Adeno-associated virus mutants with high efficiency of infection of ht-22 cells
By constructing an AAV2 peptide mutant library and screening for AAV2 capsid protein mutants with inserted heterologous peptides, the problem of AAV2 serotypes being unable to efficiently infect HT-22 cells was solved, achieving more efficient infection and cost savings, and supporting gene therapy research on central nervous system diseases.
Patent Information
- Application Number
- CN202310103538.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-13
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2043-02-13
AI Technical Summary
The existing adeno-associated virus (AAV2) serotype is difficult to infect HT-22 cells efficiently, resulting in large viral loads and impacting cell state in in vitro studies.
A peptide mutant library of AAV2 was constructed, and AAV2 serum capsid protein mutants with inserted heteropeptides were obtained through screening. Specifically, amino acid fragments MSTVGKD or VQGRVHE were inserted at positions 587-588 to form AAV2-HT01 and AAV2-HT02 mutants, which were used to infect HT-22 cells.
Under the condition of MOI=1E+5, the AAV2-HT01 and AAV2-HT02 mutants significantly improved the infection efficiency of HT-22 cells, reduced the amount of virus used, saved experimental costs, and made gene therapy research for central nervous system diseases possible.
Smart Images

Figure CN116284262B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the packaging and screening of viral vectors, and more particularly to the packaging and screening of AAV mutants, specifically adeno-associated virus mutants that efficiently infect HT-22 cells. Background Technology
[0002] Central nervous system (CNS) diseases seriously affect patients' physical and mental health and quality of life. Due to the complexity of the CNS itself and the blood-brain barrier (BBB) which hinders drug delivery, it remains difficult to treat neurological diseases with commonly used surgical or traditional drugs. Therefore, scientists in various fields are currently studying the feasibility of gene therapy-based treatments for neurological diseases.
[0003] Adeno-associated virus (AAV) is a small, non-enveloped virus with an icosahedral structure, and is currently the simplest single-stranded DNA-deficient virus discovered. Due to its good safety profile, broad host cell range (dividing and non-dividing cells), low immunogenicity, and long duration of exogenous gene expression in vivo, it has gradually become an important platform for in vivo gene therapy delivery. However, the delivery efficiency of gene vectors is a significant obstacle to the development of AAV-mediated gene therapy for the central nervous system. Unlike other viral vectors, AAV's different capsid proteins can recognize different host cell surface receptors, enabling rAAV viral vectors to specifically infect different tissues. Therefore, many studies have used various cell lines, primary cells, mouse models, or non-human primate models to screen for AAV capsid proteins that can efficiently infect, i.e., AAV serotypes.
[0004] HT-22 cells are a mouse hippocampal neuronal cell line. This cell line is an excellent model for in vitro studies of glutamate toxicity and has been widely used in many neurodegenerative diseases, such as Alzheimer's Disease and Parkinson's Disease. Many researchers also use this cell line to conduct related in vitro mechanism studies. Our previous findings indicated that AAV2 wild-type serotype infection of HT-22 cells is inefficient, leading to the need for larger viral loads in in vitro studies. Furthermore, increasing the viral load can negatively impact cell state. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention designs and constructs a peptide mutation library of AAV2. Through library screening, AAV mutants that can efficiently infect the HT-22 cell line are obtained, so as to meet the needs of the HT-22 cell line for in vitro research applications.
[0006] This invention discloses a mutant of AAV2 serum capsid protein with inserted heteropeptide.
[0007] The heteropeptide is a polypeptide whose amino acid sequence is MSTVGKD or VQGRVHE;
[0008] The AAV2 serum capsid protein amino acid 587-588 is inserted with the heteropeptide.
[0009] This invention discloses a nucleic acid molecule encoding the above-mentioned AAV2 serum capsid protein mutant.
[0010] This invention discloses a nucleic acid vector that can operatively link the above-mentioned nucleic acid molecules.
[0011] This invention discloses a host cell containing the above-mentioned nucleic acid vector.
[0012] This invention discloses a composition or kit containing the above-mentioned AAV2 serum capsid protein mutant, nucleic acid molecule or nucleic acid vector.
[0013] This invention discloses the use of the above-mentioned AAV2 serum capsid protein mutant, nucleic acid molecule or nucleic acid vector in infecting HT-22 cells, wherein the use is for non-diagnostic and non-therapeutic purposes.
[0014] This invention discloses the use of the above-mentioned AAV2 serum capsid protein mutant, nucleic acid molecule or nucleic acid carrier in the preparation of drugs for treating central nervous system diseases.
[0015] Compared with the prior art, the present invention has the following beneficial effects:
[0016] This invention constructs a peptide mutant library of AAV2 and, after screening and verification, obtains two new AAV2 mutants, AAV2-HT01 and AAV2-HT02, with seven amino acids inserted. The amino acid fragment inserted at positions 587-588 of the AAV2 capsid protein in AAV2-HT01 is MSTVGKD; the amino acid fragment inserted at positions 587-588 of the AAV2 capsid protein in AAV2-HT02 is VQGRVHE. These mutants can effectively infect HT-22 cells at an MOI of 1E+5, achieving a higher infection rate than the natural AAV2 serotype at MOI=1E+5. This effectively reduces the amount of AAV-infected cells used, saving experimental costs, and makes it feasible to study the mechanisms of gene therapy for central nervous system diseases in HT-22 cells. Attached Figure Description
[0017] Figure 1This is a flowchart illustrating the expression pAAV-shortUBC-mScarlet-polyA-P40-AAV2-Cap-FLEX-SV40polyA in Example 1;
[0018] Figure 2 The pAAV-shortUBC-mScarlet-polyA-P40-AAV2-Cap-FLEX-SV40polyA-WPRE spectrum from Example 1;
[0019] Figure 3 Flowchart for AAV2 library construction and screening;
[0020] Figure 4 Fluorescence images of HT-22 cells infected with different serotypes in Example 2;
[0021] Figure 5 The graph shows the luciferin (RLU) values of fireflies in HT-22 cells infected with different serotypes in Example 2. Detailed Implementation
[0022] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.
[0023] Example 1: Construction of AAV27-mer random peptide insertion library:
[0024] Mutation site selection: AAV2 / 2 capsid protein amino acid 587-588.
[0025] The mutation site is based on the AAV2 / 2 serotype. The wild-type AAV2 / 2 capsid protein sequence is from NCBI number NC_001401.
[0026] AAV27-mer random peptide insertion library construction, the library consists of the following vectors:
[0027] pAAV-short UBC-mScarlet-polyA-P40-AAV2-Cap-FLEX-SV40 polyA, such as Figure 1-2 As shown.
[0028] Example 2: AAV2 library construction and screening process:
[0029] 1. By constructing a random mutant library of AAV2 peptides, novel AAV2 mutants with 7 inserted amino acids were screened, such as... Figure 3 As shown.
[0030] 1.1 Chemical synthesis of the following two fragments of AAV2 / 2-7mer-NNS:
[0031] 5'GGTCTCGCCTCCAGAGAGGCAACNNSNNSNNSNNSNSNNSNNSAGACAAGCAGCTACCGGGAGACC 3'(SEQ ID NO:1)
[0032] 5'GGTCTCCCGGTAGCTGCTTGTCTSNNSNNSNNSNNSNNSNNSNNGTTGCCTCTCTGGAGGCGAGACC 3'(SEQ ID NO:2)
[0033] 1.2 10 μL each of the synthesized AAV2 / 2-7mer-NNS positive and reverse strand primers (final primer concentration 10 mM) were added and annealed to obtain the AAV2 / 2-7mer-NNS template. The annealing program was: 95℃, 5 min; 95℃, 1 min; 92 min, 1 min; 4℃, 60 min. In steps two and three, the temperature was decreased by 3℃ for each cycle, for a total of 25 cycles.
[0034] 1.3 The plasmid pAAV-short UBC-mScarlet-polyA-P40-AAV2-Cap-FLEX-SV40 polyA (its structure and insertion site are as follows) was prepared. Figure 1 As shown in Table 1, BsaI was used for single enzyme digestion. The digestion system (50 μL) is shown in Table 1.
[0035] Table 1
[0036]
[0037] After enzyme digestion at 55℃ for 4 hours, 1% agarose gel electrophoresis was performed. Under UV light, large fragments were cut off with a blade and then recovered and purified.
[0038] 1.4 The purified enzyme digestion product obtained in step 1.3 and the AAV2 / 2-7mer-NNS nucleotide sequence obtained in step 1.2 were ligated using T4 DNA ligase. The ligation was performed using Takara's T4 DNA ligase, with a 10 μL reaction volume as shown in Table 2, and incubated overnight at 4°C.
[0039] Table 2
[0040]
[0041] 1.5 Add 10 μL of enzyme ligation product to 50 μL of library-specific electroporation competent cells (purchased from Lucigen), mix well, and transfer to a pre-cooled electrode cup. Electroporate using a Bio-Rad electroporator. After electroporation, add 1 mL of preheated SOC liquid culture medium at 37°C, and then thaw at 37°C for 1 hour before centrifugation and plating.
[0042] 1.6 Repeat steps 1.4-1.5 until the number of clones reaches 5*10^11.
[0043] 2. Library virus packaging and screening
[0044] 2.1 Virus Packaging of AAV Peptide Mutant Library: 1.5 * 10^7 293AAV cells were seeded into 15 cm cell culture dishes and cultured for 18-24 h. Transfection could begin once the cells adhered. The pAAV-short UBC-mScarlet-polyA-P40-AAV2-Cap-FLEX-SV40polyA–insertion expression vector library containing the AAV2 / 2-7mer-NNS insert fragment was packaged into 293AAV cells using PEI transfection reagent. The Rep plasmid and pHelper helper plasmid were then transfected into the 293AAV cells. 72 h after transfection, the proportion of AAV-293 cells containing the vector library was counted under a fluorescence microscope to determine the virus packaging efficiency. After virus packaging was complete, the cells were repeatedly pipetted to completely detach them from the culture dishes, and all cell samples were collected.
[0045] 2.2 Virus purification: The collected cell samples were repeatedly frozen and thawed at -80℃ and 37℃, centrifuged, and the cell supernatant was collected. Cell debris was removed using a 0.45μm PVDF filter. Subsequently, the collected recombinant AAV virus was purified using an AAV purification kit to obtain recombinant AAV virus.
[0046] 2.3 Determination of recombinant AAV virus titer: Take 20 μL of concentrated virus solution, add 1 μL of RNase-free DNase, mix well, incubate at 37℃ for 30 min, centrifuge at 10000 rpm for 10 min, take 20 μL of supernatant, add 80 μL of dilution buffer to another sterile tube, mix well, and react in a metal bath at 100℃ for 10 min. Allow to cool naturally to room temperature, add 3 μL of proteinase K, incubate at 37℃ for 60 min, react in a metal bath at 100℃ for 10 min, and cool to room temperature. Dilute the above sample and use it as a template to determine the recombinant AAV virus titer using real-time quantitative PCR. The qPCR reaction system and conditions are: 95℃, 10 min; 95℃, 30 s; 60℃, 30 s, 35 cycles.
[0047] 2.4 AAV virus infection of HT-22 cells:
[0048] 2.4.1 Cell Plating: HT-22 cells were seeded into 10cm cell culture dishes at a confluence of 40%, with 5 x 10^6 cells per dish, and multiple cell culture dishes were prepared.
[0049] 2.4.2 Viral infection: HT-22 cells were infected with the virus from the pAAV-short UBC-mScarlet-polyA-P40-AAV2-Cap-FLEX-SV40polyA–insertion expression vector library.
[0050] 2.4.3 48–72 hours after infection, only a few cells were found to be infected by fluorescence microscopy.
[0051] 2.5 Collect infected cells and perform fluorescence sorting using a flow cytometer. Select the cells with the highest red fluorescence intensity (top 5%) as the target cells for collection. After sorting and collecting, plate the cells in cell culture dishes, amplify them, and then collect the cells.
[0052] 2.6 After extracting the genome from the collected cells, PCR amplification was performed, and the PCR products were sequenced in high throughput.
[0053] Amplification primers:
[0054] AAV2-F: AACCAATCCCGTGGCTACGGAGC (SEQ ID NO:3) (Forward primer on the vector)
[0055] For high-throughput sequencing of AAV2-R:CCAGACCATGCCTGGAAGAACGC (SEQ ID NO:4) (reverse primer on the vector), with adapter and index sequence added, the primers used are as follows:
[0056] NGS-AAV2-F:
[0057] TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAAACCAATCCCGTGGCTACGGAGC (SEQ ID NO: 5)
[0058] NGS-AAV2-R1:
[0059] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAG AAGGCTAGCGAGTAATCCAGACCATGCCTGGAAGAACGC(SEQ ID NO:6)
[0060] NGS-AAV2-R2:
[0061] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGG CTAGTCTCCGGACCAGACCATGCCTGGAAGAACGC(SEQ ID NO:7)
[0062] NGS-AAV2-R3:
[0063] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGG CTAGAATGAGCGCCAGACCATGCCTGGAAGAACGC(SEQ ID NO:8)
[0064] The expected sequencing sequence is:
[0065] AACCAATCCCGTGGCTACGGAGCAGTATGGTTCTGTATCTACCAACCTCCAGAG AGGCAACNNSNNSNNSNNSNNSNNSNNSAGACAAGCAGCTACCGCAGATGTCAACACACAAGGCGTTCTTCCAGGCATGGTCTGG(SEQID NO:9)
[0066] Analyzing the high-throughput sequencing results, the mutants with high frequency of occurrence were named AAV2-HTxx; for example, peptide 01 was named AAV2-HT01.
[0067] 3. Screening and validation of AAV2 / 2 mutants
[0068] 3.1 Construction of AAV2 / 2 mutant
[0069] Using the natural serotype AAV2 / 2 as a vector, candidate mutant fragments such as AAV2-HTxx were inserted at amino acid positions 587-588 to obtain new serotype vectors such as AAV2-HTxx. Based on the high-throughput results, more than 30 mutants were constructed.
[0070] 3.2 Using the shuttle vector pAAV-CBh-mScarlet-P2A-Luc2, various mutant serotypes of AAV virus were obtained by packaging with AAV2-HTxx and other serotype vectors.
[0071] 3.3 The viral titers of the above viruses were determined using WPRE primers, and the expression of viral VP1, VP2, and VP3 was confirmed using coccidial assay.
[0072] 3.4 HT-22 cells were infected with viruses such as pAAV-CBh-mScarlet-P2A-Luc2 and AAV2-HTxx at an MOI (multiple of infection) of 1*10^5. The fluorescence images after 72 hours of infection are shown below. Figure 4 As shown, AAV2-HT01 and AAV2-HT02 showed the best performance. Figure 4 As shown, AAV2-HT01 and AAV2-HT02 infected more HT-22 fluorescent cells compared to the AAV2 control group (AAV2). Simultaneously, the luciferase (RLU) value of cells was detected using firefly luciferase assays. Figure 5 As shown, the infection efficiency of AAV2-HT01 and AAV2-HT02 was higher than that of the control AAV2. The RLU value of the AAV2-HT01 group was 2.7 times higher than that of the control group AAV2, and the RLU value of the AAV2-HT02 group was 2.4 times higher than that of the control group AAV2. This indicates that the AAV2-HT01 and AAV2-HT02 serotypes can better infect HT-22 cells under the same MOI conditions.
[0073] The mutant peptide sequences of AAV2-HT01 and AAV2-HT02 are MSTVGKD (SEQ ID NO:10) or VQGRVHE (SEQ ID NO:11).
Claims
1. Mutant of the capsid protein of the AAV2 serotype, inserted with a heterologous peptide, characterized in that, said heterologous peptide is a polypeptide having the amino acid sequence MSTVGKD or VQGRVHE; said capsid protein of the AAV2 serotype has a sequence length of 736 amino acids; said capsid protein of the AAV2 serotype has inserted between the amino acids in positions 587 and 588 said heterologous peptide.
2. A nucleic acid molecule, characterized in that, nucleic acid molecule encoding the mutant of the capsid protein of the AAV2 serotype according to claim 1.
3. Nucleic acid vector operatively linked to the nucleic acid molecule according to claim 2.
4. A host cell characterized in that, nucleic acid vector according to claim 3.
5. Composition or kit containing the mutant of the capsid protein of the AAV2 serotype according to claim 1, the nucleic acid molecule according to claim 2 or the nucleic acid vector according to claim 3.
6. Use of the mutant of the capsid protein of the AAV2 serotype according to claim 1, of the nucleic acid molecule according to claim 2 or of the nucleic acid vector according to claim 3 for the infection of HT-22 cells, for non-diagnostic and therapeutic purposes.
Citation Information
Patent Citations
Capsid variants and methods of using the same
CA3220810A1
AAV mutant having brain-targeting property
CN113748122A