In one embodiment, the antigen-binding domain of the TFP is scFv, and the light chain variable region comprising the amino acid sequence described herein is attached to the heavy chain variable region comprising the amino acid sequence described herein via a linker, such as the linker described herein. In one embodiment, the antigen-binding domain of the TFP includes a (Gly4-Ser)n adapter, where n is 1, 2, 3, 4, 5, or 6, preferably 3 or 4. The light chain variable region and heavy chain variable region of the scFv can be in any of the following orientations: light chain variable region-adaptor-heavy chain variable region or heavy chain variable region-adaptor-light chain variable region. In some cases, the adapter sequence comprises a long adapter (LL) sequence. In some cases, the long adapter sequence comprises (G4S). n Where n = 2 to 4. In some cases, the joint sequence contains a short joint (SL) sequence. In some cases, the short joint sequence contains (G4S). n , where n = 1 to 3.
[0548] In some respects, nonhuman antibodies are humanized, where specific sequences or regions of the antibody are modified to increase their similarity to antibodies or fragments thereof naturally produced in humans. In another respect, the antigen-binding domain is humanized.
[0549] Humanized antibodies can be generated using a variety of techniques known in the art, including but not limited to CDR transplantation (see, for example, European Patent No. EP 239,400; International Publication No. WO91 / 09967; and U.S. Patent Nos. 5,225,539, 5,530,101 and 5,585,089, each of which is incorporated herein by reference in its entirety), veneering, or resurfacing (see, for example, European Patent Nos. EP 592,106 and EP 519,596; Padlan, 1991, Molecular Immunology, 28(4 / 5):489-498; Studnicka et al., 1994, Protein Engineering, 7(6):805-814; and Roguska et al., 1994, PNAS, 91:969-973, each of which is incorporated herein by reference in its entirety), chain truncation (see, for example, U.S. Patent No. 5,565,332, which is incorporated herein by reference in its entirety) and techniques described in, for example, the following documents: U.S. Patent Application Publication No. US2005 / 0042664, U.S. Patent Application Publication No. US2005 / 0048617, U.S. Patent No. 6,407,213, U.S. Patent No. 5,766,886, International Publication No. WO 9317105, Tan et al., J. Immunol., 169:1119-25 (2002), Caldas et al., Protein Eng., 13(5):353-60 (2000), Morea et al., Methods, 20(3):267-79 (2000), Baca et al., J. Biol. Chem., 272(16):10678-84 (1997), Roguska et al., Protein Eng., 9(10):895-904 (1996), Couto et al., Cancer Res., 55(23 Supp):5973s-5977s (1995), Couto et al., Cancer Res., 55(8):1717-22 (1995), Sandhu JS, Gene, 150(2):409-10 (1994), and Pedersen et al., J. Mol. Biol., 235(3):959-73 (1994), each of which is incorporated herein by reference in its entirety. Typically, the framework residues in the framework region are replaced by corresponding residues from the CDR donor antibody to alter (e.g., improve) antigen binding.These frameworks replace identification by methods known in the art, such as identifying framework residues important for antigen binding by modeling the interaction between CDRs and framework residues, and identifying rare framework residues at specific locations by sequence comparison (see, for example, Queen et al., U.S. Patent No. 5,585,089; and Riechmann et al., 1988, Nature, 332:323, which are incorporated herein by reference in their entirety).
[0550] Humanized antibodies or antibody fragments have one or more amino acid residues of non-human origin retained therein. These non-human amino acid residues are often referred to as “input” residues and are typically derived from “input” variable domains. As presented herein, humanized antibodies or antibody fragments contain one or more CDRs derived from non-human immunoglobulin molecules and the framework amino acid residues therein that are wholly or predominantly derived from human lineages. Various techniques for humanizing antibodies or antibody fragments are well known in the art and can be performed essentially as Winter et al. (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by replacing the corresponding sequence of a human antibody with a rodent CDR or CDR sequence (i.e., CDR transplantation) (EP 239,400; PCT Publication WO91 / 09967; and U.S. Patents 4,816,567, 6,331,415, 5,225,539, 5,530,101, 5,585,089, and 6,548,640, the contents of which are incorporated herein by reference in their entirety). In such humanized antibodies and antibody fragments, substantially fewer than the complete human variable domain has been replaced by corresponding sequences from non-human species. Humanized antibodies are typically human antibodies in which some CDR residues and possibly some framework (FR) residues have been replaced by residues from similar sites in rodent antibodies. Humanization of antibodies and antibody fragments can also be achieved by surface finishing or resurfacing (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology, 28(4 / 5):489-498; Studnicka et al., Protein Engineering, 7(6):805-814(1994) and Roguska et al., PNAS, 91:969-973(1994)) or chain truncation (US Patent No. 5,565,332), the contents of which are incorporated herein by reference in their entirety.
[0551] Human variable domains (light and heavy variable domains) were selected for the preparation of humanized antibodies to reduce antigenicity. Following the so-called “best fit” approach, sequences of rodent antibody variable domains were screened against an entire library of known human variable domain sequences. The human sequence closest to the rodent was then accepted as the human frame (FR) for the humanized antibody (Sims et al., J. Immunol., 151:2296 (1993); Chothia et al., J. Mol. Biol., 196:901 (1987), the contents of which are incorporated herein by reference in their entirety). Another approach uses specific frames derived from common sequences of all human antibodies from specific light or heavy chain subgroups. The same framework can be used for several different humanized antibodies (see, for example, Nicholson et al., Mol. Immun. 34(16-17):1157-1165(1997); Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285(1992); Presta et al., J. Immunol., 151:2623(1993), the contents of which are incorporated herein by reference in their entirety). In some embodiments, the framework regions of the heavy chain variable region, for example, all four framework regions, are derived from the VH4-4-59 germline sequence. In one embodiment, the framework regions may contain one, two, three, four, or five modifications, for example, substitutions, for example, amino acids from the corresponding mouse sequence. In one embodiment, the framework regions, for example, all four framework regions of the light chain variable region, are derived from the VK3-1.25 germline sequence. In one embodiment, the framework regions may contain one, two, three, four, or five modifications, for example, substitutions, for example, amino acids from the corresponding mouse sequence.
[0552] In some aspects, portions of the TFP compositions of this disclosure containing antibody fragments are humanized, retaining high affinity for the target antigen and other advantageous biological properties. According to one aspect of this disclosure, humanized antibodies and antibody fragments are prepared by analyzing parental sequences and various conceptual humanized products using three-dimensional models of parental sequences and humanized sequences. Three-dimensional immunoglobulin models are generally available and are well known to those skilled in the art. Computer programs illustrating and displaying possible three-dimensional conformational structures of selected candidate immunoglobulin sequences are available. Examination of these displays allows analysis of the possible roles of residues in the functional performance of the candidate immunoglobulin sequence, for example, analyzing residues affecting the ability of the candidate immunoglobulin to bind to the target antigen. Thus, FR residues can be selected and bound from the recipient and input sequences to obtain desired antibody or antibody fragment characteristics, such as increased affinity for the target antigen. Generally, CDR residues are directly and most substantially involved in influencing antigen binding.
[0553] In one aspect, the antigen-binding domain (e.g., an anti-CD70 binding domain) is characterized by a specific functional feature or property of the antibody or antibody fragment. For example, in one aspect, the portion of the TFP composition of this disclosure containing the antigen-binding domain specifically binds to human CD70. In one aspect, this disclosure relates to an antigen-binding domain constituting an antibody or antibody fragment, wherein the antigen-binding domain specifically binds to the CD70 protein or a fragment thereof, wherein the antibody or antibody fragment comprises a variable light chain and / or a variable heavy chain comprising the amino acid sequence provided herein. In some aspects, the antigen-binding domain (e.g., scFv or sdAb) is adjacent to and within the same reading frame as the leader sequence.
[0554] This article also provides a method for obtaining an antibody antigen-binding domain specific to a target antigen (e.g., CD70, or any target antigen described elsewhere in this article for a target of a fusion-bound domain), the method comprising the use of V as described herein. H The addition, deletion, substitution, or insertion of one or more amino acids in the amino acid sequence of the domain to provide as the V H V of the amino acid sequence variant of the domain H The structural domain, optionally, provides a V in this way. H The structural domain and one or more V L Domain composition, and test V H A structural domain or one or more V H / V L Combinations are used to identify specific binding members or antibody-antigen binding domains that are specific to a target antigen (e.g., CD70) and optionally have one or more desired properties.
[0555] In some cases, V HH The domains and scFv can be prepared according to methods known in the art (see, for example, Bird et al. (1988) Science 242:423-426 and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). The scFv molecule can be connected to V using a flexible peptide linker. H and V LThe regions are linked together to form the variable regions. scFv molecules contain linkers with optimized lengths and / or amino acid compositions (e.g., Ser-Gly linkers). Linker length can significantly influence how the variable regions of scFv fold and interact. In fact, if short polypeptide linkers (e.g., 5-10 amino acids) are used, intrachain folding is prevented. Interchain folding may also be required for the two variable regions to bind together to form a functional epitope binding site. In some cases, the linker sequence contains a long linker (LL) sequence. In some cases, the long linker sequence contains (G4S) n Where n = 2 to 4. In some cases, the joint sequence contains a short joint (SL) sequence. In some cases, the short joint sequence contains (G4S). n , where n = 1 to 3. Examples of joint orientation and size, see, for example, Hollinger et al., 1993 Proc Natl Acad. Sci. USA 90:6444-6448, U.S. Patent No. 7,695,936, U.S. Patent Application Publications Nos. 20050100543 and 20050175606 and PCT Publications Nos. WO2006 / 020258 and WO2007 / 024715, all of which are incorporated herein by reference.
[0556] scFv can be in its V L With V H The regions contain linkers of approximately 10, 11, 12, 13, 14, 15, or more than 15 residues. The linker sequence may contain any naturally occurring amino acid. In some embodiments, the linker sequence contains the amino acids glycine and serine. In another embodiment, the linker sequence contains a set of glycine and serine repeat sequences, such as (G4S). n Where n is a positive integer equal to or greater than 1. In one implementation, the adapter can be (G4S)4 or (G4S)3. Variations in adapter length can maintain or enhance activity, resulting in higher power in activity studies. In some cases, the adapter sequence comprises a long adapter (LL) sequence. In some cases, the long adapter sequence comprises (G4S)... n Where n = 2 to 4. In some cases, the joint sequence contains a short joint (SL) sequence. In some cases, the short joint sequence contains (G4S). n , where n = 1 to 3.
[0557] The antigen-binding domain described herein can be a camel antibody or its binding fragment. The antigen-binding domain can be a mouse antibody or its binding fragment. The antigen-binding domain can be a human or humanized antibody or its binding fragment. The antigen-binding domain can be a single-chain variable fragment (scFv) or a single-domain antibody (sdAb) domain. The antigen-binding domain can be a single-domain antibody (sdAb). The sdAb can be V HH .
[0558] The antigen-binding domain can be in the form of up to about 100, 98, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 40, 30, 20, 10, 0.5, 0.2, 0.1, 0.05, 0.01, 0.005, 0.001 nM or smaller K. D The value is associated with human CD70. In some cases, K D The value can be from about 0.001 nM to about 100 nM, from about 0.01 nM to about 10 nM, from about 0.1 nM to about 10 nM, or from about 0.1 nM to about 100 nM. The antigen-binding domain may not compete with CD27 for binding to CD70, may not inhibit the interaction between CD70 and CD27, and / or may not bind to the same epitope of CD70 bound by CD27. The antigen-binding domain may compete with CD27 for binding to CD70, may inhibit the interaction between CD70 and CD27, and / or may bind to the same epitope of CD70 bound by CD27.
[0559] The antigen-binding domain includes a variable domain containing complementarity-determining regions 1 (CDR1), 2, and 3. The CDR1, CDR2, and CDR3 of the antigen-binding domain can be selected from the group consisting of:
[0560] (i) CDR1 containing the sequence X1X2FX3IX4RGX5;
[0561] CDR2 of the sequence containing AIX6TSGX7ATX8YA; and
[0562] Includes CNMEX 11 X 12 X 13 YRX 14 CDR3 of YW sequence;
[0563] (ii) Contains X 15 X 16 X 17 X 18 X 19 YX 20 X 21 X 22The CDR1 sequence;
[0564] Includes X 23 CX 24 X 25 SX 26 X 27 X 28 X 29 X 30 CDR2 of KYA sequence; and
[0565] Includes CX 31 AAX 32 PX 33 DDCSVX 34 GX 35 CDR3 of the YGLNYW sequence;
[0566] (iii) Contains X 36 CDR1 of the TFDAYAIG sequence;
[0567] CDR2 of the sequence containing ICLSPSDGSTYYA; and
[0568] Includes CAX 37 CDR3 of the sequence PSWCSLKADFGSW;
[0569] (iv) CDR1 of sequences containing SIIRDNVMA;
[0570] Includes AIINX 38 GGSX 39 CDR2 of NVD sequence; and
[0571] Includes CNVYYRX 40 CDR3 of LW sequence;
[0572] (v) CDR1 of sequences containing SIFSIARMN or FTLDYYAIA;
[0573] CDR2 of sequences containing AILNRAGRTDYA; and
[0574] CDR3 of the sequence containing CNLQTISYHDFW; and
[0575] (vi) CDR1 of sequences containing SIFSATMME;
[0576] CDR2 of the sequence containing AIVTSGGRTNYA; and
[0577] CDR3 containing the sequence CKFERYDYVNYW;
[0578] Where X1-X39 It is any naturally occurring amino acid.
[0579] In some cases, X4 is a nonpolar amino acid; X5 is a polar amino acid; X6 is a nonpolar amino acid; X... 11 It is a polar amino acid; X 12 It is a nonpolar amino acid; X 16 It is a polar amino acid; X 18 It is a negatively charged amino acid; X 21 It is a nonpolar amino acid; X 24 It is a nonpolar amino acid; X 25 It is a polar amino acid; X 29 It is a nonpolar amino acid; and / or X 39 It is a nonpolar amino acid.
[0580] In some cases, CDR1 contains the sequence X1X2FX3IX4RGX5, where X1 is S or G; X2 is I or T; X3 is D or G; X4 is V or A; and X5 is S or N; CDR2 contains the sequence AIX6TSGX7ATX8YA, where X8 is I or V; X9 is G or D; and X 10 It is either N or D; and CDR3 contains CNMEX. 11 X 12 X 13 YRX 14 The sequence YW, where X 11 Is it S or T; X 12 It is F, V, or L; X 13 It is R or S; and X 14 It can be N or H.
[0581] In some cases, CDR1 contains X 15 X 16 X 17 X 18 X 19 YX 20 X 21 X 22 The sequence, where X 15 It is F, L, or R; X 16 Is it T, S, or N; X 17 It is L, F, or R; X 18 It is D or E; X 19 It is R, H, Y, K, N; X 20 It is S, A, or T; X 21 It is I, V, or M; and X 22 It is G or N; CDR2 contains X 23 CX 24 X 25 SX 26 X27 X 28 X 29 X 30 KYA sequence, where X 23 It is S, A, T, or L; X 24 Is it I or V; X 25 Is it S or T; X 26 It is S, K, or N; X 17 Is it G or S; X 28 It is G or D; X 29 It is I, L, or V; and X 30 It is P, T, I, or V; and CDR3 contains CX. 31 AAX 32 PX 33 DDCSVX 34 GX 35 The sequence YGLNYW, where X 31 It is G, T, or A; X 32 Is it T, G, or D; X 33 It is D, P, A, or K; X 34 It is P, A, or H; and X 35 It is H or Y.
[0582] In some cases, CDR1 contains X 36 The sequence of TFDAYAIG, where X 36 It is F or H; CDR2 contains the sequence ICLSPSDGSTYYA; and CDR3 contains CAX. 37 The sequence of PSWCSLKADFGSW, where X 37 It is T or A; or CDR1 contains a sequence of SIIRDNVMA; CDR2 contains AIINX. 38 GGSX 39 NVD sequence, where X 38 It is T or I; and X 39 It is either A or G; and CDR3 contains CNVYYRX. 40 The sequence of LW, where X 40 It is either D or G.
[0583] The antigen-binding domain may include a variable domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO:603-620 or 622-688. The variable domain may also have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO:603-620 or 622-688. The variable domain may include the sequence of any of SEQ ID NO:603-620 or 622-688. The variable domain may include the sequence of SEQ ID NO:605. The variable domain may include the sequence of SEQ ID NO:611. The variable domain may include the sequence of SEQ ID NO:613. The variable structural domain may contain the sequence of SEQ ID NO:620. The variable structural domain may contain the sequence of SEQ ID NO:618. The variable structural domain may contain the sequence of SEQ ID NO:603. The variable structural domain may contain the sequence of SEQ ID NO:615. The variable structural domain may contain the sequence of SEQ ID NO:608. The variable structural domain may contain the sequence of SEQ ID NO:610.
[0584] The antigen-binding domain may include: CDR1 containing a sequence of any one of SEQ ID NO: 87-104 or 107-172; CDR2 containing a sequence of any one of SEQ ID NO: 259-276 or 279-344; and CDR3 containing a sequence of any one of SEQ ID NO: 431-448 or 451-516. CDR1 may be SEQ ID NO: 89, CDR2 may be SEQ ID NO: 261, and CDR3 may be SEQ ID NO: 433. CDR1 may be SEQ ID NO: 95, CDR2 may be SEQ ID NO: 267, and CDR3 may be SEQ ID NO: 439. CDR1 may be SEQ ID NO: 97, CDR2 may be SEQ ID NO: 269, and CDR3 may be SEQ ID NO: 441. CDR1 may be SEQ ID NO: 104, CDR2 may be SEQ ID NO: 276, and CDR3 may be SEQ ID NO: 448. The CDR1 can be SEQ ID NO:102, the CDR2 can be SEQ ID NO:274, and the CDR3 can be SEQ ID NO:446. Alternatively, the CDR1 can be SEQ ID NO:87, the CDR2 can be SEQ ID NO:259, and the CDR3 can be SEQ ID NO:431. Another option is that the CDR1 can be SEQ ID NO:99, the CDR2 can be SEQ ID NO:271, and the CDR3 can be SEQ ID NO:443. A third option is that the CDR1 can be SEQ ID NO:92, the CDR2 can be SEQ ID NO:264, and the CDR3 can be SEQ ID NO:436. Finally, the CDR1 can be SEQ ID NO:94, the CDR2 can be SEQ ID NO:266, and the CDR3 can be SEQ ID NO:439.
[0585] The antigen-binding domain may include a variable domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:621. The variable domain may have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:621. The variable domain may contain the sequence of SEQ ID NO:621. CDR1 may be SEQ ID NO:105, CDR2 may be SEQ ID NO:227, and CDR3 may be SEQ ID NO:449.
[0586] In some cases, the antigen-binding domain is a single-chain variable fragment (scFv). The scFv may contain a heavy-chain variable (VH) domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO:783-835. The scFv may contain a heavy-chain variable (VH) domain having at least 95% sequence identity with any of SEQ ID NO:783-835. The scFv may contain a heavy-chain variable (VH) domain having the sequence of any of SEQ ID NO:783-835.
[0587] The scFv may contain a light chain variable (VL) domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO: 995-1047. The scFv may contain a light chain variable (VL) domain having at least 95% sequence identity with any of SEQ ID NO: 995-1047. The scFv may contain a light chain variable (VL) domain having a sequence of any of SEQ ID NO: 995-1047. The VH domain may contain a heavy chain complementarity determination region 1 (CDRH1) having a sequence of any of SEQ ID NO: 836-888, a CDRH2 having a sequence of any of SEQ ID NO: 889-941, and a CDRH3 having a sequence of any of SEQ ID NO: 942-994. The VL domain may include a light chain complementarity determination region 1 (CDRL1) having a sequence of any one of SEQ ID NO:1048-1100, a CDRL2 having a sequence of any one of SEQ ID NO:1101-1153, and a CDRL3 having a sequence of any one of SEQ ID NO:1154-1206.
[0588] The scFv may contain a VH domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:800. The scFv may contain a VH domain having at least 95% sequence identity with SEQ ID NO:800. The scFv may contain a VH domain having the sequence of SEQ ID NO:800. The scFv may contain a VL domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:1012. The scFv may contain a VL domain having at least 95% sequence identity with SEQ ID NO:1012. The scFv may contain a VL domain having the sequence of SEQ ID NO:1012. The VH domain may contain CDRH1 with the sequence of SEQ ID NO: 853, CDRH2 with the sequence of SEQ ID NO: 906, and CDRH3 with the sequence of SEQ ID NO: 959. The VL domain may contain CDRL1 with the sequence of SEQ ID NO: 1065, CDRL2 with the sequence of SEQ ID NO: 1118, and CDRL3 with the sequence of SEQ ID NO: 1171.
[0589] The scFv may contain a VH domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:783. The scFv may contain a VH domain having at least 95% sequence identity with SEQ ID NO:783. The scFv may contain a VH domain having the sequence of SEQ ID NO:783. The scFv may contain a VL domain having at least 90% sequence identity with SEQ ID NO:995. The scFv may contain a VL domain having at least 95% sequence identity with SEQ ID NO:995. The scFv may contain a VL domain having the sequence of SEQ ID NO:995. The VH domain may contain CDRH1 having the sequence of SEQ ID NO:836, CDRH2 having the sequence of SEQ ID NO:889, and CDRH3 having the sequence of SEQ ID NO:942. The VL domain may contain CDRL1 with the sequence SEQ ID NO:1048, CDRL2 with the sequence SEQ ID NO:1101, and CDRL3 with the sequence SEQ ID NO:1154.
[0590] The scFv may contain a VH domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:784. The scFv may contain a VH domain having at least 95% sequence identity with SEQ ID NO:784. The scFv may contain a VH domain having the sequence of SEQ ID NO:784. The scFv may contain a VL domain having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with SEQ ID NO:996. The scFv may contain a VL domain having at least 95% sequence identity with SEQ ID NO:996. The scFv may contain a VL domain having the sequence of SEQ ID NO:996. The VH domain may contain CDRH1 with the sequence of SEQ ID NO:837, CDRH2 with the sequence of SEQ ID NO:890, and CDRH3 with the sequence of SEQ ID NO:943. The VL domain may contain CDRL1 with the sequence of SEQ ID NO:1049, CDRL2 with the sequence of SEQ ID NO:1102, and CDRL3 with the sequence of SEQ ID NO:1155.
[0591] The scFv may contain a connector sequence. The connector sequence may contain the sequence of SEQ ID NO:782.
[0592] Stability and mutation
[0593] The stability of the anti-CD70 binding domain (e.g., scFv or sdAb molecules (e.g., soluble scFv or sdAb)) can be evaluated with reference to the biophysical properties (e.g., thermal stability) of a conventional control scFv molecule or full-length antibody. In one embodiment, the humanized scFv or human scFv has thermal stability at approximately 0.1, 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10°C, 11°C, 12°C, 13°C, 14°C, or 15°C higher than that of the parental scFv in the described assay.
[0594] The improved thermostability of the anti-CD70 binding domain (e.g., scFv) is then imparted to the entire anti-CD70 TFP construct, resulting in improved therapeutic properties of the anti-CD70 TFP construct. The thermostability of the anti-CD70 binding domain (e.g., scFv) can be improved by at least about 2°C or 3°C compared to a conventional antibody. In one embodiment, the anti-CD70 binding domain (e.g., scFv) has improved thermostability by 1°C compared to a conventional antibody. In another embodiment, the anti-CD70 binding domain (e.g., scFv) has improved thermostability by 2°C compared to a conventional antibody. In yet another embodiment, the scFv has improved thermostability by 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, or 15°C compared to a conventional antibody. For example, the scFv molecule disclosed herein may be associated with scFv V. H and V L Comparisons are made between scFv molecules or Fab fragments of the derived antibodies. Thermal stability can be measured using methods known in the art. For example, in one embodiment, TM can be measured. Methods for measuring TM and other methods for determining protein stability are described below.
[0595] Mutations in antigen-binding domains such as scFv or sdAb (generated through humanization or mutagenesis of soluble scFv or sdAb) alter the stability of the antigen-binding domain and improve the overall stability of the antigen-binding domain and the anti-CD70 TFP construct. The stability of the humanized antigen-binding domain can be compared to that of the mouse antigen-binding domain using measurements such as TM, temperature denaturation, and temperature aggregation. In one embodiment, the antigen-binding domain, such as scFv or sdAb, may contain at least one mutation generated by the humanization process, such that the mutated antigen-binding domain confers increased stability to the anti-CD70 TFP construct. In another embodiment, the anti-CD70 binding domain, such as scFv or sdAb, contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations generated by the humanization process, such that the mutated antigen-binding domain confers increased stability to the anti-CD70 TFP construct.
[0596] In one aspect, the antigen-binding domain of the TFP comprises an amino acid sequence homologous to the amino acid sequence of the antigen-binding domain described herein, and the antigen-binding domain retains the desired functional properties of the anti-CD70 antibody fragment described herein. In a specific aspect, the TFP composition of the present invention comprises an antibody fragment. In a further aspect, the antibody fragment comprises scFv or sdAb.
[0597] In various aspects, by modifying one or two variable regions (e.g., V) Hand / or V L The antigen-binding domain of the TFP is engineered within, for example, one or more CDR regions and / or one or more frame regions, using one or more amino acids. In one particular aspect, the TFP composition of this disclosure comprises an antibody fragment. In a further aspect, the antibody fragment comprises scFv or sdAb.
[0598] Those skilled in the art will understand that the antibodies or antibody fragments of this disclosure can be further modified to alter their amino acid sequence (e.g., from wild type) without changing the desired activity. For example, additional nucleotide substitutions can be made to the protein, resulting in the substitution of amino acids at "non-essential" amino acid residues. For example, non-essential amino acid residues in the molecule can be replaced by another amino acid residue from the same side chain family. In another embodiment, a string of amino acids can be replaced by a structurally similar string of substitutions that differ in sequence and / or composition from members of the side chain family; for example, conserved substitutions can be performed in which amino acid residues are replaced by amino acid residues having similar side chains.
[0599] Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0600] In the case of two or more nucleic acid or polypeptide sequences, the percentage of identity refers to the number of identical sequences. Two sequences are considered "substantially identical" if, when compared and aligned over a comparison window or specified region to achieve maximum similarity (e.g., using one of the following sequence comparison algorithms or measured by manual alignment and visual inspection), they have a specified percentage of identical amino acid residues or nucleotides (e.g., 60% identity over a specified region, or, when not specified, over the entire sequence, optionally 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity). Optionally, the identity exists in a region of at least about 50 nucleotides (or 10 amino acids) in length, or more preferably in a region of 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
[0601] For sequence comparison, a reference sequence is typically used and compared with a test sequence. When using a sequence comparison algorithm, the test and reference sequences are input into the computer, and subsequence coordinates are specified if necessary, along with the sequence algorithm program parameters. Default program parameters can be used, or optional parameters can be specified. The sequence comparison algorithm then calculates the percentage of sequence identity between the test sequence and the reference sequence based on the program parameters. The sequence alignment methods used for comparison are well known in the art. The optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, by the similarity search method of Pearson and Lipman, (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the WisconsinGenetics software package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, for example, Brent et al., (2003) Current Protocols in Molecular Biology). Two examples of algorithms suitable for determining percentage sequence identity and sequence similarity are the BLAST and BLAST2.0 algorithms described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402; and Altschul et al., (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analysis is publicly available from the National Center for Biotechnology Information. Algorithm parameters for determining nucleotide sequence identity using nucleotide BLAST can use scoring parameters with match / mismatch scores of 1 or -2, where the gap cost is linear. The sequence length for initiating alignment, or the word length in the BLAST algorithm, can be set to 28 for sequence alignment. Algorithm parameters for determining peptide sequence identity using protein BLAST can use scoring parameters and a BLOSUM62 matrix to assign scores for aligned residue pairs and determine the overall alignment score, where the gap cost can have a presence penalty of 11 and an extension penalty of 1. The method for adjusting the amino acid composition matrix of the compensation sequence can be conditional composition score matrix adjustment. The sequence length for initiating alignment or the word length in the BLAST algorithm can be set to 6 for sequence alignment.
[0602] In one aspect, this disclosure considers modifications to the amino acid sequence of the starting antibody or fragment (e.g., scFv or VHH) to generate a functionally equivalent molecule. For example, the V-type binding domain (e.g., scFv or VHH) contained in TFP. H or V L It can be modified to retain at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% of the anti-CD70 binding domains (e.g., scFv or V). HH The initial V H or V L Identity of the framework region. This disclosure considers modifications to the entire TFP construct, such as modifications to one or more amino acid sequences in the individual domains of the TFP construct, to generate functionally equivalent molecules. The TFP construct can be modified to retain at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity with the starting TFP construct.
[0603] In some embodiments, the CD70 binder comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or higher sequence identity with any of the sequences listed in Tables 5, 7, 8, and 9. In some embodiments, the CD70 binder comprises any of the sequences listed in Tables 5, 7, 8, and 9.
[0604] extracellular domain
[0605] The extracellular domain can be derived from natural or recombinant sources. In the case of a natural source, the domain can be derived from any protein, but is particularly a membrane-bound or transmembrane protein. In one aspect, the extracellular domain is capable of associating with a transmembrane domain. Extracellular domains particularly useful in this disclosure may include, for example, the α, β, γ, or δ chain of a T-cell receptor, or CD3ε, CD3γ, or CD3δ, or, in alternative embodiments, the extracellular regions of CD28, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154. In some cases, the extracellular domain of a TCR includes the extracellular domain or a portion thereof of a protein selected from the group consisting of: the TCRα chain, TCRβ chain, TCRγ chain, TCRδ chain, CD3εTCR subunit, CD3γTCR subunit, CD3δTCR subunit, functional fragments thereof, and their amino acid sequences having at least one but no more than 20 modifications.
[0606] In some embodiments, the TCR extracellular domain comprises an extracellular domain or a portion thereof of the TCRα chain, TCRβ chain, TCRδ chain, or TCRγ chain. In some embodiments, the TCR extracellular domain comprises an IgC domain of the TCRα chain, TCRβ chain, TCRδ chain, or TCRγ chain.
[0607] In some embodiments, the extracellular domain comprises extracellular domains containing at least a TCRα chain, a TCRβ chain, a TCRδ chain, or a TCRγ chain. (The numbers 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 4) 7, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues. In some embodiments, the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or higher sequence identity with the sequence encoding the extracellular domain of the TCRα, TCRβ, TCRδ, or TCRγ chain. In some embodiments, the extracellular domain comprises a sequence encoding a truncated extracellular domain of the TCRα, TCRβ, TCRδ, or TCRγ chain having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more amino acids at the N-terminus or C-terminus, or both.
[0608] In some embodiments, the extracellular domain comprises or at least includes IgC domains of TCRα, TCRβ, TCRδ, or TCRγ in the numbers 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, and 47. 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues. In some embodiments, the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or higher sequence identity with the sequence encoding the IgC domain of TCRα, TCRβ, TCRδ, or TCRγ. In some embodiments, the extracellular domain comprises a sequence encoding a truncated IgC domain of TCRα, TCRβ, TCRδ, or TCRγ having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more amino acids at the N-terminus or C-terminus, or at both the N-terminus and C-terminus.
[0609] In some embodiments, the extracellular domain comprises or at least includes extracellular domains containing CD3εTCR subunits, CD3γTCR subunits, or CD3δTCR subunits at positions 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 4 6, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues. In some embodiments, the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or higher sequence identity with the sequence encoding the extracellular domain of the CD3εTCR subunit, CD3γTCR subunit, or CD3δTCR subunit. In some embodiments, the extracellular domain comprises a sequence encoding a truncated extracellular domain of the CD3εTCR subunit, CD3γTCR subunit, or CD3δTCR subunit having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more amino acids at the N-terminus or C-terminus, or both.
[0610] Transmembrane domain
[0611] Generally, a TFP sequence comprises an extracellular domain and a transmembrane domain encoded by a single genomic sequence. In alternative embodiments, the TFP can be designed to include a transmembrane domain heterologous to the extracellular domain of the TFP. The transmembrane domain may contain one or more additional amino acids adjacent to the transmembrane region, for example, one or more amino acids associated with the extracellular region of the protein from which the transmembrane domain originates (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 amino acids from the extracellular region). (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more amino acids from the extracellular region). In some cases, the transmembrane domain may include at least 30, 35, 40, 45, 50, 55, 60 or more amino acids from the extracellular region. In some cases, the transmembrane domain may contain at least 30, 35, 40, 45, 50, 55, 60 or more amino acids from the intracellular region. In one respect, the transmembrane domain is a transmembrane domain that is also one of the other domains of the TFP used. In some cases, the transmembrane domain can be selected or modified by amino acid substitution to prevent such domains from binding to transmembrane domains of the same or different surface membrane proteins, for example, to minimize interactions with other members of the receptor complex. In one respect, the transmembrane domain is capable of homodimerization with another TFP on the T cell surface. In other respects, the amino acid sequence of the transmembrane domain can be modified or substituted to minimize interactions with the binding domains of the native binding partner present in the same TFP.
[0612] The transmembrane domain can be of natural or recombinant origin. If the origin is natural, the domain can be derived from any membrane-binding or transmembrane protein. In one aspect, whenever TFP has bound to a target, the transmembrane domain is capable of signaling to one or more intracellular domains. In some cases, the TCR integrative subunit contains a transmembrane domain comprising a transmembrane domain of a protein selected from the group consisting of: TCRα chain, TCRβ chain, TCRγ chain, TCRδ chain, TCRζ chain, CD3εTCR subunit, CD3γTCR subunit, CD3δTCR subunit, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, CD154, their functional fragments, and their amino acid sequences having at least one but no more than 20 modifications.
[0613] In some embodiments, the transmembrane domain comprises, or at least comprises, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more consecutive amino acid residues of the transmembrane domain of the TCRα chain, TCRβ chain, TCRγ chain, TCRδ chain, CD3εTCR subunit, CD3γTCR subunit or CD3δTCR subunit. In some embodiments, the transmembrane domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or higher sequence identity with the sequence encoding the transmembrane domain of the TCRα chain, TCRβ chain, TCRγ chain, TCRδ chain, CD3εTCR subunit, CD3γTCR subunit, or CD3δTCR subunit. In some embodiments, the transmembrane domain comprises a sequence encoding a truncated transmembrane domain of the TCRα chain, TCRβ chain, TCRγ chain, TCRδ chain, CD3εTCR subunit, CD3γTCR subunit, or CD3δTCR subunit having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more amino acids at the N-terminus or C-terminus, or both the N-terminus and C-terminus.
[0614] In some cases, the transmembrane domain may be attached to the extracellular region of the TFP (e.g., the antigen-binding domain of the TFP) via a hinge (e.g., a hinge derived from a human protein). For example, in one embodiment, the hinge may be a human immunoglobulin (Ig) hinge, such as an IgG4 hinge or a CD8a hinge.
[0615] connector
[0616] Optionally, short oligopeptides or polypeptide linkers of 2 to 10 amino acids in length can form a link between the binding element and the TCR extracellular domain of the TFP. Glycine-serine duplexes provide particularly suitable linkers. In some cases, the linker length can be at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more. For example, in one aspect, the linker comprises the amino acid sequence GGGGSGGGGS (SEQ ID NO: 690) or the sequence (GGGGS (SEQ ID NO: 1232))x, where X is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or greater. In some embodiments, X is 2. In some embodiments, X is 4. In some implementations, the adapter is encoded by the nucleotide sequence GGTGGCGGAGGTTCTGGAGG TGGAGGTTCC (SEQ ID NO:691).
[0617] Cytoplasmic domain
[0618] The cytoplasmic domain of TFP may include an intracellular domain. In some embodiments, this intracellular domain is derived from CD3γ, CD3δ, CD3ε, TCRα, TCRβ, TCRγ, or TCRδ. In some embodiments, if the TFP contains a CD3γ, δ, or ε polypeptide, the intracellular domain includes a signal transduction domain; the TCRα, TCRβ, TCRγ, and TCRδ subunits typically have short (e.g., 1-19 amino acid lengths) intracellular domains and typically lack a signal transduction domain. The intracellular signal transduction domain is typically responsible for activating at least one of the normal effector functions of an immune cell to which a TFP has been introduced. Although the intracellular domains of TCRα, TCRβ, TCRγ, and TCRδ lack a signal transduction domain, they are capable of recruiting proteins having a primary intracellular signal transduction domain (e.g., CD3ζ) as described herein, which functions as an intracellular signal transduction domain. The term "effector function" refers to a cell-specific function. For example, the effector functions of T cells can be cytolytic activity or helper activity, including cytokine secretion. Therefore, the term "intracellular signaling domain" refers to a portion of a protein that transduces effector function signals and directs the cell to perform its specific functions. While the entire intracellular signaling domain can often be used, in many cases it is not necessary to use the whole strand. Regarding the use of truncated portions of intracellular signaling domains, such truncated portions can be used in place of the complete strand, provided they transduce effector function signals. Therefore, the term intracellular signaling domain means any truncated portion of an intracellular signaling domain that is sufficient to transduce effector function signals.
[0619] Examples of intracellular domains used in the TFP of this disclosure include cytoplasmic sequences of T cell receptors (TCRs) and co-receptors capable of synergistically initiating signal transduction upon antigen receptor binding, as well as any derivatives or variants of these sequences and any recombinant sequences having the same functional capabilities.
[0620] In some embodiments, the intracellular domain comprises an intracellular domain of a TCRα chain, a TCRβ chain, a TCRγ chain, a TCRδ chain, a CD3εTCR subunit, a CD3γTCR subunit, or a CD3δTCR subunit.
[0621] In some embodiments, the intracellular domain comprises, or at least comprises, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 or more consecutive amino acid residues of the intracellular domain encoding the TCRα, TCRβ, TCRγ, or TCRδ chain. In some embodiments, the intracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or higher sequence identity with the sequence encoding the intracellular domain of the TCRα, TCRβ, TCRγ, or TCRδ chain. In some embodiments, the transmembrane domain comprises a sequence encoding an intracellular domain of a truncated TCRα, TCRβ, TCRγ, or TCRδ chain having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more amino acids at the N-terminus or C-terminus or both.
[0622] In some embodiments, the intracellular domain comprises, or at least comprises, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, or 62 or more consecutive amino acid residues of the intracellular domain of the CD3εTCR subunit, CD3γTCR subunit, or CD3δTCR subunit. In some embodiments, the intracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or higher sequence identity with the sequence encoding the intracellular domain of the CD3εTCR subunit, CD3γTCR subunit, or CD3δTCR subunit. In some embodiments, the intracellular domain comprises a sequence encoding a truncated intracellular domain of the CD3εTCR subunit, CD3γTCR subunit, or CD3δTCR subunit having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more amino acids at the N-terminus or C-terminus or both.
[0623] It is known that the signal generated by the TCR alone is insufficient to fully activate primordial T cells, and secondary / co-stimulatory signals are required. Therefore, primordial T cell activation can be described as being mediated by two distinct classes of cytoplasmic signaling sequences: those sequences that initiate antigen-dependent primary activation via the TCR (primary intracellular signaling domains) and those sequences that function in an antigen-independent manner to provide secondary or co-stimulatory signals (secondary cytoplasmic domains, e.g., co-stimulatory domains).
[0624] Primary signaling domains regulate primary activation of the TCR complex in a stimulatory or inhibitory manner. Primary intracellular signaling domains that function in a stimulatory manner may contain signaling motifs, referred to as immune receptor tyrosine-based activation motifs (ITAMs).
[0625] Examples of ITAM-containing primary intracellular signaling domains particularly useful in this disclosure include those of CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In one embodiment, the TFP of this disclosure comprises an intracellular signaling domain, such as a primary signaling domain of CD3ε, CD3δ, or CD3γ. In one embodiment, the primary signaling domain comprises a modified ITAM domain, such as a mutant ITAM domain, which has altered (e.g., enhanced or weakened) activity compared to the native ITAM domain. In one embodiment, the primary signaling domain comprises a modified ITAM-containing primary intracellular signaling domain, such as an optimized and / or truncated ITAM-containing primary intracellular signaling domain. In embodiments, the primary signaling domain comprises one, two, three, four, or more ITAM motifs.
[0626] The intracellular signaling domain of a TFP may itself contain a CD3 signaling domain, such as CD3ε, CD3δ, CD3γ, or CD3ζ, or may be combined with any one or more other desired intracellular signaling domains useful in the context of the TFP disclosed herein. For example, the intracellular signaling domain of a TFP may contain a CD3ε chain portion and a co-stimulatory signaling domain. A co-stimulatory signaling domain refers to a portion of the TFP containing an intracellular domain of a co-stimulatory molecule. A co-stimulatory molecule is a cell surface molecule other than an antigen receptor or its ligand, which is essential for the efficient response of lymphocytes to antigens. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83. For example, CD27 co-stimulation has been shown to enhance the expansion, effector function and survival of human TFP-T cells in vitro, and to enhance the persistence and antitumor activity of human T cells in vivo (Song et al., Blood. 2012; 119(3):696-706).
[0627] In some embodiments, the extracellular, transmembrane, and intracellular domains of the TFP are derived from TCRα, TCRβ, TCRγ, or TCRδ, and the extracellular, transmembrane, and intracellular domains include constant domains of TCRα, TCRβ, TCRγ, or TCRδ. The TFP may contain full-length constant domains of a TCRα, TCRβ, TCRγ, or TCRδ chain. The TFP may contain fragments (e.g., functional fragments) of the full-length constant domains of a TCRα, TCRβ, TCRγ, or TCRδ chain.
[0628] The TCRα, TCRβ, TCRγ, or TCRδ chains described herein can originate from various species. The TCR chain can be a mouse or human TCR chain. For example, a TFP may contain a constant structural domain of a mouse TCRα, mouse TCRβ, human TCRγ, or human TCRδ chain.
[0629] The intracellular signaling sequences within the cytoplasmic portion of the TFP of this disclosure can be interconnected in a random or specifically designated order. Optionally, short oligopeptides or polypeptide linkers, for example, of 2 to 10 amino acids in length (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids), can form links between the intracellular signaling sequences.
[0630] In one embodiment, a glycine-serine dinucleotide may be used as a suitable linker. In another embodiment, a single amino acid, such as alanine or glycine, may be used as a suitable linker.
[0631] In one aspect, the TFP-expressing cells described herein may also include a second TFP, for example, a second TFP containing different antigen-binding domains, such as targeting the same target (e.g., CD70) or different targets (e.g., MSLN, CD19, or MUC16). In one embodiment, when TFP-expressing cells contain two or more different TFPs, the antigen-binding domains of the different TFPs may prevent the antigen-binding domains from interacting with each other. For example, cells expressing a first TFP and a second TFP may have an antigen-binding domain of the first TFP, for example, as a fragment (e.g., scFv), which does not associate with the antigen-binding domain of the second TFP, for example, the antigen-binding domain of the second TFP being V. HH .
[0632] In another aspect, the TFP-expressing cells described herein may also express another agent, such as an agent that enhances the activity of modified T cells. For example, in one embodiment, the agent may be an agent that inhibits an inhibitory molecule. In some embodiments, an inhibitory molecule, such as PD1, may reduce the ability of modified T cells to elicit an immune effector response. Examples of inhibitory molecules include PD1, PD-L1, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, and TGFRβ. In one embodiment, the agent that inhibits the inhibitory molecule comprises a first polypeptide (e.g., an inhibitory molecule) that associates with a second polypeptide (e.g., an intracellular signaling domain described herein) that provides a positive signal to the cell. In one embodiment, the agent comprises: a first polypeptide of, for example, an inhibitory molecule (such as PD1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4, and TIGIT, or a fragment of any of these (e.g., at least a portion of the extracellular domain of any of these)); and a second polypeptide of an intracellular signaling domain as described herein (e.g., an intracellular signaling domain comprising a co-stimulatory domain (e.g., 4-1BB, CD27, or CD28, as described herein)) and / or a primary signaling domain (e.g., the CD3ζ signaling domain as described herein). In one embodiment, the agent comprises a first polypeptide of PD1 or a fragment thereof (e.g., at least a portion of the extracellular domain of PD1), and a second polypeptide of an intracellular signaling domain as described herein (e.g., the CD28 signaling domain as described herein and / or the CD3ζ signaling domain as described herein). PD1 is an inhibitory member of the CD28 receptor family, which also includes CD28, CTLA-4, ICOS, and BTLA. PD-1 is expressed on activated B cells, T cells, and myeloid cells (Agata et al., 1996, Int. Immunol 8:765-75). Two ligands of PD-1, PD-L1 and PD-L2, have been shown to downregulate T cell activation upon binding to PD-1 (Freeman et al., 2000 J. Exp. Med. 192:1027-34; Latchman et al., 2001 Nat. Immunol. 2:261-8; Carter et al., 2002 Eur. J. Immunol. 32:634-43). PD-L1 is abundant in human cancers (Dong et al., 2003 J.Mol.Med. 81:281-7; Blank et al., 2005 Cancer Immunol.Immunother. 54:307-314; Konishi et al., 2004 Clin.Cancer Res. 10:5094).Immunosuppression can be reversed by inhibiting the local interaction between PD1 and PD-L1.
[0633] In one embodiment, the agent comprises an extracellular domain (ECD) of an inhibitory molecule, such as programmed death protein 1 (PD1), which may be fused with a transmembrane domain and optionally an intracellular signaling domain such as 41BB and CD3ζ (also referred to herein as PD1 TFP). In one embodiment, PD1 TFP, when used in combination with the anti-CD70 TFP described herein, improves T cell persistence. In one embodiment, the TFP is a PD1 TFP containing the PD-1 extracellular domain. Alternatively, a TFP containing an antibody or antibody fragment (such as scFv) that specifically binds to programmed death ligand 1 (PD-L1) or programmed death ligand 2 (PD-L2) is provided.
[0634] In another aspect, this disclosure provides a population of T cells expressing TFPs (e.g., TFP-T cells). In some embodiments, the population of TFP-expressing TFPs comprises a mixture of cells expressing different TFPs. For example, in one embodiment, the TFP-T cell population may include a first cell expressing a TFP having an anti-CD70 binding domain as described herein, and a second cell expressing a TFP having a binding domain that specifically targets a different antigen (e.g., a binding domain described herein that is different from the anti-CD70 binding domain in the TFP expressed by the first cell). As another example, a population of cells expressing TFPs may include a first cell expressing a TFP including a first binding domain (e.g., a binding domain as described herein) and a second cell expressing a TFP including an antigen-binding domain targeting a target other than the binding domain of the first cell (e.g., another tumor-associated antigen).
[0635] In another aspect, this disclosure provides a cell population in which at least one cell expresses a TFP having the domains described herein, and a second cell expresses another agent, such as an agent that enhances the activity of the modified T cells. For example, in one embodiment, the agent may be an agent that inhibits an inhibitory molecule. For example, in some embodiments, an inhibitory molecule may reduce the ability of the modified T cells to elicit an immune effector response. Examples of inhibitory molecules include PD1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, and TGFRβ. In one embodiment, the agent that inhibits the inhibitory molecule comprises a first polypeptide (e.g., an inhibitory molecule) that associates with a second polypeptide (e.g., an intracellular signaling domain described herein) that provides a positive signal to the cell. In some embodiments, the agent is a cytokine. In some embodiments, the cytokine is IL-15. In some embodiments, IL-15 increases the persistence of the T cells described herein.
[0636] Recombinant nucleic acid encoding TFP
[0637] In some implementations, this document discloses recombinant nucleic acids encoding the TFP disclosed herein.
[0638] In some cases, the recombinant nucleic acid also contains a leader sequence. In some cases, the recombinant nucleic acid also contains a promoter sequence. In some cases, the recombinant nucleic acid also contains a sequence encoding a poly(A) tail. In some cases, the recombinant nucleic acid also contains a 3' UTR sequence. In some cases, the nucleic acid is an isolated nucleic acid or a non-naturally occurring nucleic acid. Non-naturally occurring nucleic acids are well known to those skilled in the art. In some cases, the nucleic acid is a nucleic acid transcribed in vitro.
[0639] This document discloses methods for generating TFP-encoding RNA encoded by in vitro transcription. This disclosure also includes TFP-encoding RNA constructs that can be directly transfected into cells. Methods for generating mRNA for transfection may include using a specially designed primer for in vitro transcription (IVT) of a template, followed by the addition of a polyA tail to produce a construct containing 3' and 5' untranslated sequences (“UTR”), a 5' cap and / or an internal ribosome entry site (IRES), the nucleic acid to be expressed, and a polyA tail (typically 50-2000 bases in length). The resulting RNA can be efficiently transfected into various cell types. In one aspect, the template includes the TFP sequence.
[0640] In one aspect, anti-CD70 TFP is encoded by messenger RNA (mRNA). In another aspect, mRNA encoding anti-CD70 TFP is introduced into T cells to generate TFP-T cells. In one embodiment, in vitro transcribed RNA TFP can be introduced into cells as a transient transfection. RNA is generated by in vitro transcription using a template generated by polymerase chain reaction (PCR). Target DNA from any source can be directly converted into a template for in vitro mRNA synthesis by PCR using suitable primers and RNA polymerase. The source of DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequences, or any other suitable DNA source. The desired template for in vitro transcription is the TFP of this disclosure. In one embodiment, the DNA used for PCR comprises an open reading frame. The DNA may be a naturally occurring DNA sequence from the genome of an organism. In one embodiment, the nucleic acid may comprise some or all of the 5' and / or 3' untranslated regions (UTRs). The nucleic acid may contain exons and introns. In one embodiment, the DNA used for PCR is a human nucleic acid sequence. In another embodiment, the DNA used for PCR is a human nucleic acid sequence comprising both the 5' and 3' UTRs. Alternatively, the DNA can be an artificial DNA sequence that is abnormally expressed in naturally occurring organisms. An exemplary artificial DNA sequence is an artificial sequence containing portions of genes linked together to form an open reading frame encoding a fusion protein. The linked DNA portions can originate from a single organism or from multiple organisms.
[0641] PCR is used to generate a template for in vitro transcription of mRNA, which is then used for transfection. Methods for performing PCR are well known in the art. Primers used for PCR are designed to have regions substantially complementary to a region of the DNA used as a template for PCR. As used herein, “substantially complementary” means a nucleotide sequence in which most or all of the bases in the primer sequence are complementary, or one or more bases are non-complementary, or mismatched. Substantially complementary sequences are able to anneal or hybridize with the intended DNA target under annealing conditions used for PCR. Primers can be designed to be substantially complementary to any portion of the DNA template. For example, primers can be designed to amplify portions (open reading frames) (including the 5' and 3' UTRs) of nucleic acids that are normally transcribed in cells. Primers can also be designed to amplify portions of nucleic acids encoding specific target domains. In one embodiment, primers are designed to amplify the coding region of human cDNA, including all or part of the 5' and 3' UTRs. Primers that can be used for PCR can be produced by synthetic methods well known in the art. A "forward primer" is a primer containing a nucleotide region that is substantially complementary to a nucleotide on a DNA template upstream of the DNA sequence to be amplified. "Upstream" herein refers to the position at 5' relative to the coding strand of the DNA sequence to be amplified. A "reverse primer" is a primer containing a nucleotide region that is substantially complementary to a double-stranded DNA template downstream of the DNA sequence to be amplified. "Downstream" herein refers to the position at 3' relative to the coding strand of the DNA sequence to be amplified.
[0642] Any DNA polymerase that can be used for PCR can be used in the methods disclosed herein. Reagents and polymerases are commercially available from a variety of sources.
[0643] Chemical structures with the ability to improve stability and / or translation efficiency can also be used. The RNA preferably has 5' and 3' UTRs. In one embodiment, the length of the 5' UTR is between 1 and 3,000 nucleotides. The lengths of the 5' and 3' UTR sequences to be added to the coding region can be changed by various methods, including but not limited to designing PCR primers that anneal to different regions of the UTR. Using this method, those skilled in the art can modify the 5' and 3' UTR lengths to achieve optimal translation efficiency after transfection of transcribed RNA.
[0644] The 5' and 3' UTRs can be naturally occurring endogenous 5' and 3' UTRs of the target nucleic acid. Alternatively, UTR sequences that are not endogenous to the target nucleic acid can be added by incorporating the UTR sequence into forward and reverse primers or by any other modification of the template. The use of UTR sequences that are not endogenous to the target nucleic acid can be useful for altering RNA stability and / or translation efficiency. For example, it is known that AU-rich elements in the 3' UTR sequence can reduce mRNA stability. Therefore, 3' UTRs can be selected or designed to increase the stability of transcribed RNA based on the characteristics of UTRs known in the art.
[0645] In one embodiment, the 5'UTR may contain a Kozak sequence of an endogenous nucleic acid. Alternatively, when a 5'UTR that is not endogenous for the target nucleic acid is added via PCR as described above, a shared Kozak sequence can be redesigned by adding a 5'UTR sequence. Kozak sequences can improve the translation efficiency of some RNA transcripts, but it appears that not all RNAs require it for efficient translation. In other embodiments, the 5'UTR may be the 5'UTR of an RNA virus whose RNA genome is stable in the cell. In other embodiments, various nucleotide analogs may be used in the 3' or 5'UTR to inhibit exonuclease degradation of the mRNA.
[0646] To enable RNA synthesis from a DNA template without gene cloning, a transcription promoter is ligated upstream of the sequence to be transcribed into the DNA template. The RNA polymerase promoter is incorporated into the PCR product upstream of the open reading frame of the sequence to be transcribed when the sequence serving as the promoter for RNA polymerase is added to the 5' end of the forward primer. In a preferred embodiment, the promoter is the T7 polymerase promoter, as described elsewhere herein. Other useful promoters include, but are not limited to, the T3 and SP6 RNA polymerase promoters. The common nucleotide sequences of the T7, T3, and SP6 promoters are known in the art.
[0647] In a preferred embodiment, the mRNA has a cap at the 5' end and a 3' poly(A) tail, which determines ribosome binding, translation initiation, and mRNA stability in the cell. On a circular DNA template (e.g., plasmid DNA), RNA polymerase produces a long tandem product unsuitable for expression in eukaryotic cells. Transcription of plasmid DNA linearized at the 3' UTR end produces a normal-sized mRNA that is ineffective in eukaryotic cell transfection, even if it is post-transcriptionally polyadenylated.
[0648] On a linear DNA template, phage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).
[0649] The conventional method for integrating polyA / T segments into DNA templates is molecular cloning. However, polyA / T sequences integrated into plasmid DNA can lead to plasmid instability, which is why plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other aberrations. This makes the cloning process not only laborious and time-consuming but also often unreliable. Therefore, methods that can construct DNA templates with polyA / T 3' segments without cloning are highly desirable.
[0650] Poly(A) / T segments of transcribed DNA templates can be generated during PCR using reverse primers containing poly(T) tails, such as 100 T tails (the size can range from 50 to 5000 T), or after PCR by any other method (including but not limited to DNA ligation or in vitro recombination). Poly(A) tails also provide stability to RNA and reduce its degradation. Generally, the length of the poly(A) tail is positively correlated with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is between 100 and 5000 adenosine.
[0651] Following in vitro transcription, the poly(A) tail of RNA can be further extended using a poly(A) polymerase such as E. coli poly(A) polymerase (E-PAP). In one embodiment, increasing the length of the poly(A) tail from 100 nucleotides to 300-400 nucleotides results in approximately a two-fold increase in RNA translation efficiency. Additionally, attaching different chemical groups to the 3' end can increase mRNA stability. This attachment can include modified / artificial nucleotides, aptamers, and other compounds. For example, ATP analogs can be incorporated into the poly(A) tail using a poly(A) polymerase. ATP analogs can further increase RNA stability.
[0652] The 5' cap also provides stability to the RNA molecule. In a preferred embodiment, the RNA produced by the methods disclosed herein includes a 5' cap. The 5' cap is provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).
[0653] RNA generated by the methods disclosed herein may also contain an internal ribosome entry site (IRES) sequence. The IRES sequence can be any viral, chromosomal, or artificially designed sequence that initiates cap-independent ribosome binding to mRNA and promotes the initiation of translation. It may include any solute suitable for cell electroporation, containing factors that promote cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants, and surfactants.
[0654] RNA can be introduced into target cells using any of a variety of different methods, such as commercially available methods, including but not limited to electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or Gene Pulser II (BioRad, Denver, Collo.), Multiporator (Eppendort, Hamburg, Germany), transfection mediated by cationic liposomes using lipid transfection, polymer encapsulation, peptide-mediated transfection, or bioballistic particle delivery systems such as “gene guns” (see, for example, Nishikawa et al., Hum Gene Ther., 12(8):861-70 (2001)).
[0655] For further information on the preparation and use of TFP T cells, see U.S. Patent Nos. 10,442,849, 10,358,473, 10,358,474 and 10,208,285, each of which is incorporated herein by reference.
[0656] Recombinant nucleic acids encoding TFP and TCR constant domains
[0657] In some embodiments, the CD70 TFP described herein may further comprise a sequence encoding a TCR constant domain, wherein the TCR constant domain is a TCRα constant domain, a TCRβ constant domain, a TCRα constant domain and a TCRβ constant domain, a TCRγ constant domain, a TCRδ constant domain, or a TCRγ constant domain and a TCRδ constant domain. The TCR subunit and the antibody may be operatively linked. When the TFP is expressed in T cells, the TFP may be functionally incorporated into the TCR complex (e.g., an endogenous TCR complex).
[0658] The constant domain may comprise a constant domain of the TCRα, TCRβ, TCRγ, or TCRδ chain. The constant domain may comprise a full-length constant domain of the TCRα, TCRβ, TCRγ, or TCRδ chain. The constant domain may comprise a fragment (e.g., a functional fragment) of the full-length constant domain of the TCRα, TCRβ, TCRγ, or TCRδ chain. For example, the constant domain may comprise at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, or more amino acid residues of the constant domain of the TCRα, TCRβ, TCRγ, or TCRδ chain. The sequence encoding the TCR constant domain may also encode a transmembrane domain and / or intracellular region of the TCRα, TCRβ, TCRγ, or TCRδ chain. The sequence encoding the TCR constant domain can encode the full-length constant region of the TCRα, TCRβ, TCRγ, or TCRδ chain. The constant region of the TCR chain can contain the constant domain, the transmembrane domain, and the intracellular region. The constant region of the TCR chain can also exclude the transmembrane domain and the intracellular region of the TCRα, TCRβ, TCRγ, or TCRδ chain.
[0659] The TCRα, TCRβ, TCRγ, or TCRδ chains described herein can be derived from various species. The TCR chain can be a mouse or human TCR chain. For example, the constant domain can contain the constant domain of a mouse or human TCRα, TCRβ, TCRγ, or TCRδ chain.
[0660] The mouse TCRα constant domain may comprise positions 2-137 of SEQ ID NO:1267. The mouse TCRα constant domain may comprise a truncated, added, or substituted portion of the constant domain sequence described herein. For example, the constant domain may comprise a truncated form of the constant domain described herein, having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid residues at positions 2-137 of SEQ ID NO:1267. For example, the constant domain may comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more additional amino acid residues at positions 2-137 of SEQ ID NO:1267. For example, the constant domain may comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid substitutions at positions 2-137 of SEQ ID NO:1267. The constant domain may comprise the sequence of positions 2-137 of SEQ ID NO:1267 or a fragment thereof. The constant domain may contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications, mutations or deletions of the sequence at positions 2-137 of SEQ ID NO: 1267. The constant domain may contain at most 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 modification, mutation or deletion of the sequence at positions 2-137 of SEQ ID NO: 1267. The constant domain may contain a sequence having at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity with the sequence at positions 2-137 of SEQ ID NO: 1267.
[0661] The mouse TCRβ constant domain may comprise positions 2-173 of SEQ ID NO:1268. The mouse TCRβ constant domain may comprise a truncated, added, or substituted sequence of the constant domain described herein. For example, the constant domain may comprise a truncated form of the constant domain described herein, having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid residues at positions 2-173 of SEQ ID NO:1268. For example, the constant domain may comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more additional amino acid residues at positions 2-173 of SEQ ID NO:1268. For example, the constant domain may comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid substitutions at positions 2-173 of SEQ ID NO:1268. The constant domain may comprise the sequence or a fragment thereof at positions 22-173 of SEQ ID NO:1268. The constant domain may contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications, mutations or deletions of the sequence at positions 2-173 of SEQ ID NO: 1268. The constant domain may contain at most 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 modification, mutation or deletion of the sequence at positions 2-173 of SEQ ID NO: 1268. The constant domain may contain a sequence having at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity with the sequence at positions 2-173 of SEQ ID NO: 1268.
[0662] The TCRγ constant domain may comprise SEQ ID NO:721, its functional fragment, and amino acid sequences thereof having at least one but no more than 20 modifications. In some cases, the sequence encoding the TCRγ constant domain also encodes the TCRγ variable domain, thereby encoding the complete TCRγ domain. The complete TCRγ domain may be γ9 or γ4. The complete TCRγ domain may comprise SEQ ID NO:1269, its functional fragment, and amino acid sequences thereof having at least one but no more than 20 modifications.
[0663] The TCRδ constant domain may comprise SEQ ID NO:725, its functional fragment, or amino acid sequences thereof having at least one but no more than 20 modifications. In some cases, the sequence encoding the TCRδ constant domain also encodes the TCRδ variable domain, thereby encoding the complete TCRδ domain. The complete TCRδ domain may be δ2 or δ1. The complete TCRδ constant domain may comprise SEQ ID NO:1270, its functional fragment, and amino acid sequences thereof having at least one but no more than 20 modifications.
[0664] In some cases, the sequence encoding the TCR constant domain may also encode a second antigen-binding domain or ligand-binding domain that is operatively linked to the sequence encoding the TCR constant domain.
[0665] In some embodiments, the TCRα and / or TCRβ invariant domains are expressed together with TFP in cells where TRAC or TRBC has been inactivated. In some embodiments, the TCRγ and / or TCRδ invariant domains are expressed together with TFP in cells where TRAC or TRBC has been inactivated.
[0666] Converting molecules
[0667] In some cases, the modified T cells also contain nucleic acids encoding a repressive molecule, said repressive molecule comprising at least a first polypeptide constituting a portion of the repressive molecule, the first polypeptide associating with a second polypeptide containing a positive signal from an intracellular signaling domain. In some cases, said repressive molecule comprises: a first polypeptide constituting at least a portion of PD-1 and a second polypeptide containing a co-stimulatory domain and a primary signaling domain. In some embodiments, when expressed in T cells, T cells expressing TFP as described herein and PD-1 switching molecules as described herein can suppress tumor growth.
[0668] In some embodiments, this document discloses recombinant nucleic acid molecules comprising a first sequence encoding a TFP as described herein and a second nucleic acid sequence encoding an agent that enhances the activity of modified T cells expressing the TFP as described herein. In some embodiments, the second nucleic acid sequence is contained in a separate nucleic acid sequence. In some embodiments, the second nucleic acid sequence is contained in the same nucleic acid molecule as the recombinant nucleic acid molecule. For example, in one embodiment, the agent that enhances the activity of modified T cells may be a PD-1 peptide. In these embodiments, the PD-1 peptide may be operatively linked via its C-terminus to the N-terminus of the intracellular domain of a co-stimulatory peptide. For example, in another embodiment, the agent that enhances the activity of modified T cells may be an anti-PD-1 antibody or an antigen-binding fragment thereof. In this embodiment, the anti-PD-1 antibody or an antigen-binding fragment thereof may be operatively linked via its C-terminus to the N-terminus of the intracellular domain of a co-stimulatory peptide. In some embodiments, the PD-1 peptide or anti-PD-1 antibody is linked via the transmembrane domain of PD-1 to the intracellular domain of the co-stimulatory peptide. In some embodiments, the co-stimulatory peptide is selected from the group consisting of: OX40, CD2, CD27, CD5, ICAM-1, ICOS (CD278), 4-1BB (CD137), GITR, CD28, CD30, CD40, IL-15Ra, IL12R, IL18R, IL21R, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, CD226, FcγRI, FcγRII, and FcγRIII. In some embodiments, the co-stimulatory peptide is CD28.
[0669] In some embodiments, this document discloses recombinant nucleic acid molecules comprising a sequence encoding a TFP as described herein, wherein the recombinant nucleic acid molecule further comprises an agent that enhances the activity of modified T cells expressing the TFP as described herein. In another aspect, cells expressing the TFP as described herein may also express another agent, for example, an agent that enhances the activity of modified T cells. For example, in one embodiment, the agent may be an agent that inhibits an inhibitory molecule. In some embodiments, inhibitory molecules such as PD-1 can reduce the ability of modified T cells to elicit an immune effector response. Examples of inhibitory molecules include PD-1, PD-L1, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, and 2B4. In one embodiment, the agent that inhibits an inhibitory molecule comprises a first polypeptide (e.g., an inhibitory molecule) that associates with a second polypeptide (e.g., an intracellular signaling domain as described herein) that provides a positive signal to the cell. In one embodiment, the agent comprises: a first polypeptide of, for example, an inhibitory molecule (such as PD-1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4, and TIGIT, or a fragment of any of these (e.g., at least a portion of the extracellular domain of any of these)); and a second polypeptide of an intracellular signaling domain as described herein (e.g., an intracellular signaling domain comprising a co-stimulatory domain (e.g., 4-1BB, CD27, or CD28, as described herein)) and / or a primary signaling domain (e.g., the CD3ζ signaling domain as described herein). In one embodiment, the agent comprises a first polypeptide of PD-1 or a fragment thereof (e.g., at least a portion of the extracellular domain of PD-1), and a second polypeptide of an intracellular signaling domain as described herein (e.g., the CD28 signaling domain as described herein and / or the CD3ζ signaling domain as described herein). In some embodiments, the recombinant nucleic acid molecule as described herein also comprises a sequence encoding PD-1 or a fragment thereof. In some embodiments, the recombinant nucleic acid molecule described herein further comprises a sequence encoding an extracellular domain of PD-1. In some embodiments, the recombinant nucleic acid molecule described herein comprises sequences encoding both an extracellular domain and a transmembrane domain of PD-1. In some embodiments, the recombinant nucleic acid molecule described herein may also comprise a sequence encoding CD28 or a fragment thereof. In some embodiments, the recombinant nucleic acid molecule described herein comprises a sequence encoding an intracellular domain of CD28. In some embodiments, the recombinant nucleic acid molecule described herein comprises a sequence encoding a fusion protein comprising an extracellular domain of PD-1 and a transmembrane domain of CD28 linked to the intracellular domain of CD28.In some embodiments, the agent comprises an extracellular domain and a transmembrane domain of PD-1 fused to the intracellular signaling domain of CD28. In some embodiments, the agent comprises SEQ ID NO:1239. PD-1 is an inhibitory member of the CD28 receptor family, which also includes CD28, CTLA-4, ICOS, and BTLA. PD-1 is expressed on activated B cells, T cells, and myeloid cells (Agata et al., 1996, Int. Immunol 8:765-75). Two ligands of PD-1, PD-L1 and PD-L2, have been shown to downregulate T cell activation upon binding to PD-1 (Freeman et al., 2000 J. Exp. Med. 192:1027-34; Latchman et al., 2001 Nat. Immunol. 2:261-8; Carter et al., 2002 Eur. J. Immunol. 32:634-43). PD-L1 is abundant in human cancers (Dong et al., 2003 J.Mol.Med.81:281-7; Blank et al., 2005 Cancer Immunol.Immunother.54:307-314; Konishi et al., 2004 Clin.Cancer Res.10:5094). Immunosuppression can be reversed by inhibiting the local interaction between PD1 and PD-L1.
[0670] In one embodiment, the agent comprises an extracellular domain (ECD) of an inhibitory molecule, such as PD-1 fused with a transmembrane domain and optionally intracellular signaling domains such as 41BB and CD3ζ (also referred to herein as PD-1TFP). In one embodiment, PD-1TFP, when used in combination with the anti-TAA TFP described herein, improves T cell persistence. In one embodiment, the TFP is a PD-1TFP containing the extracellular domain of PD-1. Alternatively, a TFP containing an antibody or antibody fragment (such as scFv) that specifically binds to programmed death ligand 1 (PD-L1) or programmed death ligand 2 (PD-L2) is provided.
[0671] In one aspect, this disclosure provides a cell population in which at least one cell in the population expresses a TFP having the domains described herein, and a second cell expresses another agent, such as an agent that enhances the activity of the modified T cells. For example, in one embodiment, the agent may be an agent that inhibits an inhibitory molecule. For example, in some embodiments, the inhibitory molecule may reduce the ability of the modified T cells to elicit an immune effector response. Examples of inhibitory molecules include PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, and 2B4. In one embodiment, the agent that inhibits the inhibitory molecule comprises a first polypeptide (e.g., an inhibitory molecule) that associates with a second polypeptide (e.g., an intracellular signaling domain described herein) that provides a positive signal to the cell.
[0672] Recombinant nucleic acids encoding conversion molecules
[0673] This document discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a T-cell receptor (TCR) fusion protein (TFP) as described herein and a second nucleic acid sequence encoding a conversion molecule as described herein. In some embodiments, the recombinant nucleic acid molecule comprises a first nucleic acid sequence encoding a T-cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding a repressive molecule, said repressive molecule comprising at least a portion of a first polypeptide constituting a repressive molecule, the first polypeptide associating with a second polypeptide comprising a positive signal from an intracellular signal transduction domain. In some embodiments, the recombinant nucleic acid molecule comprises a first nucleic acid sequence encoding a T-cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding a repressive molecule, said repressive molecule comprising at least a portion of PD-1 and a second polypeptide comprising a co-stimulatory domain and a primary signal transduction domain. In some embodiments, when expressed in T cells, T cells expressing the TFP as described herein and the PD-1 conversion molecule as described herein can suppress tumor growth.
[0674] IL-15 and IL-15 receptor α peptide
[0675] In some aspects, the TFP-expressing cells described herein may also express another agent, for example, an agent that can enhance the lifespan or activity of the TFP-expressing cells described herein. In some embodiments, the agent is a cytokine, such as a pleiotropic cytokine that plays an important role in the maintenance and homeostatic expansion of immune cells. In some embodiments, the local secretion of pleiotropic cytokines in the tumor microenvironment (TME) may contribute to enhanced antitumor immunity. In some embodiments, the agent activates cytokine signaling. In some embodiments, the agent activates interleukin-15 (IL-15) signaling. In some embodiments, the agent comprises interleukin-15 (IL-15) and / or interleukin-15 receptor (IL-15R). In some embodiments, the IL-15R is an IL-15R alpha (IL-15Rα) subunit.
[0676] This disclosure covers recombinant nucleic acid molecules encoding a polypeptide or fragment thereof encoding interleukin-15 (IL-15). In some embodiments, the IL-15 polypeptide or fragment thereof comprises IL-15 at positions 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, ... 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 1 21, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 or more consecutive amino acid residues. In some embodiments, the IL-15 polypeptide or fragment thereof comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or higher sequence identity with the sequence encoding IL-15. In some embodiments, the IL-15 polypeptide or a fragment thereof comprises a truncated IL-15 sequence encoding at the N-terminus or C-terminus, or at both the N-terminus and C-terminus, 25 or more amino acids.
[0677] In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise an IL-15 signal peptide. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 1-29 of IL-15. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 1-29 of SEQ ID NO:1245. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise the sequence of SEQ ID NO:1246. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 30-162 of IL-15. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 30-162 of SEQ ID NO:1245. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise any sequence or fragment thereof listed in Table 11. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise the sequence of SEQ ID NO:1242. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 1-162 of SEQ ID NO:1245. In some embodiments, the IL-15 peptide or a fragment thereof may comprise the sequences of SEQ ID NO:1246 and SEQ ID NO:1242. In some embodiments, the IL-15 peptide is secreted when expressed in cells such as T cells.
[0678] This disclosure also covers recombinant nucleic acid molecules encoding polypeptides or fragments thereof that encode interleukin-15 receptor (IL-15R) subunits. For example, the IL-15R subunit may be an IL-15 receptor α chain (“IL-15Rα” or CD215), an IL-2 receptor β chain (“IL-2Rβ” or CD122), and an IL-2 receptor γ / common γ chain (“IL-2Rγ / γc” or CD132). In some embodiments, the IL-15R subunit is IL-15Rα or a fragment thereof.In some embodiments, the IL-15Rα peptide or a fragment thereof comprises the 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 7 3, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250 or more consecutive amino acid residues.In some embodiments, the IL-15Rα polypeptide or a fragment thereof comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or higher sequence identity with the sequence encoding IL-15Rα. In some embodiments, the IL-15Rα polypeptide or a fragment thereof comprises a sequence encoding at the N-terminus or C-terminus, or both the N-terminus and C-terminus, having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, truncated IL-15Rα sequences of 100 or more amino acids.
[0679] In some embodiments, the IL-15Rα polypeptide or a fragment thereof may contain an IL-15Rα signal peptide. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may contain amino acids 1-30 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may contain amino acids 1-30 of SEQ ID NO:1247. In some embodiments, the IL-15Rα polypeptide or a fragment thereof does not contain an IL-15Rα signal peptide. In some embodiments, the IL-15Rα polypeptide or a fragment thereof does not contain amino acids 1-30 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or a fragment thereof does not contain amino acids 1-30 of SEQ ID NO:1247.
[0680] In some embodiments, the IL-15Rα polypeptide or a fragment thereof may contain an IL-15Rα Sushi domain. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may contain amino acids 31-95 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may contain amino acids 31-95 of SEQ ID NO:1247. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may contain the sequence of SEQ ID NO:1250.
[0681] In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise an intracellular domain of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise amino acids 229-267 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise amino acids 229-267 of the sequence SEQ ID NO:1247. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise the sequence of SEQ ID NO:1248.
[0682] In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise an IL-15Rα Sushi domain, a transmembrane domain, and an intracellular domain. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise amino acids 31-267 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise amino acids 31-267 of SEQ ID NO:1247. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise the sequence of SEQ ID NO:1250. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise the sequence of SEQ ID NO:1251. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise amino acids 96-267 of SEQ ID NO:1247. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise both the sequences of SEQ ID NO:1250 and SEQ ID NO:1251.
[0683] In some embodiments, the IL-15Rα polypeptide or a fragment thereof may be soluble IL-15Rα (sIL-15Rα). In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise amino acids 21-205 of IL-15Rα. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise amino acids 21-205 of the sequence SEQ ID NO:1247. In some embodiments, the IL-15Rα polypeptide or a fragment thereof may comprise the sequence SEQ ID NO:1249.
[0684] This disclosure covers recombinant nucleic acid molecules encoding fusion proteins comprising an IL-15 polypeptide linked to an IL-15R subunit. In some embodiments, IL-15 and the IL-15R subunit are operatively linked via a linker. In some embodiments, the IL-15R subunit is IL-15R alpha (IL-15Rα). For example, the IL-15 polypeptide may be linked to the N-terminus of the IL-15Rα subunit. For example, the IL-15 polypeptide may be linked to the C-terminus of the IL-15Rα subunit. In some embodiments, IL-15 and IL-15Rα are operatively linked via a linker. In some embodiments, the linker is not a cleavable linker. For example, the linker may comprise a sequence containing (G4S)n, where G is glycine, S is serine, and n is an integer from 1 to 10. In some embodiments, n is an integer from 1 to 4. In some embodiments, n is 3. In some embodiments, the linker comprises the sequence of SEQ ID NO: 1243.
[0685] In some embodiments, the fusion protein may comprise amino acids 30-162 of IL-15. In some embodiments, the fusion protein may comprise amino acids 30-162 of the sequence SEQ ID NO:1245. In some embodiments, the fusion protein may comprise any sequence or fragment thereof listed in Table 11. In some embodiments, the fusion protein may comprise the sequence SEQ ID NO:1242. In some embodiments, the fusion protein does not comprise the IL-15 signal peptide. In some embodiments, the fusion protein does not comprise amino acids 1-29 of IL-15. In some embodiments, the fusion protein does not comprise amino acids 1-29 of the sequence SEQ ID NO:1245. In some embodiments, the fusion protein does not comprise the sequence SEQ ID NO:1246.
[0686] In some embodiments, the fusion protein may comprise a Sushi domain. In some embodiments, the fusion protein may comprise amino acids 31-95 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 31-95 of the sequence SEQ ID NO: 1247. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO: 1250.
[0687] In some embodiments, the fusion protein may comprise an intracellular domain of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 229-267 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 229-267 of the sequence SEQ ID NO:1247. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO:1248.
[0688] In some embodiments, the fusion protein may comprise soluble IL-15Rα (sIL-15Rα). In some embodiments, the fusion protein may comprise amino acids 21-205 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 21-205 of the sequence SEQ ID NO:1247. In some embodiments, the fusion protein may comprise the sequence SEQ ID NO:1249.
[0689] In some embodiments, the fusion protein may comprise a transmembrane domain and an intracellular domain of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 96-267 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 96-267 of the sequence SEQ ID NO:1247. In some embodiments, the fusion protein may comprise the sequence of SEQ ID NO:1251.
[0690] In some embodiments, the fusion protein may comprise the Sushi domain, transmembrane domain, and intracellular domain of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 31-267 of IL-15Rα. In some embodiments, the fusion protein may comprise amino acids 31-267 of the sequence SEQ ID NO:1247. In some embodiments, the fusion protein may comprise the sequences of SEQ ID NO:1250 and SEQ ID NO:1251.
[0691] In some embodiments, the fusion protein further comprises an epitope tag. The epitope tag as described herein can be a peptide epitope tag or a protein epitope tag. Examples of peptide epitope tags include, but are not limited to, 6X His (also known as a His-tag or hexahistidine tag), FLAG (e.g., 3X FLAG), HA, Myc, and V5. Examples of protein epitope tags include, but are not limited to, green fluorescent protein (GFP), glutathione S-transferase (GST), β-galactosidase (β-GAL), luciferase, maltose-binding protein (MBP), red fluorescent protein (RFP), and vesicular stomatitis virus glycoprotein (VSV-G). In some embodiments, the fusion protein further comprises a FLAG tag. In some embodiments, the fusion protein further comprises a 3X FLAG tag. In some embodiments, the fusion protein further comprises the sequence of SEQ ID NO:1255.
[0692] Flag x3
[0693] DYKDDDDKDYKDDDDKDYKDDDDK(SEQ ID NO:1255)
[0694] In some embodiments, when the fusion protein is expressed in T cells, it is expressed on the cell surface. In some embodiments, when the fusion protein is expressed in T cells, it is secreted.
[0695] In some aspects, cells expressing the TFP, IL-15 peptide or fragments thereof, IL-15Rα peptide or fragments thereof, and / or fusion proteins comprising the IL-15 peptide and IL-15Rα peptide described herein may further express another agent that enhances the activity of modified T cells expressing TFP. For example, in one embodiment, the agent that enhances the activity of modified T cells may be a PD-1 peptide. In these embodiments, the PD-1 peptide may be operatively linked via its C-terminus to the N-terminus of the intracellular domain of the co-stimulatory peptide. For example, in another embodiment, the agent that enhances the activity of modified T cells expressing TFP may be an anti-PD-1 antibody or an antigen-binding fragment thereof. In this embodiment, the anti-PD-1 antibody or its antigen-binding fragment may be operatively linked via its C-terminus to the N-terminus of the intracellular domain of the co-stimulatory peptide. In some embodiments, the PD-1 peptide or anti-PD-1 antibody is linked via the transmembrane domain of PD-1 to the intracellular domain of the co-stimulatory peptide. In some embodiments, the co-stimulatory peptide is selected from the group consisting of: OX40, CD2, CD27, CDS, ICAM-1, ICOS (CD278), 4-1BB (CD137), GITR, CD28, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, CD226, FcγRI, FcγRII, and FcγRIII. In some embodiments, the co-stimulatory peptide is CD28.
[0696] In some aspects, the agent that enhances the activity of modified T cells expressing TFP may be linked to an IL-15Rα peptide or a fragment thereof. For example, the agent may be an agent that inhibits an inhibitory molecule that reduces the ability of T cells expressing TFP to elicit an immune effector response. In some embodiments, the agent that inhibits the inhibitory molecule comprises a first polypeptide (e.g., an inhibitory molecule) that associates with a second polypeptide (e.g., an intracellular signaling domain described herein) that provides a positive signal to the cell. In one embodiment, the agent may comprise: a first polypeptide, such as an inhibitory molecule (e.g., PD-1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4, and TIGIT, or a fragment of any of these (e.g., at least a portion of the extracellular domain of any of these)); and a second polypeptide, which is an intracellular signaling domain as described herein (e.g., an intracellular signaling domain comprising a co-stimulatory domain (e.g., 4-1BB, CD27, or CD28 as described herein) and / or a primary signaling domain (e.g., IL-15Rα as described herein). In some embodiments, the agent may be PD-1 or a fragment thereof. For example, the agent may comprise the extracellular domain of PD-1. In some embodiments, the agent may comprise both the extracellular domain and the transmembrane domain of PD-1. In some embodiments, the agent may also comprise CD28 or a fragment thereof. In some embodiments, the agent may comprise the intracellular domain of CD28. In some embodiments, the agent may comprise a fusion protein comprising a PD-1 extracellular domain and a transmembrane domain linked to an intracellular domain of CD28, wherein the intracellular domain of CD28 is linked to an intracellular domain of IL-15Rα. In some embodiments, the intracellular domain of CD28 is linked to an intracellular domain of IL-15Rα.
[0697] In some embodiments, PD-1 or a fragment thereof may comprise any of the sequences or fragments thereof listed in Table 10. In some embodiments, PD-1 or a fragment thereof may comprise the sequence of SEQ ID NO:1256. In some embodiments, PD-1 or a fragment thereof may comprise the sequence of SEQ ID NO:1257. In some embodiments, PD-1 or a fragment thereof may comprise the sequence of SEQ ID NO:1258. In some embodiments, PD-1 or a fragment thereof may comprise the sequence of SEQ ID NO:1259. In some embodiments, the transmembrane domain of PD-1 may comprise the sequence of SEQ ID NO:1239. In some embodiments, the intracellular domain of CD28 may comprise the sequence of SEQ ID NO:1260. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of IL-15Rα. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of the sequence of SEQ ID NO:1247. In some embodiments, the fusion protein comprises the sequence of SEQ ID NO:1248.
[0698] In some aspects, the agent that enhances the activity of modified T cells expressing TFP may be linked to a fusion protein comprising an IL-15 peptide and an IL-15Rα peptide. In some embodiments, the agent may be PD-1 or a fragment thereof. For example, the agent may comprise an extracellular domain of PD-1. In some embodiments, the agent may comprise an extracellular domain and a transmembrane domain of PD-1. In some embodiments, the agent may also comprise CD28 or a fragment thereof. In some embodiments, the agent may comprise an intracellular domain of CD28. In some embodiments, the agent may comprise a fusion protein comprising an extracellular domain and a transmembrane domain of PD-1 linked to an intracellular domain of CD28, the intracellular domain of CD28 being linked to a fusion protein comprising an IL-15 peptide and an IL-15Rα peptide. In some embodiments, the intracellular domain of CD28 is linked to an intracellular domain of IL-15Rα. In some embodiments, the intracellular domain of IL-15Rα is linked to the IL-15 peptide via a linker described herein. In some embodiments, the linker comprises a cleavage site. The cleavage site can be a self-cleaving peptide, such as a T2A, P2A, E2A, or F2A cleavage site. In some embodiments, the cleavage site may contain the sequence of SEQ ID NO:1261 (P2A: GSGATNFSLLKQAGDVEENPG).
[0699] In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising any sequence or fragment thereof listed in Table 10. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the sequence of SEQ ID NO:1256. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the sequence of SEQ ID NO:1257. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the sequence of SEQ ID NO:1258. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising the sequence of SEQ ID NO:1259. In some embodiments, the fusion protein may comprise PD-1 or a fragment thereof comprising a transmembrane domain of PD-1, the transmembrane domain comprising the sequence of SEQ ID NO:1239. In some embodiments, the fusion protein may comprise CD28, or a fragment thereof comprising an intracellular domain of CD28, the intracellular domain comprising the sequence of SEQ ID NO:1260. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of IL-15Rα. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of the sequence SEQ ID NO:1247. In some embodiments, the fusion protein comprises the sequence SEQ ID NO:1248. In some embodiments, the IL-15 polypeptide comprises an IL-15 signal peptide. In some embodiments, the IL-15 polypeptide comprises amino acids 1-29 of IL-15. In some embodiments, the IL-15 polypeptide comprises amino acids 1-29 of the sequence SEQ ID NO:1245. In some embodiments, the IL-15 polypeptide comprises the sequence SEQ ID NO:1246. In some embodiments, the IL-15 polypeptide comprises amino acids 30-162 of IL-15. In some embodiments, the IL-15 polypeptide comprises amino acids 30-162 of the sequence SEQ ID NO:1245. In some implementations, the IL-15 peptide comprises the sequence of SEQ ID NO:1242.
[0700] In some implementations, this document discloses polypeptides encoded by any of the recombinant nucleic acid molecules described herein.
[0701] Recombinant nucleic acids encoding IL-15 and / or IL-15Rα
[0702] This document discloses recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding the T-cell receptor (TCR) fusion protein (TFP) described herein and a second nucleic acid sequence encoding an interleukin-15 (IL-15) polypeptide or a fragment thereof. This document also discloses recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding the T-cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding an interleukin-15 receptor α (IL-15Rα) polypeptide or a fragment thereof. This document further discloses recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding the T-cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding a fusion protein comprising an IL-15 polypeptide or a fragment thereof linked to an IL-15Rα polypeptide or a fragment thereof. This document further discloses recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding the T-cell receptor (TCR) fusion protein (TFP) and a second nucleic acid sequence encoding a fusion protein comprising an IL-15Rα polypeptide or a fragment thereof linked to PD-1 or a fragment thereof and / or CD28 or a fragment thereof.
[0703] This document discloses recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof. Any recombinant nucleic acid molecule comprising the nucleic acid sequence encoding the TFP described herein may also comprise a second nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof. This document further discloses recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding an IL-15Rα polypeptide or a fragment thereof. Any recombinant nucleic acid molecule comprising the nucleic acid sequence encoding the TFP described herein may also comprise a second nucleic acid sequence encoding an IL-15Rα polypeptide or a fragment thereof.
[0704] In some embodiments, this document discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof, wherein the first and second nucleic acid sequences are contained in two separate nucleic acid molecules. In some embodiments, the first and second nucleic acid sequences are operatively linked by a first adapter. In some embodiments, this document further discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding an IL-15Rα polypeptide or a fragment thereof, wherein the first and second nucleic acid sequences are contained in two separate nucleic acid molecules. In some embodiments, this document further discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding an IL-15Rα polypeptide or a fragment thereof, wherein the first and second nucleic acid sequences are contained in a single nucleic acid molecule. In some embodiments, the first and second nucleic acid sequences are operatively linked by a first adapter. For example, the first adapter may be a cleavable adapter. In some embodiments, the first adapter may comprise a protease cleavage site. This cleavage site may be a self-cleaving peptide, such as a 2A cleavage site like T2A, P2A, E2A, or F2A. In some embodiments, the protease cleavage site is a T2A cleavage site. When expressed, this cleavage site may comprise the sequence of SEQ ID NO:1238. In some embodiments, when the first adapter is expressed, it comprises the sequence of SEQ ID NO:1238.
[0705] In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide or a fragment thereof may include a sequence encoding the IL-15 signal peptide. In some embodiments, when the IL-15 signal peptide is expressed, the IL-15 signal peptide comprises amino acids 1-29 of SEQ ID NO:1245. In some embodiments, when the IL-15 signal peptide is expressed, the IL-15 signal peptide comprises the sequence of SEQ ID NO:1246. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide or a fragment thereof may include a sequence encoding amino acids 30-162 of SEQ ID NO:1245. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide or a fragment thereof may include a sequence encoding any of the sequences listed in Table 11 or a fragment thereof. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide or a fragment thereof may include a sequence encoding the sequence of SEQ ID NO:1242. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide or a fragment thereof may include a sequence encoding amino acids 1-162 of SEQ ID NO:1245. In some embodiments, the nucleic acid sequence encoding the IL-15 polypeptide or a fragment thereof may comprise sequences encoding SEQ ID NO:1246 and SEQ ID NO:1242. In some embodiments, the IL-15 polypeptide or a fragment thereof is secreted when expressed in T cells. In some embodiments, when the IL-15 polypeptide is expressed, the IL-15 polypeptide comprises the sequence SEQ ID NO:1242.
[0706] In some embodiments, this document discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof and an IL-15R subunit or a fragment thereof, wherein the first and second nucleic acid sequences are contained in two separate nucleic acid molecules. In some embodiments, this document discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof and an IL-15R subunit or a fragment thereof, wherein the first and second nucleic acid sequences are contained in a single nucleic acid molecule. In some embodiments, the first and second nucleic acid sequences are operatively linked by a first adapter described herein. The IL-15R subunit may be IL-15R alpha (IL-15Rα), IL-2Rβ (IL-2β), or IL-2Rγ / common γ chain (IL-2Rγ / γc). In some embodiments, the IL-15R subunit is IL-15R alpha (IL-15Rα). In some embodiments, IL-15 and the IL-15R subunit are operatively linked by a second adapter. In some embodiments, IL-15 and IL-15Rα are operatively linked via a second connector. In some embodiments, the second connector is not a cleavable connector. For example, the second connector may contain a sequence containing (G4S)n, where G is glycine, S is serine, and n is an integer from 1 to 10. In some embodiments, n is an integer from 1 to 4. In some embodiments, n is 3. In some embodiments, the second connector contains the sequence of SEQ ID NO: 1243.
[0707] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding an intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include amino acid sequences 229-267 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding SEQ ID NO:1248.
[0708] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding the IL-15Rα Sushi domain. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include amino acid sequences 31-95 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding the sequence of SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding the sequence of SEQ ID NO:1250.
[0709] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include sequences encoding both the transmembrane domain and the intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include the sequence of amino acids 96-267 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include the sequence encoding SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include the sequence encoding SEQ ID NO:1251.
[0710] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include sequences encoding the Sushi domain, transmembrane domain, and intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include the sequence encoding amino acids 31-267 of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include the sequence encoding SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include sequences encoding SEQ ID NO:1250 and SEQ ID NO:1251.
[0711] In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding soluble IL-15Rα (sIL-15Rα). In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include amino acid sequences 21-205 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the IL-15Rα polypeptide or a fragment thereof may include a sequence encoding the sequence of SEQ ID NO:1249.
[0712] In some embodiments, this document discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding a fusion protein comprising an IL-15 polypeptide linked to an IL-15Rα subunit, wherein the first and second nucleic acid sequences are contained in two separate nucleic acid molecules. In some embodiments, this document discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding a fusion protein comprising an IL-15 polypeptide linked to an IL-15Rα subunit, wherein the first and second nucleic acid sequences are contained in a single nucleic acid molecule. In some embodiments, the first and second nucleic acid sequences are operatively linked via a first adapter described herein. For example, the IL-15 polypeptide may be linked to the N-terminus of the IL-15Rα subunit. For example, the IL-15 polypeptide may be linked to the C-terminus of the IL-15Rα subunit.
[0713] In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence of amino acids 1-29 encoding IL-15. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence of amino acids 1-29 encoding SEQ ID NO:1245. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence encoding the sequence of SEQ ID NO:1246. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence of amino acids 30-162 encoding IL-15. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence encoding amino acids 30-162 encoding SEQ ID NO:1245. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence encoding any sequence or fragment thereof listed in Table 11. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence encoding the sequence of SEQ ID NO:1242. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence of amino acids 1-162 encoding IL-15. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequence of amino acids 1-162 encoding SEQ ID NO:1245. In some embodiments, the nucleic acid sequence encoding the fusion protein may comprise the sequences encoding SEQ ID NO:1246 and the sequences encoding SEQ ID NO:1242.
[0714] In some embodiments, the nucleic acid sequence encoding the fusion protein may include a sequence encoding an intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may include amino acid sequences 229-267 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may include amino acid sequences 229-267 encoding SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the fusion protein may include a sequence encoding SEQ ID NO:1248.
[0715] In some embodiments, the nucleic acid sequence encoding the fusion protein may further include a sequence encoding the IL-15Rα Sushi domain. In some embodiments, the nucleic acid sequence encoding the fusion protein may include amino acid sequences 31-95 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may include amino acid sequences 31-95 encoding SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the fusion protein may include a sequence encoding the sequence of SEQ ID NO:1250.
[0716] In some embodiments, the nucleic acid sequence encoding the fusion protein may include sequences encoding a transmembrane domain and an intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may include amino acid sequences 96-267 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may include sequences encoding SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the fusion protein may include a sequence encoding SEQ ID NO:1251.
[0717] In some embodiments, the nucleic acid sequence encoding the fusion protein may include sequences encoding the Sushi domain, transmembrane domain, and intracellular domain of IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may include amino acid sequences 31-267 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may include sequences encoding SEQ ID NO:1247, amino acid sequences 31-267. In some embodiments, the nucleic acid sequence encoding the fusion protein may include sequences encoding SEQ ID NO:1250 and SEQ ID NO:1251.
[0718] In some embodiments, the nucleic acid sequence encoding the fusion protein may include a sequence encoding soluble IL-15Rα (sIL-15Rα). In some embodiments, the nucleic acid sequence encoding the fusion protein may include amino acid sequences 21-205 encoding IL-15Rα. In some embodiments, the nucleic acid sequence encoding the fusion protein may include amino acid sequences 21-205 encoding SEQ ID NO:1247. In some embodiments, the nucleic acid sequence encoding the fusion protein may include a sequence encoding SEQ ID NO:1249.
[0719] In some embodiments, the nucleic acid sequence encoding the fusion protein may further include a sequence encoding an epitope tag. The epitope tag as described herein may be a peptide epitope tag or a protein epitope tag. Examples of peptide epitope tags include, but are not limited to, 6X His (also known as a His-tag or hexahistidine tag), FLAG (e.g., 3X FLAG), HA, Myc, and V5. Examples of protein epitope tags include, but are not limited to, green fluorescent protein (GFP), glutathione S-transferase (GST), β-galactosidase (β-GAL), luciferase, maltose-binding protein (MBP), red fluorescent protein (RFP), and vesicular stomatitis virus glycoprotein (VSV-G). In some embodiments, the nucleic acid sequence encoding the fusion protein further includes a sequence encoding a FLAG tag. In some embodiments, the nucleic acid sequence encoding the fusion protein further includes a sequence encoding a 3X FLAG tag. In some embodiments, the nucleic acid sequence encoding the fusion protein further includes a sequence encoding the sequence of SEQ ID NO:1255.
[0720] In some embodiments, when the fusion protein is expressed in T cells by the recombinant nucleic acid molecules described herein, the fusion protein is expressed on the cell surface. In some embodiments, when the fusion protein is expressed in T cells by the recombinant nucleic acid molecules described herein, the fusion protein is secreted.
[0721] In some embodiments, this document discloses recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding the TFP described herein, a second nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof, and a third nucleic acid sequence encoding an agent that enhances the activity of modified T cells expressing TFP. In some embodiments, the third nucleic acid sequence is contained in a separate nucleic acid sequence. In some embodiments, the third nucleic acid sequence is contained in the same nucleic acid molecule as the first or second nucleic acid sequence, or both the first and second nucleic acid sequences. For example, in one embodiment, the agent that enhances the activity of modified T cells may be a PD-1 polypeptide. In these embodiments, the PD-1 polypeptide may be operatively linked via its C-terminus to the N-terminus of the intracellular domain of a co-stimulatory polypeptide. For example, in another embodiment, the agent that enhances the activity of modified T cells may be an anti-PD-1 antibody or an antigen-binding fragment thereof. In this embodiment, the anti-PD-1 antibody or an antigen-binding fragment thereof may be operatively linked via its C-terminus to the N-terminus of the intracellular domain of a co-stimulatory polypeptide. In some embodiments, the PD-1 peptide or anti-PD-1 antibody is linked to the intracellular domain of the co-stimulatory peptide via the transmembrane domain of PD-1. In some embodiments, the co-stimulatory peptide is selected from the group consisting of: OX40, CD2, CD27, CDS, ICAM-1, ICOS (CD278), 4-1BB (CD137), GITR, CD28, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, CD226, FcγRI, FcγRII, and FcγRIII.
[0722] In some embodiments, this document discloses recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding the TFP described herein and a second nucleic acid sequence encoding an IL-15Rα polypeptide or a fragment thereof, wherein the first and second nucleic acid sequences are operatively linked via a first adapter described herein, and wherein the second nucleic acid sequence further encodes an agent that enhances the activity of modified T cells expressing TFP. For example, the agent may be an agent that inhibits an inhibitory molecule that reduces the ability of T cells expressing TFP to elicit an immune effector response. In some embodiments, the agent that inhibits the inhibitory molecule comprises a first polypeptide (e.g., an inhibitory molecule) that associates with a second polypeptide (e.g., an intracellular signaling domain described herein) that provides a positive signal to the cell. In one embodiment, the agent may comprise: a first polypeptide, such as an inhibitory molecule (e.g., PD-1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4, and TIGIT, or fragments of any of these (e.g., at least a portion of the extracellular domain of any of these)); and a second polypeptide, which is an intracellular signaling domain as described herein (e.g., an intracellular signaling domain comprising a co-stimulatory domain (e.g., 4-1BB, CD27, or CD28 as described herein) and / or a primary signaling domain (e.g., IL-15Rα as described herein). In some embodiments, the second nucleic acid sequence further comprises a sequence encoding PD-1 or a fragment thereof. In some embodiments, the second nucleic acid sequence comprises a sequence encoding the extracellular domain of PD-1. In some embodiments, the second nucleic acid sequence comprises sequences encoding both the extracellular domain and the transmembrane domain of PD-1. In some embodiments, the second nucleic acid sequence may also comprise a sequence encoding CD28 or a fragment thereof. In some embodiments, the second nucleic acid sequence comprises a sequence encoding the intracellular domain of CD28. In some embodiments, the second nucleic acid sequence comprises a sequence encoding a fusion protein comprising a PD-1 extracellular domain and a transmembrane domain linked to a CD28 intracellular domain, the CD28 intracellular domain being linked to IL-15Rα. In some embodiments, the CD28 intracellular domain is linked to the intracellular domain of IL-15Rα. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of IL-15Rα. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of SEQ ID NO:1247. In some embodiments, the intracellular domain of IL-15Rα comprises the sequence of SEQ ID NO:1248.
[0723] In some embodiments, the second nucleic acid sequence encoding PD-1 or a fragment thereof may comprise a nucleic acid sequence encoding any of the sequences listed in Table 10 or a fragment thereof. In some embodiments, the second nucleic acid sequence encoding PD-1 or a fragment thereof may comprise a nucleic acid sequence encoding the sequence SEQ ID NO:1256. In some embodiments, the second nucleic acid sequence encoding PD-1 or a fragment thereof may comprise a nucleic acid sequence encoding the sequence SEQ ID NO:1257. In some embodiments, the second nucleic acid sequence encoding PD-1 or a fragment thereof may comprise a nucleic acid sequence encoding the sequence SEQ ID NO:1258. In some embodiments, the second nucleic acid sequence encoding PD-1 or a fragment thereof may comprise a nucleic acid sequence encoding the sequence SEQ ID NO:1259. In some embodiments, the nucleic acid sequence encoding the transmembrane domain of PD-1 may comprise a nucleic acid sequence encoding the sequence SEQ ID NO:1239. In some embodiments, the nucleic acid sequence encoding the intracellular domain of CD28 may comprise a nucleic acid sequence encoding the sequence SEQ ID NO:1260. In some embodiments, the intracellular domain of IL-15Rα comprises amino acids 229-267 of IL-15Rα. In some embodiments, the nucleic acid encoding the intracellular domain of IL-15Rα comprises nucleic acid encoding amino acids 229-267 of SEQ ID NO:1247. In some embodiments, the nucleic acid encoding the intracellular domain of IL-15Rα comprises nucleic acid encoding the sequence of SEQ ID NO:1248.
[0724] In some embodiments, this document discloses a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding the TFP described herein, a second nucleic acid sequence encoding an IL-15Rα polypeptide or a fragment thereof and an agent capable of enhancing the activity of modified T cells expressing the TFP described herein, and a third nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof. In some embodiments, the first and second nucleic acid sequences are contained in two separate nucleic acid sequences. In some embodiments, the first and second nucleic acid sequences are contained in a single nucleic acid sequence. In some embodiments, the first and second nucleic acid sequences are operatively linked via a first adapter described herein. In some embodiments, the third nucleic acid sequence is contained in a separate nucleic acid sequence. In some embodiments, the third nucleic acid sequence is contained in the same nucleic acid molecule as the first or second nucleic acid sequence, or both the first and second nucleic acid sequences. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may contain the sequence of amino acids 1-29 encoding IL-15. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may contain the sequence of amino acids 1-29 encoding SEQ ID NO:1245. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may comprise a sequence encoding the sequence of SEQ ID NO:1246. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may comprise a sequence encoding amino acids 30-162 of IL-15. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may comprise a sequence encoding amino acids 30-162 of SEQ ID NO:1245. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may comprise a sequence encoding any sequence or fragment thereof listed in Table 11. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may comprise a sequence encoding the sequence of SEQ ID NO:1242. In some embodiments, the IL-15 polypeptide is secreted when expressed in T cells. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may comprise a sequence encoding amino acids 1-162 of IL-15. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may comprise the sequence encoding amino acids 1-162 of SEQ ID NO:1245. In some embodiments, the third nucleic acid sequence encoding the IL-15 polypeptide may comprise the sequences encoding SEQ ID NO:1246 and SEQ ID NO:1242.
[0725] In some embodiments, this document discloses recombinant nucleic acid molecules comprising a nucleic acid sequence encoding the TFP described herein, a nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof, a nucleic acid sequence encoding a CD28 polypeptide or a fragment thereof, a nucleic acid sequence encoding IL-15Rα or a fragment thereof described herein, and a nucleic acid sequence encoding an IL-15 polypeptide or a fragment thereof described herein. In some embodiments, the nucleic acid sequence encoding the TFP may comprise a sequence encoding a CSF2RA signal peptide. In some embodiments, the nucleic acid sequence encoding the TFP may comprise a nucleic acid sequence encoding the sequence of SEQ ID NO: 1234. In some embodiments, the nucleic acid sequence encoding the TFP may comprise a sequence encoding CD3ε. In some embodiments, the nucleic acid sequence encoding the TFP may comprise a nucleic acid sequence encoding the sequence of SEQ ID NO: 1235. In some embodiments, the nucleic acid sequence encoding the PD-1 polypeptide or a fragment thereof comprises a sequence encoding a PD-1 signal peptide. In some embodiments, the nucleic acid sequence encoding the PD-1 polypeptide or a fragment thereof comprises a nucleic acid sequence encoding any of the sequences listed in Table 10 or a fragment thereof. In some embodiments, the nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof comprises a nucleic acid sequence encoding the sequence of SEQ ID NO:1256. In some embodiments, the nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof comprises a sequence encoding a PD-1 N-loop. In some embodiments, the nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof comprises a nucleic acid sequence encoding the sequence of SEQ ID NO:1257. In some embodiments, the nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof comprises a sequence encoding PD-1 IgV. In some embodiments, the nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof comprises a nucleic acid sequence encoding the sequence of SEQ ID NO:1258. In some embodiments, the nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof comprises a sequence encoding a PD-1 stem. In some embodiments, the nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof comprises a nucleic acid sequence encoding the sequence of SEQ ID NO:1259. In some embodiments, the nucleic acid sequence encoding a PD-1 polypeptide or a fragment thereof comprises a sequence encoding a PD-1 transmembrane domain. In some embodiments, the nucleic acid sequence encoding the PD-1 polypeptide or a fragment thereof comprises a nucleic acid sequence encoding the sequence of SEQ ID NO:1239. In some embodiments, the nucleic acid sequence encoding the CD28 polypeptide ...
Claims
1. A recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein, the fusion protein being a TFP, wherein the TFP comprises: (a) a TCR subunit comprising: (i) a TCR extracellular domain, (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain, and (b) an antigen binding domain that specifically binds CD70; and wherein the TCR subunit is operatively linked to the antigen binding domain; and wherein the antigen binding domain that specifically binds CD70 is a single chain variable fragment (scFv) comprising: (i) a heavy chain variable (VH) domain comprising a heavy chain complementarity determining region 1 (CDRH1) of the sequence of SEQ ID NO: 853, a CDRH2 of the sequence of SEQ ID NO: 906, and a CDRH3 of the sequence of SEQ ID NO: 959, and (ii) a light chain variable (VL) domain comprising a light chain complementarity determining region 1 (CDRL1) of the sequence of SEQ ID NO: 1065, a CDRL2 of the sequence of SEQ ID NO: 1118, and a CDRL3 of the sequence of SEQ ID NO: 1171.
2. The recombinant nucleic acid molecule of claim 1, wherein the TFP functionally interacts with an endogenous TCR complex when the TFP is expressed in a T cell.
3. The recombinant nucleic acid molecule of claim 1, wherein the TCR intracellular domain comprises a stimulatory domain from an intracellular signaling domain of CD3 gamma, CD3 delta, or CD3 epsilon.
4. The recombinant nucleic acid molecule of claim 1, wherein the antigen binding domain is linked to the TCR extracellular domain by a linker sequence.
5. The recombinant nucleic acid molecule of claim 4, wherein the linker sequence is 120 amino acids in length or less.
6. The recombinant nucleic acid molecule of claim 4, wherein the linker sequence comprises (G4S) n wherein G is glycine, S is serine, and n is an integer from 1 to 10.
7. The recombinant nucleic acid molecule of claim 6, wherein n is an integer from 1 to 4.
8. The recombinant nucleic acid molecule of claim 1, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from the same TCR subunit.
9. The recombinant nucleic acid molecule of claim 8, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from TCR alpha.
10. The recombinant nucleic acid molecule of claim 8, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from TCR beta.
11. The recombinant nucleic acid molecule of claim 8, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from TCR gamma.
12. The recombinant nucleic acid molecule of claim 8, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from TCR delta.
13. The recombinant nucleic acid molecule of claim 8, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 epsilon.
14. The recombinant nucleic acid molecule of claim 8, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 delta.
15. The recombinant nucleic acid molecule of claim 8, wherein at least two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 gamma.
16. The recombinant nucleic acid molecule of claim 8, wherein all three of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from the same TCR subunit.
17. The recombinant nucleic acid molecule of claim 16, wherein the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 epsilon.
18. The recombinant nucleic acid molecule of claim 16, wherein the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 delta.
19. The recombinant nucleic acid molecule of claim 16, wherein the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 gamma.
20. The recombinant nucleic acid molecule of claim 16, wherein the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain comprise a constant domain of TCR alpha.
21. The recombinant nucleic acid molecule of claim 20, wherein the constant domain of TCR alpha is murine.
22. The recombinant nucleic acid molecule of claim 16, wherein the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain comprise a constant domain of TCR beta.
23. The recombinant nucleic acid molecule of claim 22, wherein the constant domain of TCR beta is murine.
24. The recombinant nucleic acid molecule of claim 16, wherein the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain comprise a constant domain of TCR gamma.
25. The recombinant nucleic acid molecule of claim 16, wherein the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain comprise a constant domain of TCR delta.
26. The recombinant nucleic acid molecule of claim 1, wherein the antigen binding domain specifically binds to an epitope within the amino acid sequence HRDGIYMVHIQVTLAICSSTTAS (SEQ ID NO: 1230).
27. The recombinant nucleic acid molecule of claim 26, wherein the antigen binding domain specifically binds to a second epitope within the amino acid sequence ASRHHPTTLAVGICSPASRSISL (SEQ ID NO: 1231).
28. The recombinant nucleic acid molecule of claim 1, wherein the scFv comprises a VH domain having at least 90% sequence identity to SEQ ID NO: 800, provided that the VH domain of the scFv comprises CDRH1 of SEQ ID NO: 853, CDRH2 of SEQ ID NO: 906, and CDRH3 of SEQ ID NO:
959.
29. The recombinant nucleic acid molecule of claim 28, wherein the scFv comprises a VH domain of the sequence of SEQ ID NO:
800.
30. The recombinant nucleic acid molecule of claim 1, wherein the scFv comprises a VL domain having at least 90% sequence identity to SEQ ID NO: 1012, provided that the VL domain of the scFv comprises CDRL1 of SEQ ID NO: 1065, CDRL2 of SEQ ID NO: 1118, and CDRL3 of SEQ ID NO: 1171.
31. The recombinant nucleic acid molecule of claim 30, wherein the scFv comprises a VL domain of the sequence of SEQ ID NO: 1012.
32. The recombinant nucleic acid molecule of claim 1, wherein the scFv comprises a VH domain having at least 90% sequence identity to SEQ ID NO: 800 and a VL domain having at least 90% sequence identity to SEQ ID NO: 1012, provided that the VH domain of the scFv comprises CDRH1 of SEQ ID NO: 853, CDRH2 of SEQ ID NO: 906, and CDRH3 of SEQ ID NO: 959, and the VL domain of the scFv comprises CDRL1 of SEQ ID NO: 1065, CDRL2 of SEQ ID NO: 1118, and CDRL3 of SEQ ID NO: 1171.
33. The recombinant nucleic acid molecule of claim 32, wherein the scFv comprises the VH domain of the sequence of SEQ ID NO: 800 and the VL domain of the sequence of SEQ ID NO: 1012.
34. The recombinant nucleic acid molecule of claim 1, wherein the scFv comprises the linker sequence of SEQ ID NO:
782.
35. The recombinant nucleic acid molecule of claim 1, wherein T cells expressing the TFP have increased fratricide relative to TFPs with different antigen binding domains.
36. The recombinant nucleic acid molecule of claim 1, wherein T cells expressing the TFP have decreased fratricide relative to TFPs with different antigen binding domains.
37. The recombinant nucleic acid molecule of claim 1, encoding the amino acid sequence of SEQ ID NO: 1236.
38. The recombinant nucleic acid molecule of claim 1, wherein the recombinant nucleic acid molecule is selected from the group consisting of DNA and RNA.
39. The recombinant nucleic acid molecule of claim 38, wherein the recombinant nucleic acid molecule is mRNA.
40. The recombinant nucleic acid molecule of claim 38, wherein the recombinant nucleic acid molecule is a circular RNA.
41. The recombinant nucleic acid molecule of claim 1, wherein the recombinant nucleic acid molecule comprises a nucleotide analog.
42. The recombinant nucleic acid molecule of claim 41, wherein the nucleotide analog is selected from the group consisting of 2'-0-methyl, 2'-0-methoxyethyl (2'-0-MOE), 2'-0- aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0- dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), 2'-0-N-methylacetamido (2'-0-NMA) modified nucleic acids, locked nucleic acids (LNAs), ethylene nucleic acids (ENAs), peptide nucleic acids (PNAs), 1',5'-hexitol nucleic acids (HNAs), morpholino nucleotides, methylphosphonate nucleotides, thiolphosphonate nucleotides, and 2'-fluoro N3-P5'- phosphoramidites.
43. The recombinant nucleic acid molecule of claim 1, further comprising a promoter.
44. The recombinant nucleic acid molecule of claim 1, wherein the nucleic acid is in vitro a transcribed nucleic acid.
45. The recombinant nucleic acid molecule of claim 1, wherein the nucleic acid further comprises a sequence encoding a poly(A) tail.
46. The recombinant nucleic acid molecule of claim 1, wherein the nucleic acid further comprises a 3' UTR sequence.
47. A recombinant nucleic acid molecule comprising a sequence encoding an antigen binding domain that specifically binds CD70, wherein the antigen binding domain that specifically binds CD70 is a single chain variable fragment (scFv) comprising: (i) a heavy chain variable (VH) domain comprising a heavy chain complementarity determining region 1 (CDRH1) of the sequence of SEQ ID NO: 853, a CDRH2 of the sequence of SEQ ID NO: 906, and a CDRH3 of the sequence of SEQ ID NO: 959, and (ii) a light chain variable (VL) domain comprising a light chain complementarity determining region 1 (CDRL1) of the sequence of SEQ ID NO: 1065, a CDRL2 of the sequence of SEQ ID NO: 1118, and a CDRL3 of the sequence of SEQ ID NO: 1171.
48. The recombinant nucleic acid molecule of claim 47, wherein the antigen binding domain specifically binds to an epitope within the amino acid sequence HRDGIYMVHIQVTLAICSSTTAS (SEQ ID NO: 1230).
49. The recombinant nucleic acid molecule of claim 48, wherein the antibody or antibody fragment specifically binds to a second epitope within the amino acid sequence ASRHHPTTLAVGICSPASRSISL (SEQ ID NO: 1231).
50. The recombinant nucleic acid molecule of claim 47, wherein the scFv comprises a VH domain having at least 90% sequence identity to SEQ ID NO: 800, provided that the VH domain of the scFv comprises CDRH1 of SEQ ID NO: 853, CDRH2 of SEQ ID NO: 906, and CDRH3 of SEQ ID NO:
959.
51. The recombinant nucleic acid molecule of claim 47, wherein the scFv comprises a VL domain having at least 90% sequence identity to SEQ ID NO: 1012, provided that the VL domain of the scFv comprises CDRL1 of SEQ ID NO: 1065, CDRL2 of SEQ ID NO: 1118, and CDRL3 of SEQ ID NO: 1171.
52. The recombinant nucleic acid molecule of claim 47, wherein the scFv comprises a VH domain having at least 90% sequence identity to SEQ ID NO: 800 and a VL domain having at least 90% sequence identity to SEQ ID NO: 1012, provided that the VH domain of the scFv comprises CDRH1 of SEQ ID NO: 853, CDRH2 of SEQ ID NO: 906, and CDRH3 of SEQ ID NO: 959, and the VL domain of the scFv comprises CDRL1 of SEQ ID NO: 1065, CDRL2 of SEQ ID NO: 1118, and CDRL3 of SEQ ID NO: 1171.
53. The recombinant nucleic acid molecule of claim 47, wherein the scFv comprises a linker sequence of SEQ ID NO:
782.
54. The recombinant nucleic acid molecule of claim 47, wherein the recombinant nucleic acid molecule further comprises a sequence encoding a TCR constant domain.
55. The recombinant nucleic acid molecule of claim 54, wherein the antibody or antibody fragment is operably linked to the sequence encoding a TCR constant domain, thereby forming a TFP.
56. The recombinant nucleic acid molecule of claim 54, wherein the TCR constant domain is a TCR alpha constant domain, a TCR beta constant domain, a TCR alpha constant domain and a TCR beta constant domain, a TCR gamma constant domain, a TCR delta constant domain, or a TCR gamma constant domain and a TCR delta constant domain.
57. The recombinant nucleic acid molecule of claim 47, further comprising a leader sequence.
58. A polypeptide encoded by the recombinant nucleic acid molecule of any one of claims 1-57.
59. A vector comprising the recombinant nucleic acid molecule of any one of claims 1-46.
60. A vector comprising the recombinant nucleic acid molecule of any one of claims 47-57.
61. The vector of claim 59, further comprising a sequence encoding an siRNA, shRNA, or miRNA for reducing endogenous levels of CD70.
62. The vector of claim 59, further comprising a sequence encoding an inhibitory molecule comprising a first polypeptide that constitutes an inhibitory molecule associated with a second polypeptide comprising a positive signal from an intracellular signaling domain.
63. The vector of claim 59, further comprising a sequence encoding a TCR constant domain.
64. The vector of claim 63, wherein the TCR constant domain is a TCR a constant domain, a TCR b constant domain, a TCR a constant domain and a TCR b constant domain, a TCR g constant domain, a TCR d constant domain, or a TCR g constant domain and a TCR d constant domain.
65. The vector of claim 60, wherein the vector is selected from the group consisting of a DNA, an RNA, a plasmid, a lentivirus vector, an adenovirus vector, a Rous sarcoma virus (RSV) vector, or a retrovirus vector.
66. The vector of claim 60, further comprising a promoter.
67. The vector of claim 60, wherein the vector is in vitro a transcribed vector.
68. The vector of claim 60, wherein the nucleic acid sequence in the vector further comprises a poly(A) tail.
69. The vector of claim 60, wherein the nucleic acid sequence in the vector further comprises a 3’ UTR.
70. A cell comprising the recombinant nucleic acid molecule of any one of claims 1-57, the polypeptide of claim 58, or the vector of any one of claims 59-69, wherein the cell is a T cell.
71. A cell comprising a recombinant nucleic acid molecule comprising a sequence encoding a T cell receptor (TCR) fusion protein, the fusion protein being a TFP, wherein the TFP comprises: (a) a TCR subunit comprising: (i) a TCR extracellular domain, (ii) a TCR transmembrane domain, (iii) a TCR intracellular domain, and (b) an antigen binding domain that specifically binds CD70; and wherein the TCR subunit is operably linked to the antigen binding domain, wherein the antigen binding domain that specifically binds CD70 is a single chain variable fragment (scFv) comprising: (i) a heavy chain variable (VH) domain comprising a heavy chain complementarity determining region 1 (CDRH1) of the sequence of SEQ ID NO: 853, a CDRH2 of the sequence of SEQ ID NO: 906, and a CDRH3 of the sequence of SEQ ID NO: 959, and (ii) a light chain variable (VL) domain comprising a light chain complementarity determining region 1 (CDRL1) of the sequence of SEQ ID NO: 1065, a CDRL2 of the sequence of SEQ ID NO: 1118, and a CDRL3 of the sequence of SEQ ID NO: 1171, wherein the cell is a T cell.
72. The cell of claim 71, wherein the T cell is a human T cell.
73. The cell of claim 71, wherein the T cell is a CD8+ or CD4+ T cell.
74. The cell of claim 71, wherein the T cell is a human αβ T cell.
75. The cell of claim 71, wherein the T cell is a human γδ T cell.
76. The cell of claim 71, further comprising a nucleic acid encoding an inhibitory molecule comprising a first polypeptide that associates with a second polypeptide comprising a positive signal from an intracellular signaling domain.
77. The cell of claim 76, wherein the inhibitory molecule comprises: a first polypeptide that comprises PD-1 and a second polypeptide comprising a costimulatory domain and a primary signaling domain.
78. The cell of claim 77, wherein the inhibitory molecule comprises the sequence of SEQ ID NO: 1239 or SEQ ID NO: 1244.
79. The cell of claim 76, wherein the sequence encoding the TFP and the nucleic acid encoding an inhibitory molecule are contained in a single nucleic acid molecule.
80. The cell of claim 76, wherein the sequence encoding the TFP and the nucleic acid encoding an inhibitory molecule are contained in two separate nucleic acid molecules.
81. The cell of claim 71, wherein the cell further comprises a second nucleic acid sequence encoding an interleukin-15 (IL-15) polypeptide.
82. The cell of claim 81, wherein the sequence encoding the TFP and the second nucleic acid sequence are contained in a single nucleic acid molecule.
83. The cell of claim 81, wherein the sequence encoding the TFP and the second nucleic acid sequence are contained in two separate nucleic acid molecules.
84. The cell of claim 81, wherein the sequence encoding the TFP and the second nucleic acid sequence are operably linked by a second linker.
85. The cell of claim 84, wherein the second linker comprises a protease cleavage site.
86. The cell of claim 85, wherein the protease cleavage site is a 2A cleavage site.
87. The cell of claim 86, wherein the 2A cleavage site is a T2A cleavage site.
88. The cell of claim 81, wherein the IL-15 polypeptide is secreted when expressed in the cell.
89. The cell of claim 81, wherein the IL-15 polypeptide comprises the sequence of SEQ ID NO: 1242.
90. The cell of claim 81, wherein the second nucleic acid sequence further encodes an IL-15 receptor (IL-15R) subunit.
91. The cell of claim 90, wherein the IL-15R subunit is IL-15R alpha (IL-15Ra).
92. The cell of claim 91, wherein IL-15 and IL-15Ra are operably linked by a third linker.
93. The cell of claim 92, wherein the third linker is not a cleavable linker.
94. The cell of claim 92, wherein the third linker comprises a sequence comprising (G4S) n wherein G is glycine, S is serine, and n is an integer from 1 to 10.
95. The cell of claim 94, wherein n is an integer from 1 to 4.
96. The cell of claim 95, wherein n is 3.
97. The cell of claim 92, wherein the third linker comprises the sequence of SEQ ID NO: 1243.
98. The cell of claim 91, wherein the second nucleic acid sequence encodes a fusion protein comprising the IL-15 polypeptide linked to the IL-15Ra subunit.
99. The cell of claim 98, wherein the IL-15 polypeptide is linked to the N-terminus of the IL-15Ra subunit.
100. The cell of claim 98, wherein the fusion protein comprises amino acids 30-162 of IL-15.
101. The cell of claim 98, wherein the fusion protein comprises amino acids 31-267 of IL-15Ra.
102. The cell of claim 98, wherein the fusion protein further comprises a sushi domain.
103. The cell of claim 98, wherein the fusion protein comprises the sequence of SEQ ID NO: 1244.
104. The cell of claim 98, wherein the fusion protein is expressed on the cell surface when expressed in the cell.
105. The cell of claim 98, wherein the fusion protein is secreted when expressed in the cell.
106. The cell of any one of claims 81-105, wherein the cell further comprises a third nucleic acid sequence encoding a PD-1 polypeptide.
107. The cell of claim 106, wherein the PD-1 polypeptide is operably linked via its C-terminus to the N-terminus of an intracellular domain of a costimulatory polypeptide.
108. The cell of claim 106, wherein the third nucleic acid sequence is comprised in the same nucleic acid molecule as the first and second nucleic acid sequences.
109. The cell of claim 107, wherein the PD-1 polypeptide is linked to the intracellular domain of the costimulatory polypeptide via the transmembrane domain of PD-1.
110. The cell of claim 107, wherein the costimulatory polypeptide is selected from OX40, CD2, CD27, CDS, ICAM-1, ICOS (CD278), 4-1BB (CD137), GITR, CD28, CD30, CD40, BAFFR, HVEM, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, CD226, FcyRI, FcyRII, and FcyRIII.
111. The cell of claim 107, wherein the intracellular domain of the costimulatory polypeptide comprises CD28.
112. The cell of claim 111, wherein the extracellular domain and the transmembrane domain of PD-1 are linked to the intracellular domain of CD28.
113. The cell of claim 111, wherein the cell comprises a fusion protein comprising the extracellular domain and the transmembrane domain of PD-1 linked to the intracellular domain of CD28, which is linked to IL-15Ra.
114. The cell of claim 113, wherein the fusion protein comprises the sequence of SEQ ID NO: 1254 or SEQ ID NO: 1262.
115. The cell of claim 71, wherein the cell further comprises a second nucleic acid sequence encoding an interleukin-15 receptor alpha (IL-15Ra) polypeptide.
116. The cell of claim 115, wherein the sequence encoding the TFP and the second nucleic acid sequence are comprised in a single nucleic acid molecule.
117. The cell of claim 115, wherein the sequence encoding the TFP and the second nucleic acid sequence are comprised in two separate nucleic acid molecules.
118. The cell of claim 115, wherein the sequence encoding the TFP and the second nucleic acid sequence are operably linked by a second linker.
119. The cell of claim 118, wherein the second linker comprises a protease cleavage site.
120. The cell of claim 119, wherein the protease cleavage site is a 2A cleavage site.
121. The cell of claim 120, wherein the 2A cleavage site is a T2A cleavage site.
122. The cell of claim 115, wherein the second nucleic acid sequence further encodes PD-1.
123. The cell of claim 122, wherein the second nucleic acid sequence encodes the extracellular domain of PD-1.
124. The cell of claim 123, wherein the second nucleic acid sequence encodes the extracellular and transmembrane domains of PD-1.
125. The cell of claim 123, wherein the second nucleic acid sequence further encodes CD28.
126. The cell of any of claim 123, wherein the second nucleic acid sequence encodes the intracellular domain of CD28.
127. The cell of claim 126, wherein the second nucleic acid sequence encodes a fusion protein comprising the PD-1 ectodomain and transmembrane domain linked to the CD28 endodomain linked to IL-15Ra.
128. The cell of claim 127, wherein the CD28 endodomain is linked to the endodomain of IL-15Ra.
129. The cell of claim 81, wherein the second nucleic acid sequence comprises the sequence of SEQ ID NO: 1245.
130. The cell of claim 115, wherein the recombinant nucleic acid molecule further comprises a third nucleic acid sequence encoding an interleukin-15 (IL-15) polypeptide.
131. The cell of claim 130, wherein the IL-15 polypeptide is secreted when the IL-15 polypeptide is expressed in the cell.
132. The cell of claim 131, wherein the cell secretes the IL-15 polypeptide in response to a T cell activator.
133. The cell of claim 130, wherein IL-15 signaling is increased in response to a T cell activator.
134. The cell of claim 133, wherein the T cell activator comprises an anti-CD3 antibody, an anti-CD28 antibody, a cytokine, an antigen that binds the antigen binding domain of the TFP, or any combination thereof.
135. The cell of claim 71, wherein the TFP functionally interacts with an endogenous TCR complex when the TFP is expressed in the T cell.
136. The cell of claim 71, wherein the cell comprises a functional disruption of an endogenous TCR.
137. The cell of claim 71, wherein the cell is an allogeneic T cell.
138. The cell of claim 71, wherein the cell comprises a functional disruption of an endogenous CD70 gene.
139. The cell of claim 71, wherein the cell comprises a functional disruption of an endogenous CIITA gene.
140. The cell of claim 71, wherein the cell further comprises an antisense siRNA, shRNA, or miRNA for reducing CD70 endogenous levels.
141. The cell of claim 71, wherein the cell further comprises an antisense siRNA, shRNA, or miRNA for reducing CIITA endogenous levels.
142. The cell of claim 71, wherein the cell further comprises a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.
143. The cell of claim 142, wherein the recombinant nucleic acid molecule comprises a sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.
144. The cell of claim 143, wherein the sequence encoding the TFP and the sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain are contained in the same operon.
145. The cell of claim 143, wherein the ER retention domain is encoded by any one of SEQ ID NOs: 756-779.
146. The cell of claim 143, wherein the sequence encoding the fusion protein further comprises a CD8a transmembrane domain between the anti-CD70 antibody domain and the ER retention domain.
147. The cell of claim 143, wherein the sequence encoding the fusion protein further comprises a sequence encoding a CD8a signal peptide located 5’ of the sequence encoding the anti-CD70 antibody domain.
148. The cell of claim 71, wherein the cell comprises cell surface expressed CD70 bound by an anti-CD70 antibody.
149. The cell of claim 71, wherein the cell further comprises a heterologous sequence encoding an inhibitory molecule comprising a first polypeptide that constitutes an inhibitory molecule associated with a second polypeptide comprising a positive signal from an intracellular signaling domain.
150. The cell of claim 71, wherein the cell further comprises a heterologous sequence encoding a TCR constant domain.
151. The cell of claim 150, wherein the TCR constant domain is a TCRa constant domain, a TCRb constant domain, a TCRa constant domain and a TCRb constant domain, a TCRy constant domain, a TCR5 constant domain, or a TCRy constant domain and a TCR5 constant domain.
152. The cell of claim 151, wherein the TCRa constant domain or the TCRb constant domain is murine.
153. The cell of claim 71, wherein the cell comprises a recombinant nucleic acid molecule encoding the amino acid sequence of SEQ ID NO: 1236.
154. A pharmaceutical composition comprising the cell of any one of claims 71-153 and a pharmaceutically acceptable carrier.
155. A method of producing the cell of claim 138, the method comprising: (i) disrupting an endogenous CD70 gene in a T cell, thereby producing the T cell containing a functional disruption of the endogenous CD70 gene; and (ii) transducing the T cell containing the functional disruption of the endogenous CD70 gene with the recombinant nucleic acid of any one of claims 1-57 or the vector of any one of claims 59 and 62-69.
156. The method of claim 155, wherein the disrupting comprises transducing the cell with a nuclease protein targeted to the endogenous CD70 gene or a nucleic acid sequence encoding the nuclease protein.
157. The method of claim 155, wherein the method further comprises disrupting an endogenous TCR.
158. A method of producing the cell of claim 138, the method comprising transducing a T cell comprising a disruption of an endogenous CD70 gene with the recombinant nucleic acid of any one of claims 1-57 or the vector of any one of claims 58 and 59-69.
159. The method of claim 158, wherein the cell further comprises a disruption of an endogenous TCR.
160. A method of producing the cell of claim 71, the method comprising: (i) transducing a T cell with the recombinant nucleic acid of any one of claims 1-57 or the vector of any one of claims 59 and 62-69; and (ii) contacting the T cell with an anti-CD70 antibody that binds to CD70 on the surface of the cell.
161. The method of claim 160, wherein the contacting occurs prior to the transducing.
162. The method of claim 161, wherein the contacting occurs up to 1 day prior to the transducing.
163. The method of claim 160, wherein the contacting occurs after the transducing.
164. The method of claim 163, wherein the contacting occurs up to 5 days after the transducing.
165. The method of claim 160, further comprising subculturing the cell in a medium that does not comprise the anti-CD70 antibody 4 or more days after the transducing.
166. The method of claim 165, wherein the subculturing comprises subculturing the cell in a medium that does not comprise the anti-CD70 antibody 7 or more days after the transducing.
167. Use of the pharmaceutical composition of claim 154 in the manufacture of a medicament for treating a cancer in a subject in need thereof, wherein the cancer is human acute myeloid leukemia or renal cell carcinoma.
168. Use of the cell of any one of claims 71-153 in the manufacture of a medicament for treating a cancer in a subject in need thereof, wherein the cancer is human acute myeloid leukemia or renal cell carcinoma.
169. The use of claim 167, further comprising administering to the subject an agent that increases the level of CD70 in the cancer cell.
170. The use of claim 169, wherein the agent that increases the level of CD70 is a hypomethylating agent.
171. The use of claim 170, wherein the hypomethylating agent is 5-azacitidine or decitabine.
172. The use of claim 167, wherein the subject is a human.
173. Use of producing the cell of claim 139, the use comprising: (i) disrupting an endogenous CIITA gene in a T cell, thereby producing a T cell containing a functional disruption of an endogenous CIITA gene; and (ii) transducing the T cell containing the functional disruption of the endogenous CIITA gene with the recombinant nucleic acid of any one of claims 1-57 or the vector of any one of claims 59 and 62-69. 174. The use of claim 173, wherein the disrupting comprises transducing the T cell with a nuclease protein or a nucleic acid sequence encoding the nuclease protein targeted to the endogenous CIITA gene.
175. The use of claim 173, wherein the use further comprises disrupting an endogenous TCR.
176. A use of producing the cell of claim 139, comprising transducing a T cell comprising a disruption of an endogenous CIITA gene with the recombinant nucleic acid of any one of claims 1-57 or the vector of any one of claims 59 and 62-69.
177. The use of claim 176, wherein the T cell further comprises a disruption of an endogenous TCR.
178. A use of producing the cell of claim 142, comprising transducing a T cell with the recombinant nucleic acid of any one of claims 1-57 or the vector of any one of claims 59 and 62-69 and a sequence encoding a fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.
179. The use of claim 178, wherein the recombinant nucleic acid or vector and the sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain are transduced simultaneously.
180. The use of claim 179, wherein the recombinant nucleic acid molecule or vector comprises a sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.
181. The use of claim 180, wherein the sequence encoding the TFP and the sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain are comprised in the same operon.
182. The use of claim 178, wherein the recombinant nucleic acid molecule or vector is transduced before or after the sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain.
183. The use of claim 178, wherein the ER retention domain is encoded by any one of SEQ ID NOs: 756-779.
184. The use of claim 178, wherein the sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain further comprises a CD8a transmembrane domain interposed between the anti-CD70 antibody domain and the ER retention domain.
185. The use of claim 178, wherein the sequence encoding the fusion protein comprising an anti-CD70 antibody domain and an ER retention domain further comprises a sequence encoding a CD8a signal peptide located 5' of the sequence encoding the anti-CD70 antibody domain.
Citation Information
Patent Citations
Process for preparing acetylaminobenzenes
EP0001994A1
Recombinant antibodies and methods for their production
EP0239400A2
A method for reducing the immunogenicity of antibody variable domains
EP0519596A1
Resurfacing of rodent antibodies
EP0592106A1
Compositions and methods for TCR reprogramming using fusion proteins
US10208285B2