Application of SNP markers in identification of mouse sublines and primer sequences

By using liquid-phase chip technology with at least three SNP site combinations and primer combinations, the problem of distinguishing between C57BL/6 and BALB/c mouse subspecies in existing technologies has been solved, achieving efficient and accurate mouse subspecies identification.

CN116334241BActive Publication Date: 2026-04-24NAT INST FOR FOOD & DRUG CONTROL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310216604.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-08
Publication Date
2026-04-24
Estimated Expiration
2043-03-08

Smart Images

  • Figure BDA0004115149780000061
    Figure BDA0004115149780000061
  • Figure BDA0004115149780000071
    Figure BDA0004115149780000071
  • Figure BDA0004115149780000072
    Figure BDA0004115149780000072
Patent Text Reader

Abstract

The application discloses application of a SNP marker in mouse subline identification and a primer sequence. The SNP marker provided by the application is a combination of at least three SNP sites, can be used for identifying three C57BL / 6 mouse sublines including C57BL / 6N, C57BL / 6J and C57BL / 6-bg, and / or two BALB / c mouse sublines including BALB / cJ and BALB / cCrSlc, improves the range of mouse subline identification, and can save identification cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the technical field of mouse strain identification, specifically relating to the application of SNP markers in mouse subspecies identification and primer sequences. Background Technology

[0002] Laboratory animals are animals that are artificially bred and whose microorganisms are controlled, whose genetic background is clear or whose origin is well-known, and which are used for scientific research, teaching, production, testing, and other scientific experiments. Common laboratory animals include laboratory rats and laboratory mice, which include thousands of strains such as closed colonies, inbred strains, recombinant homologous strains, recombinant inbred strains, and mutant strains.

[0003] Among the various common and long-standing mouse substrains, differences exist in many aspects. However, these differences are not readily apparent in epigenetic traits, making it almost impossible to identify mouse substrains solely based on appearance. Furthermore, these differences can lead to biases in experimental data. With the advancement of biomedicine, researchers and businesses have increasingly higher requirements for the quality of laboratory animals. Therefore, the identification of mouse substrains has become an urgent problem to be solved.

[0004] Patent document CN114317767A (hereinafter referred to as Document 1) discloses a primer, kit and method for distinguishing C57BL / 6 subspecies mice. It uses at least three SNP sites in three groups (e.g., rs244794780, rs260260338 and rs224344563, or rs226310424, rs260260338 and rs239219835, etc.) to distinguish C57BL / 6N subspecies, C57BL / 6J subspecies and C57BL / 6By subspecies. It can also identify C57BL / 6NJ, or the combination of C57BL / 6NCrl and C57BL / 6NTac in the C57BL / 6N subspecies. However, the combination of SNP sites disclosed in Reference 1 can only distinguish C57BL / 6 subspecies mice, but cannot distinguish BALB / c subspecies mice, let alone distinguish both C57BL / 6 and BALB / c subspecies mice at the same time. Therefore, the universality of the combination of SNP sites disclosed in Reference 1 is poor. Summary of the Invention

[0005] To address one or more problems existing in the prior art, one aspect of the present invention provides an application of SNP markers in mouse subline identification, which utilizes a combination of SNP markers comprising at least three SNP loci to identify three C57BL / 6 mouse sublines or two BALB / c mouse sublines, wherein the three C57BL / 6 mouse sublines are selected from C57BL / 6N, C57BL / 6J, and C57BL / 6-bg, and the two BALB / c mouse sublines are selected from BALB / cJ and BALB / cCrSlc; the SNP marker combination comprises at least three SNP loci selected from any one of the following groups 1)-18):

[0006] 1) Three SNP loci named SNP1, SNP8, and SNP3;

[0007] 2) Name the three SNP loci as SNP1, SNP8, and SNP2;

[0008] 3) Name the three SNP loci as SNP1, SNP8, and SNP4;

[0009] 4) Name the three SNP loci as SNP1, SNP6, and SNP3;

[0010] 5) Name the three SNP loci as SNP1, SNP6, and SNP2;

[0011] 6) Name the three SNP loci as SNP1, SNP6, and SNP4;

[0012] 7) Name the three SNP loci as SNP1, SNP7, and SNP3;

[0013] 8) Name the three SNP loci as SNP1, SNP7, and SNP2;

[0014] 9) Name the three SNP loci as SNP1, SNP7, and SNP4;

[0015] 10) Name the three SNP loci as SNP6, SNP2, and SNP5;

[0016] 11) Name the three SNP loci as SNP6, SNP3, and SNP5;

[0017] 12) Name the three SNP loci as SNP6, SNP4, and SNP5;

[0018] 13) Name the three SNP loci as SNP7, SNP2, and SNP5;

[0019] 14) Three SNP loci named SNP7, SNP3, and SNP5;

[0020] 15) Name the three SNP loci as SNP7, SNP4, and SNP5;

[0021] 16) Name the three SNP loci as SNP8, SNP2, and SNP5;

[0022] 17) Name the three SNP loci as SNP8, SNP3, and SNP5;

[0023] 18) Name the three SNP loci as SNP8, SNP4, and SNP5;

[0024] in:

[0025] The SNP1 Ensembl rs number is rs3709624, and its allele is T or C;

[0026] The SNP2 has an Ensembl rs number of rs3659787 and its alleles are T or C.

[0027] The SNP3 has an Ensembl rs number of rs3722313 and its allele is T or C.

[0028] The SNP4 has an Ensembl rs number of rs3702158 and its allele is A or G.

[0029] The SNP5 has an Ensembl rs number of rs3724876 and its allele is G or T.

[0030] The SNP6 Ensembl rs number is rs3712692, and its allele is G or T.

[0031] The SNP7 Ensembl rs number is rs3706082, and its allele is T or C;

[0032] The SNP8 Ensembl rs number is rs3656801, and its alleles are G or A.

[0033] In some implementations, the SNP marker combination is a combination of eight SNP sites, SNP1-SNP8.

[0034] In some embodiments, the SNP marker combination further includes a combination of at least four SNP sites selected from one or more sites named SNP9, SNP10, SNP14, and SNP16, and the application is to use this combination to simultaneously identify five mouse sublines, wherein the five mouse sublines are selected from C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc; wherein:

[0035] The SNP9 Ensembl rs number is rs3023251, and its allele is T or C;

[0036] The SNP10 has an Ensembl rs number of rs3088673 and its alleles are T or G.

[0037] The SNP14 has an Ensembl rs number of rs3023177 and its allele is C or A;

[0038] The SNP16 Ensembl rs number is rs3089984, and its allele is A or C.

[0039] Another aspect of the present invention provides the application of the above-described SNP marker combinations in the preparation of a kit or liquid-phase chip for identifying mouse sublines, wherein the kit or liquid-phase chip is used to detect alleles of at least three SNP loci in the mouse subline, wherein the three SNP loci are those mentioned in any group of 1)-18) above, and the mouse subline is selected from C57BL / 6N, C57BL / 6J, and C57BL / 6-bg, or the mouse subline is selected from BALB / cJ and BALB / cCrSlc; or the kit or liquid-phase chip is used to detect alleles of at least four SNP loci in the mouse subline, wherein the four SNP loci are those mentioned in any group of 1)-18) above and any one of SNP9, SNP10, SNP14, and SNP16; the mouse subline is selected from C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc.

[0040] Another aspect of the present invention provides a primer combination for amplifying the above-mentioned SNP marker combination, which is used to identify mouse sublines, including primers for amplifying the three SNP sites mentioned in any one of groups 1)-18) above, wherein the mouse sublines are selected from C57BL / 6N, C57BL / 6J and C57BL / 6-bg, or the mouse sublines are selected from BALB / cJ and BALB / cCrSlc; or the primer combination includes primers for amplifying the three SNP sites mentioned in any one of groups 1)-18) above and primers for amplifying one or more SNP sites among SNP9, SNP10, SNP14 and SNP16, wherein the mouse sublines are selected from C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ and BALB / cCrSlc.

[0041] In some embodiments, the nucleotide sequences of the upstream and downstream primers used to amplify the SNP1 site are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively; the nucleotide sequences of the upstream and downstream primers used to amplify the SNP2 site are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively; the nucleotide sequences of the upstream and downstream primers used to amplify the SNP3 site are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; the nucleotide sequences of the upstream and downstream primers used to amplify the SNP4 site are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; the nucleotide sequences of the upstream and downstream primers used to amplify the SNP5 site are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively; the nucleotide sequences of the upstream and downstream primers used to amplify the SNP6 site are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively; the nucleotide sequences of the upstream and downstream primers used to amplify the SNP7 site are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively; and the nucleotide sequences of the upstream and downstream primers used to amplify the SNP8 site are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively. The nucleotide sequences of the upstream and downstream primers used to amplify SNP9 are shown in SEQ ID NO:16; the nucleotide sequences of the upstream and downstream primers used to amplify SNP10 are shown in SEQ ID NO:19 and SEQ ID NO:20; the nucleotide sequences of the upstream and downstream primers used to amplify SNP14 are shown in SEQ ID NO:27 and SEQ ID NO:28; and the nucleotide sequences of the upstream and downstream primers used to amplify SNP16 are shown in SEQ ID NO:31 and SEQ ID NO:32.

[0042] The application of the above primer combinations in the preparation of kits or liquid-phase chips for identifying mouse sublines is also within the scope of this invention, wherein the mouse sublines are selected from C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc.

[0043] In another aspect, the present invention provides a kit or liquid-phase chip for identifying mouse subspecies, comprising: A. the primer combination described above;

[0044] Optionally, the reagent kit or liquid phase chip further includes:

[0045] B. One or more wild-type and mutant-specific ASPE primers for each of the three SNP sites mentioned in any of groups 1)-18) above, and for one or more SNP sites of optional SNP9, SNP10, SNP14, and SNP16, wherein each ASPE primer consists of a tag sequence at the 5' end and a specific primer sequence for the SNP site at the 3' end; optionally, the specific primer sequence is a sequence selected from SEQ ID NO:33-52, SEQ ID NO:59-60, and SEQ ID NO:63-64; further optionally, the tag sequence is a sequence selected from SEQ ID NO:65-80; and

[0046] C. Magnetic spheres respectively coated with specific anti-tag sequences, wherein the anti-tag sequences are complementary to the tag sequences in B; optionally, the anti-tag sequences are sequences selected from SEQ ID NO:81-96.

[0047] In another aspect, the present invention provides a method for detecting SNP sites in mouse sublines, which uses the above-mentioned kit or liquid phase chip to detect the DNA of the mouse to be tested, wherein the mouse subline is selected from C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ and BALB / cCrSlc.

[0048] In some embodiments, the detection method includes the following steps:

[0049] (1) PCR amplification of the DNA sample of the mouse to be tested to obtain PCR amplification products;

[0050] (2) The obtained PCR amplification products were purified to obtain purified products;

[0051] (3) The purified product was extended using the specific ASPE primers, and biotin-labeled dCTP was incorporated into the reaction to obtain the post-reaction product with multiple biotin labels.

[0052] (4) Hybridize the magnetic beads coated with specific anti-tag sequences corresponding to the specific ASPE primers with the reaction products labeled with multiple biotin to obtain hybridization products;

[0053] (5) The hybridization product is reacted with streptavidin-phycoerythrin to obtain the reaction product;

[0054] (6) Detect the reaction product to obtain the allele information of the SNP site of the mouse to be tested.

[0055] In another aspect, the present invention provides a method for identifying mouse subspecies, which, in addition to the above-described detection method, further includes the following steps:

[0056] (7) Identify mouse sublines using the allele information of the SNP sites of the mice to be tested;

[0057] When using allele information from any of the three SNP loci mentioned in 1)-18) above to identify mouse sublines, the identification process includes: using allele information from SNP1 or SNP5 to distinguish C57BL / 6J from two other mouse sublines in the C57BL / 6 mouse subline; then using allele information from SNP2, SNP3, or SNP4 to distinguish C57BL / 6N from C57BL / 6-bg; simultaneously using allele information from SNP6, SNP7, or SNP8 to distinguish BALB / cJ from BALB / c mouse sublines; thereby achieving the mutual identification of the three C57BL / 6 mouse sublines, including C57BL / 6J, C57BL / 6N, and C57BL / 6-bg, or the identification of the two BALB / c mouse sublines, including BALB / cJ and BALB / cCrSlc.

[0058] When identifying mouse sublines using allele information from any of the three SNP loci mentioned in any of groups 1)-18) above, and one or more SNP loci from SNP9, SNP10, SNP14, and SNP16, the identification process includes: using allele information from SNP1 or SNP5 to distinguish C57BL / 6J from the other four mouse sublines; then using allele information from SNP6, SNP7, or SNP8 to distinguish BALB / cJ from the remaining three mouse sublines; and finally using SN... Allele information at P2, SNP3, or SNP4 loci is used to distinguish C57BL / 6-bg from the remaining two mouse sublines. Then, allele information at SNP9, SNP10, SNP14, or SNP16 loci is used to distinguish C57BL / 6N and BALB / cCrSlc. This allows for the simultaneous identification of five mouse sublines, including C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc.

[0059] The SNP markers provided by the above technical solution for identifying mouse subspecies consist of a combination of at least three SNP sites. Using this SNP marker combination, three C57BL / 6 mouse subspecies (C57BL / 6N, C57BL / 6J, C57BL / 6-bg) and / or two BALB / c mouse subspecies (BALB / cJ, BALB / cCrSlc) can be identified simultaneously. Therefore, compared to the method disclosed in Reference 1 (which can distinguish between the C57BL / 6N, C57BL / 6J, and C57BL / 6By subspecies), the present invention identifies a richer range of mouse subspecies and can simultaneously distinguish between C57BL / 6 and BALB / c subspecies mice. Furthermore, the primers provided by the present invention for amplifying each group of SNP sites can be grouped together, allowing for multiplex PCR amplification of mouse subspecies DNA samples simultaneously. Therefore, only one PCR amplification reaction is needed for each sample, effectively simplifying the operation, saving time, and thus improving the efficiency of mouse subspecies identification. Attached Figure Description

[0060] Figure 1 These are gel electrophoresis images of the products from PCR amplification of genomic DNA from five mouse sublines using PCR primers targeting SNP1-16 sites; image A shows gel electrophoresis images using PCR primers targeting SNP1-8 sites, and image B shows gel electrophoresis images using PCR primers targeting SNP9-16 sites. Detailed Implementation

[0061] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings.

[0062] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.

[0063] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).

[0064] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials used in this invention. In fact, the sources of biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted and used according to the suggestions in the embodiments.

[0065] Example 1: Determination of SNP markers for identifying mouse sublines and primer design for amplifying SNP sites

[0066] 1.1 Screening of SNP markers for identifying mouse sublines

[0067] PETKOV PM et al. (PETKOV PM, CASSELL MA, SARGENT EE, et al. Development of a SNP genotyping panel for genetic monitoring of the laboratory mouse[J]. Genomics, 2004, 83(5):902-911) have disclosed several SNP loci that can be used for genetic quality testing of laboratory mice. The inventors have screened out several SNP loci, as shown in Table 1 below, totaling 16 SNP loci, to identify those that can be used for genetic quality testing of five mouse sublines (including three C57BL / 6 mouse sublines and two BALB / c mouse sublines, specifically the three C57BL / 6 mouse sublines C57BL / 6NNifdc (referred to as C57BL / 6N in this paper), C57BL / 6J...). The SNP combinations identified in Nifdc (hereinafter referred to as C57BL / 6J) and C57BL / 6-bgNifdc (hereinafter referred to as C57BL / 6-bg), specifically the two BALB / c mouse sublines BALB / cJNifdc (hereinafter referred to as BALB / cJ) and BALB / cCrSlcNifdc (hereinafter referred to as BALB / cCrSlc) are shown in Table 2 below. The 22 groups of SNP sites (named as Group 1, Group 2, Group 3, ..., Group 22, respectively) are illustrated in the table below.

[0068] Table 1: 16 SNP loci, their locations, and allele information

[0069] Site number Ensembl rs number Chromosome localization Alleles SNP1 rs3709624 Chromosome 8:15241287 T / C SNP2 rs3659787 Chromosome 11:4458730 T / C SNP3 rs3722313 Chromosome 13:41596262 T / C SNP4 rs3702158 Chromosome 15:57023882 A / G SNP5 rs3724876 Chromosome 19:49964593 G / T SNP6 rs3712692 Chromosome 1:31763467 G / T SNP7 rs3706082 Chromosome 4:65725485 T / C SNP8 rs3656801 Chromosome 18:64593498 G / A SNP9 rs3023251 Chromosome 11:20903301 T / C SNP10 rs3088673 Chromosome 11:8452194 T / G SNP11 rs3089604 Chromosome X:68706245 T / C SNP12 rs3089109 Chromosome 10:87601155 C / G SNP13 rs3023203 Chromosome 9:29034302 A / G SNP14 rs3023177 Chromosome 8:14809100 C / A SNP15 rs3022953 Chromosome 15:32696333 A / G SNP16 rs3089984 Chromosome 10:8813751 A / C

[0070] Table 2: Combinations of SNP sites

[0071]

[0072]

[0073] 1.2 Design of PCR primers targeting SNP sites

[0074] Based on the information of the 16 SNP sites screened in step 1.1 above (as shown in Table 1), the base sequences near each SNP site were searched in the UCSC database. PCR primers capable of amplifying SNP sites were designed using Primer 6.0 software, and the fragment sizes of their amplification products were preferably 20-100 bp apart to facilitate differentiation by electrophoresis. The specific primer sequences are shown in Table 3. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0075] Table 3: PCR primers for SNP1-16 sites

[0076]

[0077] The inventors used the combinations of SNP loci shown in Table 2 (groups 1-22) to simultaneously identify three C57BL / 6 mouse sublines (C57BL / 6N, C57BL / 6J, and C57BL / 6-bg) and two BALB / c mouse sublines (BALB / cJ and BALB / cCrSlc) according to the method described in Example 2 below. This allowed for the differentiation between the three C57BL / 6 mouse sublines and the two BALB / c mouse sublines. The results showed that SNP loci in groups 1-18 and 21 of Table 2 could achieve the above objective, while SNP loci in groups 19, 20, and 22 could not (detailed in Example 2 below). Therefore, this invention demonstrates that SNP loci in groups 1-18 and 21 of Table 2 can be used to identify three C57BL / 6 mouse sublines and simultaneously identify two BALB / c mouse sublines, exhibiting good versatility.

[0078] Example 2: Identification of three C57BL / 6 mouse sublines and two BALB / c mouse sublines

[0079] This embodiment uses the combinations of SNP sites shown in Table 2 (groups 1-22) determined in Example 1 above, and the PCR primers for SNP1-16 sites shown in Table 3 to identify three C57BL / 6 mouse sublines (C57BL / 6N, C57BL / 6J and C57BL / 6-bg) and two BALB / c mouse sublines (BALB / cJ and BALB / cCrSlc). The identification method specifically includes the following operations.

[0080] 2.1 Extraction of DNA samples from mouse subspecies

[0081] This step uses a commercially available blood / cell / tissue genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.) to extract genomic DNA from mice. The specific steps are as follows, referring to the kit's instructions:

[0082] (1) Cut off 1-2 cm of the rat tail and place it in a 1.5 mL EP tube. First, add 50 μL of proteinase K, then add 500 μL of extraction buffer to the EP tube. Seal with sealing film, mix well, and place on a float. Incubate overnight in a water bath at 53.5℃, stirring up and down several times during the incubation period. Note that there should be enough purified water in the water bath and the lid should be closed.

[0083] (2) On the second day, remove the float from the water bath, remove the EP tube from the float, add 500 μL of Tris-phenol solution, mix well, centrifuge at 12000 rpm / min for 2 min, take the supernatant and put it into a new EP tube. When aspirating the supernatant, be careful to keep the pipette tip close to the EP tube wall and do not aspirate the lower oily substance.

[0084] (3) Add an equal volume of chloroform:isoamyl alcohol (24:1) mixture to the new EP tube from step (2), ensuring proper ventilation. After thoroughly mixing by inverting, centrifuge at 12000 rpm / min for 2 min, and transfer the supernatant to a new EP tube.

[0085] (4) Add 25 μL of ammonium acetate and 750 μL of isopropanol to the new EP tube from step (3), and gently mix them up and down. You will see obvious flocculent precipitate. Centrifuge at 12000 rpm for 5 min.

[0086] (5) Pour out the liquid in the EP tube once, add 500 μL of 70% ethanol, shake gently up and down to mix, centrifuge at 12000 rpm for 5 min, and discard the supernatant.

[0087] (6) Place the EP tube with the supernatant discarded on filter paper and leave it at room temperature for about 30 minutes to completely remove the ethanol. Then add 200 μL of the prepared TE solution to dissolve it. Store at -20℃ for later use.

[0088] (7) After the DNA solution to be extracted is stabilized in a refrigerator at 4°C for 1-2 days, the DNA integrity is detected by 1.6% agarose gel electrophoresis, and the purity and concentration of the DNA are detected by micro spectrophotometer.

[0089] Genomic DNA samples of five mouse sublines were extracted according to steps (1)-(7) above.

[0090] 2.2 PCR amplification of genomic DNA from mouse sublines

[0091] In this step, the PCR primers listed in Table 3 of Example 1 were used to perform PCR amplification on the genomic DNA samples of the five mouse subspecies extracted in Step 2.1 according to the SNP site combinations in Table 2 (artificially synthesized plasmids were used as positive controls, and sterile water was used as a negative control) to obtain the PCR amplification products for each mouse subspecies. The PCR reaction system and procedure are shown in Tables 4 and 5 below. When using the PCR primers shown in Table 3 to perform PCR amplification on the genomic DNA of the mouse subspecies, multiplex detection was performed according to the SNP site combinations shown in Table 2. For example, triple PCR amplification was performed for SNP sites in groups 1-20, and octet PCR amplification was performed for SNP sites in groups 21 and 22.

[0092] Table 4: Multiplex PCR reaction system

[0093]

[0094] Table 5: Multiplex PCR reaction procedure

[0095]

[0096] 2.3 Electrophoretic detection of multiplex PCR products

[0097] To prepare a 2.5% agarose gel: Add 1.0 g of agarose to 40 mL of 1×TAE solution, add Ex Red staining solution (Note: the ratio of staining solution to agarose gel is 1:10000), mix well, and place in a microwave oven. Heat several times until the solution is clear and free of bubbles. During the process, pay attention to whether the agarose gel is overflowing from the Erlenmeyer flask. If it overflows, stop heating immediately and shorten the heating time. Then pour the dissolved solution into a gel plate, insert a comb, and let it stand at room temperature for 20-30 minutes.

[0098] Add 5 μL of PCR amplification product to 1 μL of 6× DNA loading buffer, mix well, and then add to the electrophoresis tank for electrophoresis detection. Use a 50 bp DNA marker as a band position reference. Electrophoresis is performed at 130V for 30 min, followed by scanning and imaging using a UV gel imaging system. Figure 1 As shown, exemplary gel electrophoresis images are displayed. Image A represents the results of PCR amplification of genomic DNA from five mouse sublines using PCR primers targeting the 21st group of SNP sites (i.e., SNP1-SNP8), and image B represents the results of PCR amplification of genomic DNA from five mouse sublines using PCR primers targeting the 22nd group of SNP sites (i.e., SNP9-SNP16). It can be seen that the PCR primers targeting SNP1-SNP16 can effectively amplify the genomic DNA from the five mouse sublines, and each band is clear and distinct.

[0099] 2.4 Purification of Multiplex PCR Products

[0100] After multiplex PCR, residual dNTPs, primers, and single-stranded products may remain, affecting subsequent ASPE extension reactions. ExoI can remove these residual primers and single-stranded products, while SAP enzyme removes residual primers, single-stranded DNA, and dNTPs, especially dCTPs, from the PCR products. In this step, the ExoSAP-IT kit (purchased from USB Corporation, USA) is used. 1 μL of Exo-SAP mixture is added to every 10 μL of multiplex PCR product, followed by incubation at 37°C for 30 min, and then at 80°C for 15 min to inactivate the enzyme, yielding purified multiplex PCR products.

[0101] 2.5 Site-Specific Primer Extension (ASPE)

[0102] This step utilizes designed site-specific primers to perform primer extension reactions on the multiplex PCR products purified in step 2.4 above. During the reaction, biotin-labeled dCTP (purchased from Shanghai Sangon Biotech Co., Ltd.) is incorporated, thereby enabling the product to carry multiple biotin labels.

[0103] 2.5.1 Design of Site-Specific Primers (ASPE Primers)

[0104] Each ASPE primer (annealed at 51-56℃) consists of two parts: the 5' end contains a specific tag sequence targeting the anti-tag sequence on the corresponding magnetic sphere, and the 3' end contains a mutant or wild-type specific primer sequence. All ASPE primers were synthesized by Shanghai Sangon Biotech Co., Ltd. The ASPE primers designed for SNP1-16 sites in this step are shown in Table 6 below.

[0105] Table 6: TAG and ASPE primer sequence information for SNP1-16 sites, respectively.

[0106]

[0107]

[0108] 2.5.2 ASPE Reaction System and Reaction Procedure

[0109] The ASPE reaction system was selected from the 20 μL system recommended in the Luminex operating guide, as shown in Table 7 below.

[0110] Table 7: ASPE Reaction System

[0111]

[0112] After setting the PCR amplification instrument according to the reaction program in Table 8 below, put the prepared ASPE reaction system into it to carry out the ASPE reaction and obtain the ASPE extension reaction product.

[0113] Table 8: ASPE Reaction Procedure

[0114]

[0115] 2.6 Hybridization reaction

[0116] 2.6.1 Selection of magnetic balls and anti-tag sequence coating

[0117] This step involves selecting appropriate magnetic beads (all magnetic bead concentrations are 2.5 × 10⁻⁶) based on the ASPE primers designed in Table 6 above. 5 Each magnetic bead carries a different color code, and each bead surface is attached with a 24bp specific oligonucleotide sequence (anti-tag sequence, synthesized by Haishenggong Biotechnology Co., Ltd.; a 5-10 T spacer arm sequence is attached between the anti-tag sequence and the magnetic bead, i.e., a 5-10 T spacer arm sequence is added before each anti-tag sequence). These anti-tag sequences can specifically bind to the tag sequence at the 5' end of the corresponding ASPE primer. The color codes of the corresponding magnetic beads and the anti-tag sequences they carry are shown in Table 9 below.

[0118] Table 9: Color coding of magnetic spheres and their anti-tag sequences

[0119] Magnetic ball number Anti-tag sequences of magnetic ball coupling SEQ ID MTAG-A019 GTGTGTTATTTGTTTGTAAAGTAT NO:81 MTAG-B083 GAAAGTTTAAGTGATGTATATTGT NO:82 MTAG-A073 GTTGAGAATTAGAATTTGATAAAG NO:83 MTAG-B094 TAGATAATGTGAAGTAATAAGTGA NO:84 MTAG-A027 AAGATGATAGTTAAGTGTAAGTTA NO:85 MTAG-A065 TGAGTAAGTTTGTATGTTTAAGTA NO:86 MTAG-A013 AGTGAATGTAAGATTATGTATTTG NO:87 MTAG-A039 TTGTGATAGTAGTTAGATATTTGT NO:88 MTAG-A030 GTGTTATAGAAGTTAAATGTTAAG NO:89 MTAG-A053 GTTTGTGTTTGTATAAGTTGTTAA NO:90 MTAG-A015 GTTGTAAATTGTAGTAAAGAAGTA NO:91 MTAG-A061 TATTAGAGAGAAATTGTAGAGATT NO:92 MTAG-A025 GTATGTTGTAATGTTAAAGAAAG NO:93 MTAG-B058 TGAGAATGTAAAGAATGTTTATTG NO:94 MTAG-B089 GTTATGAAAGAGTATGTGTTAAAT NO:95 MTAG-B098 TATGTGTATGAAGGATTATAGTTAG NO:96

[0120] The process of magnetic spheres being coated with anti-tag sequences is as follows:

[0121] Take 5×10 6One carboxylated magnetic bead (purchased from Luminex) with the above-mentioned number was suspended in 50 μL of 0.1 mol / L MES solution (pH 4.5), and 10 μL of synthesized anti-tag molecule (100 nmol / ml) was added. A 10 ng / ml EDC (N-(3-Dimethylaminopropyl)-N-ethylcarbodiimide) working solution (purchased from Pierce Chemical) was prepared. 2.5 μL of EDC working solution was added to the magnetic bead suspension, and the mixture was incubated at a constant temperature for 30 minutes. Another 2.5 μL of EDC working solution was added, and the mixture was incubated at a constant temperature for another 30 minutes. After the reaction was complete, the mixture was washed once with 0.02% Tween-20 solution, and then once with 0.1% SDS solution. The washed magnetic beads coated with anti-tag sequences were resuspended in 100 μL of Tris-EDTA solution [10 mmol / L Tris (pH 8.0), 1 mmol / L EDTA] and stored at 2–8 °C protected from light.

[0122] 2.6.2 Hybridization reaction of ASPE extended PCR products with magnetic beads coated with anti-tag sequences

[0123] The Luminex user guide recommends two hybridization methods: one with cleaned magnetic balls and one without. This example uses the method without cleaning the magnetic balls.

[0124] (1) Before use, shake the magnetic balls with a vortex mixer for 30-60 seconds to prevent the magnetic balls from not being able to be picked up and settled at the bottom of the bottle. Take 10 μL of each type of magnetic ball to prepare the magnetic ball stock solution. Then dilute the stock solution to prepare the working solution. The working solution concentration is about 50 balls / μL. Take 22.5 μL of the magnetic ball working solution into the PCR eight-tube reaction tube.

[0125] (2) Add 2.5 μL of the ASPE extension reaction product to be tested to the reaction tube, so that the total reaction volume is 25 μL;

[0126] (3) Add 2.5 μL ddH2O to the negative control and add 2.5 μL of the ASPE extension reaction product of the synthesized plasmid to the positive control;

[0127] (4) After labeling, place the PCR eight-tube bundle on a vortex mixer to mix, then centrifuge in a micro centrifuge for about 10 seconds, and then place it in a PCR amplification instrument. The reaction conditions are: denaturation at 96℃ for 90 seconds, followed by reaction at 37℃ for 30 minutes.

[0128] (5) Add 100 μL of 1× hybridization buffer containing 8 μg / mL streptavidin phycoerythrin and 0.01% BSA to a PCR eight-tube, and slowly pipette it. Do not use a vortex mixer to mix it. Resuspend the precipitated magnetic beads.

[0129] (6) Place the PCR eight-tube reaction tubes into the PCR amplification instrument again for streptavidin-phycoerythrin hybridization. Adjust the temperature to 37℃ and react at this temperature for 20 min. After the reaction is complete, the Luminex 200 instrument can be used for detection. The system output value is the median fluorescence intensity (MFI).

[0130] (7) Before using the Luminex instrument to test the sample, turn on the machine and warm it up for 30 minutes. Then, verify the instrument. Only after the verification is completed can the sample be tested. Note that the height of the probe should be adjusted at any time.

[0131] (8) After the sample testing is completed, the detection probe needs to be cleaned. Add deionized water and 84 disinfectant to the corresponding position on the calibration plate to clean the probe. After cleaning, the software can be closed. Note that the waste liquid in the waste liquid tank should be cleaned regularly.

[0132] 2.7 Data Analysis

[0133] After the hybridization reaction in step 2.6.2 above, the magnetic sphere system was detected using a Luminex 200 reading system by exciting red and green lasers, respectively. The output value was the median fluorescence intensity (MFI), which was used to calculate the allele MFI ratio. Allele MFI ratio = MFI 目标碱基 / (MIF 野生型 +MFI 突变型 The genotyping principle is as follows: an allele MFI ratio > 0.75 or < 0.25 indicates a homozygous wild type or homozygous mutant, while an allele MFI ratio < 0.25 indicates a heterozygous mutant. Statistical analysis, including CV, was performed using Excel 2019 software.

[0134] The Luminex detection results and calculated allele MFI ratios for the 21st group of SNPs shown in Table 2 are shown in Tables 10 and 11, respectively. The Luminex detection results and calculated allele MFI ratios for the 22nd group of SNPs shown in Table 2 are shown in Tables 12 and 13, respectively. The allele MFI ratios for SNPs from groups 1 to 20 shown in Table 2 are shown in Table 14.

[0135]

[0136]

[0137]

[0138] As shown in Table 11 above, the MFI ratio of alleles can be calculated to distinguish the three C57BL / 6 mouse sublines (C57BL / 6N, C57BL / 6J, and C57BL / 6-bg) from each other based on some (at least three) or all of the SNP sites in SNP1-SNP8, and can also distinguish the two BALB / c mouse sublines (BALB / cJ and BALB / cCrSlc) from each other. For details, please refer to the allele information of SNP loci in groups 1-18 shown in Table 14. For example, in the allele results of SNP loci in group 1, C57BL / 6J in the C57BL / 6 mouse subline can be distinguished from the other two sublines based on the genotyping results of SNP1 locus, and C57BL / 6N and C57BL / 6-bg can be distinguished based on the genotyping results of SNP3 locus; at the same time, BALB / cJ and BALB / cCrSlc in the BALB / c mouse subline can be distinguished based on the genotyping results of SNP8 locus. In the allele results of the second group of SNP loci, the C57BL / 6J subline of the C57BL / 6 mouse subline can be distinguished from the other two sublines based on the SNP1 locus genotyping results, and the C57BL / 6N and C57BL / 6-bg sublines can be distinguished based on the SNP2 locus genotyping results; simultaneously, the BALB / cJ and BALB / cCrSlc sublines of the BALB / c mouse subline can be distinguished based on the SNP8 locus genotyping results. In the allele results of the third group of SNP loci, the C57BL / 6J subline of the C57BL / 6 mouse subline can be distinguished from the other two sublines based on the SNP1 locus genotyping results, and the C57BL / 6N and C57BL / 6-bg sublines can be distinguished based on the SNP4 locus genotyping results; simultaneously, the BALB / cJ and BALB / cCrSlc sublines of the BALB / c mouse subline can be distinguished based on the SNP8 locus genotyping results. Similarly, the genotyping results of SNP loci in groups 4-18 can be used to distinguish the three C57BL / 6 mouse sublines from each other, and simultaneously distinguish the two BALB / c mouse sublines from each other. However, as shown in Table 14 above, in the allele results of SNP loci in group 19, only the genotyping results of SNP1 can distinguish C57BL / 6J in the C57BL / 6 mouse subline from the other two sublines, and the genotyping results of SNP8 or SNP6 can distinguish BALB / cJ and BALB / cCrSlc in the BALB / c mouse subline. However, it is not possible to further distinguish C57BL / 6N and C57BL / 6-bg.In the allele results of the 20th group of SNP loci, C57BL / 6N in the C57BL / 6 mouse subline can only be distinguished from the other two sublines based on the genotyping results of SNP3, or SNP2, or SNP4 loci. However, it is not possible to further distinguish C57BL / 6J and C57BL / 6-bg, nor can it distinguish BALB / cJ and BALB / cCrSlc in the BALB / c mouse subline.

[0139] As shown in Table 13 above, the allele MFI ratio calculation results indicate that although the 22nd group of SNP sites consists of 8 SNP sites from SNP9 to SNP16, the allele information of these SNP sites is completely identical in the three C57BL / 6 mouse sublines (C57BL / 6N, C57BL / 6J, and C57BL / 6-bg) and the two BALB / c mouse sublines (BALB / cJ and BALB / cCrSlc). Therefore, this group of SNP sites cannot distinguish between the three C57BL / 6 mouse sublines or between the two BALB / c mouse sublines.

[0140] In summary, the three SNP loci in groups 1-18 provided by this invention can be used to identify three C57BL / 6 mouse sublines, including C57BL / 6N, C57BL / 6J, and C57BL / 6-bg, and can also be used to distinguish two BALB / c mouse sublines, including BALB / cJ and BALB / cCrSlc. Therefore, compared with Reference 1, the SNP locus combination provided by this invention has better versatility. Furthermore, to distinguish more variant sublines within the C57BL / 6 mouse subline and / or the BALB / c mouse subline, a combination of more SNP loci (i.e., at least three SNP loci), including the three SNP loci in groups 1-18, is preferred. For example, the SNP locus in group 21 provided by this invention consists of eight SNP loci, SNP1-SNP8, and therefore has more SNP allele information, which can be used to identify more variant sublines.

[0141] Example 3: Identification of five mouse sublines (C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, BALB / cCrSlc)

[0142] Based on the results of Example 2 above, it can be seen that SNP sites in groups 1-18 can be used to identify three C57BL / 6 mouse sublines, including C57BL / 6N, C57BL / 6J, and C57BL / 6-bg, and simultaneously to identify two BALB / c mouse sublines, including BALB / cJ and BALB / cCrSlc. Furthermore, when using SNP sites in groups 1-18 to identify five mouse sublines simultaneously including C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc, the identification can be based on SNP1 or SNP2. The genotyping results at the P5 locus distinguished C57BL / 6J from the other four mouse sublines. Subsequently, the genotyping results at SNP6, SNP7, or SNP8 loci distinguished BALB / cJ from the remaining three mouse sublines (C57BL / 6N, C57BL / 6-bg, and BALB / cCrSlc). The genotyping results at SNP2, SNP3, or SNP4 loci distinguished C57BL / 6-bg from the remaining two mouse sublines (C57BL / 6N and BALB / cCrSlc). However, C57BL / 6N and BALB / cCrSlc could not be further distinguished. It is evident that the SNP sites in groups 1-18 provided in Example 2, when identifying five mouse sublines that simultaneously include C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc, could only fail to identify C57BL / 6N and BALB / cCrSlc. However, according to the results in Table 13 above, the allele information of C57BL / 6N and BALB / cCrSlc at SNP9, SNP10, SNP14 and SNP16 are different. Therefore, the SNP sites in each of groups 1-18 can be further combined with one or more of the SNP9, SNP10, SNP14 and SNP16 sites. The resulting combination of at least 4 SNP sites can simultaneously distinguish the 5 mouse sublines including C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ and BALB / cCrSlc from each other.

[0143] To verify that SNP marker combinations of SNP loci in groups 1-18, and one or more of SNP9, SNP10, SNP14, and SNP16 loci, can be used to simultaneously identify five mouse sublines, including C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc, Table 15 below shows some of the combinations including four SNP loci (groups 23-40). The allele information of these loci in the five mouse sublines was obtained by detecting them according to the method in Example 2 above, and the detection results are shown in Table 15 below. As can be seen, when the typing results of the SNP sites in groups 1 to 18 provided in Example 2 above are used to distinguish C57BL / 6J, C57BL / 6-bg, and BALB / cJ from the remaining two mouse sublines (C57BL / 6N and BALB / cCrSlc), C57BL / 6N and BALB / cCrSlc can indeed be further distinguished based on the typing results of SNP9, SNP10, SNP14, or SNP16. Thus, it is possible to distinguish the five mouse sublines, including C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc, from each other. The results of this embodiment demonstrate that SNP marker combinations formed by further combining SNP sites from groups 1 to 18 with one or more of SNP9, SNP10, SNP14, and SNP16 sites can be used to simultaneously identify five mouse sublines, including C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc.

[0144] Table 15: Alleles calculated based on Luminex detection results of SNP loci in groups 23-40

[0145]

[0146] Example 4: Kits or liquid-phase microarrays for identifying mouse subspecies

[0147] This embodiment provides a kit or liquid phase chip for identifying three C57BL / 6 mouse sublines (C57BL / 6N, C57BL / 6J, C57BL / 6-bg) or two BALB / c mouse sublines (BALB / cJ, BALB / cCrSlc), named the first kit or first liquid phase chip, which includes the following components:

[0148] A1. The PCR primers shown in Table 3 of Example 1 are used to amplify any of the following groups (1)-(19): (1) SNP1, SNP8 and SNP3; (2) SNP1, SNP8 and SNP2; (3) SNP1, SNP8 and SNP4; (4) SNP1, SNP6 and SNP3; (5) SNP1, SNP6 and SNP2; (6) SNP1, SNP6 and SNP4; (7) SNP1, SNP7 and SNP3; (8) SNP1, SNP7 and SNP2; (9) SNP 1. SNP7 and SNP4; (10) SNP6, SNP2 and SNP5; (11) SNP6, SNP3 and SNP5; (12) SNP6, SNP4 and SNP5; (13) SNP7, SNP2 and SNP5; (14) SNP7, SNP3 and SNP5; (15) SNP7, SNP4 and SNP5; (16) SNP8, SNP2 and SNP5; (17) SNP8, SNP3 and SNP5; (18) SNP8, SNP4 and SNP5; (19) SNP1-SNP8;

[0149] B1. One or more ASPE primers for wild-type and mutant specific SNP sites mentioned in any group (1)-(19) of A1, wherein each ASPE primer consists of a tag sequence at the 5' end and a specific primer sequence for the SNP site at the 3' end; optionally, the specific primer sequence is a sequence selected from SEQ ID NO:33-48 in Table 6; further optionally, the tag sequence is a sequence selected from SEQ ID NO:65-80 in Table 6; and

[0150] C1. Magnetic spheres respectively coated with specific anti-tag sequences, wherein the anti-tag sequences are complementary to the tag sequences in B1; optionally, the anti-tag sequences are sequences selected from SEQ ID NO:81-96 in Table 9.

[0151] This embodiment also provides a kit or liquid phase chip for the simultaneous identification of five mouse sublines (C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, BALB / cCrSlc), named the second kit or second liquid phase chip, which includes the following components:

[0152] A2. Based on the PCR primers in A1 above for amplifying SNP sites in any of the groups (1)-(19), each group may also include PCR primers for amplifying one or more SNP sites in SNP9, SNP10, SNP14 and SNP16.

[0153] B2. Based on B1 above, it further includes one or more wild-type and mutant-specific ASPE primers targeting one or more SNP sites in SNP9, SNP10, SNP14, and SNP16, respectively, wherein each ASPE primer consists of a tag sequence at the 5' end and a specific primer sequence targeting the SNP site at the 3' end; optionally, the specific primer sequence is a sequence selected from SEQ ID NO:49-52, SEQ ID NO:59-60, and SEQ ID NO:63-64 in Table 6; further optionally, the tag sequence is a sequence selected from SEQ ID NO:65, SEQ ID NO:71-72, SEQ ID NO:77, SEQ ID NO:68, SEQ ID NO:79, SEQ ID NO:75, and SEQ ID NO:80 in Table 6; and

[0154] C2. Based on C1 above, it further includes magnetic spheres coated with other specific anti-tag sequences, wherein the other anti-tag sequences can be complementary to the tag sequences in B2; optionally, the other anti-tag sequences are sequences selected from SEQ ID NO:81, SEQ ID NO:87-88, SEQ ID NO:93, SEQ ID NO:84, SEQ ID NO:95-96, and SEQ ID NO:91 in Table 9.

[0155] In addition, the kit or liquid-phase chip (first and second) provided by the present invention also includes a method for detecting SNP sites of mouse sublines or a method for identifying mouse sublines using the kit or liquid-phase chip, wherein:

[0156] The method for detecting SNP sites in mouse sublines includes the following steps:

[0157] (1) Amplify the DNA sample obtained from the mouse to be tested using the PCR primers provided in the kit or liquid phase chip (multiplex PCR amplification can be used) to obtain PCR amplification products;

[0158] (2) The obtained PCR amplification products were purified to obtain purified products;

[0159] (3) Use the specific ASPE primers provided in the kit or liquid phase chip to perform primer extension reaction on the obtained purified product, and incorporate biotin-labeled dCTP during the reaction to obtain the reaction product with multiple biotin labels.

[0160] (4) Hybridize the magnetic beads coated with specific anti-tag sequences corresponding to the specific ASPE primers with the reaction products labeled with multiple biotin to obtain hybridization products;

[0161] (5) The hybridization product is reacted with streptavidin-phycoerythrin to obtain the reaction product;

[0162] (6) Detect (e.g., by a fluorescence detector) the reaction product to obtain allele information of the SNP loci of the mouse to be tested.

[0163] The method for identifying mouse sublines, based on the method for detecting SNP sites in mouse sublines provided above, also includes the following steps: (7) Identifying mouse sublines using the allele information of the SNP sites of the mice to be tested;

[0164] When using the first kit or the first liquid-phase chip to identify mouse sublines, the identification process includes: using allele information at SNP1 or SNP5 to distinguish C57BL / 6J from two other mouse sublines in the C57BL / 6 subline; then using allele information at SNP2, SNP3, or SNP4 to distinguish C57BL / 6N from C57BL / 6-bg; simultaneously using allele information at SNP6, SNP7, or SNP8 to distinguish BALB / cJ from BALB / c mouse sublines; thereby achieving the identification of the three C57BL / 6 mouse sublines, including C57BL / 6J, C57BL / 6N, and C57BL / 6-bg, or the identification of the two BALB / c mouse sublines, including BALB / cJ and BALB / cCrSlc.

[0165] When using the second kit or the second liquid-phase chip to identify mouse sublines, the identification process includes: using allele information at SNP1 or SNP5 to distinguish C57BL / 6J from the other four mouse sublines; then using allele information at SNP6, SNP7, or SNP8 to distinguish BALB / cJ from the remaining three mouse sublines; then using allele information at SNP2, SNP3, or SNP4 to distinguish C57BL / 6-bg from the remaining two mouse sublines; and then using allele information at SNP9, SNP10, SNP14, or SNP16 to distinguish C57BL / 6N and BALB / cCrSlc. This allows for the simultaneous identification of five mouse sublines, including C57BL / 6N, C57BL / 6J, C57BL / 6-bg, BALB / cJ, and BALB / cCrSlc.

[0166] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be considered part of the present invention.

Claims

1. The application of a reagent for detecting SNP marker alleles in mouse subline identification, characterized in that, The SNP markers were combinations of nine SNP loci, and these combinations were used to identify three C57BL / 6 mouse sublines and two BALB / c mouse sublines. The nine SNP loci were named SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, and SNP9. The three C57BL / 6 mouse sublines were designated C57BL / 6N. Nifdc C57BL / 6J Nifdc and C57BL / 6-bg Nifdc The two BALB / c mouse sublines are BALB / cJ. Nifdc and BALB / cCrSlc Nifdc ;in: The SNP1 Ensembl rs number is rs3709624, and its allele is T or C; The SNP2 has an Ensembl rs number of rs3659787 and its alleles are T or C. The SNP3 has an Ensembl rs number of rs3722313 and its allele is T or C. The SNP4 has an Ensembl rs number of rs3702158 and its allele is A or G. The SNP5 has an Ensembl rs number of rs3724876 and its allele is G or T. The SNP6 Ensembl rs number is rs3712692, and its allele is G or T. The SNP7 Ensembl rs number is rs3706082, and its allele is T or C; The SNP8 has an Ensembl rs number of rs3656801 and its allele is G or A. The SNP9 Ensembl rs number is rs3023251, and its alleles are T or C.

2. The use of the primer combination for amplifying the SNP marker described in claim 1 in the preparation of a kit for identifying mouse sublines, characterized in that, The mouse substrain was C57BL / 6N. Nifdc C57BL / 6J Nifdc C57BL / 6-bg Nifdc BALB / cJ Nifdc and BALB / cCrSlc Nifdc ; The primer combination includes a combination of upstream and downstream primers for amplifying SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8 and SNP9 sites, respectively.

3. The application according to claim 2, characterized in that, The nucleotide sequences of the upstream and downstream primers used to amplify the SNP1 site are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The nucleotide sequences of the upstream and downstream primers used to amplify the SNP2 site are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively. The nucleotide sequences of the upstream and downstream primers used to amplify the SNP3 site are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively. The nucleotide sequences of the upstream and downstream primers used to amplify the SNP4 site are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively. The nucleotide sequences of the upstream and downstream primers used to amplify the SNP5 site are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively. The nucleotide sequences of the upstream and downstream primers used to amplify the SNP6 site are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively. The nucleotide sequences of the upstream and downstream primers used to amplify the SNP7 site are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively. The nucleotide sequences of the upstream and downstream primers used to amplify the SNP8 site are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively; and The nucleotide sequences of the upstream and downstream primers used to amplify the SNP9 site are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively.

4. The application according to claim 3, characterized in that, The kit also includes: B. Wild-type and mutant-specific ASPE primers for SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, and SNP9, respectively, wherein each ASPE primer consists of a 5' tag sequence and a 3' specific primer sequence for the SNP site; and C. Magnetic spheres each coated with a specific anti-tag sequence, wherein the anti-tag sequence is complementary to the tag sequence described in B; in: The wild-type specific ASPE primer for the SNP1 site consists of SEQ ID NO:33 at the 3' end and SEQ ID NO:65 at the 5' end, while the mutant specific ASPE primer for the SNP1 site consists of SEQ ID NO:34 at the 3' end and SEQ ID NO:66 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:81 and SEQ ID NO:

82. The wild-type specific ASPE primer for SNP2 consists of SEQ ID NO:35 at the 3' end and SEQ ID NO:67 at the 5' end, and the mutant specific ASPE primer for SNP1 consists of SEQ ID NO:36 at the 3' end and SEQ ID NO:68 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:83 and SEQ ID NO:

84. The wild-type specific ASPE primer for SNP3 consists of SEQ ID NO:37 at the 3' end and SEQ ID NO:69 at the 5' end, and the mutant specific ASPE primer for SNP1 consists of SEQ ID NO:38 at the 3' end and SEQ ID NO:70 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:85 and SEQ ID NO:

86. The wild-type specific ASPE primer for SNP4 consists of SEQ ID NO:39 at the 3' end and SEQ ID NO:71 at the 5' end, and the mutant specific ASPE primer for SNP1 consists of SEQ ID NO:40 at the 3' end and SEQ ID NO:72 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:87 and SEQ ID NO:

88. The wild-type specific ASPE primer for SNP5 consists of SEQ ID NO:41 at the 3' end and SEQ ID NO:73 at the 5' end, and the mutant specific ASPE primer for SNP1 consists of SEQ ID NO:42 at the 3' end and SEQ ID NO:74 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:89 and SEQ ID NO:

90. The wild-type specific ASPE primer for SNP6 consists of SEQ ID NO:43 at the 3' end and SEQ ID NO:75 at the 5' end, and the mutant specific ASPE primer for SNP1 consists of SEQ ID NO:44 at the 3' end and SEQ ID NO:76 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:91 and SEQ ID NO:

92. The wild-type specific ASPE primer for SNP7 consists of SEQ ID NO:45 at the 3' end and SEQ ID NO:77 at the 5' end, and the mutant specific ASPE primer for SNP1 consists of SEQ ID NO:46 at the 3' end and SEQ ID NO:78 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:93 and SEQ ID NO:

94. The wild-type specific ASPE primer for SNP8 consists of SEQ ID NO:47 at the 3' end and SEQ ID NO:79 at the 5' end, and the mutant specific ASPE primer for SNP1 consists of SEQ ID NO:48 at the 3' end and SEQ ID NO:80 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:95 and SEQ ID NO:

96. The wild-type specific ASPE primer for SNP9 consists of SEQ ID NO:49 at the 3' end and SEQ ID NO:65 at the 5' end, while the mutant-type specific ASPE primer for SNP1 consists of SEQ ID NO:50 at the 3' end and SEQ ID NO:72 at the 5' end. The corresponding specific anti-tag sequences are SEQ ID NO:81 and SEQ ID NO:

88.

5. A method for identifying mouse subspecies, characterized in that, The mouse sublines consist of three C57BL / 6 mouse sublines and two BALB / c mouse sublines, wherein the three C57BL / 6 mouse sublines are C57BL / 6N. Nifdc C57BL / 6J Nifdc and C57BL / 6-bg Nifdc The two BALB / c mouse sublines are BALB / cJ. Nifdc and BALB / cCrSlc Nifdc The method includes performing the following steps using the kit of claim 4: (1) PCR amplification of DNA samples from mice to be tested to obtain PCR amplification products; (2) The obtained PCR amplification products are purified to obtain purified products; (3) The purified product was extended with the specific ASPE primers and biotin-labeled dCTP was incorporated into the reaction to obtain the post-reaction product with multiple biotin labels. (4) Hybridize the magnetic beads coated with specific anti-tag sequences corresponding to the specific ASPE primers with the reaction products labeled with multiple biotin to obtain hybridization products; (5) The hybridization product is reacted with streptavidin-phycoerythrin to obtain the reaction product; (6) Detect the reaction product to obtain the allele information of the SNP locus combination of the mouse under test; (7) Identify mouse sublines using allele information of SNP locus combinations obtained from the mice to be tested; The identification process includes: using allele information from SNP1 or SNP5 loci to identify C57BL / 6J. Nifdc It was distinguished from the other four mouse sublines, and then the BALB / cJ subline was identified using allele information at SNP6, SNP7, or SNP8 loci. Nifdc Differentiate it from the remaining three mouse sublines, and then use the allele information of SNP2, SNP3, or SNP4 loci to identify C57BL / 6-bg. Nifdc It was differentiated from the remaining two mouse sublines, and then the C57BL / 6N subline was identified using allele information at the SNP9 locus. Nifdc and BALB / cCrSlc Nifdc Identify and separate them, thereby achieving simultaneous integration of C57BL / 6N. Nifdc C57BL / 6J Nifdc C57BL / 6-bg Nifdc BALB / cJ Nifdc and BALB / cCrSlc Nifdc The five mouse sublines, including the one mentioned above, were distinguished from each other.

Citation Information

Patent Citations

  • Primer, kit and method for distinguishing C57BL / 6 subline mice

    CN114317767A

  • C57BL / 6 subline mouse KASP genetic test kit and primer

    CN110423826A