Nucleic acid, kit and detection method for group a rotavirus genotyping by multiplex real-time fluorescent quantitative rt-pcr detection
By designing a multiplex real-time quantitative RT-PCR method with specific primers and probes, nine genotypes of group A rotavirus were detected in groups, solving the problems of detection complexity and large sample size in existing technologies, and realizing rapid, simple, sensitive and specific genotyping detection.
Patent Information
- Application Number
- CN202111400473.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-11-24
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2041-11-24
AI Technical Summary
Existing technologies cannot effectively detect the genotyping of group A rotavirus, and the multiplex real-time quantitative RT-PCR method is complex to operate, prone to contamination, and requires a large sample volume, making it difficult to meet the needs of rapid and efficient detection.
Specific primers and probes were designed to detect nine genotypes of group A rotavirus. Multiplex real-time quantitative RT-PCR was used to detect three groups: G1, G9, and P[6] were group A, G2, G4, and P[4] were group B, and G3, G8, and P[8] were group C. Nucleic acid kits and detection methods were used to ensure that there was no cross-reaction between primers and probes, and the reaction conditions were optimized to improve sensitivity and specificity.
It enables rapid and efficient detection of nine genotypes of group A rotavirus, saving scarce samples, reducing the risk of contamination, and is easy to operate. It has high sensitivity, strong specificity, and objective and accurate result interpretation, making it suitable for the prevention and control of group A rotavirus.
Smart Images

Figure CN116162732B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of microbial technology, and relates to a nucleic acid, a kit and a detection method for multiplex real-time fluorescent quantitative RT-PCR detection of genotyping of group A rotavirus. BACKGROUND
[0002] Rotavirus (RV) belongs to the family of Reoviridae and the genus of Rotavirus, and is a double-stranded RNA virus. According to the antigenicity of the structural protein VP6 of the virus, rotavirus can be divided into ten groups A to J. Among them, group A rotavirus is the main pathogen of severe diarrhea in infants and young children. Globally, more than 200 million infants and young children suffer from rotavirus infectious diarrhea every year, and about 185,000 people die. The virus is mainly transmitted through the fecal-oral route. All children under the age of 5 have been infected with rotavirus. Infants and young children aged 6 months to 2 years are the main population infected with group A rotavirus, which seriously affects the health of children and even endangers their lives.
[0003] According to the sequence difference of RNA fragments 7 and 4, group A rotavirus is further divided into different genotypes G and P. So far, 36 G genotypes and 51 P genotypes have been identified, of which 12 G genotypes and 15 P genotypes can infect humans. In China, the main genotypes prevailing are G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8].
[0004] A fluorescence quantitative PCR detection method for group A rotavirus is disclosed in Chinese application No. CN201510519271.2. The method includes taking rotavirus VP6 gene as the target gene, designing primers and probes, designing experiments to find the annealing temperature, primer concentration and probe concentration under the optimal conditions; designing a pair of primers outside the primers and amplifying the fragments, using the fragments to construct a recombinant plasmid, linearizing the constructed recombinant plasmid in vitro as a template, transcribing to obtain RNA, diluting by ten-fold gradient to serve as a standard, performing real-time PCR reaction, and establishing a Ct / LogCopynumber working curve. In the above scheme, only the VP6 gene can be detected, and the genotyping of group A rotavirus cannot be detected.
[0005] At present, the common typing methods of group A rotavirus include semi-nested polymerase chain reaction, single and multiple real-time fluorescent quantitative RT-PCR methods. The semi-nested PCR operation is complex, secondary pollution is easy to be caused in the operation process, the reaction time is relatively long, the result analysis is easy to be affected by subjective judgment, and a large amount of samples are needed. At present, there are few multiple real-time fluorescent quantitative RT-PCR detection methods for group A rotavirus typing, and the multiple real-time fluorescent quantitative RT-PCR detection method can effectively save the rare samples and save the reagents. Therefore, it is necessary to establish the multiple real-time fluorescent quantitative RT-PCR gene typing detection method of group A rotavirus.
[0006] In view of this, the present application is proposed. SUMMARY
[0007] The technical problem solved by the present application is to overcome the deficiencies of the prior art, and to provide a nucleic acid, a kit and a detection method for multiple real-time fluorescent quantitative RT-PCR detection of group A rotavirus gene typing. The method can quickly and efficiently detect 9 kinds of gene typing of group A rotavirus, can effectively save rare samples, save reagents, has high sensitivity and specificity, the result is simple to read and easy to apply, and provides a reference for specific detection of group A rotavirus typing and prevention and control of group A rotavirus.
[0008] To solve the above technical problems, the basic idea of the technical solution of the present application is:
[0009] The first object of the present application is to provide a nucleic acid for multiple real-time fluorescent quantitative RT-PCR detection of group A rotavirus gene typing, and the genotypes detected include G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8], and the detection is carried out in groups, at least two genotypes are detected in each group, wherein:
[0010] The first primer pair for detecting G1 genotype and the first probe, the nucleic acid sequence of the first primer pair is shown as SEQ ID NO: 1 and SEQ ID NO: 2; the nucleic acid sequence of the first probe is shown as SEQ ID NO: 3 and / or SEQ ID NO: 4, and the fluorescent label is 5'FAM, 3'MGB;
[0011] The second primer pair for detecting G9 genotype and the second probe, the nucleic acid sequence of the second primer pair is shown as SEQ ID NO: 5 and SEQ ID NO: 6; the nucleic acid sequence of the second probe is shown as SEQ ID NO: 7, and the fluorescent label is 5'VIC, 3'MGB;
[0012] a third primer pair for detecting P[6] genotype, the nucleic acid sequences of the third primer pair are shown as SEQ ID NO: 8 and SEQ ID NO: 9; the nucleic acid sequence of the third probe is shown as SEQ ID NO: 10, the fluorescent label is 5’CY5, 3’MGB;
[0013] a fourth primer pair for detecting G2 genotype, the nucleic acid sequences of the fourth primer pair are shown as SEQ ID NO: 11 and SEQ ID NO: 12; the nucleic acid sequence of the fourth probe is shown as SEQ ID NO: 13, the fluorescent label is 5’VIC, 3’BHQ-1;
[0014] a fifth primer pair for detecting G4 genotype, the nucleic acid sequences of the fifth primer pair are shown as SEQ ID NO: 14 and SEQ ID NO: 15; the nucleic acid sequence of the fifth probe is shown as SEQ ID NO: 16, the fluorescent label is 5’CY5, 3’BHQ-2;
[0015] a sixth primer pair for detecting P[4] genotype, the nucleic acid sequence of the upstream primer of the sixth primer pair is shown as SEQ ID NO: 17 and / or SEQ ID NO: 18, the nucleic acid sequence of the downstream primer is shown as SEQ ID NO: 19; the nucleic acid sequence of the sixth probe is shown as SEQ ID NO: 20 and / or SEQ ID NO: 21, the fluorescent label is 5’FAM, 3’BHQ-1;
[0016] a seventh primer pair for detecting G3 genotype, the nucleic acid sequence of the upstream primer of the seventh primer pair is shown as SEQ ID NO: 22, the nucleic acid sequence of the downstream primer is shown as SEQ ID NO: 23 and / or SEQ ID NO: 24; the nucleic acid sequence of the seventh probe is shown as SEQ ID NO: 25, the fluorescent label is 5’FAM, 3’MGB;
[0017] an eighth primer pair for detecting G8 genotype, the nucleic acid sequence of the upstream primer of the eighth primer pair is shown as SEQ ID NO: 26 and / or SEQ ID NO: 27, the nucleic acid sequence of the downstream primer is shown as SEQ ID NO: 28; the nucleic acid sequence of the eighth probe is shown as SEQ ID NO: 29, the fluorescent label is 5’CY5, 3’MGB;
[0018] The ninth primer pair for detecting P[8] genotype, the nucleic acid sequences of the ninth primer pair are shown as SEQ ID NO: 30 and SEQ ID NO: 31; the nucleic acid sequence of the ninth probe is shown as SEQ ID NO: 32, and the fluorescent label is 5'VIC, 3'MGB.
[0019] Preferably, grouping detection is performed, and 2-4 genotypes are detected in each group.
[0020] Preferably, grouping detection is performed, and 2-4 genotypes are detected in each group.
[0021] The present application provides primers and probes suitable for grouping detection of G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8], and the grouping detection of the above 9 genotypes can include various modes, and the primers and probes of each genotype do not cross-react, which is conducive to realizing multiplex real-time fluorescent quantitative RT-PCR detection.
[0022] As a preferred mode, G3 and G9 are not detected in the same group to avoid mutual influence.
[0023] As a more preferred mode, grouping detection can be performed, G1, G9 and P[6] are in group A, G2, G4 and P[4] are in group B, and G3, G8 and P[8] are in group C, and this mode has low detection limit, higher sensitivity, good repeatability and better specificity.
[0024] The second object of the present application is to provide a kit for multiplex real-time fluorescent quantitative RT-PCR detection of rotavirus genotyping in group A, and the kit includes nucleic acids for detecting G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8] genotypes as described in the above mode.
[0025] Further, the kit further includes a quality control product containing the target sequences of G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8] genotypes, and the nucleic acid sequence of the quality control product is shown as SEQ ID NO: 33.
[0026] Preferably, the kit further includes Premix EX TaqTM.
[0027] Alternatively, the kit further includes qRT-PCR buffer and qRT-PCR Enzyme.
[0028] The third object of the present application is to provide a multiplex real-time fluorescent quantitative RT-PCR detection method for genotyping of group A rotavirus, comprising the following steps:
[0029] (1) Extracting RNA of the sample to be tested for standby;
[0030] (2) Preparing RNA standard containing the target sequence of G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8] genotypes with a set concentration;
[0031] (3) Using the RNA of the sample to be tested and the RNA standard as templates, respectively, and using the nucleic acid for detecting G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8] genotypes as described in the above scheme, performing multiplex real-time fluorescent quantitative RT-PCR detection in groups, drawing standard curves of each genotype according to the detection results of the RNA standard, and determining the lowest detection limit of each genotype;
[0032] (4) Interpreting the results of the sample to be tested.
[0033] Preferably, 2-4 genotypes are detected in each group for grouping detection;
[0034] Preferably, three groups are detected, G1, G9 and P[6] are in group A, G2, G4 and P[4] are in group B, and G3, G8 and P[8] are in group C, and primers and probes corresponding to the genotypes are added in each group.
[0035] As a preferred embodiment, the method of the present application is used for detecting 9 common genotypes (G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8]) of group A rotavirus, wherein G1, G9 and P[6] are in group one (group A), G2, G4 and P[4] are in group two (group B), and G3, G8 and P[8] are in group three (group C). Each sample to be tested is divided into three groups for reaction, and each group reaction is performed in a reaction tube. Specifically:
[0036] The sequences of the primers and probes in group one (group A) include:
[0037] In the real-time RT-PCR of G1 genotype: the upstream primer G1F is shown as SEQ ID NO: 1; the downstream primer G1R is shown as SEQ ID NO: 2; the probe G1P1 is shown as SEQ ID NO: 3, and / or the probe G1P2 is shown as SEQ ID NO: 4.
[0038] G9 genotype in Real-time RT-RT-PCR: the upstream primer G9F is as set forth in SEQ ID NO: 5; the downstream primer G9R is as set forth in SEQ ID NO: 6; the probe G9P is as set forth in SEQ ID NO: 7.
[0039] P[6] genotype in Real-time RT-RT-PCR: the upstream primer P[6]F is as set forth in SEQ ID NO: 8; the downstream primer P[6]R is as set forth in SEQ ID NO: 9; the probe P[6]P is as set forth in SEQ ID NO: 10.
[0040] The sequences of the primers and probes in Group Two (Group B) include:
[0041] G2 genotype in Real-time RT-RT-PCR: the upstream primer G2F is as set forth in SEQ ID NO: 11; the downstream primer G2R is as set forth in SEQ ID NO: 12; the probe G2P is as set forth in SEQ ID NO: 13.
[0042] G4 genotype in Real-time RT-RT-PCR: the upstream primer G4F is as set forth in SEQ ID NO: 14; the downstream primer G4R is as set forth in SEQ ID NO: 15; the probe G4P is as set forth in SEQ ID NO: 16.
[0043] P[4] genotype in Real-time RT-RT-PCR: the upstream primer P[4]F1 is as set forth in SEQ ID NO: 17, and / or the upstream primer P[4]F2 is as set forth in SEQ ID NO: 18; the downstream primer P[4]R is as set forth in SEQ ID NO: 19; the probe P[4]P1 is as set forth in SEQ ID NO: 20, and / or the probe P[4]P2 is as set forth in SEQ ID NO: 21.
[0044] The sequences of the primers and probes in Group Three (Group C) include:
[0045] G3 genotype in Real-time RT-RT-PCR: the upstream primer G3F is as set forth in SEQ ID NO: 22; the downstream primer G3R1 is as set forth in SEQ ID NO: 23, and / or the downstream primer G3R2 is as set forth in SEQ ID NO: 24; the probe G3P is as set forth in SEQ ID NO: 25.
[0046] G8 genotype Real-time RT-RT-PCR: the upstream primer G8F1 is as shown in SEQ ID NO: 26, and / or the upstream primer G8F2 is as shown in SEQ ID NO: 27; the downstream primer G8R is as shown in SEQ ID NO: 28; the probe G8P is as shown in SEQ ID NO: 29.
[0047] P[8] genotype Real-time RT-RT-PCR: the upstream primer P[8]F is as shown in SEQ ID NO: 30; the downstream primer P[8]R is as shown in SEQ ID NO: 31; the probe P[8]P is as shown in SEQ ID NO: 32.
[0048] In a further scheme, in step (2), the target sequences of G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8] genotypes are recombined and spliced, the recombined sequence is SEQ ID NO: 33, which is cloned into the pGEM-T vector to obtain a recombinant plasmid, and then the plasmid is amplified, the amplification product is purified, in vitro transcription and purification are performed, and an RNA standard is obtained, the nucleic acid sequence of the RNA standard is the same as the recombined sequence, which is shown as SEQ ID NO: 33. The concentration is determined and converted into copy number.
[0049] In the present application, the RNA standard is to ensure that the RNA concentration of the sample to be tested is within the linear range of real-time quantitative fluorescent RT-PCR, and to ensure the objective accuracy of the detection.
[0050] In a further scheme, in step (3), the final concentration of the upstream primer and the downstream primer of each genotype in the reaction system of the multiplex real-time fluorescent quantitative RT-PCR is 200-400nM.
[0051] Preferably, the final concentration of the upstream primer and the downstream primer of each genotype is 200nM.
[0052] In a further scheme, in step (3), the final concentration of the probe of each genotype is 100-200nM.
[0053] Preferably, the final concentration of the probe of each genotype is 100nM.
[0054] In a further scheme, in step (3), the volume of the template is 2.5-5μL.
[0055] Preferably, the volume of the template is 5μL.
[0056] In a further scheme, in step (3), the reaction conditions of the multiplex real-time fluorescent quantitative RT-PCR include:
[0057] 48-55°C reverse transcription 10-15 min, 95°C RT-PCR start activation 20-40 s, 95°C denaturation 10-20 s, 55-60°C annealing and extension 30-60 s, 35-45 cycles, collect fluorescence signal after each cycle;
[0058] Preferably, the reaction conditions of multiplex real-time fluorescent quantitative RT-PCR are as follows: 53°C reverse transcription 15 min, 95°C start activation 30 s, 95°C denaturation 10 s, 58°C annealing and extension 45 s, 40 cycles, detect fluorescence signal after each cycle.
[0059] Further, standard curves of each genotype are drawn, including:
[0060] In group one (group A):
[0061] The linear regression equation of G1 is Y=-3.846lgX+41.556, wherein y is Ct value, x is template copy number, the curve regression coefficient R 2 =0.994, and the amplification efficiency Eff%=81.983.
[0062] The linear regression equation of G9 is Y=-3.572lgX+40.172, wherein y is Ct value, x is template copy number, the curve regression coefficient R 2 =0.994, and the amplification efficiency Eff%=90.520.
[0063] The linear regression equation of P[6] is Y=-3.52lgX+41.332, wherein y is Ct value, x is template copy number, the curve regression coefficient R 2 =1, and the amplification efficiency Eff%=92.342.
[0064] In group two (group B):
[0065] The linear regression equation of G2 is Y=-3.564lgX+38.816, wherein y is Ct value, x is template copy number, the curve regression coefficient R 2 =0.998, and the amplification efficiency Eff%=90.792.
[0066] The linear regression equation of G4 is Y=-3.201lgX+42.159, wherein y is Ct value, x is template copy number, the curve regression coefficient R 2 =0.991, and the amplification efficiency Eff%=105.302.
[0067] The linear regression equation of P[4] is Y=-3.442lgX+37.974, wherein y is Ct value, x is template copy number, the curve regression coefficient R 2= 0.99, amplification efficiency Eff% = 95.218.
[0068] In group three (group C):
[0069] The linear regression equation of G3 is: Y = -3.514lgX + 39.97, wherein y is the Ct value, x is the template copy number, and the curve regression coefficient R 2 = 0.994, amplification efficiency Eff% = 92.546.
[0070] The linear regression equation of G8 is: Y = -3.381lgX + 35.751, wherein y is the Ct value, x is the template copy number, and the curve regression coefficient R 2 = 0.99, amplification efficiency Eff% = 97.608.
[0071] The linear regression equation of P[8] is: Y = -3.52lgX + 40.414, wherein y is the Ct value, x is the template copy number, and the curve regression coefficient R 2 = 0.991, amplification efficiency Eff% = 92.335.
[0072] Further, in the basic concept (6), the minimum detection limit of each genotype is determined, including:
[0073] In group one (group A):
[0074] The minimum copy number that G1 can detect is 1 copies / μL; the minimum copy number that G9 can detect is 1 copies / μL; the minimum copy number that P[6] can detect is 1 copies / μL.
[0075] In group two (group B):
[0076] The minimum copy number that G2 can detect is 1 copies / μL; the minimum copy number that G4 can detect is 1 copies / μL; the minimum copy number that P[4] can detect is 1 copies / μL.
[0077] In group three (group C):
[0078] The minimum copy number that G3 can detect is 1 copies / μL; the minimum copy number that G8 can detect is 1 copies / μL; the minimum copy number that P[8] can detect is 1 copies / μL.
[0079] Further, the method for interpreting the results of the sample to be tested includes:
[0080] Further, in step (4), the method for interpreting the results of the sample to be tested includes:
[0081] If the detection result of the sample to be tested is CT≤35, the curve is S-shaped and has a clear exponential growth period, it is judged as nucleic acid detection positive;
[0082] If the detection result of the sample to be tested is 35<CT≤38, at this time the sample is repeatedly detected, if the re-reading result CT value is still in the range of 35-38, the curve is S-shaped and has a clear exponential growth period, it is judged as nucleic acid detection positive, otherwise it is negative;
[0083] If the detection result of the sample to be tested is CT>38 or not detected, the result is judged as nucleic acid detection negative.
[0084] Specifically:
[0085] FAM channel (G1 / P[4] / G3):
[0086] A. Positive: the detection result of the sample to be tested is CT≤35, the curve is S-shaped and has a clear exponential growth period, it is judged as G1 / P[4] / G3 nucleic acid detection positive;
[0087] B. Suspicious: the detection result of the sample to be tested is 35<CT≤38, at this time the sample should be repeatedly detected, if the re-reading result CT value is still in the range of 35-38, the curve is S-shaped and has a clear exponential growth period, it is judged as G1 / P[4] / G3 nucleic acid detection positive, otherwise it is negative;
[0088] C. Negative: in CT>38 or not detected, the result is judged as G1 / P[4] / G3 nucleic acid detection negative.
[0089] VIC channel (G9 / G2 / P[8]):
[0090] A. Positive: the detection result of the sample to be tested is CT≤35, the curve is S-shaped and has a clear exponential growth period, it is judged as G9 / G2 / P[8] nucleic acid detection positive;
[0091] B. Suspicious: the detection result of the sample to be tested is 35<CT≤38, at this time the sample should be repeatedly detected, if the re-reading result CT value is still in the range of 35-38, the curve is S-shaped and has a clear exponential growth period, it is judged as G9 / G2 / P[8] nucleic acid detection positive, otherwise it is negative;
[0092] C. Negative: in CT>38 or not detected, the result is judged as G9 / G2 / P[8] nucleic acid detection negative.
[0093] CY5 channel (P[6] / G4 / G8):
[0094] A. Positive: the detection result of the sample to be tested is CT≤35, the curve is S-shaped and has a clear exponential growth period, it is judged as P[6] / G4 / G8 nucleic acid detection positive;
[0095] B. Suspicious: the detection result of the sample to be tested is 35 < CT < 38, at this time the sample should be repeatedly detected, if the re-reading result CT value is still in the range of 35-38, the curve is S-shaped and there is an obvious exponential growth period, then it is judged that the P[6] / G4 / G8 nucleic acid detection is positive, otherwise it is negative;
[0096] C. Negative: CT > 38 or not detected, the result of this time is judged as P[6] / G4 / G8 nucleic acid detection negative.
[0097] After the above technical scheme is adopted, the present application has the following beneficial effects compared with the prior art:
[0098] 1. The present application provides a nucleic acid group for multiplex real-time fluorescent quantitative RT-PCR detection of A group rotavirus genotyping, 9 genotypes can be detected in groups, preferably in three groups, the primers and probes of each genotype do not have cross-reaction, and the detection has high sensitivity and strong specificity.
[0099] 2. The kit for multiplex real-time fluorescent quantitative RT-PCR detection of A group rotavirus genotyping provided by the present application is convenient to use, simple to operate, and uses few reagents, which can effectively save rare samples, save costs, reduce pollution in the operation process, avoid excessive consumption of repeated operations, save labor, realize rapid screening, have strong specificity, and have high sensitivity.
[0100] 3. The method of the present application can quickly and efficiently detect 9 genotypes of A group rotavirus, is simple to operate, has fast diagnosis speed, high sensitivity, strong specificity, can save limited samples and costs, has more objective and accurate result interpretation, reduces human factor difference, and is more comprehensive for A group rotavirus epidemic type detection in China.
[0101] The specific embodiments of the present application will be further described in detail below with reference to the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS
[0102] The drawings are part of the present application, which are used to provide further understanding of the present application, the schematic embodiments of the present application and the description thereof are used to explain the present application, but do not constitute improper limitation on the present application. Obviously, the drawings in the following description are only some embodiments, and other drawings can be obtained by those skilled in the art without creative labor. In the drawings:
[0103] Figures 1-9 are the amplification curve diagrams of G1, G9, P[6], G2, G4, P[4], G3, G8 and P[8] genotypes in turn;
[0104] Figures 10-18The standard curve schematic diagram of G1, G9, P[6], G2, G4, P[4], G3, G8 and P[8] genotypes in turn;
[0105] Figures 19-27 The specific detection result diagram of G1, G9, P[6], G2, G4, P[4], G3, G8 and P[8] genotypes in turn;
[0106] Figures 28-36 The intra-assay repeatability amplification curve of G1, G9, P[6], G2, G4, P[4], G3, G8 and P[8] genotypes in turn.
[0107] It should be noted that these drawings and written descriptions are not intended to limit the scope of the inventive concept in any way, but to illustrate the inventive concept to those skilled in the art by referring to specific embodiments. DETAILED DESCRIPTION
[0108] In order to make the purpose, technical scheme and advantages of the embodiments of the present application more clear, the technical scheme in the embodiments will be described clearly and completely below in conjunction with the drawings in the embodiments of the present application. The following embodiments are used to illustrate the present application, but not to limit the scope of the present application.
[0109] Embodiment 1
[0110] 1. Nucleic acid group for three-tube multiplex real-time fluorescent quantitative RT-PCR detection of group A rotavirus genotyping
[0111] According to the complete sequence corresponding to the reference sequence of the researched genotype found in genebank, the primer probe is designed by using Primer premier 5. The nucleic acid sequences of the primers and probes of each genotype are shown in Table 1.
[0112] Table 1 Nucleic acid sequences of primers and probes of each genotype
[0113]
[0114]
[0115] 2. Synthesis of plasmid and preparation of RNA standard
[0116] (1) Plasmid synthesis
[0117] TM 5α competent cells, evenly coated on the solid medium resistant to AMP, incubated in an incubator at 37°C overnight. White single colonies were picked and added to AMP-resistant liquid medium, and cultured at 37°C with 180 r / min shaking for 12-16 hours. After the bacteria were increased, plasmids were extracted using an endotoxin-free plasmid extraction kit.
[0118] (2) Preparation of RNA standard by in vitro transcription
[0119] The plasmid in step (1) was subjected to PCR amplification, and the upstream primer M13F was TCCTGTGTGAAATTGTTATCCGCT, i.e., SEQ ID NO: 34; and the downstream primer M13R was CGCCAGGGTTTTCCCAGTCACGAC, i.e., SEQ ID NO: 35. The PCR product was subjected to gel electrophoresis, and then recovered and purified using a gel recovery kit. The gel recovery and purification product was subjected to in vitro transcription using an in vitro transcription kit, and the in vitro transcription product was purified using a transcript purification kit, to obtain an RNA standard, the concentration of which was determined and converted into copy number, and stored at -80°C.
[0120] 3. Determination of multiplex real-time fluorescent quantitative RT-PCR reaction system
[0121] 10 2 copies / μL, 10 4 copies / μL, and 10 6 copies / μL of the RNA standard were used as templates to optimize the primer concentration (200-400 nM), the probe concentration (100-200 nM), and the template amount (2.5-5 μL), respectively. Single factor variance analysis was performed to compare whether there was a statistical difference between the CT values. If there was a statistical difference between the CT values, the optimal scheme was selected. If there was no statistical difference between the CT values, the amplification efficiency between different concentrations or volumes was compared to determine the optimal scheme.
[0122] After condition screening, the optimal primer final concentration was 200 μM, the optimal probe final concentration was 100 μM, and the optimal template volume was 5 μL.
[0123] 4. Determination of multiplex real-time fluorescent quantitative RT-PCR reaction conditions
[0124] 10 2 copies / μL, 10 4 copies / μL, and 10 6The reverse transcription temperature (48-55 °C), annealing temperature (55-60 °C) and cycle number (35-45) were optimized respectively by taking the RNA standard with a concentration of 1,000 copies / μL as template. The statistical difference between CT values was compared by one-way ANOVA. If there was statistical difference between CT values, the optimal scheme was selected; if there was no statistical difference between CT values, the amplification efficiency of different temperatures or cycle numbers was compared to determine the optimal scheme.
[0125] Through conditional screening, the optimal reaction condition was obtained as follows: reverse transcription at 53 °C for 15 min, initial activation at 95 °C for 30 s, denaturation at 95 °C for 10 s, annealing and extension at 58 °C for 45 s, and detection of fluorescence signal after 40 cycles.
[0126] 5. Preparation of standard curve
[0127] The prepared RNA standard was diluted by 10 times gradient, and the reaction system and reaction condition determined were applied to prepare the standard curve. The standard curve of each genotype was established by taking the RNA standard copy number as abscissa and CT value as ordinate.
[0128] Results:
[0129] In group one (group A):
[0130] The linear regression equation of G1 was Y=-3.846lgX+41.556, wherein y was Ct value, x was template copy number, the curve regression coefficient R was 0.994, and the amplification efficiency Eff% was 81.983. 2
[0131] The linear regression equation of G9 was Y=-3.572lgX+40.172, wherein y was Ct value, x was template copy number, the curve regression coefficient R was 0.994, and the amplification efficiency Eff% was 90.520. 2
[0132] The linear regression equation of P[6] was Y=-3.52lgX+41.332, wherein y was Ct value, x was template copy number, the curve regression coefficient R was 1, and the amplification efficiency Eff% was 92.342. 2
[0133] In group two (group B):
[0134] The linear regression equation of G2 was Y=-3.564lgX+38.816, wherein y was Ct value, x was template copy number, the curve regression coefficient R was 0.998, and the amplification efficiency Eff% was 90.792. 2
[0135] The linear regression equation of G4 is: Y = -3.201 lgX + 42.159, wherein y is the Ct value, x is the template copy number, the curve regression coefficient R 2 = 0.991, and the amplification efficiency Eff% = 105.302.
[0136] The linear regression equation of P[4] is: Y = -3.442 lgX + 37.974, wherein y is the Ct value, x is the template copy number, the curve regression coefficient R 2 = 0.99, and the amplification efficiency Eff% = 95.218.
[0137] In group three (group C):
[0138] The linear regression equation of G3 is: Y = -3.514 lgX + 39.97, wherein y is the Ct value, x is the template copy number, the curve regression coefficient R 2 = 0.994, and the amplification efficiency Eff% = 92.546.
[0139] The linear regression equation of G8 is: Y = -3.381 lgX + 35.751, wherein y is the Ct value, x is the template copy number, the curve regression coefficient R 2 = 0.99, and the amplification efficiency Eff% = 97.608.
[0140] The linear regression equation of P[6] is: Y = -3.52 lgX + 40.414, R 2 = 0.991, wherein y is the Ct value, x is the template copy number, the curve regression coefficient R 2 = 0.991, and the amplification efficiency Eff% = 92.335.
[0141] 6, Minimum detection limit of multiplex real-time fluorescent quantitative RT-PCR
[0142] The minimum detection limit is determined by using gradient dilution of RNA standard, each gradient is repeated for not less than 3 times, and the minimum level of virus standard with a positive rate of more than 95% is used as the minimum detection limit.
[0143] Results:
[0144] In group one (group A):
[0145] The minimum copy number that can be detected by G1 is 1 copies / μL; the minimum copy number that can be detected by G9 is 1 copies / μL; and the minimum copy number that can be detected by P[6] is 10 copies / μL.
[0146] In group two (group B):
[0147] The minimum copy number that G2 can detect is 1 copies / μL; the minimum copy number that G4 can detect is 1 copies / μL; the minimum copy number that P[4] can detect is 1 copies / μL.
[0148] In group three (group C):
[0149] The minimum copy number that G3 can detect is 1 copies / μL; the minimum copy number that G8 can detect is 1 copies / μL; the minimum copy number that P[8] can detect is 1 copies / μL.
[0150] 7. Specific detection of multiplex real-time fluorescent quantitative RT-PCR
[0151] The rotavirus types in group A for cross-reaction verification are G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8], and different type samples are selected to complete the intra-group and inter-group cross-reaction experiments of the three groups.
[0152] Results:
[0153] In group one (group A):
[0154] The Ct values of G1, G9 and P[6] type virus standards are 11.823, 11.551 and 17.445 respectively, and the cross-reaction control samples, NTC controls and negative controls have no amplification.
[0155] In group two (group B):
[0156] The Ct values of G2, G4 and P[4] type virus standards are 12.275, 16.901 and 14.283 respectively, and the cross-reaction control samples, NTC controls and negative controls have no amplification.
[0157] In group three (group C):
[0158] The Ct values of G3, G8 and P[8] type virus standards are 10.307, 13.421 and 14.707 respectively, and the cross-reaction control samples, NTC controls and negative controls have no amplification.
[0159] 8. Reproducibility detection of multiplex real-time fluorescent quantitative RT-PCR
[0160] 10 6 copies / μL high, medium and low concentration standards of each genotype are selected, three-tube multiplex real-time fluorescent RT-PCR detection is performed, and each genotype is repeated 3 times to complete the batch reproducibility detection. 4 2 copies / μL high, medium and low concentration standards of each genotype are selected, three-tube multiplex real-time fluorescent RT-PCR detection is performed, and each genotype is repeated 3 times to complete the batch reproducibility detection.
[0161] The results are shown in Tables 2-4 below.
[0162] Group one (Group A):
[0163] Table 2 Intra-assay reproducibility of Group A rotavirus G1, G9, P[6] triplex Taqman real time RT-PCR method
[0164]
[0165] Group two (Group B):
[0166] Table 3 Intra-assay reproducibility of Group A rotavirus G2, G4, P[4] triplex Taqman real time RT-PCR method
[0167]
[0168] Group three (Group C):
[0169] Table 4 Intra-assay reproducibility of Group A rotavirus G3, G8, P[8] triplex Taqman real time RT-PCR method
[0170]
[0171] Example 2 Detection of 20 actual samples
[0172] 1. Virus nucleic acid extraction
[0173] Virus nucleic acid was extracted from Group A rotavirus positive samples using a viral RNA extraction kit as a template for detection.
[0174] 2. PCR amplification detection
[0175] (1) 22 PCR reaction solutions (20 + 2 negative controls) were prepared according to the following composition, note that before preparation, each component should be mixed and centrifuged, and after preparation, the PCR reaction solution should be mixed and centrifuged.
[0176] Group one (Group A):
[0177]
[0178] Group two (Group B):
[0179]
[0180] Group three (Group C):
[0181]
[0182] (2) The reaction system is divided into 20 μL / tube and placed into the PCR reaction tube. The reaction tube with the PCR reaction solution is moved to the sample processing area.
[0183] (3) The reaction template and negative control are added into the sample processing area, each 5 μL, mixed and centrifuged.
[0184] (4) Fluorescence quantitative PCR amplification. The reaction tube is placed into the instrument. The program is set as 53℃ reverse transcription for 15 min, 95℃ starting activation for 30 s, 95℃ denaturation for 10 s, 58℃ annealing and extension for 45 s, 40 cycles, and the fluorescence signal is detected after each cycle.
[0185] (5) The experiment is ended and the result is interpreted.
[0186] 3. Results: A total of 20 RVA positive samples were detected, including 13 G9P[8] type, 3 G2P[4] type, 3 G3P[8] type and 1 G1P[8] type.
[0187] The above only describes the preferred embodiments of the present application and does not limit the present application in any form. Although the present application has been disclosed as above with the preferred embodiments, it is not intended to limit the present application. Any person skilled in the art can make some changes or modifications to the above-mentioned technical content without departing from the technical solution of the present application, and any simple modification, equivalent change and modification of the above-mentioned embodiments according to the technical essence of the present application still belong to the scope of the present application.
Claims
1. A nucleic acid combination for multiplex real-time quantitative RT-PCR detection of group A rotavirus genotyping, characterized in that, The genotypes for the nucleic acid combination detection include G1, G2, G3, G4, G8, G9, P[4], P[6], and P[8], and are divided into three groups for detection: G1, G9, and P[6] are group A, G2, G4, and P[4] are group B, and G3, G8, and P[8] are group C. The nucleic acid combination includes: The first primer pair and the first probe are used to detect the G1 genotype. The nucleic acid sequences of the first primer pair are shown in SEQ ID NO:1 and SEQ ID NO:
2. The nucleic acid sequences of the first probe are shown in SEQ ID NO:3 and SEQ ID NO:
4. The fluorescent labels are 5'FAM and 3'MGB. The second primer pair and the second probe are used to detect the G9 genotype. The nucleic acid sequences of the second primer pair are shown in SEQ ID NO:5 and SEQ ID NO:6; the nucleic acid sequence of the second probe is shown in SEQ ID NO:7, and the fluorescent labels are 5'VIC and 3'MGB. The third primer pair and the third probe are used to detect the P[6] genotype. The nucleic acid sequences of the third primer pair are shown in SEQ ID NO:8 and SEQ ID NO:
9. The nucleic acid sequence of the third probe is shown in SEQ ID NO:
10. The fluorescent label is 5'CY5, 3'MGB. The fourth primer pair and fourth probe are used to detect the G2 genotype. The nucleic acid sequences of the fourth primer pair are shown in SEQ ID NO:11 and SEQ ID NO:
12. The nucleic acid sequence of the fourth probe is shown in SEQ ID NO:13, and the fluorescent labels are 5'VIC and 3'BHQ-1. The fifth primer pair and the fifth probe are used to detect the G4 genotype. The nucleic acid sequences of the fifth primer pair are shown in SEQ ID NO:14 and SEQ ID NO:
15. The nucleic acid sequence of the fifth probe is shown in SEQ ID NO:16, and the fluorescent label is 5'CY5, 3'BHQ-2. The sixth primer pair and the sixth probe are used to detect the P[4] genotype. The nucleic acid sequences of the upstream primer of the sixth primer pair are shown in SEQ ID NO:17 and SEQ ID NO:18, and the nucleic acid sequences of the downstream primer are shown in SEQ ID NO:
19. The nucleic acid sequences of the sixth probe are shown in SEQ ID NO:20 and SEQ ID NO:21, and the fluorescent labels are 5'FAM and 3'BHQ-1. The seventh primer pair and seventh probe are used to detect the G3 genotype. The nucleic acid sequence of the upstream primer of the seventh primer pair is shown in SEQ ID NO:22, and the nucleic acid sequences of the downstream primer are shown in SEQ ID NO:23 and SEQ ID NO:
24. The nucleic acid sequence of the seventh probe is shown in SEQ ID NO:25, and the fluorescent label is 5'FAM, 3'MGB. The eighth primer pair and eighth probe are used for detecting the G8 genotype. The nucleic acid sequences of the upstream primer of the eighth primer pair are shown in SEQ ID NO:26 and SEQ ID NO:27, and the nucleic acid sequence of the downstream primer is shown in SEQ ID NO:
28. The nucleic acid sequence of the eighth probe is shown in SEQ ID NO:29, and it is fluorescently labeled as 5'CY5, 3'MGB. The ninth primer pair and the ninth probe are used to detect the P[8] genotype. The nucleic acid sequences of the ninth primer pair are shown in SEQ ID NO:30 and SEQ ID NO:
31. The nucleic acid sequence of the ninth probe is shown in SEQ ID NO:
32. The fluorescent labels are 5'VIC and 3'MGB.
2. A kit for multiplex real-time quantitative RT-PCR detection of group A rotavirus genotyping, characterized in that, The kit comprises the nucleic acid combination as described in claim 1.
3. The reagent kit according to claim 2, characterized in that, The kit also includes quality control samples containing the target sequences of genotypes G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8], the nucleic acid sequences of which are shown in SEQ ID NO:
33.
4. A multiplex real-time quantitative RT-PCR detection method for group A rotavirus genotyping for non-diagnostic purposes, characterized in that, Includes the following steps: (1) Extract RNA from the sample to be tested for later use; (2) Prepare RNA standards containing the target sequences of genotypes G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8] at a set concentration; (3) Using RNA and RNA standard of the sample to be tested as templates, the nucleic acid combination described in claim 1 is used to perform multiplex real-time fluorescence quantitative RT-PCR detection in groups. Based on the detection results of RNA standard, standard curves of each genotype are plotted to determine the limit of detection of each genotype. (4) Interpret the results of the sample to be tested; When grouping, the samples were divided into three groups for testing: G1, G9, P[6] were group A, G2, G4, P[4] were group B, and G3, G8, P[8] were group C. Primers and probes corresponding to the genotypes were added to each group.
5. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 4, characterized in that, In step (2), the target sequences of genotypes G1, G2, G3, G4, G8, G9, P[4], P[6] and P[8] are recombined and spliced together. The recombinant sequence is as shown in SEQ ID NO:
33. It is cloned into the pGEM-T vector to obtain a recombinant plasmid. The plasmid is amplified, the amplification product is purified, and then transcribed and purified in vitro to obtain an RNA standard. The nucleic acid sequence of the RNA standard is the same as the recombinant sequence, as shown in SEQ ID NO:
33.
6. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 4, characterized in that, In step (3), the final concentration of the upstream and downstream primers for each genotype in the multiplex real-time quantitative RT-PCR reaction system is 200-400 nM.
7. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 6, characterized in that, The final concentration of the upstream and downstream primers for each genotype was 200 nM.
8. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 4, characterized in that, In step (3), the final concentration of the probe for each genotype is 100-200 nM.
9. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 8, characterized in that, The final concentration of the probe for each genotype was 100 nM.
10. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 4, characterized in that, In step (3), the volume of the template is 2.5-5µL.
11. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 10, characterized in that, The template volume is 5µL.
12. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 4, characterized in that, In step (3), the reaction conditions for multiplex real-time quantitative RT-PCR include: Reverse transcription at 48-55℃ for 10-15 min, RT-PCR activation at 95℃ for 20-40 s, denaturation at 95℃ for 10-20 s, annealing and extension at 55-60℃ for 30-60 s, for 35-45 cycles, and collect fluorescence signals after each cycle.
13. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to claim 12, characterized in that, The reaction conditions for multiplex real-time quantitative RT-PCR were as follows: reverse transcription at 53℃ for 15 min, activation at 95℃ for 30 s, denaturation at 95℃ for 10 s, annealing and extension at 58℃ for 45 s, for 40 cycles, and fluorescence signal was detected after each cycle.
14. The multiplex real-time quantitative RT-PCR detection method for non-diagnostic rotavirus genotyping of group A virus according to any one of claims 4-13, characterized in that, In step (4), the methods for interpreting the results of the sample to be tested include: If the test result of the sample is CT≤35, the curve is S-shaped and has a clear exponential growth period, it is judged to be positive for nucleic acid test; If the test result of the sample is 35 < CT ≤ 38, the sample should be tested again. If the CT value of the retest result is still in the range of 35-38, and the curve is S-shaped with a clear exponential growth period, then the nucleic acid test is considered positive; otherwise, it is considered negative. If the test result of the sample is CT>38 or not detected, the result is judged as a negative nucleic acid test.
Citation Information
Patent Citations
Fluorogenic quantitative PCR (polymerase chain reaction) detecting method for A type rotavirus
CN105087828A