Artificial immunoprotective antigen protein of avibacterium paragallinarum c and application thereof

By developing an artificial immunoprotective antigen protein of avian bacillus paragallinarum type C to prepare a subunit vaccine, the problem of poor immunization effect of existing vaccines has been solved, achieving highly efficient immunoprotection against avian bacillus paragallinarum type C, improving the disease prevention effect and maintaining the production performance of chickens.

CN116063414BActive Publication Date: 2025-11-07BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111293709.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-03
Publication Date
2025-11-07
Estimated Expiration
2041-11-03

AI Technical Summary

Technical Problem

Existing avian bacillus vaccines have poor immunization efficacy, cannot effectively cover multiple variant strains, and large-scale vaccination may affect egg production and growth in chickens, resulting in limited disease prevention effects.

Method used

Develop an artificial type C avian bacillus immunoprotective antigen protein to prepare a subunit vaccine. This antigen protein can cover multiple avian bacillus variants and enhance the resistance of chickens.

Benefits of technology

It achieves 100% immune protection against type C avian bacillus, which is superior to traditional whole-bacterial inactivated vaccines, significantly improving the disease prevention effect, while not affecting the egg production and growth of chickens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003335866870000071
    Figure BDA0003335866870000071
  • Figure BDA0003335866870000072
    Figure BDA0003335866870000072
  • Figure BDA0003335866870000082
    Figure BDA0003335866870000082
Patent Text Reader

Abstract

The application belongs to the technical field of poultry infectious disease vaccine preparation, and relates to an artificial immunoprotective antigen protein of C type paragallinacean bacillus and application thereof. The artificial immunoprotective antigen protein of C type paragallinacean bacillus provided by the application has an amino acid sequence as shown in SEQ ID No. 1. The antigen protein has strong immunogenicity, and a subunit vaccine prepared by using the antigen protein can obviously enhance the resistance of chickens to C type paragallinacean bacillus, the protection effect of the subunit vaccine is better than that of a whole bacterium inactivated vaccine, and the subunit vaccine can effectively prevent infection of C type paragallinacean bacillus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of poultry infectious disease vaccine preparation, and particularly relates to an artificial C-type Avibacterium paragallinarum immunoprotective antigen protein and application thereof. BACKGROUND

[0002] Avibacterium paragallinarum (Apg) is a short gram-negative bacillus of Pasteurellaceae family, and basic characteristics are non-motility, polymorphism of bacterial body and virulent strain with capsule. In 1932, De Blieck first reported that a gram-negative bacillus was isolated from chicken group with acute catarrhal inflammation of nasal mucosa, facial edema and conjunctivitis. The initial research report pointed out that the pathogenic bacteria need both X (hematin crystal) factor and V (nicotinamide adenine dinucleotide, NAD) factor in growth conditions, and early researchers named it Haemophilus gallinarum. In 1962, Page et al. found that all IC cases of isolated strains only need V factor for growth. Therefore, some scholars proposed to name the chicken hemophilus that only needs V factor as a new species: H. paragallinarum, which is widely accepted. In recent years, Avibacterium paragallinarum strains that do not depend on V factor have been isolated from chickens with rhinitis in South Africa, Mexico and other places. Therefore, it is not scientific to classify hemophilus according to the need for growth factors in vitro. In 2005, Blackall et al. changed the name of Avibacterium paragallinarum to Avibacterium paragallinarum.

[0003] Avibacterium paragallinarum is an important respiratory pathogen of chicken, which often causes infectious coryza (IC) in chicken. The disease is widely spread in the world and causes more and more serious economic losses to the poultry industry. At present, there are many reports of the disease in domestic chicken farms. From the infected site, Avibacterium paragallinarum infects the most forward part of the respiratory system, the nasal and sinus mucosa, which can be said to be the portal disease of respiratory diseases. If the first barrier is destroyed, the infection rate of other pathogens will greatly increase. If it is complicated with other pathogens such as chicken infectious bronchitis virus, chicken mycoplasma, chicken infectious laryngotracheitis, etc., it will cause chicken respiratory disease syndrome and cause greater losses to the poultry industry. Chickens of all ages are susceptible to the bacteria, which are commonly found in chickens over 13 weeks of age, usually with low mortality and high morbidity, and a 10% to 40% decrease in egg production. The pathological changes of the disease mainly manifest in the upper respiratory tract acute catarrhal inflammation, and the typical symptoms are mucoid sinusitis, nasal sinus mucosa edema and hyperemia, mucosal rod-shaped cell exudation, and accompanied by heterophils and macrophages, producing typical rhinitis lesions. The clinical manifestations are unilateral or bilateral facial swelling, runny nose, decreased appetite, and decreased egg production.

[0004] Chicken infectious coryza is a respiratory infectious disease, which is currently mainly controlled by inactivated vaccine. The immune effect of inactivated vaccine may be related to the mucosal antibody stimulated. Studies have shown that Avibacterium paragallinarum (Apg) of A, B and C serotypes all have different degrees of pathogenicity, but there is no inter-type cross immunity among the three inactivated bacteria, but only intra-type cross immune protection. At present, the inactivated vaccine widely used internationally mostly contains A and C types. With the discovery of a large number of B type Apg epidemic and occurrence at home and abroad, the internationally influential vaccine companies have begun to provide trivalent inactivated vaccine containing A, B and C serotypes. On the other hand, due to the presence of LPS and other toxic substances in Avibacterium paragallinarum, the toxic side effects brought by a large number of vaccination will also affect the egg production and growth of chickens, thus leading to the occurrence of immunization failure in production. The preventive effect of chicken infectious coryza inactivated vaccine on field chicken infection is about 70-80%, and different results may be obtained due to the inconsistency of environment and evaluation method in its efficacy test. Therefore, it is necessary to study a safer and more effective Avibacterium paragallinarum vaccine, which can neither affect the egg production and growth of chickens nor improve the prevention and control effect of chicken infectious coryza. SUMMARY

[0005] In order to make up for the deficiency of the existing Avibacterium paragallinarum vaccine immunization effect, the present application provides an artificial C type Avibacterium paragallinarum immunoprotective antigen protein, which has strong immunogenicity and can cover various Avibacterium paragallinarum mutant strains. The antigen protein can be used to prepare a subunit vaccine with remarkable preventive effect on C type Avibacterium paragallinarum.

[0006] The artificial immunoprotective antigen protein of the invention has an amino acid sequence as shown in SEQ ID No. 1.

[0007] The invention also provides a subunit vaccine of Avian Pasteurella multocida, which has an active ingredient of the artificial immunoprotective antigen protein of Avian Pasteurella multocida.

[0008] Preferably, the final concentration of the artificial immunoprotective antigen protein of Avian Pasteurella multocida in the subunit vaccine of Avian Pasteurella multocida is 20 μg / ml.

[0009] The gene encoding the artificial immunoprotective antigen protein of Avian Pasteurella multocida also falls within the protection scope of the invention.

[0010] Preferably, the nucleotide sequence of the gene is as shown in SEQ ID No. 2.

[0011] The expression cassette containing the gene also falls within the protection scope of the invention.

[0012] The vector containing the gene also falls within the protection scope of the invention.

[0013] The vector can be a cloning vector containing the gene encoding the artificial immunoprotective antigen protein of Avian Pasteurella multocida and other elements required for plasmid replication. The vector can also be an expression vector containing the gene encoding the artificial immunoprotective antigen protein of Avian Pasteurella multocida and other elements capable of successful protein expression. In some embodiments, the expression vector is a pET-28a(+) vector into which the gene encoding the artificial immunoprotective antigen protein of Avian Pasteurella multocida is inserted.

[0014] The bacteria or fungi containing the gene also falls within the protection scope of the invention.

[0015] The bacteria can be bacteria containing a gene cloning vector, such as E. coli DH5α, which replicates the gene encoding the artificial immunoprotective antigen protein of Avian Pasteurella multocida by culturing the bacteria under appropriate conditions; or bacteria containing a gene expression vector, such as E. coli BL21(DE3), which obtains the artificial immunoprotective antigen protein of Avian Pasteurella multocida by culturing the bacteria and inducing protein expression. The fungi can be fungi containing a gene expression vector, such as Pichia pastoris, which obtains the artificial immunoprotective antigen protein of Avian Pasteurella multocida by culturing the fungi and inducing protein expression.

[0016] The application also provides a preparation method of the artificial immunoprotective antigen protein of Avibacterium paragallinarum serovar C, which is characterized by comprising the following steps: synthesizing a coding gene of the artificial immunoprotective antigen protein of Avibacterium paragallinarum serovar C; introducing the coding gene into an expression vector to obtain a recombinant expression vector; introducing the recombinant expression vector into a protein expression host bacterium to obtain a recombinant bacterium; culturing the recombinant bacterium, inducing protein expression, and purifying to obtain the artificial immunoprotective antigen protein of Avibacterium paragallinarum serovar C.

[0017] The application of the artificial immunoprotective antigen protein of Avibacterium paragallinarum serovar C in preparing an Avibacterium paragallinarum serovar C subunit vaccine also belongs to the protection scope of the application.

[0018] In some embodiments of the application, the artificial immunoprotective antigen protein of Avibacterium paragallinarum serovar C is mixed with Freund's adjuvant in equal volume for emulsification to prepare an Avibacterium paragallinarum serovar C subunit vaccine. In other embodiments of the application, the artificial immunoprotective antigen protein of Avibacterium paragallinarum serovar C can also be combined with other proteins or inactivated bacteria known in the art which can be used as poultry vaccines to prepare a combined vaccine.

[0019] After the chickens are immunized with the subunit vaccine prepared from the artificial immunoprotective antigen protein of Avibacterium paragallinarum serovar C of the application and attacked by Avibacterium paragallinarum serovar C, no chickens have rhinitis symptoms, and the protection rate is 100%. After the chickens are immunized with a whole bacterium conventional inactivated vaccine (Modesto) and attacked by Avibacterium paragallinarum serovar C, 2-3 chickens have clinical symptoms within 7 days, and the protection rate is 70-80%. All chickens in the PBS control group have rhinitis symptoms after the attack, and the incidence rate is 100% (Table 2). There is a very significant difference in the protection rate between the immunized group and the control group. Therefore, the artificial immunoprotective antigen protein of Avibacterium paragallinarum serovar C of the application can significantly enhance the resistance of chickens to Avibacterium paragallinarum serovar C, produce an immunoprotective effect against the prevalent Avibacterium paragallinarum serovar C (such as the Modesto, H18, and the like), and has a protection effect superior to that of the whole bacterium inactivated vaccine, and can effectively prevent the infection of Avibacterium paragallinarum serovar C. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Map of the pET-28a(+) plasmid.

[0021] Figure 2 Recombinant protein P6 of the application + PCR amplification result of the coding gene of the recombinant protein P6.

[0022] Figure 3 Recombinant plasmid pET28a-P6 +NdeI / XhoI double enzyme digestion identification results. In the figure, M is a DNA molecular weight marker, 1 is recombinant plasmid pET28a-P6 + , 2 is the double enzyme digestion product of the recombinant plasmid.

[0023] Figure 4 . The pET28a-P6 + of the present application + of the recombinant expression strain before induction, after induction and after purification.

[0024] Figure 5 . The recombinant protein P6 + of the present application + of the present application + of the present application + . DETAILED DESCRIPTION

[0025] The present application will be described in detail below in conjunction with specific examples, and it should be understood that the following examples are only used to explain and illustrate the present application, and do not limit the scope of the present application in any way.

[0026] The E. coli competent cells Top10 and E. coli BL21 (DE3) competent cells used in the following examples were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. The Avian Bordetella Modesto strain and H18 strain used were purchased from China Institute for Control of Animal Product Quality in Beijing, and are commercial strains.

[0027] The SPF chickens used in the following examples were purchased from Boehringer Ingelheim Vetmedinca Witon Biotechnology Co., Ltd. in Beijing.

[0028] The pET-28a(+) plasmid used in the following examples is a product of Pharmacia Company, purchased from Beijing Bailingke Biotechnology Co., Ltd., and the plasmid map is as shown in Figure 1 .

[0029] The reagents and consumables used in the following examples are as follows:

[0030] Pfu polymerase, 10xpfu Buffer, Ndel and Xhol endonuclease and related Buffer, T4 DNA ligase and 10xT4 DNA ligase Buffer, Rnase, DNA marker (DL-2000, DL-15000) were all products of Bao Biological (Dalian) Co., Ltd. Sodium chloride, disodium EDTA salt, ethanol, methanol, ponceau S, trichloroacetic acid (TCA) were purchased from Shanghai Reagent Company. Tris base (Tris-HCL), dithiothreitol (DTT), glycerol, sodium dodecyl sulfate (SDS), acrylamide, ammonium persulfate, tetramethyl ethylenediamine (TEMED), sodium carbonate, sodium acetate were purchased from Shanghai Sangon Biological Engineering Technology Co., Ltd. Glycine, coomassie brilliant blue R-250 were purchased from AMRESCO company. Bovine serum albumin (BSA), trypsin, protease inhibitor (PMSF), formaldehyde were purchased from Sigma company. Proteinase K (stock solution concentration was 20 mg / ml, using liquid concentration was 1 mg / ml) was purchased from Shanghai Huashun Biological Engineering Co., Ltd. Kanamycin, fetal bovine serum, inducer IPTG (isopropyl-β-D-thiogalactoside) were purchased from Invitrogen company. Absorbing head and centrifugal tube were purchased from AxyGen company. Column type centrifugal DNA gel recovery kit, horseradish peroxidase (HRP) labeled rabbit anti-chicken IgG, avian pasteurella culture medium TSA, Freund's complete adjuvant and Freund's incomplete adjuvant were purchased from Sigma company. The 5 mL Ni-IDA pre-packed column used for purifying avian pasteurella antigen protein was a product of Amershan pharmacia company, purchased from Beijing Bailingke Biological Technology Co., Ltd.

[0031] Part of the medium and solution formula:

[0032] LB liquid medium and solid medium: 5 g of yeast extract, 10 g of tryptone, 10 g of NaCl per liter, pH adjusted to 7.5 with 10 mol / L NaOH, 121℃ high pressure sterilization for 20 min, 4℃ storage for standby. Add 1.5 g of agar to each 100 ml of LB liquid medium to obtain LB solid medium, 121℃ high pressure sterilization for 20 min, 4℃ storage for standby.

[0033] Substrate solution preparation: A solution: 0.006% H2O2 buffer; B solution: take Na2HPO4.12H2O 14.2 g, citric acid 10.5 g, constant volume to 500 mL with double distilled water to prepare 0.1 M phosphate citric acid buffer (pH 5.0), then add benzidine (TMB). When using, mix equal volume of A and B solutions, use within 5 minutes after mixing, prepare fresh every time.

[0034] PBS buffer: NaCl 8.0 g, KCl 0.2 g, KH2PO4 0.24 g, Na2HPO4·12H2O 3.628 g, dissolved in 800 ml of distilled water, pH 7.4 adjusted with hydrochloric acid, distilled water to 1000 ml, 121 °C high pressure sterilization for 20 min, room temperature preservation.

[0035] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, which can be commercially available or prepared according to conventional methods in the art, and the specifications are laboratory grade. Unless otherwise specified, the experimental methods and conditions used in the following examples are all conventional experimental methods and conditions in the art, which can be referred to relevant experimental manuals, known literature or manufacturer's instructions. Unless otherwise defined, the meanings of all technical and scientific terms used herein are the same as those generally understood by those of ordinary skill in the art to which the present application belongs.

[0036] Example 1. Recombinant protein P6 of Pasteurella avium + obtained

[0037] 1. Protein design

[0038] In order to obtain a safe and effective Pasteurella avium vaccine, we analyzed the coding gene (GenBank No. KJ867498.1) of the outer membrane protein of Pasteurella avium type C and its full protein sequence, and designed 50 kinds of recombinant protein sequences. The designed recombinant protein sequences were expressed in prokaryotes, and the sequences that could not express proteins were eliminated. The successfully expressed proteins were further analyzed for immunogenicity, and finally one kind of recombinant protein easy to express in prokaryotes and with strong immunogenicity was screened, which is called recombinant protein P6 + in this paper, the amino acid sequence of which is shown as SEQ ID No. 1, and the coding gene sequence of which is shown as SEQ ID No. 2.

[0039] Amino acid sequence (595 aa) of recombinant protein P6 +

[0040] ​MSLSSAKRKPLQTLIKDLEILENIKNKIHLELYTPTETQECTQQTLQCYLGEVVTLKKETEDDTEIKEEFVTAIQNIEKNLKSLTGLNHTGSECKICGANNKKKFPDFLHELTNFVRYLQKGSGGSGGGGSNSPITVESSTDNNKKKTFTVGLEKNITEVNSITFDKSGQDPNQVTGRMSSAGLTFKKGDTTNGSTTTFAEDGLTIDSTTNSAQTNLVKVSRDGFSVKNGSDESKLAPTKLSIGAENAEHVEVTKSGIALKANNTTGKSSITLSDSAITLAAATAGNAIKLTGVADGSITAGSKDAVNGGQLRTLLGVDSGAKIGGTEKTTISEAISDVKQALTDAKLAYKADNKNSKTVKLTDGLNFTSTTNIDASVEDSGVVKFTLKDKLIGLKTIATESLNASRNIIAGGTVTVGGETEGIVLTKSGSGNDRTLSLSGAGNAATDGIKVSGVKAGTADTDAVNKGQLDKLFKAINDALGTTDLAVTKDPNQTSIFNPINGTAPTTFKDAVDKLTTAVNTGWGSKVGILATGIDGIDAGNKKISNVADGDISPTSGDVVTGRQLYALMQKGIRVYGDEVSPTKTQTTAPTASS (SEQ ID No. 1).

[0041] Recombinant protein P6 + Gene sequence (1788 bp):

[0042]

[0043] 2. Gene and primer synthesis

[0044] BGI Genomics (Beijing) Co., Ltd. was commissioned to study the recombinant protein P6. + The full sequence of the encoding gene (SEQ ID No. 2) was synthesized to obtain the target gene. Primers were designed based on the target gene sequence, and NdeI and XhoI restriction sites were introduced into the upstream and downstream primers, respectively, to obtain specific primers (P6) for amplifying the target gene. + -F and P6 + -R), and commissioned BGI Genomics (Beijing) Co., Ltd. to synthesize the primers. The nucleotide sequences of the primers are as follows:

[0045] upstream primer P6 + -F:5'-GC CAT ATG AGTCTGAGCAGTGCAAAACGCA-3' (The underlined part is the NdeI restriction site) (SEQ ID No. 3);

[0046] Downstream primer P6 + -R:5'-CG CTC GAG TTAGCTGCTTGCTGTCGGTGCGGTGGTC-3' (the underlined part is the XhoI restriction site) (SEQ ID No. 4).

[0047] 3. Carrier Construction

[0048] 3.1 PCR amplification of the target gene

[0049] Using the artificially synthesized target gene as a template, PCR amplification was performed according to the following system and procedure.

[0050] PCR system (where the concentration of upstream and downstream primers is 1 OD dissolved in 400 μl ddH2O):

[0051]

[0052] PCR program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 22 sec, 56℃ annealing for 20 sec, 72℃ extension for 54 sec, 22 cycles; 72℃ extension for 5 min.

[0053] After the reaction, the amplification products were detected by agarose gel electrophoresis. The results are as follows: Figure 2 As shown, the size of the amplified product was basically consistent with the size of the target gene fragment (1788 bp). The target gene fragment was then recovered using a column-based DNA gel extraction kit (Sigma).

[0054] 3.2 Enzyme digestion

[0055] 3.2.1 The recovered target gene fragment was double-digested according to the following enzyme digestion system and conditions.

[0056] Enzyme digestion system (50 μl):

[0057]

[0058]

[0059] The above system was placed in a 37°C constant temperature water bath for 2 h. The digested DNA fragment was recovered using a general DNA gel recovery kit from Tian Gen Biochemical Technology (Beijing) Co., Ltd. according to the operation steps recorded in the kit instructions, and the specific operation was as follows:

[0060] (1) 0.8% agarose gel electrophoresis was used to separate the target DNA fragment from other DNA as much as possible. Under a long-wave ultraviolet lamp, a scalpel blade that had been burned on an alcohol lamp flame was used to cut the agarose block containing the target DNA fragment and placed in a 1.5 ml sterile centrifuge tube, and the weight was measured.

[0061] (2) 3 times the volume of the gel solution was added to the centrifuge tube; (for example, if the weight of the gel is 0.1 g, the volume can be considered as 100 μl, and so on). 55-60°C water bath for 10 min, constantly turning the centrifuge tube up and down gently to ensure that the gel block is fully dissolved. If there is still a gel block that has not completely dissolved, you can add more gel solution or add more time, until the gel block is completely dissolved (if the volume of the gel block is too large, the gel block can be cut into small pieces first).

[0062] (3) The solution obtained in step (2) was added to the adsorption column (the adsorption column was pre-placed in the collection tube), and then the collection tube was placed at room temperature for 1 min, and then centrifuged at 12000 r / min for 2 min, and the waste liquid was discarded. The adsorption column was placed back into the collection tube.

[0063] (4) 700 μL of the rinse solution (anhydrous ethanol has been added) was added to the adsorption column, and centrifuged at 12000 r / min for 1 min, and the waste liquid in the collection tube was discarded, and the adsorption column was placed back into the collection tube.

[0064] (5) 700 μL of the rinse solution was added to the adsorption column, and centrifuged at 12000 r / min for 1 min, and the waste liquid was discarded.

[0065] (6) The adsorption column was placed back into the collection tube, and centrifuged at 12000 r / min for 2 min to remove as much rinse solution as possible. The adsorption column was placed at room temperature for several minutes to dry completely.

[0066] (7) Put the adsorption column into a sterile centrifuge tube, and add the elution buffer EB to the middle of the adsorption membrane. Incubate at room temperature for 2 min. Collect the DNA solution by centrifugation at 12000 r / min for 2 min. The liquid in the centrifuge tube is the recovered DNA fragment, which can be used immediately or stored at -20°C for later use.

[0067] 3.2.2 Enzymatic digestion and recovery of the expression vector

[0068] Enzymatic digestion system (50 μl) of the vector:

[0069]

[0070] Put the above system into a 37°C constant temperature water bath for 2 h. Recover the linear pET-28a(+) vector obtained by enzymatic digestion using the ordinary DNA gel recovery kit from Tiangen Biosciences (Beijing) Co., Ltd. according to the operation steps described in the kit manual.

[0071] 3.3 Ligation of the target gene fragment and the vector

[0072] Ligate the purified target gene fragment and the linear pET-28a(+) vector according to the following system and conditions.

[0073] Ligation system (20 μl):

[0074]

[0075] Put the above ligation system into a PCR instrument, and ligate at 22°C for 1 h to obtain the recombinant plasmid pET28a-P6 + .

[0076] 3.4 Transformation and selection of positive clones

[0077] Add 100 μl of E. coli competent cells Top10 into a 1.5 ml EP tube, add 5-10 μl of the recombinant plasmid pET28a-P6 + , and mix well. Incubate on ice for 30 min, heat shock at 42°C for 90 sec, and ice bath for 3-5 min. Add 400 μl of sterile LB liquid medium without antibiotics, and incubate at 37°C and 200 rpm for 45 min to recover the cells. Centrifuge the recovered recombinant E. coli suspension at 25000 rpm and 4°C for 10 min, discard 400 μl of supernatant, resuspend the remaining 100 μl of bacterial pellet, and spread on an LB agar plate containing 25 μg / ml kanamycin. Place the plate at 37°C for 1 h, then invert the plate and incubate at 37°C for 14-16 h until colonies appear.

[0078] 3.5 Extraction and enzymatic digestion identification of the recombinant plasmid

[0079] The recombinant plasmid was extracted by alkaline lysis method (the method was introduced in the third edition of Molecular Cloning Laboratory Guide. Huang Peitang et al, Beijing, Science Press, 2002 edition), and the specific operation steps were as follows:

[0080] (1) Randomly pick several single colonies on the LB plate with sterilized toothpicks, and inoculate them into 3 ml of LB liquid medium containing 25 μg / ml of kanamycin, and incubate them at 37°C with shaking overnight.

[0081] (2) Transfer the bacterial solution into a 1.5 ml centrifuge tube, centrifuge it at 8000 rpm for 1-3 min at 4°C, and discard the supernatant; then add the remaining 1.5 ml of bacterial solution into the centrifuge tube, centrifuge it at 8000 rpm for 1-3 min at 4°C, and discard the supernatant; and stand the centrifuge tube upside down on the water absorption paper to make the liquid flow out.

[0082] (3) Add 100 μl of ice-precooled solution I, vortex to fully suspend the bacterial cells, then add 200 μl of freshly prepared solution II, repeatedly invert the centrifuge tube for several times, ice-bath for 5 min, finally add 150 μl of ice-precooled solution III, gently invert the centrifuge tube for several times, and ice-bath for 10 min.

[0083] (4) Centrifuge it at 12000 rpm for 10 min at 4°C, and transfer the supernatant into another 1.5 ml centrifuge tube, add an equal volume of isopropanol, mix well, and stand it at room temperature for 5 min.

[0084] (5) Centrifuge it at 12000 rpm for 10 min at room temperature, discard the supernatant, and rinse the precipitate with 75% cold ethanol, then dry it according to the conventional vacuum drying or natural drying method.

[0085] (6) Dissolve the precipitate with 200 μl of TE (pH 8.0) containing Rnase (20 μg / ml), and incubate it at 56°C for 30 min or at 37°C for 1 h to remove RNA.

[0086] (7) Add 100 μl of 7.5 mol / L NH4Ac, stand it at room temperature for 5 min, and then centrifuge it at 12000 rpm for 5 min at room temperature.

[0087] (8) Transfer the supernatant into another 1.5 ml EP tube, add 2 volumes of cold anhydrous ethanol, and stand it in ice-bath for 10 min.

[0088] (9) Centrifuge it at 12000 rpm for 10 min at 4°C, discard the supernatant, rinse the precipitate with 75% cold ethanol, and then dry it in vacuum, and dissolve it in 20 μl of ddH2O or TE (pH 8.0) to obtain the recombinant plasmid solution, which is stored in the refrigerator at -20°C for standby use.

[0089] Double enzyme digestion identification of recombinant plasmid: the extracted recombinant plasmid was subjected to double enzyme digestion with Nde I and Xho I endonuclease, and the enzyme digestion system and conditions were the same as above. The correct recombinant plasmid was obtained if the expected size of the target gene fragment and the vector fragment appeared after enzyme digestion. The results are shown in Figure 3 Figure 2, and two target bands appeared in the enzyme digestion product, the size of which was consistent with the pET-28a(+) plasmid (5369 bp) and the P6 + target gene fragment (1788 bp).

[0090] 3.6 Construction of recombinant expression strain

[0091] The E. coli competent cell BL21(DE3) 100 μl was added to a 1.5 ml EP tube, and 0.5 μl of the recombinant plasmid pET28a-P6 + with correct double enzyme digestion identification result was added and mixed. After being placed on ice for 30 min, it was heat shocked at 42℃ for 90 seconds, and then ice bathed for 3-5 min. 400 μl of sterile LB liquid medium without antibiotics was added, and the cells were cultured at 37℃ and 200 rpm for 45 min to recover. The recovered recombinant E. coli suspension was centrifuged at 25000 rpm for 10 min at 4℃, and 400 μl of supernatant was discarded. The remaining 100 μl of bacterial body precipitate was resuspended and spread on an LB agar plate containing 25 μg / ml kanamycin. The plate was placed at 37℃ for 1 h to proliferate, and then the plate was inverted and cultured at 37℃ for 14-16 h until colonies appeared. A sterile toothpick was used to randomly pick several single colonies on the plate, which were inoculated into 3 ml of LB liquid medium containing 25 μg / ml kanamycin, and cultured at 37℃ overnight. Bacterial liquid PCR was performed using specific primers (P6 + -F and P6 + -R) of the target gene to identify positive clones.

[0092] PCR system:

[0093]

[0094]

[0095] PCR program: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 1 min, annealing at 58℃ for 0.5 min, extension at 72℃ for 1 min, 30 cycles; extension at 72℃ for 10 min, and incubation at 4℃.

[0096] After the reaction was completed, the amplification product was detected by agarose gel electrophoresis. The bacterial liquid with correct amplification product size was sent to Shangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0097] 4. Protein expression and purification

[0098] 4.1 Induced expression of the gene of interest

[0099] Sequencing results of the correct pET28a-P6 + The recombinant expression strain was inoculated into 3 mL LB liquid medium containing 25 μg / mL kanamycin and cultured at 37 °C overnight. 100 μL of the cultured bacteria was inoculated into 10 mL fresh LB liquid medium containing 25 μg / mL kanamycin and cultured at 37 °C for about 3 h until the OD 600 When the OD reached 0.6-1.0, IPTG was added to a final concentration of 0.8 mmol, and the bacteria were cultured for another 3 h before being collected.

[0100] 4.2 SDS-PAGE electrophoresis analysis of the expression product

[0101] (1) Preparation of solutions related to SDS-PAGE and Western-blotting

[0102] 10% APS: 0.1 g of APS was added to 1 mL of ddH2O in an EP tube and used immediately.

[0103] 1.5 mol / L Tris-HCl (pH 8.8): 18.17 g of Tris was dissolved in 80 mL of ddH2O, and the pH was adjusted to 8.8 with concentrated HCl, then the volume was adjusted to 100 mL, and it was stored at room temperature.

[0104] 1 mol / L Tris-HCl (pH 6.8): 12.1 g of Tris was dissolved in 80 mL of ddH2O, and the pH was adjusted to 6.8 with concentrated HCl, then the volume was adjusted to 100 mL, and it was stored at room temperature.

[0105] 1 mol / L Tris-HCl (pH 7.5): 30.29 g of Tris was dissolved in 200 mL of ddH2O, and the pH was adjusted to 7.5 with concentrated HCl, then the volume was adjusted to 250 mL, and it was stored at room temperature.

[0106] 10% SDS: 10 g of SDS was added to ddH2O to make 100 mL, and it was dissolved in a 50 °C water bath and then stored at room temperature.

[0107] 5x Tris-glycine running buffer (pH 8.3): 15.1 g of Tris, 94 g of glycine, and 5 g of SDS were added to ddH2O to make 1000 mL, and it was diluted 5-fold immediately before use.

[0108] 1 mol / L DTT: 7.71 g of DTT was dissolved in 50 mL of 0.01 mol / L NaAc (pH 5.2), filtered to remove bacteria, and stored in small portions at -20 °C.

[0109] 2xSDS loading buffer: 10ml of 1mol / L Tris-HCl (pH 6.8), 4g of SDS, 0.2g of bromophenol blue, 20ml of glycerol, add ddH2O to 100ml, add 1mol / L DTT to make the final concentration 0.2mol / L before use.

[0110] Coomassie brilliant blue staining solution: 30ml of methanol, 60ml of ddH2O, 10ml of ice acetic acid, mix well, then add 0.25g of Coomassie brilliant blue, filter with filter paper and store in a brown bottle at room temperature.

[0111] Decolorizing solution: 30ml of methanol, 60ml of ddH2O, 10ml of ice acetic acid, mix well.

[0112] Protein transfer buffer: 5.82g of Tris, 2.93g of glycine, 300ml of methanol, add ddH2O to 1000ml.

[0113] TBS buffer: 10ml of 1mol / L Tris-HCl (pH 7.5), 8.8g of NaCl, add ddH2O to 1000ml.

[0114] TBST buffer: 2.5ml of 20% Tween-20, add TBS to 1000ml, mix well.

[0115] Blocking solution: 5g of skimmed milk powder is added to 100ml of TBS, dissolved thoroughly and stored at 4°C.

[0116] Dilution solution: 1g of skimmed milk powder is added to 100ml of TBS, dissolved thoroughly and stored at 4°C.

[0117] Ponceau S (10x) stock solution: 2g of Ponceau S, 30g of trichloroacetic acid, 30g of sulfosalicylic acid, add ddH2O to 100ml.

[0118] (2) Preparation of SDS-PAGE electrophoresis sample

[0119] The induced recombinant E. coli was centrifuged at 8000r / min for 15min. The precipitate was resuspended with 1 / 10 volume of 50mmol / L Tris-Cl (pH 7.5) and lysozyme was added to a final concentration of 1mg / ml, and ice bath for 30min. Ultrasonic crushing was carried out under ice bath condition until the bacterial solution was no longer viscous, and centrifuged at 10000r / min for 30min. A small amount of supernatant and precipitate after lysis were taken, 2xSDS loading buffer 125μl, DTT 25μl and TE liquid 100μl were added, shaken and mixed, boiled at 100°C for 10min, centrifuged at 12000r / min for 5min, and SDS-PAGE electrophoresis analysis was carried out.

[0120] (3) Preparation and electrophoresis of SDS-polyacrylamide gel

[0121] The SDS-PAGE gel preparation method is shown in Table 1:

[0122] Table 1. SDS-PAGE gel preparation methods

[0123]

[0124] Preparation of 15% separating gel: Add all components and mix quickly, then pour into the gel casting plate and top with purified water. Next, prepare 5% stacking gel: Add the relevant components from Table 1 and mix quickly, then pour onto top of the separating gel in the casting plate (first drain the purified water from the separating gel), filling completely and inserting the sample comb. After the stacking gel solidifies, remove the comb, fix the gel on the electrophoresis apparatus, add sufficient Tris-glycine electrophoresis buffer, and add each sample to the sample wells. Set the electrophoresis voltage to 200V and the current to the range of 20-40mA, and electrophoresis for 1 hour until bromophenol blue precipitates from the bottom of the gel, then stop the electrophoresis.

[0125] (4) Polyacrylamide gel staining and decolorization

[0126] Remove the gel, stain with Coomassie Brilliant Blue R250 staining solution for 30 minutes, then destain with destaining solution for 1 minute, and observe the results. Figure 4 As shown, Escherichia coli containing the positive recombinant plasmid was induced to express the protein at 37°C with 1 mM IPTG, and the expression was detected by SDS-PAGE. The result showed an expression band at approximately 58 kDa, consistent with the expected protein size. This protein was not present in uninduced bacteria. The protein content in the lysate supernatant after induction was higher than that in the precipitate. Therefore, the lysate supernatant can be used directly for purification, eliminating the need for the inclusion body denaturation and renaturation step.

[0127] 4.3 Preparation and purification of recombinant proteins

[0128] (1) pET28a-P6 + The recombinant expression strain was inoculated into 3 mL of LB liquid medium containing 25 μg / mL kanamycin and activated overnight at 37°C. Then, it was inoculated into fresh LB liquid medium containing 25 μg / mL kanamycin at a 1:100 volume ratio and cultured at 37°C with shaking at 230 rpm until the logarithmic growth phase (OD200). 600=0.6~1), IPTG was added to a final concentration of 1 mmol / L, and the culture was induced at 37°C and 230 r / min for 6-8 h. 1 mL of bacterial solution was taken before and at different times after induction, centrifuged at 5,000 r / min for 10 min to collect the bacterial cells, and 2x SDS loading buffer was added after the supernatant was discarded, boiled for 10 min, and checked by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the protein expression yield was analyzed by Quantity One-4.3.1 (BIO-RAD) software.

[0129] (2) 500 mL of bacterial solution induced for 6 h was collected, centrifuged at 8000 r / min for 10 min, and the precipitate was dissolved in 5 mL of 10 mmol / L PBS, ultrasonically broken, centrifuged at 12,000 r / min for 10 min, and the supernatant after each centrifugation was collected, and then subjected to SDS-PAGE electrophoresis detection.

[0130] (3) The supernatant of the bacterial cells lysed by ultrasonic wave was treated by nickel agarose affinity chromatography, and the specific operation was as follows:

[0131] ① 5 mL of Ni-IDA pre-packed column (Amershan pharmacia) was taken, and the column was washed and balanced with 10 times the column bed volume of Binding buffer at a flow rate of 5 mL / min.

[0132] ② The sample (lysate supernatant) was loaded onto the column at a flow rate of 2 mL / min, and the breakthrough liquid was collected.

[0133] ③ The column was washed with 10 times the column bed volume of Binding buffer at a flow rate of 10 mL / min.

[0134] ④ The impurities were washed with Wash Buffer at a flow rate of 5 ml / min, and the eluate was collected.

[0135] ⑤ The eluate was collected at a flow rate of 2 ml / min.

[0136] ⑥ The purified protein was placed in a dialysis bag and slowly dialyzed in PBS buffer (pH=7.4), and the dialyzed sample was collected for SDS-PAGE analysis.

[0137] Note: Binding Buffer (PBS, 0.5% Triton X-100, pH=7.4)

[0138] Wash buffer-10 (PBS, 10 mM imidazole, pH=7.4)

[0139] Wash buffer-25 (PBS, 25mM imidazole, pH=7.4)

[0140] Elution Buffer-100 (PBS, 100mM imidazole, pH=7.4)

[0141] Elution Buffer-500 (PBS, 500mM imidazole, pH=7.4)

[0142] The results are as follows Figure 5 As shown in Figure A, the elution buffer with a concentration of 500 mM imidazole showed the best elution effect; after purification, relatively pure recombinant protein P6 was obtained. + .

[0143] Example 2. Characterization of recombinant proteins

[0144] 1. Antigenicity analysis of recombinant proteins

[0145] The purified recombinant protein P6 was then used. + Perform SDS-PAGE using standard methods, and then perform Western blotting experiments as follows:

[0146] (1) Transfer: Cut out 6 Whatman 3M filter papers and 1 nitrocellulose membrane (NC membrane). The size of the filter paper and membrane should be exactly the same as or slightly smaller than the gel size. Mark one corner of the filter membrane with a pencil to ensure the relative orientation of the membrane and gel after transfer. Soak the nitrocellulose membrane in purified water for 5 minutes. Add a small amount of transfer buffer to another shallow tray and soak the 6 Whatman 3M filter papers in it. Then install the transfer electrophoresis tank as follows: Place the base (anode) of the graphite electrode flat, and place 3 layers of 3M filter paper, nitrocellulose membrane, polyacrylamide gel, and 3 layers of 3M filter paper in sequence. After thoroughly removing air bubbles between the layers, attach the top cover of the transfer electrophoresis tank to the graphite electrode-transfer membrane gel composite. Connect the power supply, according to the gel plate area, at 0.65 mA / cm². 2 -1.0mA / cm 2 The parameters are set to the current, and the electrophoretic transfer time is 0.5h-2h.

[0147] (2) Ponceau S staining: After the transfer is completed, remove the NC membrane, rinse it 2-3 times in deionized water, and then transfer it to Ponceau S staining solution for 5-10 min. Observe the transfer effect and mark the protein marker position with a pencil. Rinse the nitrocellulose membrane with deionized water at room temperature until the color fades. Place the NC membrane in 5% skim milk powder and block it at room temperature for 2 h. Discard the blocking solution and wash the NC membrane 3 times with 1×TBST for 5 min each time.

[0148] (3) First antibody incubation: Put the NC membrane into chicken anti-C paragafflammatory disease positive serum (prepared by our laboratory, SPF chicken immunized with paragafflammatory disease Modesto strain, see the preparation method in the People's Republic of China agricultural industry standard chicken infectious rhinitis diagnosis technology NY / T538-2015) diluted by 5% skim milk powder at a volume ratio of 1:50, incubate at 37°C for 1h; take out the NC membrane, wash the membrane with 1xTBST for 3 times, 10min each time.

[0149] (4) Second antibody incubation: Transfer the membrane into HRP labeled rabbit anti-chicken IgG antibody (Sigma, A9046-1ML) diluted by 5% skim milk powder at a volume ratio of 1:5000, incubate at 37°C for 2h; wash the membrane and take out the NC membrane, wash the membrane with 1xTBST for 3 times, 10min each time.

[0150] (5) Color development: Put the NC membrane into the newly prepared DAB color developing solution, develop in the dark, and when the color depth of the protein band reaches the required level, wash with 1xTBST to terminate the reaction.

[0151] Recombinant protein P6 + The Western-blotting detection results are shown in Figure 5 B. The size of recombinant protein P6 + is 58KDa Figure 5 A), and chicken anti-C paragafflammatory disease positive serum binds to recombinant protein P6 + at about 58KDa Figure 5 B), which is consistent with the expected results. It shows that recombinant protein P6 + has good antibody binding activity.

[0152] 2. Immunogenicity analysis of recombinant protein

[0153] Preparation of recombinant protein vaccine: Mix the recombinant protein P6 + with Freund's complete adjuvant (Sigma) in equal volume to emulsify, so that the final concentration of recombinant protein P6 + in the vaccine is 20μg / ml. The second immunization uses Freund's incomplete adjuvant (Sigma).

[0154] Immunization method: Vaccinate 42-day-old test SPF chickens with recombinant protein vaccine emulsified with Freund's complete adjuvant (vaccination amount is 0.2ml per chicken); 2 weeks later, vaccinate with recombinant protein vaccine emulsified with Freund's incomplete adjuvant (vaccination amount is 0.2ml per chicken); collect blood from the wing vein after 10 days, and collect serum.

[0155] Detection of serum specific antibodies: Use ELISA method for detection, the specific steps are as follows: use purified recombinant protein P6 +(1 μg / 100 μl) was used to coat an ELISA plate (Costar, 42592) overnight at 4°C, 100 μl / well. The plate was blocked with 1% BSA at 37°C for 1 h, then washed once with washing buffer (1×TBST) and stored at -20°C. One week after booster immunization, serum was collected from chickens, serially diluted, and 100 μl was added to the ELISA plate. Chicken anti-Avianella paragallinarum positive serum control, Freund's adjuvant control, and blank control were also included. The plate was incubated at 37°C for 30 min. After washing three times, rabbit anti-chicken IgY(H+L)-HRP (Sigma, A9046-1ML) diluted 1:10,000 was added, and the plate was incubated at 37°C for 30 min. After washing five times, 100 μl of substrate solution was added, and the plate was developed in the dark for 10 min. The reaction was terminated by adding 2% H2SO4, and the absorbance (OD) was read at 630 nm. 630nm OD values ​​of serum samples and blank control group. 630nm Serum samples with a ratio greater than 2 were considered positive for serum ELISA antibodies. ELISA results showed that the OD value of chicken serum one week after immunization was... 630nm The value was as high as 1.2, comparable to chicken serum positive for avian paraguine type C, and far higher than the control group's 0.07. The OD values ​​of the serum samples and the blank control group were also significantly higher. 630nm The ratio of values ​​is greater than 2, indicating that the recombinant protein P6... + The recombinant protein P6 can specifically bind to chicken anti-Avian bacillus paragallinarum positive serum. + It has excellent immunogenicity.

[0156] Example 3. Immunogenic efficacy test of recombinant protein against SPF chickens

[0157] 1. Vaccine preparation

[0158] Subunit vaccine (P6) + Preparation of recombinant protein P6: + Emulsify with an equal volume of Freund's complete adjuvant (Sigma) to allow the recombinant protein P6 in the vaccine to be contained. + The final concentration was 20 μg / ml, used for the initial immunization. The second immunization used Freund's incomplete adjuvant (Sigma), with the remaining components the same as the initial immunization.

[0159] Preparation of the whole-cell inactivated vaccine (Modesto): After pure culture of *Avianobacter paragallinarum* Modesto strain, 8-10 single colonies were picked and spread onto TSA (Sigma) agar plates (containing 10% inactivated bovine serum). After incubation at 37°C for 16-18 hours, the bacterial growth on the plates was washed off with sterile 0.01 mol / L PBS and diluted to 7.5 × 10⁻⁶. 9cfu / ml, inactivated with formaldehyde (3‰) for 24-48h, then mixed with Freund's adjuvant at a volume ratio of 1:1 to emulsify, so that the final concentration reaches 3.0x10 9 cfu / ml.

[0160] 2. Immunization of test chickens

[0161] 42-day-old SPF test chickens 60, divided into 3 test groups, 20 in each group, respectively set as P6 + immunization group, whole bacteria inactivated vaccine immunization group and PBS control group. The test chickens in P6 + immunization group, whole bacteria inactivated vaccine immunization group and PBS control group are injected with Freund's complete adjuvant emulsified subunit vaccine (P6 + ), whole bacteria inactivated vaccine (Modesto) and PBS, respectively, 0.5ml / each; 4 weeks later, the same dose, the same way is used for booster immunization. Every two weeks, the blood is taken from the wing vein for the detection of serum specific antibodies (the method is the same as in Example 2).

[0162] 3. Challenge test of immunized chickens

[0163] The SPF chickens after 4 weeks of booster immunization are subjected to challenge test. Each test group is divided into 2 groups for challenge, 10 in each group, respectively, 1x10 6 CFU dose of C. coli Avigall P6 + Modesto strain and H18 strain are inoculated into the suborbital sinus of the two groups of chickens. Continuous observation for three days, record the clinical features and death of the test chickens, evaluate the immunoprotection of the recombinant protein P6 + , the results are shown in Table 2.

[0164] Table 2: Challenge test results of immunized chickens in each test group

[0165]

[0166] *The recombinant protein P6 + immunization group obtains a significant difference in the number of immunoprotected test chickens compared with the PBS control group.

[0167] As can be seen from Table 2, the recombinant protein P6 + as an antigen vaccine has a significant immunization effect. The SPF chickens are immunized with the prokaryotic expressed recombinant protein P6 + , after 2 times of immunization, the PBS control group of all test chickens successively develops the disease. The P6 + immunization group does not show rhinitis symptoms after challenge, and the protection rate is 10 / 10; the whole bacteria inactivated vaccine immunization group has 2-3 chickens showing clinical symptoms within 3 days after challenge. The recombinant protein P6 +The protective effect of the application is better than that of the whole bacteria inactivated vaccine, and there is a significant difference compared with the PBS control group. Since the purified protein does not contain the lipopolysaccharide and other components carried by the whole bacteria, the subunit vaccine prepared by the application has no side effects, while the whole bacteria inactivated vaccine has side effects such as temporary loss of appetite and mental depression. In terms of preparation cost, the subunit vaccine is easy to culture and induce, the culture medium is cheap, and it is easy to purify, so the cost is also lower than that of the conventional inactivated vaccine.

[0168] The above only describes the preferred embodiments of the application, and it should be pointed out that for those skilled in the art, without departing from the principles of the application, a number of improvements and modifications can be made, and these improvements and modifications also fall within the protection scope of the application. SEQUENCE LISTING <110> Beijing Academy of Agricultural and Forestry Sciences <120> An artificial immunoprotective antigen protein of C. psittaci and application thereof <130> P210693-NLK <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 595 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 1 Met Ser Leu Ser Ser Ala Lys Arg Lys Pro Leu Gln Thr Leu Ile Lys 1 5 10 15 Asp Leu Glu Ile Leu Glu Asn Ile Lys Asn Lys Ile His Leu Glu Leu 20 25 30 Tyr Thr Pro Thr Glu Thr Gln Glu Cys Thr Gln Gln Thr Leu Gln Cys 35 40 45 Tyr Leu Gly Glu Val Val Thr Leu Lys Lys Glu Thr Glu Asp Asp Thr 50 55 60 Glu lie Lys Glu Glu Phe Val Thr Ala lie Gin Asn lie Glu Lys Asn 65 70 75 80 Leu Lys Ser Leu Thr Gly Leu Asn His Thr Gly Ser Glu Cys Lys lie 85 90 95 Cys Gly Ala Asn Asn Lys Lys Lys Phe Pro Asp Phe Leu His Glu Leu 100 105 110 Thr Asn Phe Val Arg Tyr Leu Gin Lys Gly Ser Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Asn Ser Pro lie Thr Val Glu Ser Ser Thr Asp Asn Asn 130 135 140 Lys Lys Lys Thr Phe Thr Val Gly Leu Glu Lys Asn lie Thr Glu Val 145 150 155 160 Asn Ser lie Thr Phe Asp Lys Ser Gly Gin Asp Pro Asn Gin Val Thr 165 170 175 Gly Arg Met Ser Ser Ala Gly Leu Thr Phe Lys Lys Gly Asp Thr Thr 180 185 190 Asn Gly Ser Thr Thr Thr Phe Ala Glu Asp Gly Leu Thr lie Asp Ser 195 200 205 Thr Thr Asn Ser Ala Gin Thr Asn Leu Val Lys Val Ser Arg Asp Gly 210 215 220 Phe Ser Val Lys Asn Gly Ser Asp Glu Ser Lys Leu Ala Pro Thr Lys 225 230 235 240 Leu Ser Ile Gly Ala Glu Asn Ala Glu His Val Glu Val Thr Lys Ser 245 250 255 Gly Ile Ala Leu Lys Ala Asn Asn Thr Thr Gly Lys Ser Ser Ile Thr 260 265 270 Leu Ser Asp Ser Ala Ile Thr Leu Ala Ala Ala Thr Ala Gly Asn Ala 275 280 285 Ile Lys Leu Thr Gly Val Ala Asp Gly Ser Ile Thr Ala Gly Ser Lys 290 295 300 Asp Ala Val Asn Gly Gly Gln Leu Arg Thr Leu Leu Gly Val Asp Ser 305 310 315 320 Gly Ala Lys Ile Gly Gly Thr Glu Lys Thr Thr Ile Ser Glu Ala Ile 325 330 335 Ser Asp Val Lys Gln Ala Leu Thr Asp Ala Lys Leu Ala Tyr Lys Ala 340 345 350 Asp Asn Lys Asn Ser Lys Thr Val Lys Leu Thr Asp Gly Leu Asn Phe 355 360 365 Thr Ser Thr Thr Asn Ile Asp Ala Ser Val Glu Asp Ser Gly Val Val 370 375 380 Lys Phe Thr Leu Lys Asp Lys Leu Ile Gly Leu Lys Thr Ile Ala Thr 385 390 395 400 Glu Ser Leu Asn Ala Ser Arg Asn Ile Ile Ala Gly Gly Thr Val Thr 405 410 415 Val Gly Gly Glu Thr Glu Gly Ile Val Leu Thr Lys Ser Gly Ser Gly 420 425 430 Asn Asp Arg Thr Leu Ser Leu Ser Gly Ala Gly Asn Ala Ala Thr Asp 435 440 445 Gly Ile Lys Val Ser Gly Val Lys Ala Gly Thr Ala Asp Thr Asp Ala 450 455 460 Val Asn Lys Gly Gln Leu Asp Lys Leu Phe Lys Ala Ile Asn Asp Ala 465 470 475 480 Leu Gly Thr Thr Asp Leu Ala Val Thr Lys Asp Pro Asn Gln Thr Ser 485 490 495 Ile Phe Asn Pro Ile Asn Gly Thr Ala Pro Thr Thr Phe Lys Asp Ala 500 505 510 Val Asp Lys Leu Thr Thr Ala Val Asn Thr Gly Trp Gly Ser Lys Val 515 520 525 Gly Ile Leu Ala Thr Gly Ile Asp Gly Ile Asp Ala Gly Asn Lys Lys 530 535 540 Ile Ser Asn Val Ala Asp Gly Asp Ile Ser Pro Thr Ser Gly Asp Val 545 550 555 560 Val Thr Gly Arg Gln Leu Tyr Ala Leu Met Gln Lys Gly Ile Arg Val 565 570 575 Tyr Gly Asp Glu Val Ser Pro Thr Lys Thr Gln Thr Thr Ala Pro Thr 580 585 590 Ala Ser Ser 595 <210> 2 <211> 1788 <212> DNA <213> Artificial Sequence <400> 2 atgagtctga gcagtgcaaa acgcaaaccg ctgcagaccc tgattaagga tctggaaatt 60 ctggaaaata tcaaaaacaa gatccacctg gaactgtata ccccgaccga aacccaggaa 120 tgtacccagc agaccctgca gtgttatctg ggcgaagtgg ttaccctgaa aaaagaaacc 180 gaagatgata ccgaaattaa ggaagaattt gtgaccgcca ttcagaatat tgaaaagaat 240 ctgaaaagcc tgaccggcct gaatcatacc ggtagtgaat gtaaaatttg cggcgccaat 300 aataagaaaa aatttccgga tttcctgcat gaactgacca attttgtgcg ctatctgcag 360 AAAGGCAGCG GTGGCAGCGG TGGTGGTGGT AGTAATAGTC CGATTACCGT GGAAAGCAGC 420 ACCGATAATA ATAAGAAGAA AACCTTTACC GTGGGTCTGG AAAAGAATAT TACC GAAGTG 480 AATAGTATCA CCTTTGATAA AAGTGGTCAA GACCCTAATC AGGTGACCGG TCGCATGAGC 540 AGCGCAGGTC TGACCTTTAA AAAAGGCGAT ACCACCAATG GTAGCACCAC CCACTTTGCC 600 GAAGATGGCC TGACCATTGA TAGTACCACC AATAGCGCCC AGACCAATCT GGTGAAAGTG 660 AGCCGCGATG GTTTTAGTGT TAAAAATGGC AGCGATGAAG TAAACTGGC ACCGACCAAA 720 CTGAGTATTG GCgcAGAAAA TGCAGAACAT GTGGAAGTTA CCAAAAGTGG TATTGCCTG 780 AAAGCAAATA ATACCACCGT AAAAGTAGCA TTACCCTGAG CGATAGCGCA ATTACCCTG 840 GCAGCAGCAA CCGCCGGTA ATGCCATTAAG CTGACCGGTG TTGCAGATGG TAGCATTACC 900 GCAGGCAGCA AAGATGCCGT GAATGGTGCC AGCTGCGCAC CCTGCTGGG CGTTGATAGT 960 GGCGCCAAAA TTGgtGgtAC CGAAAAAACC ACCATTAGCG AAGCAATTAG CGATGTAAAA 1020 CAGGCACCGA TGCACAACCT GGCCTATAAA GCAGATAATA AGAATAGCAA AACCCTT 1080 AAAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT 54 AGTGGTGTGGTTAAATTCAC TCTGAAAGAT AAAC T GATCGGCCTGAAAAC CATTGCAACC 1200 GAAAGTCTGAATGCCAGCCGTAATATTATTGCCG GTGGCACCGTGACC GTGGGC GGTGAA 1260 ACC GAAGGTATTGTGCTGACCAAAAGTGGCAGTGGCAATGATCGTACCC TGA GTCTGA GC 1320 GGTGCAGGT AATGCCGCC ACCGATGGCATT AAGGT TAGTGGC GTGAAAGC AGGT ACCGCA 1380 GATAACCGATGCAGTTAATAAGGTCAGCTGGATAA ACTGTTAAAGCCATTAATGATGCC 1440 CTGGGTACCA CCGATCTGGC AGTTACCAAAG ATCCGAATC AGACCAGTATTTT TAATCCG 1500 ATTAACGGTACC GCACC GAC CACCTT TAAA GATGCCGT T GAT AAAC T GAC CACCGCAGTT 1560 AATAACGGTTGGGGTAGCAAAGTGGGTATTCTGGCCACCGGTATTGATGGCATTGATGCA 1620 GGCAATAAGAAAATTAGCAATGTTCG AT GGTGACAT TAGTCCGACCAGTGGTGACGTT 1680 GTGACC GGT C GT C AGCTGT ATGC ACTGATGC AGAAAGGTATTCGTGTTTATGGTGACGAA 1740 GTGAGCCC GAC CAAAAC CAGACC ACCGC ACCGAC AGCAA GCAGCTAA 1788 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> 3 gccatatgag tctgagcagt gcaaaacgca 30 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <400> 4 cgctcgagtt agctgcttgc tgtcggtgcg gtggtc 36

Claims

1. An artificial immunoprotective antigen protein of Avian Pasteurella multocida serogroup C, the amino acid sequence of which is shown in SEQ ID No.

1. 2.A subunit vaccine of Avian Pasteurella multocida serogroup C, the active ingredient of which comprises the artificial immunoprotective antigen protein of Avian Pasteurella multocida serogroup C according to claim 1.

3. The C. psittaci subunit vaccine of claim 2, wherein, The final concentration of the artificial immunoprotective antigen protein of Avian Pasteurella multocida serogroup C in the subunit vaccine of Avian Pasteurella multocida serogroup C is 20 μg / ml. 4.A gene encoding the artificial immunoprotective antigen protein of Avian Pasteurella multocida serogroup C according to claim 1.

5. The gene of claim 4, wherein The nucleotide sequence of the gene is shown in SEQ ID No.

2. 6.An expression cassette comprising the gene according to claim 4 or 5. 7.A vector comprising the gene according to claim 4 or 5. 8.A bacterium or fungus comprising the gene according to claim 4 or 5.

9. The method of producing an immunoprotective antigenic protein of artificial C. psittaci of claim 1, characterized by, The method comprises the following steps: synthesizing the gene encoding the artificial immunoprotective antigen protein of Avian Pasteurella multocida serogroup C; introducing the gene into an expression vector to obtain a recombinant expression vector; introducing the recombinant expression vector into a protein expression host bacterium to obtain a recombinant bacterium; culturing the recombinant bacterium, inducing protein expression, and purifying to obtain the artificial immunoprotective antigen protein of Avian Pasteurella multocida serogroup C. 10.Use of the artificial immunoprotective antigen protein of Avian Pasteurella multocida serogroup C according to claim 1 in the preparation of a subunit vaccine of Avian Pasteurella multocida serogroup C.

Citation Information

Patent Citations

  • Chicken infectious rhinitis subunit vaccine and preparing method thereof

    CN106220716A

  • Chicken infectious rhinitis subunit vaccine and preparation method thereof

    CN107266538A