Immunomodulatory peptide bugacath and uses thereof

By extracting and synthesizing the immunomodulatory peptide BugaCATH from the Chinese toad, a gap in research on skin wound repair has been filled, achieving significant skin wound healing effects that are superior to existing technologies.

CN116462747BActive Publication Date: 2026-08-04KUNMING MEDICAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310490776.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-04
Publication Date
2026-08-04
Estimated Expiration
2043-05-04

AI Technical Summary

Technical Problem

There are no reports in the existing technology on the active skin components of the Chinese toad in promoting skin wound repair, and the skin injury healing process of amphibians has not been effectively utilized.

Method used

The immunomodulatory peptide BugaCATH from the Chinese toad was extracted and synthesized. Its structure was determined by nucleotide and amino acid sequences, and it was applied to the preparation of a therapeutic drug that promotes the repair of skin wounds.

Benefits of technology

BugaCATH significantly promotes skin wound healing, outperforming epidermal growth factor (EGF), and exhibits significant wound healing effects in mouse models.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116462747B_ABST
    Figure CN116462747B_ABST
Patent Text Reader

Abstract

The application discloses an immunoregulatory peptide BugaCATH and application thereof, and belongs to the field of biomedicine. Buga The CATH is a cyclic polypeptide with a pair of intramolecular disulfide bond composed of a sixth cysteine and a thirteenth cysteine, and has a molecular weight of 3156.67 Dalton and an isoelectric point of 8.76, wherein the amino acid sequence is shown as SEQ ID NO: 2. Buga The gene (GenBank accession: OQ870533) of the CATH precursor is composed of 663 nucleotide sequences, and the nucleotide sequence is shown as SEQ ID NO: 1; wherein the nucleotide at the positions of 322-448 is the immunoregulatory peptide Buga The encoding gene of the CATH. The immunoregulatory peptide Buga The application of the CATH in the preparation of a treatment drug for promoting skin wound repair.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an immunomodulatory peptide BugaCATH and its applications. Background Technology

[0002] Amphibians, as a transitional type between aquatic and terrestrial vertebrates, inhabit complex and diverse environments. Their bare, smooth, hairless, and scale-covered skin presents them with numerous threats and challenges. To adapt to the complex environments of both terrestrial and aquatic habitats, amphibians have evolved a unique and powerful skin defense system. As an important physical barrier, the skin prevents microbial invasion and maintains body temperature and fluid homeostasis. Skin trauma can instantly destroy this barrier, posing a significant threat to health. Therefore, skin wound healing is crucial for maintaining the body's external barrier function. Skin wound healing is a dynamic process of self-repair and reconstruction of intact skin after tissue damage, strictly regulated by multiple cell types and numerous factors.

[0003] Amphibian skin plays a vital role in maintaining their survival and adapting to diverse habitats, providing essential protection for their well-being. Amphibian skin can secrete a large number of bioactive molecules to defend against biotic and abiotic attacks from the environment. The Chinese toad (Bufo gargarizans) is an economically valuable animal in my country, and research on it has mainly focused on its skin products, toad venom and toad skin. However, there are no reports on the identification and mechanism of its active ingredients that promote skin repair. Summary of the Invention

[0004] The first objective of this invention is to provide an immunomodulatory peptide, BugaCATH; the second objective is to provide applications of the aforementioned immunomodulatory peptide, BugaCATH.

[0005] The first objective of this invention is achieved as follows: the nucleotide sequence of the immunomodulatory peptide BugaCATH is shown in the sequence listing SEQ ID NO: 1.

[0006] The immunomodulatory peptide BugaCATH described in this invention is a cyclic polypeptide encoded by the defense peptide gene of the Chinese amphibian, BugacatH. It consists of 29 amino acid residues, has a molecular weight of 3156.67 Daltons, an isoelectric point of 8.76, and its amino acid sequence is shown in SEQ ID NO:2. Asn Gly Lys Lys Lys Cys Lys Glu Pro Glu Lys Leu Cys Leu Lys Pro GlyGly His SerVal Ile Phe Asp Ala Ser Val Asn Glu.

[0007] The gene encoding this immunomodulatory peptide precursor consists of 663 nucleotides, and its nucleotide sequence is shown in SEQ ID NO:1. Its sequence from the 5' end to the 3' end is as follows: .

[0008] Nucleotides 322–448 are immunomodulatory peptides. Buga The gene encoding CATH.

[0009] The second objective of this invention is achieved as follows: the immunomodulatory peptide... Buga Application of CATH in the preparation of drugs that promote the repair of skin wounds.

[0010] The beneficial effects of this invention are: it provides a novel immunomodulatory peptide. Buga CATH, an immunomodulatory peptide, has a significant function in promoting skin wound repair and can be used in the preparation of drugs that promote skin wound repair. Attached Figure Description

[0011] Picture 1 This is a schematic diagram showing the comparison of how the immunomodulatory peptide BugaCATH promotes wound healing in mice according to the present invention. Among them, A is an immunomodulatory peptide BugaCATH-based mouse wound healing model, which is applied topically daily. Buga Comparison of images after treatment with CATH, EGF, and sterile water (vehicle negative control group); B is for use at 2mg / mL Buga Comparison of 20µL each of CATH peptide (sample treatment group), 100mg / mL Epidermal Growth Factor (EGF, positive control group), and sterile water (Vehicle, negative control group) applied to mouse wounds; Compared with the vehicle negative control group, Buga The skin wound area of ​​mice treated with CATH and EGF was significantly reduced (mean ± standard deviation, ns, p>0.05, *p<0.05, **p<0.01). Detailed Implementation

[0012] The present invention will be further described below with reference to embodiments and accompanying drawings, but this does not limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0013] The nucleotide sequence of the immunomodulatory peptide BugaCATH described in this invention is shown in SEQ ID NO: 1 of the sequence listing.

[0014] The amino acid sequence encoded by the immunomodulatory peptide BugaCATH is shown in SEQ ID NO: 2.

[0015] The application of the immunomodulatory peptide BugaCATH described in this invention is its use in the preparation of drugs that promote skin wound repair.

[0016] The invention will be further illustrated below with specific implementation examples: Example 1 Immunomodulatory peptides Buga Chemical Synthesis Methods of CATH (1) Synthesized using an automated peptide synthesizer (433A, Applied Biosystems, USA) Buga The complete amino acid sequence of CATH was determined by high-performance liquid chromatography (HPLC) (Waters, USA). 18 The synthesized sample was purified by reverse-phase column chromatography desalting. (2) The molecular weight of the synthesized sample was determined by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF). (3) The purity of the synthesized sample was identified by high-performance liquid chromatography (HPLC). The molecular weight of the chemically synthesized peptide was determined to be 3156.67 Da by MALDI-TOF, the isoelectric point of the synthesized peptide was determined to be 8.76 by isoelectric focusing electrophoresis, and the purity of the synthesized sample was determined to be >95% by HPLC. The synthesized amino acid sequencer was used to determine the molecular weight of the synthesized peptide. Buga CATH amino acid sequence structure and natural Buga Consistent with CATH.

[0017] Example 2 Immunomodulatory peptides Buga CATH gene cloning (1) Total RNA extraction from the skin of the Chinese toad: Rinse the skin on the toad's back with deionized water, then flash-freeze in liquid nitrogen for 10 hours. Take 100 mg of skin tissue, add 1 ml of Trizol solution, and homogenize in a 20 ml glass homogenizer for 30 minutes. Add an equal volume of phenol / chloroform solution, mix vigorously, incubate at room temperature for 10 minutes, centrifuge at 12000 rpm for 10 minutes at 4°C, and discard the precipitate. Add an equal volume of isopropanol to the supernatant, incubate at room temperature for 10 minutes, centrifuge at 12000 rpm for 10 minutes at 4°C, wash the precipitate once with 75% ethanol, air dry, and the precipitate at the bottom of the tube is the total RNA from the skin.

[0018] (2) Construction of the cDNA library of the skin of the Chinese toad: Using CLONTECH's Creator TM SMART TM The cDNA Library Construction Kit is a plasmid-cDNA library construction kit. Follow the instructions in the manual for specific operation.

[0019] The first-chain synthesis utilizes the CDS Ⅲ / 3' Primer provided in the kit. 5'-ATTCTAGAGGCCGAGGCGGCCGACATG (30) N-1N-3' (N=A,C,G or T;N-1=A,G or C) and SMART TM IV. oligonucleotide: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'. The second chain was synthesized using CDS Ⅲ / 3' Primer provided in the kit. 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-3' and 5'primer 5'-AAGCAGTGGTATCAACGCAGAGT-3'. The reverse transcriptase used for first-strand synthesis and the high-fidelity polymerase used for second-strand synthesis were provided by the kit. The cDNA double-stranded DNA was stored at -80°C after synthesis.

[0020] (3) Immunomodulatory peptides Buga CATH gene clone screening: Degenerate primers were designed based on the conserved region of cathelicidin from published amphibian sources: 5'-(A / T)(C / G)C(A / G)CAG(A / G)(C / T)CTTCACCTCC-3'. These primers, along with the 5' PCR primer from the library preparation kit: 5'-AAGCAGTGGTATCAACGCAGAGT-3', were used. PCR amplification was performed using second-strand cDNA from *Bufo gargarizans* skin as a template under the following conditions: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 10 s, 50℃ annealing for 30 s, and 72℃ extension for 40 s. The entire amplification process consisted of 35 cycles. The amplified PCR products were verified by agarose gel electrophoresis and then sent to a sequencing company for sequencing.

[0021] Based on the 5' end sequence obtained from sequencing, primer 5'-CCATGAGGAGCTGGTGGCTGT-3' was designed and used in conjunction with the 3' PCR primer 5'-ATTCTAGAGGCCGAGGCGGCCG-3' from the library preparation kit for PCR amplification under the same conditions as above. After amplification, the target fragment was recovered using a DNA gel extraction kit, and the band size was verified by gel electrophoresis. The gel-extracted product was ligated overnight with the pMD18-T vector and transformed into *E. coli* DH5α competent cells prepared using the calcium chloride method. The next day, single clones were picked for colony PCR, and positive clones were screened for inoculation and plasmid extraction. Subsequently, the plasmid fragment size was verified by agarose gel electrophoresis, and plasmids corresponding to the correct band size were sequenced.

[0022] (4) Immunomodulatory peptides Buga CATH gene sequencing: Plasmid DNA was extracted and its nucleotide sequence was determined using the dideoxy sequencing method. The instrument used was an Applied Biosystems 373A fully automated nucleotide sequencer, and the sequencing primers were BcaBEST. TMSequencing Primer RV-M and BcaBEST TM Sequencing Primer M13-47, BcaBEST TM Sequencing Primer RV-M sequence: 5`GAGCGGATAACAATTTCAC ACAGG 3', BcaBEST TM Sequencing Primer M13-47: 5'CGCCAGGGTTTTCCCAGTCACGAC 3'.

[0023] Gene sequencing results indicate that the gene encodes an immunomodulatory peptide. Buga The gene for the CATH precursor consists of 663 nucleotides (SEQ ID NO: 1) (GenBank Accession Number: OQ870533), and its sequence from the 5' end to the 3' end is as follows: .

[0024] Nucleotides 322–448 are immunomodulatory peptides. Buga The gene encoding CATH.

[0025] Example 3 Immunomodulatory peptides Buga Application of CATH in the preparation of drugs for promoting skin wound repair The backs of the mice were disinfected with 75% alcohol swabs, and then the mice were housed separately. Using a sterilized punch, equal-sized, round, full-coverage dermal incisions were made on both sides of the mouse's back. 2 mg / mL of the solution was then injected. Buga20 µL each of CATH peptide (treatment group), 100 mg / mL Epidermal Growth Factor (EGF, positive control group), and sterile water (Vehicle, negative control group) were applied to the wounds of mice once a day. Changes in the wounds were photographed on days 0, 2, 4, 6, 8, and 10 after treatment.

[0026] The results are as follows Picture 1 As shown: Compared to the vehicle group, Buga The CATH treatment group and the positive control EGF group effectively promoted wound healing in mice. Picture 1 (A). On the 2nd, 4th, 6th, and 8th days. Buga The wound healing rates in the CATH group were 32.7%, 64.7%, 72.5%, and 85.5%, respectively; in the EGF group, they were 29.6%, 56.7%, 65.1%, and 83%, respectively; and in the blank group, they were 17.4%, 47.9%, 60.7%, and 76%, respectively. Picture 1 (B). Around day 8, the wounds in the treatment group had basically healed, showing a significant difference compared to the control group. Experimental results indicate that immunomodulatory peptides... Buga CATH has a significant effect on promoting skin wound healing, and its effect is better than that of epidermal growth factor (EGF). Immunomodulatory peptides Buga CATH can be used in the preparation of drugs that promote skin wound repair.

[0027] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An immunomodulatory peptide, BugaCATH, characterized in that... The immunomodulatory peptide BugaCATH is a cyclic polypeptide consisting of a pair of intramolecular disulfide bonds formed by the sixth and thirteenth cysteine ​​residues. The amino acid sequence of the immunomodulatory peptide BugaCATH is shown in SEQ ID NO:

2.

2. An application of the immunomodulatory peptide BugaCATH according to claim 1, characterized in that... The application of the immunomodulatory peptide BugaCATH in the preparation of drugs that promote skin wound repair.