Sf9-pt cells free of rhabdovirus and their use

By selecting and passaged Sf9-PT cells free of rhabdovirus contamination, the problem of Sf9 cells being contaminated by Sf-RV was solved, enabling high-density culture and stable packaging of AAV5 virus, thus improving the safety and production efficiency of bioproducts.

CN116515728BActive Publication Date: 2026-06-30PORTON BIOLOGICS LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
PORTON BIOLOGICS LTD
Filing Date
2023-03-29
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing Sf9 cells are contaminated with Sf-rhabditis virus (Sf-RV), raising concerns about the safety of biopharmaceutical production, and the proliferation level and packaging stability of recombinant baculovirus are insufficient.

Method used

A strain of Sf9-PT cell free from rhabdovirus contamination was provided. Through screening and passage culture, it was ensured that the cells did not carry Sf-RV. The cells were then used in an insect baculovirus expression system to package adeno-associated virus and express recombinant proteins, thereby improving the proliferation level and packaging stability of recombinant baculovirus.

Benefits of technology

Sf9-PT cells can be cultured at high density, increasing the expression of exogenous proteins, reducing costs, and their ability to package AAV5 virus remains stable up to the 30th generation, ensuring the safety and production efficiency of bioproducts.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116515728B_ABST
    Figure CN116515728B_ABST
Patent Text Reader

Abstract

This application provides a rhabdovirus-free Sf9-PT cell line and its applications. This cell line was deposited on March 15, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: C202334. The Sf9-PT cell line screened in this application is free from rhabdovirus contamination, allows for high-density culture, exhibits higher viral proliferation levels, and demonstrates more durable viral packaging stability. This cell line can serve as a modified alternative host for the development and commercial production of biological products and vaccines, and can more safely avoid the potential dangers posed by Sf-RV virus contamination.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to a strain of Sf9-PT cell without rhabdovirus and its applications. Background Technology

[0002] Baculovirus-insect cell expression systems are powerful platforms for recombinant protein expression and have been used to develop various investigational biopharmaceuticals and produce viral vaccines. Comprehensive strategies for mitigating the risk of biopharmaceutical contamination remain applicable to product safety, including starting materials such as cell lines and cell culture reagents used in product manufacturing. Because insects are phylogenetically distant from humans, researchers generally believe that using insect-derived cell lines to produce biopharmaceuticals better avoids some safety issues associated with exogenous viruses compared to using mammalian cells.

[0003] Sf9 cells, with their advantages of high protein expression and ease of manipulation, have become one of the most widely used insect cell lines for eukaryotic protein expression. However, in recent years, the U.S. Center for Biological Evaluation and Research discovered that all tested Sf cells were contaminated with a novel exogenous virus, Sf-rhabdovirus (Sf-RV). This discovery has raised concerns about the safety of biopharmaceuticals produced using insect cell-baculovirus expression vector systems. Although there is currently no evidence that Sf-RV poses a threat to humans or animals, any exogenous viral contamination discovered during biopharmaceutical preparation must be removed using all available methods to ensure the safety of the biopharmaceutical. Our laboratory tested Gibco-derived Sf9 cells for Sf-RV contamination, and the results showed that they were also contaminated with this virus.

[0004] Currently, Chinese invention patent application CN110423726A provides a strain of Sf9-ZY cells free from rhabdovirus contamination; Chinese invention patent application CN114807009A relates to a serum-independent Sf9-RF cell strain free from rhabdovirus contamination; existing Sf9 cells free from rhabdovirus contamination show no significant difference from commercially available Sf9 cells in terms of growth characteristics, proliferation level, baculovirus amplification capacity, and viral packaging stability. Summary of the Invention

[0005] Based on this, this application provides an Sf9-PT cell line that is free from rhabdovirus contamination, has a high-density culture capacity, higher baculovirus amplification capacity, and durable packaging stability.

[0006] According to one aspect of this application, a strain of Sf9-PT cell free of rhabdovirus is provided, which was deposited on March 15, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: C202334.

[0007] This application also provides an application of the Sf9-PT cells with the above-mentioned accession number CCTCC NO: C202334, the specific technical solution of which is as follows:

[0008] Application of Sf9-PT cells with accession number CCTCC NO: C202334 in constructing biological research models for toxicology, physiology, molecular genetics, or developmental biology.

[0009] Application of Sf9-PT cells with accession number CCTCC NO: C202334 in insect baculovirus expression system.

[0010] In some embodiments, the Sf9-PT cells are used to package adeno-associated virus.

[0011] In some embodiments, the Sf9-PT cells are used to express recombinant proteins.

[0012] Application of Sf9-PT cells with accession number CCTCC NO: C202334 in studying the structure and function of baculovirus genome.

[0013] Application of Sf9-PT cells with accession number CCTCC NO: C202334 in the study of eukaryotic gene expression regulation mechanisms.

[0014] Application of Sf9-PT cells with accession number CCTCC NO: C202334 in the preparation of bioproducts.

[0015] Application of Sf9-PT cells with accession number CCTCC NO: C202334 in the preparation of recombinant viral vaccines.

[0016] In some embodiments, the viral vaccine includes a recombinant novel coronavirus vaccine, an epidemic Japanese encephalitis vaccine, a human papillomavirus vaccine, and an avian influenza vaccine.

[0017] Based on the above technical solution, this application has at least the following beneficial effects:

[0018] (1) The Sf9-PT cell line screened in this application is not contaminated with rhabdovirus. This cell line can be used as a modified alternative host for the development and commercial production of biological products and vaccines, and can more safely avoid the potential dangers caused by Sf-RV virus contamination.

[0019] (2) It has the characteristic of high-density culture, which can increase the expression level of exogenous proteins and reduce costs;

[0020] (3) Recombinant baculoviruses exhibit higher proliferation levels in the Sf9-PT cell line;

[0021] (4) The ability of the Sf9-PT cell line to package AAV5 virus can be stable up to the 30th generation. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 The images shown are gel electrophoresis detection diagrams from Example 1. (a) shows the detection of G1 / G2 using primers, (b) shows the detection of Mono1 / Mono2 using primers, and (c) shows the detection of Mono1i / Mono2i using primers.

[0024] Figure 2 The cell growth curves in Example 2 are shown in Figure 2. (a) represents cell viability, (b) represents cell density, (c) represents cell diameter, and (d) represents cell doubling time.

[0025] Figure 3 This is a statistical graph showing the infection titers of recombinant baculovirus proliferation in Sf9 cells and Sf9-PT cells in Example 3;

[0026] Figure 4 This is a statistical graph showing the genomic titer of AAV5 packaged in Sf9 cells and Sf9-PT cells in Example 4;

[0027] Figure 5 This is a statistical graph showing the genomic titer of AAV5 packaged in Sf9-PT cells of different generations in Example 5.

[0028] This application provides a fall armyworm Sf9-PT cell line free of rhabdovirus, which was deposited on March 15, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: C202334. Detailed Implementation

[0029] To make the above-mentioned objectives, features, and advantages of this application more apparent and understandable, a detailed description of specific embodiments of this application is provided. Many specific details are set forth in the following description to provide a thorough understanding of this application. However, this application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of this application. Therefore, this application is not limited to the specific embodiments disclosed below.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Unless otherwise specifically stated, all raw materials, reagents, instruments, and equipment used in this application are commercially available or can be prepared by existing methods.

[0031] In this invention, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous, and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0032] Unless otherwise specified, the temperature parameters in this invention can be either constant temperature treatment or variations within a certain temperature range. It should be understood that the constant temperature treatment allows temperature fluctuations within the precision range controlled by the instrument. Fluctuations are permitted within ranges such as ±5℃, ±4℃, ±3℃, ±2℃, and ±1℃.

[0033] Some embodiments of this application provide a strain of Sf9-PT cell free of rhabdovirus, which was deposited on March 15, 2023, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: C202334.

[0034] This cell line was obtained through screening using the following method:

[0035] (1) Preparation of cell suspension: Use commercial Sf9 cells cultured for 3-4 days in the logarithmic growth phase, at which time the viable cell density is 5×10⁻⁶. 6 cells / ml - 10×10 6 cells / ml, cell viability ≥90%.

[0036] (2) Dilute the cell suspension: Use ExpiSf containing 20% ​​FBS (fetal bovine serum) TM CD Medium serially diluted the cell suspension to 100 cells / ml and seeded it into 96-well plates at 0.1 ml / well, sealing the wells with sealing film to prevent culture medium evaporation.

[0037] (3) Incubate the 96-well plate from step (2) in a constant temperature incubator at 27°C for 7 days and observe the cell colony formation.

[0038] (4) After culturing for 20 days, add 100µl of ExpiSf to the well containing cell colonies from step (3). TM Mix CDMedium (containing 20% ​​FBS) gently by pipetting, then place the 96-well plate in a 27°C incubator for further static incubation.

[0039] (5) After culturing for 7 days, transfer the cells from the 96-well plate to a 6-well plate for further culture (2 ml of ExpiSf containing 20% ​​FBS). TM (CD Medium) Gently shake the 6-well plate to disperse the cells evenly.

[0040] (6) Culture the cells from step (5) for 7 days, collect a certain amount of cell pellet for rhabdovirus gene detection. The cell line that is free of rhabdovirus contamination is Sf9-PT.

[0041] The above-mentioned method for passage culture of Sf9-PT cells includes the following steps:

[0042] (7) After culturing the cells from step (5) for 7 days, passage them into T25 square flasks and culture them on a shaker. After 4 days of culture, passage them into 125 ml shake flasks, and passage them every 3 or 4 days. The viable cell density at passage is 5.0 × 10⁻⁶. 6 cells / ml ~10.0×10 6 cells / ml, seeding density of 0.6 × 10⁶ cells / ml 6 cells / ml or 1.0×10 6 cells / ml.

[0043] (8) After 3 days of culture, sample and count the cells. If the cell viability is >90%, centrifuge at 300 g for 5 min at room temperature, and resuspend the cells in the prepared cell cryopreservation solution at 1.0 × 10⁻⁶. 7 Cells / ml, 1.5 ml / tube, stored in liquid nitrogen tank for long-term preservation.

[0044] This invention also provides applications of the above-mentioned Sf9-PT cell line, including: (1) applications in constructing biological research models for toxicology, physiology, molecular genetics, or developmental biology; (2) applications in insect baculovirus expression systems; specifically, the Sf9-PT cell line of this application can be used for packaging adeno-associated virus (AAV), expressing recombinant proteins, etc.; (3) applications in studying the structure and function of baculovirus genomes; (4) applications in studying the regulatory mechanisms of eukaryotic gene expression; and (5) applications in preparing biological products; specifically, the Sf9-PT cell line of this application can be used to prepare recombinant viral vaccines, including recombinant novel coronavirus vaccines, Japanese encephalitis vaccines, human papillomavirus vaccines, and avian influenza vaccines, etc.; it is understood that the Sf9-PT cell line of this application can also be used to prepare other unlisted recombinant vaccines.

[0045] The Sf9-PT cell line provided in this application is not contaminated with rhabdovirus and can serve as a modified alternative host for the development and commercial production of biological products and vaccines, thus more safely avoiding the potential dangers caused by Sf-RV virus contamination. It can achieve high-density culture, thereby increasing the expression level of exogenous proteins and reducing costs. The recombinant baculovirus has a higher proliferation level in the Sf9-PT cell line of this application. The ability of the Sf9-PT cell line of this application to package AAV5 virus can be stable up to the 30th generation.

[0046] The present application will be further described below with reference to specific embodiments and comparative examples, but these should not be construed as limiting the scope of protection of the present application. Experimental methods in the following embodiments that do not specify specific conditions should first refer to the guidelines given in this invention, or be performed according to experimental manuals or conventional conditions in the field, or according to the conditions recommended by the manufacturer, or refer to experimental methods known in the field.

[0047] Example 1: Screening of Sf9-PT, a high-density cultured cell line without rhabdomyovirus

[0048] (1) Prepare cell suspension and plate it.

[0049] 1.1 Commercially available Sf9 cells (Gibco-derived) cultured for 3-4 days in the logarithmic growth phase were used, at which point the viable cell density was 5 × 10⁻⁶. 6 cells / ml ~10×10 6 cells / ml, cell viability ≥90%.

[0050] 1.2 Take the cell suspension from step 1.1 and use ExpiSf... TM The cell suspension was serially diluted to 100 cells / ml using CD Medium (containing 20% ​​FBS) and seeded into 96-well plates at 0.1 ml / well. The plates were sealed with sealing film to prevent the culture medium from evaporating.

[0051] 1.3 Incubate the 96-well plate from step 1.2 in a constant temperature incubator at 27°C.

[0052] (2) Single-cell passage culture

[0053] 2.1 Observe the cell colony formation in the 96-well plate from step 1 every 7 days.

[0054] 2.2 After 20 days of culture, add 100 µl of ExpiSf containing 20% ​​FBS (fetal bovine serum) to the wells containing cell colonies from step 2.1. TM For CD medium, gently pipette to mix, then place the 96-well plate in a 27°C incubator for continued static incubation.

[0055] 2.3 After culturing for 7 days in step 2.2, transfer the cells to a 6-well plate for further culture (2 ml of ExpiSf containing 20% ​​FBS). TM (CD Medium) Gently shake the 6-well plate to disperse the cells evenly, and then place the 6-well plate in a 27°C incubator for continued static culture.

[0056] 2.4 Culture the cells from step 2.3 for 7 days, collect a certain amount of cell suspension for rhabdovirus gene detection, record the rhabdovirus positive wells and negative wells, and passage the cell lines in the rhabdovirus negative wells.

[0057] 2.5 After discarding the culture medium from the rhabdovirus-negative cells in step 2.4, add serum-free ExpiSf. TM The cells were gently resuspended in CDMedium, passaged into T25 flasks, and cultured in 27°C, 95 rpm shaker with added culture medium to a final volume of 10 ml.

[0058] 2.6 After culturing rhabdovirus-negative cells in T25 square flasks for 4 days, they were passaged into 125 ml shake flasks and passaged every 3 or 4 days, with a viable cell density of 5.0 × 10⁻⁶ cells per passage. 6 cells / ml ~10.0×10 6 cells / ml, seeding density of 0.6 × 10⁶ cells / ml 6 cells / ml or 1.0×10 6cells / ml. After 5 stable passages, a certain amount of cells were collected for rhabdovirus gene detection. The rhabdovirus-free high-density cultured cell line was named Sf9-PT. This cell line was deposited at the China Center for Type Culture Collection (CCTCC) on March 15, 2023, at Wuhan University, Wuhan, China, with accession number CCTCC NO: C202334.

[0059] 2.7 Establishment of a rhabdovirus-free cell bank. Cells cultured for 3 days were sampled and counted; cell viability was >90%. Cells were centrifuged at 300 g for 5 min at room temperature, and resuspended in pre-prepared cell cryopreservation medium at 1.0 × 10⁶ cells / mL. 7 Cells / ml, 1.5ml / tube, stored in liquid nitrogen tank for long-term preservation.

[0060] (3) Detection of rhabdovirus in Sf9-PT cell line

[0061] Commercial Sf9 cells and the Sf9-PT cell line obtained through the above screening were subjected to rhabdovirus detection. Cells from passages 5, 10, 15, 20, 25, 30, and 35, along with cell-free culture supernatant, were collected. Total RNA and viral genomic RNA were extracted using an RNA extraction kit. cDNA was synthesized using the RNA as a template. Then, using the cDNA as a template, PCR premix and specific primers (Mono1 / 2; G1 / G2) for detecting the L and G proteins of rhabdovirus were added. PCR amplification and agarose gel electrophoresis were performed to identify the presence of rhabdovirus contamination. The primer sequences used for PCR amplification are shown in Table 1.

[0062] Table 1 Primer sequence information

[0063]

[0064] The specific detection steps for rhabdoviruses are as follows:

[0065] 3.1 Extraction of rhabdovirus RNA: Collect Sf9-PT cells and cell-free culture supernatant from passages 5, 10, 15, 20, 25, 30, and 35 respectively, and extract total RNA and viral genomic RNA according to the kit instructions.

[0066] 3.2 Reverse transcription of cDNA: cDNA was synthesized according to the product instructions of the TIANScript II RT Kit.

[0067] 3.3 PCR Amplification: 1 µl of cDNA was mixed with 10 µl of Q5 Hot Start High-Fidelity DNA-PolMaster Mix. 1 µl each of the forward and reverse primers (Mono1 and Mono2, respectively) were added, and Nuclease-free water was added to a final volume of 20 µl. The mixture was thoroughly mixed. The PCR reaction system was then placed in a PCR instrument for amplification. The PCR reaction program was as follows: 98℃ pre-denaturation for 30 s; 30 cycles: 98℃ denaturation for 10 s, 62℃ annealing for 20 s, 72℃ extension for 30 s; 72℃ extension for 5 min. The primary PCR products were detected by agarose gel electrophoresis.

[0068] 3.4 Nested PCR: Using nested primers Mono 1i and Mono 2i as primers and the primary PCR product synthesized in step 3.3 as a template, nested PCR was performed under the same conditions. The PCR products were detected by agarose gel electrophoresis.

[0069] 3.5 Judgment Criteria: Primer pairs Mono1 / 2 and Mono1i / 2i were used to detect the L protein of Rhabdovirus, with target band sizes of 792 bp and 500 bp, respectively. Primer pair G1 / 2 was used to detect the G protein of Rhabdovirus, with a target band size of 722 bp. The band size was determined on the agarose gel based on the band size indicated by the 2000 bp DNA ladder. If the PCR product size distribution conformed to the above results, the Sf9 cells were considered to be contaminated with Rhabdovirus.

[0070] Gel electrophoresis results as follows Figure 1 As shown, Sf9 cells and cell-free culture supernatant were subjected to gel electrophoresis using primer pair G1 / G2 (results are shown in Figure 1). Figure 1 The target band was detected in all samples (as shown in a). However, the target band was not detected in Sf9-PT cells from passages 5, 10, 15, 20, 25, 30, and 35, or in cell-free culture supernatant, when using primer pair G1 / G2. The target band was not detected in Sf9 cells or cell-free culture supernatant when using primer pair Mono1 / Mono2 (gel electrophoresis results are shown in a). Figure 1 The target band was detected in all passages (as shown in b). However, the target band was not detected in Sf9-PT cells from passages 5, 10, 15, 20, 25, 30, and 35, or in cell-free culture supernatant. The Sf9 cells and cell-free culture supernatant were analyzed using primer pair Mono1i / Mono2i (gel electrophoresis results are shown in b). Figure 1The target band was detected in all cells (as shown in c). However, the target band was not detected in Sf9-PT cells from passages 5, 10, 15, 20, 25, 30, and 35, or in cell-free culture supernatant. The target band was not detected in the selected Sf9-PT cells or cell-free culture supernatant using all three primer pairs, indicating that the Sf9-PT cell lines obtained in this application were not contaminated with rhabdovirus.

[0071] Example 2: Proliferation characteristics of Sf9-PT cells

[0072] Sf9-PT cells and commercial Sf9 cells were cultured separately, and 30 ml of each was taken at a cell density of 0.6 × 10⁻⁶. 6 Cell suspensions of 100 cells / ml were seeded into 125 ml shake flasks and incubated on a 95 rpm constant temperature shaker at 27°C. Samples were taken every 24 h until cell death. The number of viable cells, cell viability, and cell diameter were determined using a cell counter.

[0073] The results are as follows Figure 2 As shown, the growth cycles of the Sf9-PT cell line and Sf9 cells were basically the same, with cell doubling times ranging from 26 h to 37 h and cell diameters ranging from 15 μm to 17 μm. However, the highest cell density of Sf9-PT was superior to that of Sf9: the Sf9 cell density reached its peak (approximately 20 × 10⁻⁶) on day 7 of culture. 6 The cell density (cells / ml) then entered a decline phase; while the cell density of Sf9-PT continued to increase, reaching a maximum cell density of 20 × 10⁻⁶. 6 cells / ml ~25×10 6 The cell / ml ratio was also analyzed. Furthermore, Sf9 cell viability decreased significantly after day 7 of culture, while the decline in Sf9-PT cell viability was relatively slow. These results indicate that Sf9-PT cells can be cultured at high density, and their cell viability is significantly superior to that of commercial Sf9 cells after 7 days of culture.

[0074] Example 3: Proliferation level of baculovirus in Sf9-PT cell line

[0075] (1) Construction of recombinant donor plasmid: The synthetic sequence GFP was cloned into the donor plasmid pFastBac Dual and named pFastBac-GFP; the synthetic sequences Rep and Cap were cloned into the donor plasmid pFastBac Dual and named pFastBac-RepCap.

[0076] (2) Take 1 ng of pFastBac-GFP and pFastBac-RepCap plasmids obtained in step (1) and add them to DH10Bac competent cells, then mix gently. Incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for 2 min, then add 800 μl of LB liquid medium (antibiotic-free), and shake at 37℃ and 220 rpm for 4 h. Spread 100 μl of bacterial culture onto an LB solid plate containing kanamycin / gentamicin / tetracycline / IPTG. Incubate at 37℃ upright for 30 min until the bacterial culture is absorbed by the medium, then invert and incubate for 24 h to 48 h. When obvious blue-white spots are observed, select white spots for PCR identification. The identification primers are M13-F (nucleotide sequence as shown in SEQ ID NO.7: CCCAGTCACGACGTTGTAAAACG) and M13-R (nucleotide sequence as shown in SEQ ID NO.8: AGCGGATAACAATTTCACACAGG). PCR amplification conditions were as follows: 98℃ pre-denaturation for 30 s; 30 cycles: 98℃ denaturation for 10 s, 62℃ annealing for 30 s, 72℃ extension for 3 min, and 72℃ extension for 5 min. The positive recombinant baculovirus shuttle plasmids (Bacmid) were named Bacmid-Rep2Cap5 and Bacmid-ITR-GOI-ITR, respectively, and transfected into Sf9-PT cells to obtain recombinant baculoviruses free of rhabdovirus contamination, named Bac-Rep2Cap5 and Bac-ITR-GOI-ITR, respectively.

[0077] (3) The recombinant baculoviruses (Bac-Rep2Cap5 and Bac-ITR-GOI-ITR) obtained in step (2) were inoculated into Sf9-PT cells and Sf9 cells at a cell density of 5×10⁻⁵ at an MOI of 0.05. 6 Cells / ml were inoculated and cultured in a shaker at 27°C and 95 rpm for 96 h. The supernatant was collected, and the infection titer of the recombinant baculovirus was detected by flow cytometry. The steps are as follows:

[0078] (a) Adjust the cell density to 1.25 × 10⁻⁶ 6 cells / ml, take 800 μl (i.e., 1×10⁻⁶ cells / ml). 6 (100 cells) were seeded in 24-well cell culture plates;

[0079] (b) 100 μl of four different viral dilutions (1E-02, 5E-03, 2.5E-03, and 1.25E-03) were added to each well of a 24-well cell culture plate, along with a blank control group (virus-free ExpiSf). TM CD medium);

[0080] (c) Place the 24-well plate in an incubator at 27°C and incubate overnight at a speed of 95 rpm.

[0081] (d) Preparation of Wash buffer: Prepare PBS buffer containing 2% FBS.

[0082] (e) After the cells were infected with recombinant baculovirus for 16±2 h, the 24-well cell culture plate was removed, the cell culture medium was transferred to EP tubes, centrifuged at 300 g for 5 min, and the supernatant was discarded.

[0083] (f) Washing cells: Add 1 ml of Wash buffer to each tube, mix the cells, centrifuge at 300 g for 5 min at room temperature, and discard the supernatant;

[0084] (g) Antibody incubation: Resuspend cells in 100 μl of diluted APC-gp64 antibody, incubate at room temperature in the dark for 30 min, centrifuge at 300 g for 5 min at room temperature, and discard the supernatant;

[0085] (h) Washing cells: Add 1 ml of Wash buffer to each tube, mix the cells, centrifuge at 300 g for 5 min at room temperature, discard the supernatant, and resuspend the cells in 200 μl of Wash buffer;

[0086] (i) Use a flow cytometer to create an experiment, enter the sample name, set the flow rate, collect the target number of cells, set the stop conditions, set the relevant gating strategy, create graphs and gating, draw the relevant peak plots or scatter plots, and collect data.

[0087] Viral particle titer calculation: Select groups with a positivity rate between 1% and 30% for titer calculation.

[0088] Titer calculation formula: Titer (ivp / ml) = Number of cells before recombinant baculovirus infection × Cell positivity rate × Dilution factor / Volume of recombinant baculovirus dilution solution per well.

[0089] Viral particle titer statistics as follows Figure 3 As shown, the infection titer of recombinant baculovirus proliferating in Sf9 cells was only 5 × 10⁻⁶. 8 The inoculovirus concentration was around 10 p / ml; while the infection titer of recombinant baculovirus proliferating in Sf9-PT cells could reach 9 × 10⁻⁶. 8 IVP / ml ~ 10×10 8 ivp / ml. These results indicate that, compared to Sf9 cells, the recombinant baculovirus exhibited significantly increased proliferation levels and stronger infectivity in Sf9-PT cells.

[0090] Example 4: Sf9-PT cell line packaging AAV5 levels

[0091] Recombinant baculoviruses Bac-Rep2Cap5 and Bac-ITR-GOI-ITR from generation P0 were inoculated into Sf9-PT and Sf9 cell suspensions at an MOI ratio of 2:2, with a cell density of 5 × 10⁶ cells / year. 6 Cells / ml, cultured in 25 ml flasks, and cultured at 27°C and 95 rpm for 72 h in a 125 ml shaker. The cell suspension was collected, and the AAV5 genomic titer was detected by qPCR. Primer sequences used for qPCR are shown in Table 2.

[0092] Table 2 qPCR primer sequence information

[0093]

[0094] The results are as follows Figure 4 As shown, the genomic titers of AAV5 packaged by Sf9-PT and Sf9 cells under the same conditions were both around 5 × 10⁻⁶. 10 vg / ml ~6×10 10 vg / ml. The above results indicate no significant difference between the Sf9-PT cell line and commercial Sf9 cells in their ability to package AAV5 virus.

[0095] Example 5: Stability test of AAV5 packaging in different passages of Sf9-PT cell lines

[0096] Recombinant baculoviruses Bac-Rep2Cap5 and Bac-ITR-GOI-ITR from generation P0 were inoculated into Sf9-PT cell suspensions at passages 5, 10, 15, and 30 at an MOI ratio of 2:2, with a cell density of 5 × 10⁶ cells / year. 6 Cells / ml were cultured in 25 ml flasks, and each 125 ml flask was incubated at 27°C and 95 rpm for 72 h. The cell suspension was collected, and the AAV5 genomic titer was detected by qPCR.

[0097] The results are as follows Figure 5 As shown, the genomic titers of AAV samples obtained from different passages of Sf9-PT cells infected with P0-Bac were all around 4.5 × 10⁻⁶. 10 vg / ml ~7×10 10 The results indicate that the Sf9-PT cell line's ability to package AAV5 virus remains stable up to passage 30.

[0098] In summary, compared to commercial Sf9 cells, the Sf9-PT cell line exhibits superior proliferation characteristics, and its ability to package AAV5 virus is not significantly different from that of commercial cells. Furthermore, it possesses high-density culture characteristics and avoids the risk of using commercial Sf9 cells or other Sf cell lines carrying exogenous rhabdoviruses, thus eliminating potential safety hazards associated with bioproducts. Therefore, the Sf9-PT cell line screened in this application has the potential to serve as an alternative host for Sf9 or other Sf cell lines for the production of bioproducts using insect cell-baculovirus expression vector systems, ensuring the safety of the bioproducts.

[0099] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0100] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.

Claims

1. A strain of Sf9-PT cell line free of rhabdovirus, which was deposited on March 15, 2023 at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with accession number CCTCCNO:C202334.

2. The application of the Sf9-PT cells without rhabdovirus as described in claim 1 in constructing biological research models for toxicology, physiology, molecular genetics, or developmental biology.

3. The application of the Sf9-PT cells without rhabdovirus as described in claim 1 in the insect baculovirus expression system.

4. The application according to claim 3, characterized in that, The Sf9-PT cells are used to package adeno-associated virus.

5. The application according to claim 3, characterized in that, The Sf9-PT cells were used to express recombinant proteins.

6. The application of the Sf9-PT cells without baculovirus as described in claim 1 in the study of the structure and function of baculovirus genomes.

7. The application of the Sf9-PT cells without rhabdovirus as described in claim 1 in the study of eukaryotic gene expression regulation mechanisms.

8. The use of the Sf9-PT cells without bullet-shaped viruses as described in claim 1 in the preparation of biological products.

9. The use of the Sf9-PT cells without bullet-shaped viruses as described in claim 1 in the preparation of recombinant viral vaccines.

10. The application according to claim 9, characterized in that, The viral vaccines include recombinant novel coronavirus vaccine, Japanese encephalitis vaccine, human papillomavirus vaccine, and avian influenza vaccine.

Citation Information

Patent Citations

  • Sf9 cell line free from Sf-RV pollution as well as screening method and application of Sf9 cell line

    CN110423726A

  • Serum-independent rhabdovirus-pollution-free sf9 cell strain, screening method and application

    CN114807009A

  • Virus-free cell lines and methods for obtaining same

    CN108603176A

  • Method for obtaining virus-free cell line and virus-free cell line obtained by method

    CN115466710A