A method and application for detecting IGFBP-7 based on an immuno-nucleic acid CHA fluorescence sensing system.

By combining antigen-antibody specific recognition with nucleic acid catalytic hairpin assembly reaction, an immuno-nucleic acid CHA fluorescence sensing system was constructed, which solved the sensitivity and stability problems of IGFBP-7 detection and achieved high specificity and high sensitivity for early diagnosis of AKI.

CN116377021BActive Publication Date: 2025-12-02ANHUI MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310220060.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-09
Publication Date
2025-12-02
Estimated Expiration
2043-03-09

Smart Images

  • Figure CN116377021B_ABST
    Figure CN116377021B_ABST
Patent Text Reader

Abstract

This invention relates to a kit and method for detecting anti-human insulin-like growth factor binding protein 7 (IGFBP-7) using a double-antibody sandwich principle combined with a nucleic acid probe self-assembly signal amplification method. The kit comprises three parts: 1) a capture domain formed by IGFBP-7 antibody 1 coated on the surface of an ELISA plate; 2) a tandem functional domain composed of biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primers; and 3) a fluorescence signal functional domain composed of two DNA hairpin probes. Compared with traditional ELISA methods, the method of this invention significantly improves detection sensitivity and features high specificity, high sensitivity, good stability, and strong versatility, as well as good clinical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biology, and more specifically to a method for detecting the kidney injury marker IGFBP-7. Background Technology

[0002] Acute kidney injury (AKI) is a common clinical emergency caused by various factors, including heart failure, sepsis, bleeding, and nephrotoxic drugs. It is characterized by a sudden decline in kidney function, leading to the retention of metabolic products such as nitrogenous waste and creatinine, and has a high morbidity and mortality rate. Early diagnosis of AKI provides a crucial treatment window to prevent progression to chronic kidney failure. Currently, changes in serum creatinine levels and urine output are considered the gold standard for diagnosing acute kidney injury. However, serum creatinine and urine output are easily affected by factors such as age and weight, often resulting in delayed increases and failing to reflect the extent of kidney damage in a timely manner, making them less effective for early AKI diagnosis.

[0003] In recent years, with the development of information technology, nanotechnology, and biomedicine, researchers have discovered many novel biomarkers for the early diagnosis of acute kidney injury (AKI). Among them, human insulin-like growth factor binding protein 7 (IGFBP-7) is a novel early AKI biomarker with superior accuracy compared to traditional indicators. Therefore, developing a reliable method for detecting early AKI biomarker (IGFBP-7) is of great significance.

[0004] Currently, the main method developed for detecting AKI is enzyme-linked immunosorbent assay (ELISA), an immunological method. Although ELISA is a mature detection technology with high sensitivity and specificity, its results are not very stable when performing color development. Therefore, a simple and stable method for detecting early biomarkers of AKI still has good prospects for the diagnosis of AKI.

[0005] Catalytic hairpin assembly is an isothermal, enzyme-free amplification technique. Using a specific trigger strand, two custom-designed hairpins self-assemble, generating abundant and stable double-stranded signal readings, and is commonly used for the amplification and detection of target molecules. This isothermal nucleic acid amplification method can be performed at relatively low temperatures, without the need for thermal cycling and precise temperature control, and can achieve high levels of signal amplification in a relatively short time.

[0006] Currently, there is an urgent need in clinical applications to develop a highly specific, sensitive, and stable method for detecting IGFBP-7. There are currently no literature reports in this field that combine antigen-antibody specific recognition with nucleic acid catalytic hairpin assembly reaction for the detection of IGFBP-7. Summary of the Invention

[0007] The purpose of this invention is to provide a method for detecting IGFBP-7 using an immuno-nucleic acid CHA-based fluorescence sensing system, in order to solve the problems mentioned in the background art.

[0008] To achieve the above objectives, a first aspect of the present invention provides a method for quantitative detection of IGFBP-7 using an immuno-nucleic acid CHA-based fluorescence sensing system, the method comprising the following steps:

[0009] (1) Centrifuge the sample to be tested at low speed and take the supernatant as the test solution;

[0010] (2) Add the test solution to the enzyme-labeled plate coated with IGFBP-7 antibody 1, mix thoroughly, and then remove excess components by washing to obtain component A;

[0011] (3) Take equal volumes of biotin-labeled IGFBP-7 antibody 2, streptavidin and biotin-labeled DNA primer, mix them and place them at room temperature. Then add the mixture to component A, mix and react thoroughly, and remove excess components by washing to obtain component B.

[0012] (4) Add DNA hairpin probe AP1, DNA hairpin probe AP2 and buffer to component B, mix thoroughly and react, and then directly detect the fluorescence signal of the resulting solution.

[0013] (5) The content of IGFBP-7 in the test solution was calculated based on the linear relationship between the fluorescence signal value and the IGFBP-7 concentration.

[0014] Preferably, the sample to be tested in step (1) is human blood or urine.

[0015] Preferably, the reaction temperature in step (2) is 30-40℃ and the reaction time is 60-120min.

[0016] More preferably, the reaction temperature in step (2) is 37°C and the reaction time is 90 min.

[0017] Preferably, in step (2), the IGFBP-7 antibody 1 is an IGFBP-7 goat monoclonal antibody.

[0018] Preferably, in step (3), the biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primers are mixed and then left at room temperature for 1 hour.

[0019] Preferably, in step (3), the concentration ratio of the biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primer is 1:1:(1-3).

[0020] More preferably, in step (3), the concentration ratio of biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primer is 1:1:2.

[0021] Preferably, the biotin-labeled IGFBP-7 antibody 2 in step (3) is a biotin-labeled IGFBP-7 rabbit monoclonal antibody.

[0022] Preferably, the nucleotide sequence of the biotin-labeled DNA primer in step (3) is shown in SEQ ID NO.1.

[0023] 5'-TAGCTTATCAGACTGATGTTGATTTTTTTTTT T -3'(SEQ ID NO.1).

[0024] Preferably, the 3' end of the SEQ ID NO.1 sequence is modified with biotin, and the modified bases at the 3' end are indicated by underline.

[0025] Preferably, the reaction temperature in step (3) is 30-40℃ and the reaction time is 30-90min.

[0026] More preferably, the reaction temperature in step (3) is 37°C and the reaction time is 60 min.

[0027] Preferably, the nucleotide sequence of the DNA hairpin probe AP1 in step (4) is shown in SEQ ID NO.2.

[0028] 5'-TCAACATCAG T CTGATAAGCTAGATGTTGAAACCTAGCTAGCTTATCAGAC T -3'(SEQ ID NO.2).

[0029] Preferably, the 5' end of the SEQ ID NO.2 sequence is modified with a fluorescence quenching group, and the 3' end is modified with a fluorescent group, wherein the modification positions at the 5' and 3' ends are indicated by underlined bases.

[0030] Preferably, the fluorescence quenching group is 4-dimethylamine azobenzene-4'-carboxylic acid (DABCYL), and the fluorescent group is FAM.

[0031] Preferably, the nucleotide sequence of the DNA hairpin probe AP2 in step (4) is shown in SEQ ID NO.3.

[0032] 5'-TAAGCTAGCTAGGTTTCAACATCTAGCTTATCAGAGAGATGTTGAAAACCTAGCCCTT-3' (SEQ ID NO. 3).

[0033] Preferably, the reaction temperature in step (4) is 30-40℃ and the reaction time is 60-120min.

[0034] More preferably, the reaction temperature in step (4) is 37°C and the reaction time is 90 min.

[0035] Preferably, the buffer solution in step (4) is selected from Tris buffer, rCutSmart buffer, etc. TM One or more of the following: buffer solution, Klenow buffer, and TNaK buffer.

[0036] Preferably, the buffer solution in step (4) is a Tris buffer solution.

[0037] Preferably, the fluorescence signal value in step (5) is the fluorescence peak value at a wavelength of 512 nm.

[0038] A second aspect of the present invention provides a kit for the quantitative detection of IGFBP-7, the kit comprising a capture domain, a tandem domain, and a fluorescence signal domain, wherein the capture domain is formed by coating IGFBP-7 antibody 1 onto the surface of an enzyme-labeled plate, the tandem domain is composed of equal volumes of biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primers, and the fluorescence signal domain is composed of two DNA hairpin probes AP1 and AP2 and a buffer solution.

[0039] Preferably, the IGFBP-7 antibody 1 is an IGFBP-7 sheep monoclonal antibody.

[0040] Preferably, the concentration ratio of the biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primer is 1:1:(1-3).

[0041] More preferably, the concentration ratio of the biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primer is 1:1:2.

[0042] Preferably, the biotin-labeled IGFBP-7 antibody 2 is a biotin-labeled IGFBP-7 rabbit monoclonal antibody.

[0043] Preferably, the nucleotide sequence of the biotin-labeled DNA primer is shown in SEQ ID NO.1.

[0044] Preferably, the 3' end of the SEQ ID NO.1 sequence is modified with biotin, and the modified bases at the 3' end are indicated by underline.

[0045] Preferably, the nucleotide sequence of the DNA hairpin probe AP1 is shown in SEQ ID NO.2.

[0046] Preferably, the 5' end of the SEQ ID NO.2 sequence is modified with a fluorescence quenching group, and the 3' end is modified with a fluorescent group, wherein the modification positions at the 5' and 3' ends are indicated by underlined bases.

[0047] Preferably, the fluorescence quenching group is 4-dimethylamine azobenzene-4'-carboxylic acid (DABCYL), and the fluorescent group is FAM.

[0048] Preferably, the nucleotide sequence of the DNA hairpin probe AP2 is shown in SEQ ID NO.3.

[0049] Preferably, the buffer solution is selected from Tris buffer, rCutSmart buffer, etc. TM One or more of the following: buffer solution, Klenow buffer, and TNaK buffer.

[0050] More preferably, the buffer solution is a Tris buffer solution.

[0051] A third aspect of the present invention provides the application of the above-described kit in the preparation of reagents for the quantitative detection of IGFBP-7.

[0052] A fourth aspect of the present invention provides the use of the above-described kit in the preparation of reagents for screening kidney diseases.

[0053] Preferably, the kidney disease is acute kidney injury.

[0054] The basic principle of this invention: This invention combines antigen-antibody specific immune capture and nucleic acid-catalyzed hairpin assembly reaction to develop a highly specific and sensitive IGFBP-7 detection method for the diagnosis of acute kidney injury. This method consists of three parts: a capture domain, a tandem domain, and a fluorescence signal domain. The capture domain is formed by IGFBP-7 antibody 1 coated on the surface of an ELISA plate, specifically capturing IGFBP-7. The tandem domain consists of biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primers. The biotin-labeled IGFBP-7 antibody at one end of this domain binds to IGFBP-7, and the DNA primer at the other end binds to the fluorescence domain. The fluorescence domain consists of two DNA hairpin probes, AP1 and AP2, which undergo a CHA reaction in the presence of the DNA primers to generate an exponentially amplified fluorescence signal. The CHA reaction is an enzyme-free cyclic reaction based on a footpoint strand displacement reaction, relying on specific primers as catalysts to catalyze the formation of abundant and stable DNA double strands from two metastable hairpin probes. This invention modifies the DNA hairpin probe AP1 with fluorescent and quenching groups. Under normal circumstances, the fluorescence signal of the two groups near AP1 is quenched. When a self-assembly reaction occurs, a strong fluorescence signal is released, which enables the entire detection system to achieve an exponential amplification effect.

[0055] Compared with the prior art, the advantages of the present invention are as follows:

[0056] 1. This invention combines antigen-antibody specific capture with catalytic hairpin assembly reaction to achieve a significant catalytic amplification effect, thus constructing a novel high-sensitivity protein quantification detection technology. The method for quantifying IGFBP-7 of this invention has wide applicability.

[0057] 2. The reaction temperature of the detection method of the present invention is 30-37℃, which avoids the use of expensive instruments and reduces the detection cost.

[0058] 3. The fluorescence signal of this invention is designed based on the fluorescence energy resonance transfer theory. The system has low background signal, high sensitivity, and stable results.

[0059] 4. Through screening experiments on the concentration ratio of each component in the tandem functional domain, this invention found that when the ratio of the tandem functional domain components IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primers is in the range of 1:1:1 to 1:1:3, the detection method of this invention can obtain better detection performance. Attached Figure Description

[0060] Figure 1 This is a schematic diagram of the present invention for detecting IGFBP-7, including a schematic diagram of the division and composition of each functional domain (A) and a schematic diagram of IGFBP-7 detection (B);

[0061] Figure 2 The fluorescence intensity response diagrams for different samples tested in this invention are shown.

[0062] Figure 3 The graph shows the sensitivity and linearity analysis of IGFBP-7 detected in this invention. Detailed Implementation

[0063] The present invention will be further described below with reference to the accompanying drawings and preferred embodiments, but this does not limit the scope of protection of the present invention.

[0064] Example 1: Method for quantitative detection of IGFBP-7 according to the present invention and its feasibility analysis

[0065] Different concentrations of IGFBP-7 test solutions were prepared. 100 μL of each solution was added to an ELISA plate coated with IGFBP-7 goat monoclonal antibody (from the IGFBP-7 ELISA kit, Sangon Biotech (Shanghai) Co., Ltd.). After thorough mixing and incubation at 37°C for 90 min, excess components were removed by washing to obtain component A. Biotin-labeled IGFBP-7 rabbit monoclonal antibody (from the IGFBP-7 ELISA kit, Sangon Biotech (Shanghai) Co., Ltd.), streptavidin, and biotin-labeled DNA primers (5'-TAGCTTATCAGACTGATGTTGATTTTTTTTT) were mixed in equal volumes at a concentration ratio of 1:1:2. T -3' (SEQ ID NO.1), the 3' end is modified with biotin (the modified base at the 3' end is indicated by underlined bases). The mixture was allowed to stand at room temperature for 1 h to obtain 100 μL of the tandem conjugate. The tandem conjugate was added to component A and mixed thoroughly. After reacting at 37 °C for 60 min, excess components were removed by washing to obtain component B. 1 μL of 10 μM AP1 probe (5'-TCAACATCAG) was added to component B. T CTGATAAGCTAGATGTTGAAACCTAGCTAGCTTATCAGAC T-3' (SEQ ID NO.2), with the 5' end modified with the fluorescence quencher group 4-dimethylamine azobenzene-4'-carboxylic acid, and the 3' end modified with the fluorescent group FAM, wherein the modification positions of the 5' and 3' ends are indicated by underlined bases), 1 μL of 10 μM AP2 probe (5'-TAAGCTAGCTAGGTTTCAACATCTAGCTTATCAGAGAGATGTTGAAACCTAG CCCTT-3' (SEQ ID NO.3)) and 98 μL of Tris buffer were thoroughly mixed and reacted at 37℃ for 90 min. The fluorescence signal of the resulting solution at a wavelength of 512 nm was directly detected. The content of IGFBP-7 in the test solution was calculated based on the linear relationship between the fluorescence signal value and the IGFBP-7 concentration.

[0066] Three different groups of samples were tested following the steps described above: a control group (i.e., without any target sample), a KIM-1 group (as a non-specific control group), and an IGFBP-7 group. The experimental results are as follows: Figure 2 As shown, a significant fluorescence signal only appears in the presence of IGFBP-7, verifying the feasibility of the detection method of the present invention, and also indicating that the method of the present invention does not respond to non-specific targets.

[0067] Example 2: Sensitivity and Linearity Analysis of the Detection Method of the Present Invention

[0068] Different concentrations (0.001 ng / mL to 3 μg / mL) of IGFBP-7 were prepared to investigate the sensitivity of the fluorescence sensing system of Example 1 of this invention. Figure 3 As shown, the fluorescence intensity increases with increasing IGFBP-7 concentration. The fluorescence intensity and IGFBP-7 concentration were fitted using Origin software. The results indicate that within the IGFBP-7 protein detection concentration range of 0.001 ng / mL to 100 ng / mL, a good linear correlation exists between fluorescence intensity and IGFBP-7 concentration. Currently, the detection range of commercially available IGFBP-7 enzyme-linked immunosorbent assay kits is 0.94-60 ng / mL. Therefore, the method of this invention can significantly improve the sensitivity and detection range of IGFBP-7 protein.

[0069] Example 3: Sensitivity Comparison Analysis of the Method of the Present Invention and Commercially Available Reagent Kits

[0070] Using the method described in Example 1 above and the existing human insulin-like growth factor binding protein 7 (IGFBP-7) enzyme-linked immunosorbent assay kit, the same sample content was measured according to the instructions. The sensitivity of the two methods was compared, and the experimental results are shown in Table 1 below.

[0071] Table 1. Comparison of the sensitivity of the method of the present invention with that of commercially available reagent kits.

[0072]

[0073]

[0074] Table 1 shows that the experimental results indicate that the detection method of this invention maintains high accuracy within the range of 0.01-100 ng / mL, while commercially available kits fail to accurately detect the concentration of the standard vials when the standard concentration increases to 100 ng / mL. Furthermore, when the standard concentration decreases to 0.01 ng / mL, the commercially available kits show no response, while the method of this invention still maintains high accuracy. Therefore, this invention has significant advantages over commercially available kits in terms of detection accuracy and sensitivity.

[0075] Example 4: Experiment on the optimization of the allocation ratio of each group of the serial functional domains of the present invention

[0076] The tandem functional domain composed of IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primers is crucial to the performance of the entire detection technology. This embodiment screened the optimal tandem functional domain composition ratio through different concentration ratios of the three components. The specific process is as follows: A 10 μg / mL IGFBP-7 standard test solution was prepared and added to an ELISA plate coated with IGFBP-7 goat monoclonal antibody. After thorough mixing and incubation at 37°C for 90 min, excess components were removed by washing to obtain component A. Following the method in Example 1, different tandem functional domain compositions were prepared according to the concentration ratios of components in Table 2 (each component added in compositions 1-8 is 10 μL). ddH2O was then added to 100 μL, and the tandem functional domain composition was added to component A. After thorough mixing and incubation at 37°C for 60 min, excess components were removed by washing to obtain component B. Following the method in Example 1, 1 μL of a 10 μM AP1 probe (SEQ ID NO) was added to component B. NO.2, with a fluorescence quencher group 4-dimethylamine azobenzene-4'-carboxylic acid at its 5' end and a fluorescent group FAM at its 3' end, along with 1 μL of 10 μM AP2 probe (SEQ ID NO.3) and 98 μL of buffer, was thoroughly mixed and reacted at 37°C for 90 min. The fluorescence signal of the resulting solution was directly detected at a wavelength of 512 nm. The optimal detection performance was determined based on the fluorescence signal value. Eight groups of tandem functional domain component compositions with different concentration ratios were tested according to the above steps, and the experimental results are shown in Table 2 below.

[0077] Table 2. Fluorescence peak values ​​of tandem functional domains prepared by different ratios of components in this invention.

[0078]

[0079]

[0080] As shown in Table 2 above, the fluorescence signal intensity of the tandem functional domain is relatively high when the concentration ratio of the three components is in the range of 1:1:1 to 1:1:3. It is particularly noteworthy that the fluorescence signal intensity of the tandem functional domain is highest when the concentration ratio of the three components is 1:1:2, indicating that the detection method of the present invention has the best detection performance at this concentration ratio.

[0081] Although specific embodiments of the invention have been described, those skilled in the art will recognize that various changes and modifications can be made to the invention without departing from its scope or spirit. Therefore, the invention is intended to cover all such changes and modifications falling within the scope of the appended claims and their equivalents.

Claims

1. A kit for the quantitative detection of IGFBP-7, characterized in that, The kit comprises a capture domain, a tandem domain, and a fluorescence signal domain. The capture domain is formed by coating IGFBP-7 antibody 1 onto the surface of an enzyme-labeled plate. The tandem domain consists of biotin-labeled IGFBP-7 antibody 2, streptavidin, and biotin-labeled DNA primers. The fluorescence signal domain consists of two DNA hairpin probes, AP1 and AP2, and a buffer solution. The nucleotide sequences of the biotin-labeled DNA primers are shown in SEQ ID NO. 1, the nucleotide sequences of DNA hairpin probe AP1 are shown in SEQ ID NO. 2, and the nucleotide sequences of DNA hairpin probe AP2 are shown in SEQ ID NO.

3.

2. The use of the kit described in claim 1 in the preparation of reagents for the quantitative detection of IGFBP-7.

3. The use of the kit according to claim 1 in the preparation of reagents for screening kidney diseases, characterized in that, The kidney disease described is acute kidney injury.

Citation Information

Patent Citations

  • Single quantum dot fluorescent nano sensor based on non-enzyme catalyst and self-assembly and preparation method and application thereof

    CN110398481A

  • Method for detecting target nucleic acid based on cationic conjugated polymer and nuclease-assisted cyclic amplification

    CN111850103A